Comparative Population Structure of Two Edible Indo-Pacific Coral Reef Sea Cucumbers (Echinodermata: Holothuroidea)

Home , Holothuria nobilis, Holothuria whitmaei, Lutjanus fulvus

Bull Mar Sci. 90(1):359–378. 2014 research paper http://dx.doi.org/10.5343/bms.2013.1001

Comparative population structure of two edible Indo-Pacific coral reef sea cucumbers (Echinodermata: Holothuroidea)

1 Hawai‘i Institute of Marine Derek J Skillings 1, 2 * Biology, School of Ocean and 1, 3 Earth Science and Technology, Christopher E Bird University of Hawai‘i at Mānoa, Robert J Toonen 1 P.O. Box 1346, Kaneohe, Hawaii 96744.

2 Department of Biology, Abstract.—Echinoderms are the targets of considerable University of Hawai‘i at Mānoa, global artisanal and commercial fisheries, but efforts to 2450 Campus Road, Honolulu, Hawaii 96822. effectively manage them suffer from poor understanding of population demographics and connectivity. Here we report 3 Marine Biology Program, population genetic data (mitochondrial COI sequence) for Department of Life Sciences, two congeneric sea cucumbers, Holothuria atra (Jaeger, Texas A & M University–Corpus Christi, 6300 Ocean Drive, 1833) and Holothuria whitmaei (Bell, 1887), throughout Corpus Christi, Texas 78412. the Hawaiian Archipelago and Johnston Atoll to inform resource management. These two species share a wide range * Corresponding Author: Current Address: Philosophy Program, across the Indo-Pacific region, and are the most ubiquitous The Graduate Center, CUNY, species on Hawaiian coral reefs. Both species have roughly 365 Fifth Ave., Rm. 7113, New similar haplotype diversity (h = 0.88 for H. atra, 0.83 for York, New York 10016. Email: H. whitmaei), but the nucleotide diversity (π = 0.0087 and

. 0.0067, respectively) and effective number of alleles (AE = 8.3 and 5.9, respectively) were both lower for H. whitmaei. Regardless of the metric of population differentiation used, H. atra shows evidence for restricted gene flow relative to the

congeneric H. whitmaei; global ΦST was 0.165 with 12.65% of variation in analysis of molecular variance is distributed

among groups for H. atra, whereas global ΦST was −0.006 and 100% of the variation is within the three groups (Main Hawaiian Islands, Northwestern Hawaiian Islands, Johnston Atoll) for H. whitmaei. These data contribute to the growing body of literature cautioning against the extrapolation of single-species exemplar studies to management and highlight that even for such broadly-distributed species, local-scale

Date Submitted: 3 January, 2013. management is justified because migration between the Date Accepted: 30 May, 2013. Main and Northwestern Hawaiian islands does not occur Available Online: 14 January, 2014. within ecologically relevant time frames.

The Hawaiian Archipelago stretches >2500 km, and consists of two regions: the Main Hawaiian Islands (MHI), which are populated high volcanic islands; and the Northwestern Hawaiian Islands (NWHI), which are an uninhabited string of tiny islands, atolls, shoals, and banks. Owing to their isolation, the NWHI coral reefs are among the healthiest and most extensive remaining in the world (Pandolfi et al. 2003, Halpern et al. 2008). The reefs of the NWHI represent one of the few remaining undamaged coral reef ecosystems with abundant and large apex predators and an extremely high proportion of endemic species across many taxa (Friedlander and DeMartini 2002, DeMartini and Friedlander 2004), and little human impact Bulletin of Marine Science 359 © 2014 Rosenstiel School of Marine & Atmospheric Science of OA the University of Miami Open access content 360 Bulletin of Marine Science. Vol 90, No 1. 2014 compared to the heavily populated MHI (Halpern et al. 2008, Selkoe et al. 2008, Selkoe et al. 2009). In contrast, coral reefs in the MHI are under considerable anthropogenic pressure from 1.29 million residents (with >900,000 of those living on the island of Oahu) and more than seven million tourists visiting the state each year. The Hawaiian Archipelago also lies at the periphery of the tropical Central Pacific and is one of the most isolated island chains in the world, making it biogeographi- cally partitioned from the rest of the Pacific islands (reviewed by Ziegler 2002, Briggs and Bowen 2012). This isolation results in one of the highest proportions of endemism in the world (e.g., Briggs 1974, Kay 1980, Grigg 1983, reviewed by Ziegler 2002, Eldredge and Evenhuis 2003). Though there are many examples of pan-Pacific coral reef organisms in Hawaii, the isolation of the Hawaiian Archipelago is thought to limit larval exchange sufficiently that colonization is rare (Hourigan and Reese 1987, Kay and Palumbi 1987, Jokiel and Martinelli 1992). For example, Kay (1984) estimated that western Pacific marine species successfully colonize the Hawaiian Archipelago about once every 13,000 yrs. Unlike the terrestrial fauna, however, the Hawaiian marine fauna contains a large proportion of endemics that are differentiated, but not diversified, from their Indo–West Pacific roots (Hourigan and Reese 1987, Jokiel 1987, Kay and Palumbi 1987, Ziegler 2002). Johnston Atoll, the nearest emergent piece of land, is believed to be a stepping-stone into Hawaii. Simulations of larval dispersal indicate that larvae from Johnston atoll can reach French Frigate Shoals or Kauai within about a month along two separate larval corridors (Kobayashi 2006, Kobayashi and Polovina 2006). Proxies for dispersal, such as pelagic larval duration (PLD) and geographic range, have generally been used as rules of thumb in the absence of a detailed understanding of connectivity for most marine species. Additionally, intuitive expectations of larval dispersal potential as a function of PLD are often not upheld in comparative analyses of the existing literature (e.g., Weersing and Toonen 2009, Riginos et al. 2011, Selkoe and Toonen 2011, Mercer et al. 2013). Realized dispersal distance is typically less than potential dispersal distance because of factors such as larval swimming, larval settling preferences, larval mortality, or the presence of biophysical or biogeographical barriers (Shanks et al. 2003, Severance and Karl 2006, Dawson and Hamner 2008). Barriers that limit dispersal between marine populations include obvious geographical features such as land masses, i.e., the Isthmus of Panama (Bermingham and Lessios 1993), but also more subtle factors such as currents and oceanographic regimes, i.e., the Mona Passage between Hispaniola and Puerto Rico (Dawson 2001, Barber et al. 2002, Sotka et al. 2004, Baums et al. 2006, White et al. 2010). Echinoderms play a major role in structuring several marine ecosystems, and many are described as “keystone species” because of their profound influence on benthic communities (e.g., Paine 1969, Power et al. 1996, Lessios et al. 2001, reviewed by Uthicke et al. 2009). In addition to their important ecosystem functions, numerous echinoderm species are also the target of artisanal or commercial fishing, particu- larly the sea urchins and sea cucumbers (Sloan 1984, Conand 1990, Sala et al. 1998, Purcell 2010). Stocks of the most valuable species are severely depleted throughout the Pacific with fishers continually moving to more remote locations and harvesting less valuable species (Conand 1990, Uthicke 2004, Purcell et al. 2011). The lollyfish, Holothuria atra (Jaeger, 1833), and the black teatfish,Holothuria whitmaei (Bell, 1887), are two common shallow-water tropical sea cucumbers in the Indo-Pacific waters that extend into the Hawaiian Archipelago, where they are locally Skillings et al.: Comparative population structure in two sea cucumbers 361 known as loli (Clark and Rowe 1971, Conand 1994, Uthicke et al. 2001, Uthicke and Benzie 2003). Both species perform vital ecosystem services on coral reefs such as sediment bioturbation. (Bonham and Held 1963, Uthicke 1999, Purcell 2010). There is an active fishery for both species in many regions of the Pacific; H. atra is a low value species, whereas H. whitmaei is a high value species and heavily overfished in much of its range (Uthicke and Benzie 2000a, Uthicke et al. 2004). There is no regu- lated sea cucumber fishery in Hawaii, but anecdotal evidence suggests that H. whitmaei is harvested. The authors have found H. whitmaei and H. atra to be common, and occasionally in high densities, in the protected Northwest Hawaiian Islands, which is unpopulated by humans. Holothuria atra is common in the populated Main Hawaiian Islands, whereas H. whitmaei is fairly uncommon and usually only found in isolated or difficult to access locations (DJS, CEB, RJT pers obs). Prepared and dried sea cucumber flesh—visually unidentifiable to the species level—can also -oc casionally be found for sale in Honolulu markets (DJS, CEB, RJT pers obs). Echinoderms are described as a boom-bust phylum in which populations go through marked natural population cycles (Uthicke et al. 2009). Generally, holothurians are further characterized by limited adult mobility, late maturity, density- dependent reproduction and low rates of recruitment (Uthicke and Benzie 2000b, Uthicke and Purcell 2004, Uthicke et al. 2004). Furthermore, the boom-bust nature of many echinoderm populations has important implications for connectivity in evolutionary time-frames where biological attributes can drive population structure to a greater extent than oceanographic processes as hypothesized in the Tripneustes sea urchins (Lessios et al. 2003). Together, these characteristics make H. atra and H. whitmaei ideal organisms to examine levels of connectivity and historical population dynamics to inform management and to test hypotheses about population connectivity within Hawaii and between Hawaii and its closest neighbor Johnston Atoll. Here, we compare the mitochondrial genetic population structure of the congeners H. atra and H. whitmaei within Hawaii.

Methods

Sampling, PCR, and Sequencing.—Holothuria atra and H. whitmaei were sampled from 11 sites on 10 islands within the Hawaiian Archipelago and one site from Johnston Atoll, though both species were not found at every locality (Table 1, Fig. 1). Sampling in the Northwest Hawaiian Islands took place within the Papahānaumokuākea Marine National Monument on research cruises aboard the NOAA RV Hi‘ialakai. All other samples were collected on shore dives or while snorkeling. Sampling took place between spring 2006 and fall 2009. Samples were obtained non-lethally through muscle-tissue biopsy and preserved in either 95% eth- anol or DMSO salt buffer, and archived at the Hawai‘i Institute of Marine Biology at room temperature. Skillings and Toonen (2010) provide a detailed discussion of sampling and preservation protocol. No asexual morphs of H. atra—distinguished by transverse scarring, smaller body size, and their location in lagoonal habitats— were found during sampling expeditions and no reports are known indicating the presence of the asexual stage of H. atra at the sampled locations. The asexual morph of H. atra appears to occur only in the southern Pacific, west Pacific, and the Indian oceans (e.g., Ebert 1983, Conand 1994, Uthicke et al. 2001, Lee et al. 2008). Asexual reproducing forms of H. whitmaei are not reported in the literature. 362 Bulletin of Marine Science. Vol 90, No 1. 2014

Table 1. Summary of Holothuria atra and Holothuria whitmaei halotypes. n = sample size, H = total number of haplotypes, Hu = number of unique haplotypes at site, π = nucleotide diversity, h = haplotype diversity, AE = effective number of alleles in COI. Bolded test values are significant atP < 0.05.

Region/site n H Hu π (SD) h (SD) AE Tajima’s D Fu’s Fs Holothuria atra Main Hawaiian Islands Hilo 9 4 0 0.0041 (0.0030) 0.81 (0.08) 5.3 −0.27 0.08 Kona 21 10 2 0.0078 (0.0046) 0.87 (0.06) 7.5 −0.57 −2.21 Oahu 24 7 2 0.0052 (0.0033) 0.79 (0.05) 4.7 −0.88 −0.58 Kauai 30 8 3 0.0033 (0.0023) 0.75 (0.06) 4.0 −1.21 −2.61 Niihau 5 4 1 0.0071 (0.0052) 0.90 (0.16) 10.0 −0.75 −0.33 Northwest Hawaiian Islands French Frigate 28 10 2 0.0082 (0.0048) 0.88 (0.04) 8.3 −0.14 −1.12 Gardner 2 1 0 N/A N/A N/A N/A N/A Laysan 12 8 0 0.0064 (0.0041) 0.89 (0.08) 9.1 −1.06 −2.91 Pearl and Hermes 37 10 2 0.0086 (0.0049) 0.79 (0.05) 4.8 −1.26 −0.23 Midway 35 14 7 0.0084 (0.0048) 0.84 (0.05) 6.2 −0.64 −3.61 Kure 23 8 2 0.0096 (0.0055) 0.85 (0.04) 6.9 −0.92 0.47 Johnston 26 7 1 0.0131 (0.0073) 0.81 (0.05) 5.3 −0.28 2.96 Overall 252 32 22 0.0087 (0.0004) 0.88 (0.01) 8.3 −1.34 −2.49 Holothuria whitmaei Main Hawaiian Islands Kona 27 7 0 0.0055 (0.0034) 0.80 (0.04) 5.0 −0.19 −0.01 Kauai 33 7 1 0.0056 (0.0035) 0.77 (0.05) 4.3 0.11 0.15 Northwest Hawaiian Islands Nihoa 10 2 0 0.0036 (0.0030) 0.53 (0.09) 2.1 1.83 3.34 French Frigate 25 10 2 0.0067 (0.0040) 0.82 (0.06) 5.6 −0.82 −2.20 Gardner 1 1 0 N/A N/A N/A N/A N/A Lisianski 2 1 0 N/A N/A N/A N/A N/A Laysan 21 6 1 0.0044 (0.0029) 0.66 (0.10) 2.9 −0.50 −0.01 Pearl and Hermes 57 13 2 0.0057 (0.0034) 0.86 (0.02) 7.1 −2.68 1.30 Midway 27 13 6 0.0251 (0.0131) 0.90 (0.04) 10.0 −1.19 −4.59 Kure 39 10 2 0.0048 (0.0030) 0.85 (0.03) 6.7 −0.10 −1.91 Johnston 31 9 1 0.0078 (0.0045) 0.85 (0.04) 6.7 0.27 −0.18 Overall 273 27 15 0.0067 (0.0013) 0.83 (0.01) 5.9 −2.63 −9.37

Total genomic DNA was extracted using DNeasy™ Blood and Tissue Kits (QIAGEN) following the manufacturer instructions. Polymerase chain reaction (PCR) was used to amplify a fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) using custom primers created with Primer3 (Rozen and Skaletsky 2000) tar- geting Holothuria spp.: GenHol2L (5΄–AACCAAATGGTTCTTGCTTACC–3΄) and GenHol2R (5΄–TTCTGATTAATCCCACCATCC–3΄) (Skillings et al. 2011). The re- solved fragment was 423 base pairs long in H. atra and 446 base pairs in H. whitmaei. PCR was performed using 15 µl reactions containing 1 µl of diluted DNA extract (one part genomic extraction to 199 parts nanopure water), 1 µl each of 0.2 µM forward and reverse primers, 0.6 µl of 0.5 µM BSA, 7.5 µl of Bioline (Bioline) Biomix Red diluted as per manufacturer instructions, and 3.9 µL of nanopure water. PCR was done on Bio-Rad Icycler™ thermocyclers (Bio-Rad Laboratories) with an initial denaturation at 95 °C for 7 min followed by 35 cycles of a denaturing step at 95 °C for Skillings et al.: Comparative population structure in two sea cucumbers 363

Figure 1. Maps of the Hawaiian Archipelago and Johnston Atoll. Holothuria atra is represented on the left and Holothuria whitmaei is represented on right. Samples sizes for each species at each island are in parenthesis. The shaded areas outline geographical regions with genetically distinct populations, as inferred by genetic differentiation, that were used for Migrate analyses. The arrows represent the direction and relative magnitude of migration, and the numbers are the associated estimates. Based on our analysis there is one population of H. whitmaei in this region.

1 min, annealing at 50 °C for 1 min, extension at 72 °C for 1 min. A final extension at 72 °C was held for 7 min before refrigeration. PCR product (8 µl) was treated with 0.7 µl of Exonuclease I combined with 0.7 µl of calf intestinal alkaline phosphatase (Exo- CIAP) and incubated at 37 °C for 30 min and with a final inactivation step at 85 °C for 10 min. The treated PCR product was sequenced using an ABI Prism automatic sequencer at the Hawai‘i Institute of Marine Biology’s EPSCoR sequencing facility. All samples were sequenced in the forward direction; uncertain sequences were also sequenced in the reverse direction for confirmation. Sequences were compiled and trimmed using Sequencher 4.8 and aligned using ClustalW implemented in Bioedit 7.0.5 (Thompson et al. 1994, Hall 1999). Data Analysis.—Statistical parsimony networks of mitochondrial haplotypes were constructed by creating median joining networks implemented in Network 4.610 (http://www.fluxus-engineering.com; Bandelt et al. 1995, 1999). Networks were drawn using Network Publisher 1.3.0.0 (http://www.fluxus-engineering.com). Nei’s average pairwise genetic difference π( ) (Nei and Li 1979), haplotype diversity

(h), Tajima’s D (Tajima 1989), and Fu’s FS (Fu 1997) were calculated in DnaSP 4.1 (Rozas 2003). The effective number of alleles [1/(1 − h)] was calculated by hand following Jost (2008).

To assess levels of genetic differentiation among sites we calculated pairwise FST and ΦST values using Arlequin 3.1 (Excoffier et al. 2005). Pairwise Dest_chao values (Jost

2008) were calculated using the program SPADE (Chao et al. 2008). ΦST is a fixation index incorporating genetic distance that ranges from 0 to 1, where a zero indicates identical haplotypic composition and a one signifies alternate fixation of alleles and a complete lack of gene flow. Dest_chao is an index of genetic dissimilarity, which does not account for genetic distance among haplotypes, but also ranges from 0 to 1 (note that both ΦST and Dest_chao can be slightly negative due to bias correction for sampling er- ror). In the case of Dest_chao, a zero also indicates identical haplotypic composition, but unlike ΦST, a one simply indicates that no haplotypes are shared between the populations. The primary difference in interpretation is that in the absence of gene flowST Φ values can be significantly <1, which is not the case for Dest_chao and argued to be an advantage of it (Jost 2008). To adjust the critical P-value for statistical significance 364 Bulletin of Marine Science. Vol 90, No 1. 2014 in pairwise comparisons, the family-wise false discovery rate (FDR) correction of (Benjamini et al. 2006) was implemented. Analysis of molecular variance (AMOVA) was used for hierarchical analysis of the partitioning of COI diversity among sites within archipelagic regions and among archipelagic regions using Arlequin 3.1. The pairwise ΦST and AMOVA analyses were conducted using a distance matrix with 50,000 permutations and the Tamura-Nei mutational model (Tamura and Nei 1993) with gamma = 0.0164. The mutational model HKY+G was selected using AIC in Modeltest 3.7; the model hierarchy was used to select the closest available model when the best-fit model could not be implemented by the chosen program, as in the case of Arlequin (Posada and Crandall 1998). Regardless, the inferences are robust to the mutational model and our conclusions were not altered regardless of which model is chosen (data not shown).

Bayesian coalescent-based calculations of migration rate among regions (Nem) and the region mutation parameter (θ) were conducted using Migrate 3.1.3 (Beerli 2006). Three replicate runs of a Bayesian MCMC search strategy were completed and averaged by Migrate. A nucleotide model with a transition-to-transversion ratio of 6.16:1 and three regions of substitution rates with a gamma-value of 0.016 was used; Markov chain length = 1,000,000 sampled every 20 generations with a 10% burn-in. Program defaults, including the selection of priors, were used for all other settings. The nucleotide model was the closest available model to the one chosen by Modeltest 3.7. Regions for Migrate 3.1.3 analyses were selected based upon evidence of restricted gene flow from population differentiation analyses. Convergence was judged using effective sample sizes and by comparing replicate runs.

Results

Holothuria atra.—In total, 252 individuals were sampled in our study. We observed 32 haplotypes, of which 22 were private with 20 of them occurring in single individuals (Fig. 2). Due to low sample size, Niihau (n = 5) and Gardner Pinnacles (n = 2) were excluded from all between-site population analyses. The number of individuals (n), number of haplotypes (H), number of unique haplotypes at site (Hu), nucleotide diversity averaged over sequence length (π), haplotype diversity (h), and effective number of alleles (AE) can be found in the upper half of Table 1. Overall nucleotide diversity was relatively low (π = 0.0087 ± 0.0004) compared to other species in marine population genetic surveys in Hawaii, while the corresponding haplotype diversity was relatively high (h = 0.88 ± 0.01) (Toonen et al. 2011). Across all sites, π ranged from 0.0033 at Kauai to 0.0131 at Johnston Atoll. Haplotype diversity ranged from 0.75 at Kauai to 0.89 at Laysan, excluding Niihau because of low sample size. There were no haplotypes shared across all sites.

Test results for neutrality, Tajima’s D, and Fu’s FS appear in Table 1. Because many population genetic estimates are relatively insensitive to weak selection (Slatkin and Barton 1989), loci which do not show significant deviations from neutral expectations should provide reliable inferences about population structure (Hutchison and Templeton 1999). None of the site-by-site Tajima’s D values were significant, and only

Laysan deviated from expectation using Fu’s FS; thus, there is no evidence to indicate that non-neutral processes are responsible for the pattern of COI haplotype diversity presented here. Skillings et al.: Comparative population structure in two sea cucumbers 365

Figure 2. Haplotype network for Holothuria atra. Each circle represents a unique haplotype connected by a line to those that differ by one base pair. Nodes on lines indicate a missing haplotype and numbers represent multiple missing haplotypes. Each haplotype is color-coded by site and circle size is proportional to frequency. The smallest circles represent one occurrence of a haplotype.

Two analyses of molecular variance were performed on the H. atra COI haplotype data (Table 2). Previous studies have shown significant population differentiation -be tween islands in the Northwest Hawaiian Islands and the Main Hawaiian Islands in multiple species (Toonen et al. 2011). To test subdivision using AMOVAs, we clus- tered sites into these two general regions, with Johnston Atoll as a separate region because it lies outside of the Hawaiian Archipelago and is differentiated in corals (Concepcion et al. 2014). The two AMOVAs differed in the measure used to deter- mine genetic diversity; FST, or strict haplotype counts, and ΦST, which incorporates genetic distance between haplotypes. Both measures displayed a similar partitioning of among-population-within-region variance, but the among-group partitioning of variance was more than twice as high when measured using ΦST. Overall, all tests were significant P( < 0.0001), indicating significant genetic partitioning among regions.

Overall FST was 0.090 (P < 0.0001). Overall ΦST was 0.165 (P < 0.0001). The Morisita dissimilarity (Chao 2008), or nearly unbiased estimation of haplotypic differentiation was 0.439 (SE 0.042). Pairwise site comparisons showed agreement between haplotypic-based FST and distance-based ΦST measures (Tables 3, 4). In the Main Hawaiian Islands (MHI), Oahu and Kauai were both significantly different from the Kona site on the Island of Hawaii. These two sites were also significantly different from all other sites except Laysan Island. There was little structure within the Northwestern Hawaiian Islands (NWHI); only Laysan Island was significantly partitioned from the other sampling sites in the NWHI. Though outside the Hawaiian Archipelago, Johnston Atoll showed significant differentiation only from Laysan, Kauai, and Oahu. 366 Bulletin of Marine Science. Vol 90, No 1. 2014

Table 2. Analyses of molecular variance (AMOVA) by region (Main Hawaiian Islands,

Northwest Hawaiian Islands, Johnston Atoll) using haplotype distance (ΦST) and non-distance (FST) measures. AG = Among groups, AP(G) = Among populations within groups, WP = Within populations.

Source of Percent of Species Measure variation variation Φ statistics P-values

Holothuria atra FST AG 5.80 FCT = 0.058 <0.01

AP(G) 3.22 FSC = 0.034 <0.01 WP 90.99

Holothuria atra ΦST AG 12.65 ΦCT = 0.127 <0.01

AP(G) 3.84 ΦSC = 0.044 <0.01 WP 83.51

Holothuria whitmaei FST AG −0.77 FCT = −0.008 0.50

AP(G) 2.48 FSC = 0.025 0.01 WP 98.30

Holothuria whitmaei ΦST AG −0.87 ΦCT = 0.373 0.87

AP(G) 0.67 ΦSC = 0.032 0.24 WP 100.20

The results from the Migrate software analsyes showed strong asymmetric patterns of gene flow between regions with both the MHI and Johnston Atoll contribut- ing disproportionately to the NWHI population (Table 5, Fig. 1). Posterior probability distributions for all values were unimodal curves. Effective migration rates (Nem) were above one for every estimate except from the MHI to Johnston Atoll. Gene flow was predominantly directed into the protected NWHI, with an order of magnitude less migration out of the NWHI into the MHI and to Johnston Atoll. The lowest effective migration rates were between Johnston Atoll and the MHI. The much higher effective migration rates into the NWHI were driven by both the larger effective population size of the NWHI and higher M values. Holothuria whitmaei.—In total, 273 individuals were sampled in our study. We observed 27 haplotypes, of which 15 were private and only sampled from single individuals (Fig. 3). Due to low sample size, Lisianski (n = 2) and Gardner Pinnacles (n = 1) were excluded from all between site population analyses. The number of individuals (N), number of haplotypes (H), number of unique haplotypes at site (Hu), nucleotide diversity averaged over sequence length (π), haplotype diversity (h), and effective number of alleles (AE) appear in the lower half of Table 1. Overall nucleotide diversity was relatively low (π = 0.0067 ± 0.0013) while the corresponding haplotype diversity was relatively high (h = 0.83 ± 0.01). Across all sites, π ranged from 0.0036 at Nihoa to 0.0251 at Midway. Haplotype diversity ranged from 0.52 at Nihoa to 0.90 at Midway. There was one haplotype present at all sites and two haplotypes only missing from Gardner, Lisianski and Nihoa; three sites with only 13 samples composed of 3 haplotypes between them.

Tests for neutrality, Tajima’s D and Fu’s FS, also appear in Table 1. Midway was the only site showing a significant Fu’s FS statistic, indicating an excess of low-frequency haplotypes, suggesting either selection or a recent demographic expansion (Gaither et al. 2010). Pearl and Hermes deviated from expectation in Tajima’s D test, indicating the genetic distance between haplotypes was greater than expected, also Skillings et al.: Comparative population structure in two sea cucumbers 367 - 0.167 0.000 0.000 0.038 0.194 0.000 0.000 0.708 Johnston Atoll

Kona 0.000 0.000 0.000 0.000 0.058 0.000 0.144 0.352 ------

Oahu 0.515 0.782 Main Hawaiian Islands

0.048 0.000 0.010 0.172 0.072 0.499 0.000 0.901 0.495 Kauai - - - -

values are in the upper right half of the table.the of half right upper the in are values whitmaei Holothuria 0.303 0.451 0.422 0.647 0.403 Nihoa -

0.024 0.629 0.000 0.035 0.512 0.230 0.000 0.000 French Frigate -

0.209 0.000 0.203 0.205 0.122 0.138 0.286 0.694 Laysan Island -

0.003 0.888 0.000 0.744 0.674 0.008 0.000 0.000 Northwest Hawaiian Islands Pearl and Hermes values are in the lower left half of the table and table the of half left lower the in are values atra Holothuria -

0.000 0.880 0.000 0.846 0.555 0.000 0.093 0.000 Midway Atoll -

0.666 0.160 0.035 0.410 0.483 0.111 0.000 − 0.030 Kure Atoll comparisons by species and site. and species by comparisons est_chao

Kure Atoll Kauai Midway Atoll Pearl and Hermes Oahu Laysan Island Kona Johnston Atoll French Frigate Nihoa

Site Islands

Hawaiian Islands Hawaiian Hawaiian

Northwest Northwest Main Cells with a “-” indicate no comparisons were done for that species between those sites. Bolded values are significant differences after correction using the procedure outlined in Benjamini et al. (200 6). Table 3. Pairwise 3. Table 368 Bulletin of Marine Science. Vol 90, No 1. 2014

0.231 0.046 0.018 0.309 0.156 0.015 0.017 0.027 0.023 −0.013 −0.005 −0.005 −0.022 −0.005 −0.003 −0.005 Johnston Atoll Johnston Atoll

0.005 0.022 0.009 0.127 0.016 0.026 0.203 0.049 0.027 Kona Kona −0.009 −0.022 −0.007 −0.018 −0.004 −0.010 −0.006 MHI

0.021 0.006 Oahu 0.193 0.097 0.263 0.258 0.050 0.018 0.220 0.163 Kauai MHI −0.009 −0.019 −0.002 −0.010 −0.004 −0.021

0.109 0.278 0.050 0.335 0.341 0.000 0.305 0.204 Kauai 0.186 0.128 0.022 0.212 0.160 Nihoa −0.010 −0.035 −0.029 values are contained in the lower left half of each table and values are contained in the lower left half of each table and

ST 0.000 0.091 0.126 0.145 0.008 0.058 0.140 F −0.016 −0.012 −0.014 −0.002 −0.016 −0.002 −0.013 −0.011 −0.004 French Frigate French Frigate

0.019 0.124 0.173 0.194 0.025 0.045 0.026 0.035 0.110 0.020 0.013 0.030 0.057 0.073 0.295 −0.025 Laysan Island Laysan Island NHI NHI

0.003 0.211 0.166 0.000 0.002 0.119 0.013 0.006 0.054 0.006 0.123 −0.013 −0.012 −0.006 −0.010 −0.011 Pearl and Hermes Pearl and Hermes

0.004 0.186 0.161 0.009 0.082 0.019 0.052 0.126 −0.014 −0.004 −0.006 −0.004 −0.015 −0.008 −0.003 −0.012 Midway Atoll Midway Atoll

0.018 0.028 0.008 0.144 0.082 0.011 0.066 0.000 0.029 0.059 0.004 0.094 −0.005 −0.004 −0.006 −0.004 (Morisita dissimilarity 0.190 ± 0.059) Kure Atoll Kure Atoll

Kona Kure Atoll Midway Atoll Hermes and Pearl Kauai Oahu Kure Atoll Kauai Laysan Island French Frigate Johnston Atoll Kona Midway Atoll

Pearl and Hermes and Pearl Johnston Atoll Laysan Island French Frigate Nihoa

values are in the upper right half of each table. Bolded values are significant differences after correction using the procedure outlined in Benjamini et al. al. et Benjamini in outlined procedure the using correction after differences significant are values Bolded table. each of half right upper the in are values

MHI NHI MHI ST NHI (2006). Shaded cells signify significant differences between sites in both tests . NHI = Northwest Hawaiian Islands, MHI Main Islands. (2006). Shaded cells signify significant differences (A) Holothuria atra (Morisita dissimilarity 0.439 ± 0.042) Site Φ Table 4. Pairwise comparisons by site for (A) Holothuria atra and (B) whitmaei . Table

(B) Holothuria whitmaei

Site Skillings et al.: Comparative population structure in two sea cucumbers 369

Table 5. Holothuria atra pairwise population (A) effective migration rate estimates (NeΜ) and (B) 95% HPD intervals based on a Bayesian MCMC simulation. The mode value of M (the mutation- scaled immigration rate, m/μ) calculated by Migrate was multiplied by the mode of θ, as calculated by Migrate, of the destination population to estimate migration. The effective migration estimates are seperated by direction; the columns are source populations and the the rows are sink populations. The 95% HPD intervals for M follow this pattern and the the 95% HPD intervals for θ are found shaded in the diagonal. MHI = Main Hawaiian Islands, NWHI = Northwestern Hawaiian Islands.

(A) Effective migration rate estimates MHI NWHI Johnston MHI - 2.5988 1.0731 NWHI 37.6540 - 79.0910 Johnston 0.3135 3.5416 - (B) 95% HPD intervals MHI NWHI Johnston MHI 0.002–0.0135 75–985 0–730 NWHI 365–1200 0.0095–0.0785 470–1300 Johnston 0–835 260–1700 0–0.0105 suggesting selection or recent demographic expansion. Tajima’s D and Fu’s FS were both significant for the overall diversity. Two AMOVAs were performed on the H. whitmaei COI haplotype data with regional groupings identical to those done for the H. atra analysis (Table 2). Almost all of the variance was explained by within-population variance for both genetic measures. The AMOVA using FST showed a small, but significant, amount of among- population within-group variance (Table 2).

Overall FST was 0.01704 (P = 0.00782). Overall ΦST was −0.00635 (P = 0.65103). The Morisita dissimilarity was 0.190 (SE 0.059). The only significant pairwise comparisons were between Nihoa and all other sites except for Kure and Kona, and only when haplotype frequencies were compared as opposed to genetic distance (Tables 3, 4). Because of the lack of population differentiation Migrate analyses with H. whitmaei did not converge on any particular migration rate (Fig. 1).

Discussion

Holothuria atra and H. whitmaei are the most ubiquitous sea cucumbers on Hawaii’s coral reefs, sharing a wide range across the central and Indo-Pacific region, with similar life histories. In this survey of genetic connectivity within the Hawaiian Archipelago and Johnston Atoll, we were interested in phylogeographic similarities between these species that could be used for evaluating or planning marine management actions. Studies have shown that a single representative or model species is not always useful as a proxy for estimating dispersal among marine communities, even in closely related groups such as the endemic, sympatric, Hawaiian limpets, opihi (Bird et al. 2007, Toonen et al. 2011). Would surveying one species give us the proper foundations for the management of a group of wide-ranging fisheries animals? With growing certainty, distinct differences in population structure among Hawaiian species argue that exemplar species are a poor proxy for community patterns of connectivity and should not be used as the sole means to guide management decisions. 370 Bulletin of Marine Science. Vol 90, No 1. 2014

Figure 3. Haplotype network for Holothuria whitmaei. Each circle represents a unique haplotype connected by a line to those that differ by one base pair. Nodes on lines indicate a missing haplotype and numbers represent multiple missing haplotypes. Each haplotype is color-coded by site and circle size is proportional to frequency. The smallest circles represent one occurrence of a haplotype.

Biogeography, Life History, and Range Size.—If a large species range is a consequence of high dispersal potential (Thorson 1950, Gilman 2006, Paulay and Meyer 2006), then both H. atra and H. whitmaei should have little pronounced population structure, especially across small scales. Indeed, this is the case for many species in the central west Pacific (Lessios et al. 2003,C raig et al. 2007, Schultz et al. 2007, Eble et al. 2010, Gaither et al. 2010). Despite a species range that stretches from the western Red Sea to the eastern central Pacific, we found evidence of limited gene flow in H. atra. In contrast, H. whitmaei showed almost no significant population structure despite a far more restricted species range. This pattern is consistent with population genetic survey of H. whitmaei on the Great Barrier Reef and the Australasian Region, which found structure between regions, but not within regions (Uthicke and Benzie 2003). These contrasting patterns highlight the pitfalls of making predictions about population connectivity and diversity based solely on larval developmental mode, or the location and size of a species’ range (reviewed by Lester et al. 2007, Mercier et al. 2013). The larval life history of H. atra and H. whitmaei are not known exactly, but they require at least 18–25 d to reach competency to settle, and are believed to be capable of traversing long oceanic distances with sufficient frequency to maintain species cohesion across a very broad geographic range (Laxminarayana 2005). Counter to intuition, the geographic distance among sites is a poor predictor of the ease with which larvae can disperse among locations; the “oceanographic distance” experi- enced by larvae between sites is uncorrelated with geographic separation between them (Baums et al. 2006, White et al. 2010). Likewise, recent comparative analyses indicate the relationship between the length of pelagic larval development and dispersal ability is not as tight as has been generally assumed (Bradbury et al. 2008, Skillings et al.: Comparative population structure in two sea cucumbers 371

Weersing and Toonen 2009, Shanks 2009, Ross et al. 2009, Riginos et al. 2011, Selkoe and Toonen 2011). Mercier et al. (2013) examined the widely accepted relationship between larval developmental mode (feeding and yolk-supplied) and dispersal peri- ods and found a synergistic influence of phylogeny and climate on dispersal ability as opposed to developmental mode. A broad meta-analysis by Lester et al. (2007) indicated the intuitive relationship between range size and larval dispersal potential was poorly correlated in general, but can play an important role in some taxa. Finally, Faurby and Barber (2012) showed that poor correlations between PLD and genetic connectivity may come from differences in effective population size and non- equilibrium conditions. Although the mechanism of isolation across small scales remains unknown, our data clearly indicate that for H. whitmaei and H. atra relative range size does not predict relative dispersal ability. Given that both species appear to share a similar life history, have a similar minimum larval duration, occupy the same habitats, are both wide ranging, and are closely related, one would expect them to have similar levels of population partitioning. A direct comparison of larval biology that may explain the discrepancy is lacking, but differences in population structure may alternatively stem from subtle, species-specific disparities in habitat usage, population size, or history that also have large impacts on genetic structure (Whitlock and McCauley 1999, Lowe and Allendorf 2010, Hart and Marko 2010, 2011, Karl et al. 2012). Population Structure in the Hawaiian Archipelago and Johnston Atoll.—Both species showed high haplotype diversity and a low nucleotide diversity in the COI gene. Except for the H. whitmaei Laysan and Nihoa populations, haplotype diversity was similar at all localities in each species. At Laysan and Nihoa, H. whitmaei was characterized by relatively low haplotype diversity. Nucleotide diversity was higher in H. atra, but there were no other apparent patterns of genetic diversity between localities in either species. The higher nucleotide diversity in H. atra was likely a reflection of the greater average genetic distances between haplotypes. Our mtDNA examination of H. atra and H. whitmaei revealed contrasting patterns of population partitioning. Regional population partitioning was not detected in H. whitmaei with AMOVA, whereas significant regional partitioning was detected in H. atra. Pairwise population comparisons also reflected this pattern. All pairwise H. whitmaei comparisons had low non-significant values except for the isolation of Nihoa. Genetic similarity in H. whitmaei appeared driven by three haplotypes common throughout the range, the most common of which was not detected in the low number of samples it was possible to collect at Nihoa. Although it would be ideal to collect more samples, it is difficult to collect at this site because weather and cruise logistics (planned a year in advance) have to mesh for an opportunity sample. The absence of this haplotype was likely the reason why Nihoa stood in these comparisons. Two interesting patterns were revealed by the H. atra population partitioning. Excluding Laysan Island, there were no significant pairwise differences between any other islands in the NWHI (spanning nearly 2000 km), indicating few limits to gene flow throughout the NWHI, excluding Laysan. In contrast, there is significant structuring within the MHI (roughly 600 km), and between the NWHI and the MHI. This differentiation at the smaller scales of the MHI indicates that factors beyond geographic distance influence population partitioning inH. atra. All of the population structure in H. atra was driven by the three localities of Oahu, Kauai, and Laysan. 372 Bulletin of Marine Science. Vol 90, No 1. 2014

Johnston Atoll, the nearest neighboring land mass, roughly 860 km south of French Frigate Shoals, was genetically distinct from most of the MHI and Laysan, and genetically similar to all of the NWHI, except Laysan. It has been suggested that Johnston Atoll acts as a stepping-stone into the Hawaiian Islands (Maragos and Jokiel 1986). Computer simulations predict two larval transport corridors from Johnston Atoll to the Hawaiian Archipelago: one corridor stretching from Johnston to French Frigate Shoals in the NWHI, and one from Johnston to Oahu in the MHI (Kobayashi and Polovina 2006, Kobayashi 2006). Our data support the predicted larval transport corridor between Johnston Atoll and French Frigate

Shoals, but not the latter. The low FST and ΦST values indicated strong genetic similarity between Johnston Atoll and the NWHI, indicating that, at least for these sea cucumbers, Johnston Atoll is an isolated outpost of the Northwest Hawaiian Islands. Assuming equilibrium conditions, migration between areas in the Hawaiian Archipelago is heavily one-sided with migration from the MHI into the NWHI dominating. Non-equilibrium conditions, such as from differences in population sizes or a bottleneck resulting from a recent colonization or population expansion, could also have contributed to the pattern of asymmetric migration seen in H. atra, but given the wider inter-archipelagic patterns for H. atra it is unlikely that either the MHI or NWHI populations were a recent colonization with no subsequent gene flow S( killings et al. 2011). It is possible that H. whitmaei is a recent colonizer of the Hawaiian Archipelago, but given that the Hawaii population showed a fairly high haplotype diversity, yet no strong genetic population structure, we contend that the evidence does not favor a bottleneck scenario stemming from a recent colonization. If a H. whitmaei colonization wave did recently colonize Hawaii, it would have had to have quickly expanded through the Archipelago; indicating a high dispersal potential that would presumably continue to maintain genetic connectivity among sites. In conclusion, many echinoderm species are the target of artisanal or commercial fishing, and properly managing these fisheries requires a detailed understanding of dispersal pathways and population connectivity within a spatial management network. Lying at the periphery of the tropical Central Pacific, it has long been debated why some species maintain connectivity and species cohesion between the Hawaiian Islands and the rest of the Pacific, whereas others diverge to become Hawaiian endemics, and yet others fail to colonize the Hawaiian Archipelago at all. Considerable evidence is accumulating that it is indefensible to make predictions of connectivity based solely on proxies such as ecological or phylogenetic similarity, pelagic larval duration, developmental mode, or species range sizes (Bird et al. 2007, Lester et al. 2007, Bradbury et al. 2008, Shanks 2009, Weersing and Toonen 2009, Riginos et al. 2011, Mercier et al. 2013). The differences in population structuring among congeneric sea cucumbers H. atra and H. whitmaei provides yet another example that single exemplar species make a poor basis for management decisions in the absence of additional information. We argue that in cases where there are clash- ing patterns of population structure, place-based management approaches, such as marine spatial management or ecosystem-based management, are the best bet for responding to the complex relationships between populations that defy simple rules of thumb. Skillings et al.: Comparative population structure in two sea cucumbers 373

Acknowledgments

We thank the Papahānaumokuākea Marine National Monument, US Fish and Wildlife Services, and Hawai‘i Division of Aquatic Resources (DAR) for coordinating research activi- ties and permitting, and the National Oceanic and Atmospheric Administration (NOAA) RV Hi‘ialakai and her crew for years of outstanding service and support. Special thanks go to B Bowen, the members of the ToBo Lab, UH Dive Program, NMFS, PIFSC, CRED, M Skillings, K Boyle, J Claisse, D Wagner, P Aldrich, M Iacchei, J Puritz, J Eble, I Baums, M Timmers, R Kosaki, S Karl, C Meyer, S Godwin, M Stat, X Pochon, H Kawelo, T Daly-Engel, M Craig, L Rocha, M Gaither, G Conception, Y Papastamatiou, M Crepeau, Z Szabo, J Salerno, and the HIMB NSF-EPSCoR Core Genetics Facility. We also thank the guest editor and the anony- mous reviewers who put in the extra time to help strengthen the quality of this work. This work was funded in part by grants from the National Science Foundation (DEB#99-75287, OCE#04-54873, OCE#06-23678, OCE#09-29031), National Marine Sanctuaries NWHICRER- HIMB partnership (MOA-2005-008-6882), National Marine Fisheries Service, NOAA’s Coral Reef Conservation Program, and the Hawai‘i Coral Reef Initiative. This is contribution #1421 from the Hawai‘i Institute of Marine Biology, and SOEST 8049.

Literature Cited

Bandelt HJ, Forster P, Sykes BC, Richards MB. 1995. Mitochondrial portraits of human populations using median networks. Genetics. 141:743–753. PMid:8647407. PMCid:PMC1206770. Bandelt HJ, Foster P, Röhl A. 1999. Median-joining networks for inferring intraspecific phylog- enies. Mol Biol Evol. 16(1):37–48. PMid:10331250. http://dx.doi.org/10.1093/oxfordjourn- als.molbev.a026036 Barber PH, Palumbi SR, Erdmann MV, Moosa MK. 2002. Sharp genetic breaks among populations of Haptosquilla pulchella (Stomatopoda) indicate limits larval transport: patterns, causes, and consequences. Mol Ecol. 659–674. PMid:11972755. http://dx.doi. org/10.1046/j.1365-294X.2002.01468.x Baums IB, Paris CB, Cherubin LM. 2006. A bio-oceanographic filter to larval dispersal in a reef-building coral. Limnol Oceanogr. 51:1969–1981. http://dx.doi.org/10.4319/ lo.2006.51.5.1969 Beerli P. 2006. Comparison of Bayesian and maximum likelihood inference of population genetic parameters. Bioinformatics. 22(3):341–345. PMid:16317072. http://dx.doi.org/10.1093/ bioinformatics/bti803 Bell FJ. 1887. Studies in the Holothuroidea. VI. Description of new species. Proc Zool Soc. p. 531–534. Benjamini Y, Krieger AM, Yekutieli D. 2006. Adaptive linear step-up procedures that control the false discovery rate. Biometrika. 93(3):491–507. http://dx.doi.org/10.1093/biomet/93.3.491 Bermingham E, Lessios H. 1993. Rate variation of protein and mtDNA evolution as revealed by sea urchins separated by the Isthmus of Panama. Proc Natl Acad Sci. 90:2734–2738. PMid:8096641. PMCid:PMC46170. http://dx.doi.org/10.1073/pnas.90.7.2734 Bird CE, Holland BS, Bowen BW, Toonen RJ. 2007. Contrasting phylogeography in three endemic Hawaiian limpets (Cellana spp.) with similar life histories. Mol Ecol. 16(15):3173– 3186. PMid:17651195. http://dx.doi.org/10.1111/j.1365-294X.2007.03385.x Bonham K, Held EE. 1963. Ecological observations on the sea cucumbers Holothuria atra and H. leucospilota at Rongelap Atoll, Marshall Islands. Pac Sci. 17:305–314. Bradbury IR, Laurel B, Snelgrove PV, Bentzen P, Campana SE. 2008. Global patterns in marine dispersal estimates: the influence of geography, taxonomic category and life history. Proc Roy Soc B: Biol Sci. 275(1644):1803–1809. PMid:18445556. PMCid:PMC2587791. http:// dx.doi.org/10.1098/rspb.2008.0216 Briggs JC. 1974. Marine Zoogeography. McGraw Hill Publishers, New York, NY. 374 Bulletin of Marine Science. Vol 90, No 1. 2014

Briggs JC, Bowen BW. 2012. A realignment of marine biogeographic provinces with particular reference to fish distributions. J Biogeogr. 39:12–30. http://dx.doi. org/10.1111/j.1365-2699.2011.02613.x Chao A, Jost L, Chiang SC, Jiang Y-H, Chazdon R. 2008. A two-stage probabilistic approach to multiple-community similarity indices. Biometrics. 64:1178–1186. PMid:18355386. http:// dx.doi.org/10.1111/j.1541-0420.2008.01010.x Clark AM and Rowe FEW. 1971. Monograph of shallow water Indo–West Pacific echinoderms. Trustees of the British Museum (Natural History), London. Conand C. 1990. The fishery resources of Pacific island countries. Part 2: Holothurians. FAO Fisheries Technical Paper, No. 272 (2). Rome, Italy. Afailable from: ftp://ftp.fao.org/docrep/ fao/008/t0293e/t0293e00.pdf Conand C. 1994. Asexual reproduction by fission inHolothuria atra: variability of some parameters in populations from the tropical Indo-Pacific. Oceanologica Acta. 19(4):209–216. Craig MT, Eble JA, Bowen BW, Robertson DR. 2007. High genetic connectivity across the Indian and Pacific oceans in the reef fish Myripristes berndti (Holocentridae). Mar Ecol Prog Ser. 334:245–254. http://dx.doi.org/10.3354/meps334245 Dawson MN. 2001. Phylogeography in coastal marine animals: solution from California? J Biogeogr. 28:723–736. http://dx.doi.org/10.1046/j.1365-2699.2001.00572.x Dawson MN, Hamner WM. 2008. A biophysical perspective on dispersal and the geography of evolution in marine and terrestrial systems. J Roy Soc Interface. 5:135–150. PMid:17626000. PMCid:PMC2093964. http://dx.doi.org/10.1098/rsif.2007.1089 DeMartini EE, Friedlander AM. 2004. Spatial pattern of endemism in shallow water reef fish populations of the Northwestern Hawaiian Island. Mar Ecol Prog Ser. 271:281–296. http:// dx.doi.org/10.3354/meps271281 Ebert TA. 1983. Recruitment in echinoderms. In: Echinoderm studies 1. Jangoux M, Lawrence JM, editors. Eble JA, Toonen RJ, Bowen BW. 2009. Endemism and dispersal: comparative phylogeography of three surgeonfishes across the Hawaiian Archipelago. Mar Biol. 156(4):689–698. http:// dx.doi.org/10.1007/s00227-008-1119-4 Eldredge LG, Evenhuis NL. 2003. Hawaii’s biodiversity: a detailed assessment of the numbers of species in the Hawaiian Islands. Bishop Mus Occ Pap. 76:1–28. Excoffier L, Laval G, Schneider S. 2005. Arlequin version 3.0: an integrated software pack- age for population genetics data analysis. Evol Bioinformatics Online. 1:47–50. PMCid:PMC2658868. Faurby S, Barber PH. 2012. Theoretical limits to the correlation between pelagic larval duration and population genetic structure. Mol Ecol. 21:3419–3432. PMid:22574811. http://dx.doi. org/10.1111/j.1365-294X.2012.05609.x Friedlander AM, DeMartini EE. 2002. Contrasts in density, size and biomass of reef fishes between the Northwestern and Main Hawaiian Islands: the effects of fishing down apex predators. Mar Ecol Prog Ser. 230:253–264. http://dx.doi.org/10.3354/meps230253 Gaither MR, Toonen RJ, Robertson DR, Planes S, Bowen BW. 2010. Genetic evaluation of marine biogeographical barriers: perspectives from two widespread Indo-Pacific snap- pers (Lutjanus kasmira and Lutjanus fulvus). J Biogeogr. 37(1):133–147. http://dx.doi. org/10.1111/j.1365-2699.2009.02188.x Gilman SE. 2006. Life at the edge: an experimental study of poleward range boundary. Oecologia. 148:270–279. PMid:16477473. http://dx.doi.org/10.1007/s00442-006-0372-9 Grigg RW. 1983. Community structure, succession and development of coral reefs in Hawaii. Mar Ecol Prog Ser. 11:1–14. http://dx.doi.org/10.3354/meps011001 Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 41:95–98. Halpern BS, Walbridge S, Selkoe KA, Kappel CV, Micheli F, D’Agrosa C, Bruno JF, Casey KS, Ebert C, Fox HE, et al. 2008. A global map of human impact on marine ecosystems. Science. 319(5865):948–952. PMid:18276889. http://dx.doi.org/10.1126/science.1149345 Skillings et al.: Comparative population structure in two sea cucumbers 375

Hart MW, Marko PB. 2010. It’s about time: divergence, demography, and the evolution of developmental modes in marine invertebrates. Integrative Comp Biol. 50:643–661. PMid:21558230. http://dx.doi.org/10.1093/icb/icq068 Hourigan TF, Reese ES. 1987. Mid-ocean isolation and evolution of Hawaiian reef fishes. Trends Ecol Evol. 2:187–191. http://dx.doi.org/10.1016/0169-5347(87)90018-8 Hutchison DW, Templeton A. 1999. Correlation of pairwise genetic and geographic distance measures: inferring the relative influences of gene flow and drift on the distribution of genetic variability. Evolution. 53:1898–1914. http://dx.doi.org/10.2307/2640449 Jokiel PL. 1987. Ecology, biogeography and evolution of corals in Hawaii. Trends Ecol Evol. 2:179–182. http://dx.doi.org/10.1016/0169-5347(87)90016-4

Jost L. 2008. GST and its relatives do not measure differentiation. Mol Ecol. 17(18)4015–4026. PMid:19238703. http://dx.doi.org/10.1111/j.1365-294X.2008.03887.x Karl SA, Toonen RJ, Grant WS, Bowen BW. 2012. Common misconceptions in molecular ecology: echoes of the modern synthesis. Mol Ecol. 21:4171–4189. PMid:22574714. http:// dx.doi.org/10.1111/j.1365-294X.2012.05576.x Kay EA. 1980. Little worlds of the Pacific. An essay on Pacific Basin Biogeography. Harold L. Lyon Arboretum, University of Hawaii, Lecture No. 9:1–40. Kay EA. 1984. Patterns of speciation in the Indo–West Pacific. In: Radovsky FJ, Raven PH, Sohmer SH, editors. Biogeography of the tropical Pacific. Assoc System Collections BP Bishop Mus. 15–31. Kay EA, Palumbi SR. 1987. Endemism and evolution in Hawaiian marine invertebrates. Trends Ecol Evol. 2(7):183–186. http://dx.doi.org/10.1016/0169-5347(87)90017-6 Kobayashi DR. 2006. Colonization of the Hawaiian Archipelago via Johnston Atoll: a character- ization of oceanographic transport corridors for pelagic larvae using computer simulation. Coral Reefs. 25:407–417. http://dx.doi.org/10.1007/s00338-006-0118-5 Kobayashi DR, Polovina JJ. 2006. Simulated seasonal and interannual variability in larval transport and oceanography in the Northwestern Hawaiian Islands using satellite remotely sensed data and computer modeling. Atoll Res Bull. 543:365–390. Laxminarayana A. 2005. Induced spawning and larval rearing of the sea cucumbers, Bohadschia marmorata and Holothuria atra in Mauritius. Fish Res. 48–52. Lee J, Byrne M, Uthicke S. 2008. The influence of population density on fission and growth of Holothuria atra in natural mesocosms. J Exp Mar Biol Ecol. 365:126–135. http://dx.doi. org/10.1016/j.jembe.2008.08.003 Lessios HA, Garrido M, Kessing BD. 2001. Demographic history of Diadema antilla- rum, a keystone herbivore on Caribbean reefs. Proc Roy Soc. 268:1–7. PMid:11703875. PMCid:PMC1088886. http://dx.doi.org/10.1098/rspb.2001.1806 Lessios HA, Kane J, Robertson DR. 2003. Phylogeography of the pantropical sea urchin Tripneustes: contrasting patterns of population structure between oceans. Evolution. 57(9):2026–2036. PMid:14575324. Lester SE, Ruttenberg BI, Gaines SD, Kinlan BP. 2007. The relationship between dispersal ability and geographic range size. Ecol Lett. 10:745–758. PMid:17594430. http://dx.doi. org/10.1111/j.1461-0248.2007.01070.x Lowe WH, Allendorf FW. 2010. What can genetics tell us about population connectivity? Mol Ecol. 19:3038–3051. PMid:20618697. http://dx.doi.org/10.1111/j.1365-294X.2010.04688.x Maragos JE, Jokiel PL. 1986. Reef corals of Johnston Atoll: one of the world’s most isolated reefs. Coral Reefs. 4(3):141–150. http://dx.doi.org/10.1007/BF00427935 Marko PB, Hart MW. 2011. Retrospective coalescent methods and the reconstruction of metapopulation histories in the sea. Evol Ecol. 26:291–315. http://dx.doi.org/10.1007/ s10682-011-9467-9 Mercier A, Sewell MA, Hamel JF. 2013. Pelagic propagule duration and developmental mode: reassessment of a fading link. Global Ecol Biogeogr. 22:517–530. http://dx.doi.org/10.1111/ geb.12018 376 Bulletin of Marine Science. Vol 90, No 1. 2014

Nei M, Li WM. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc Natl Acad Sci USA. 11:291–306. Paine RT. 1969. A note on trophic complexity and community stability. Am Nat. 103:91–93. http://dx.doi.org/10.1086/282586 Pandolfi JM, Bradbury RH, Sala E, Hughes TP, Bjorndal KA, Cooke RG, McArdle D, McClenachan L, Newman MJH, Paredes G, et al. 2003. Global trajectories of the long- term decline of coral reef ecosystems. Science. 301:955–958. PMid:12920296. http://dx.doi. org/10.1126/science.1085706 Paulay G, Meyer C. 2006. Dispersal and divergence across the greatest ocean region: do larvae matter? Integr Comp Biol. 46(3):269–281. PMid:21672741. http://dx.doi.org/10.1093/icb/ icj027 Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics. 14:817–818. http://dx.doi.org/10.1093/bioinformatics/14.9.817 Power ME, Tilman D, Estes JA, Menge BA, Bond WJ, Mills LS, Daily G, Castilla JC, Lubchenco J, Paine RT. 1996. Challenges in the quest for keystones. BioScience. 46:609–620. http:// dx.doi.org/10.2307/1312990 Purcell SW. 2010. Managing sea cucumber fisheries with an ecosystem approach. In: Lovatelli A, Vasconcellos M, Yimin Y, editors. FAO fisheries and aquaculture technical paper no. 520. Rome, FAO. 157 p. Purcell SW, Mercier A, Conand C, Hamel J-F, Toral-Granda MV, Lovatelli A, Uthicke S. 2011. Sea cucumber fisheries: global analysis of stocks, management measures and drivers of overfishing. Fish Fish. 14:34–59. http://dx.doi.org/10.1111/j.1467-2979.2011.00443.x Riginos C, Victor BC. 2001. Larval spatial distributions and other early life-history characteristics predict genetic differentiation in eastern Pacific blennioid fishes. Proc Roy Soc B: Biol Sci. 268(1479):1931–1936. PMid:11564350. PMCid:PMC1088830. http://dx.doi. org/10.1098/rspb.2001.1748 Riginos C, Douglas KE, Jin Y, Shanahan DF, Treml EA. 2011. Effects of geography and life history traits on genetic differentiation in benthic marine fishes. Ecography. 34(4):566–575. http://dx.doi.org/10.1111/j.1600-0587.2010.06511.x Rozas J. 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 19(18):2496–2497. PMid:14668244. http://dx.doi.org/10.1093/ bioinformatics/btg359 Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist program- mers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, NJ. p. 365–386. PMid:10547847. Sala E, Boudouresque CF, Harmelin-Vivien M. 1998. Fishing, trophic cascades, and the structure of algal assemblages: evaluation of an old but untested paradigm. Oikos. 82:425–443. http://dx.doi.org/10.2307/3546364 Schultz JK, Pyle RL, DeMartini E, Bowen BW. 2007. Genetic connectivity among color morphs and Pacific archipelagos for the flame angelfish, Centropyga loriculus. Mar Biol. 151:167– 175. http://dx.doi.org/10.1007/s00227-006-0471-5 Selkoe KA, Halpern BS, Toonen RJ. 2008. Evaluating anthropogenic threats to the Northwestern Hawaiian Islands. Aquat Conserv: Mar Freshwat Ecosyst. 18(7):1149–1165. http://dx.doi. org/10.1002/aqc.961 Selkoe KA, Henzler C, Gaines SD. 2009. Seascape genetics and the spatial ecology of marine populations. Fish Fish. 9:363–377. http://dx.doi.org/10.1111/j.1467-2979.2008.00300.x Selkoe KA, Toonen RJ. 2011. Marine connectivity: a new look at pelagic larval duration and genetic metrics of dispersal. Mar Ecol Prog Ser. 436:291–305. http://dx.doi.org/10.3354/ meps09238 Severance E, Karl S. 2006. Contrasting population genetic structures of sympatric, mass-spawning Caribbean corals. Mar Biol. 150:57–68. http://dx.doi.org/10.1007/s00227-006-0332-2 Skillings et al.: Comparative population structure in two sea cucumbers 377

Shanks A, Grantham B, Carr M. 2003. Propagule dispersal distance and the size and spacing of marine reserves. Ecol Appl. 13:S159–S169. http://dx.doi. org/10.1890/1051-0761(2003)013[0159:PDDATS]2.0.CO;2 Skillings DJ, Toonen RJ. 2010. It’s just a flesh wound: non-lethal sampling for conservation genetics studies. In: Pollock NW, editor. Diving for science. Proceedings of the 29th American Academy of Underwater Sciences Symposium. Dauphin Island, AL: AAUS. Skillings DJ, Bird CE, Toonen RJ. 2011. Gateways to Hawaii—genetic population structure of the tropical sea cucumber Holothuria atra. J Mar Biol. 2011:783030. http://dx.doi. org/10.1155/2011/783030 Slatkin M, Barton N. 1989. A comparison of three indirect methods for estimating average levels of gene flow. Evolution. 43:1349–1368. http://dx.doi.org/10.2307/2409452 Sloan SA. 1984. Echinoderm fisheries of the world: a review. In: Keegan BF, O’Connor BDS, editors. Echinodermata: Proceedings of the Fifth International Echinoderm Conference. AA Balkema, Rotterdam, Netherlands. p. 109–124. Sotka EE, Wares JP, Barth JA, Grosberg RK, Palumbi SR. 2004. Strong genetic clines and geographical variation in gene flow in the rocky intertidal barnacle Belanus glandula. Mol Ecol. 13:2143–2156. PMid:15245390. http://dx.doi.org/10.1111/j.1365-294X.2004.02225.x Tajima F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics. 125:585–593. Tamura K, Nei M. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 10:512–526. PMid:8336541. Thompson JD, Higgins DG, Gibson TJ. 1994. ClustalW: improving the sensitivity of pro- gressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680. PMid:7984417. PMCid:PMC308517. http://dx.doi.org/10.1093/nar/22.22.4673 Thorson G. 1950. Reproductive and larval ecology of marine bottom invertebrates. Biol Rev Camb Philos Soc. 25:1–45. http://dx.doi.org/10.1111/j.1469-185X.1950.tb00585.x Toonen RJ, Andrews KR, Baums IB, Bird CE, Concepcion GT, Daly-Engel TS, Eble JA, Faucci A, Gaither MR, Iacchei M, et al. 2011. Defining boundaries for ecosystem-based management: a multispecies case study of marine connectivity across the Hawaiian Archipelago. J Mar Biol. 2011:460173, 13 p. Uthicke S. 1999. Sediment bioturbation and impact of feeding activity of Holothuria (Halodeima) atra and Stichopus chloronotus, two sediment feeding holothurians, at Lizard Island, Great Barrier Reef. Bull Mar Sci. 64:129–141. Uthicke S, Benzie JAH. 2000a. The effect of beche-de-mer fishing on densities and size structure of Holothuria nobilis (Echinodermata: Holothuroidea) populations on the Great Barrier Reef. Coral Reefs. 19:271–276. Uthicke S, Benzie JAH. 2000b. Allozyme electrophoresis indicates high gene flow between populations of Holothuria (Microthele) nobilis (Holothuroidea: Aspidochirodita) on the Great Barrier Reef. Mar Biol. 137(5–6):819–825. http://dx.doi.org/10.1007/s002270000393 Uthicke S, Conand C, Benzie J. 2001. Population genetics of the fissiparous holothurians Stichopus chloronotus and Holothuria atra (Aspidochirotida): a comparison between the Torres Strait and La Réunion. Mar Biol. 139(2):257–265. http://dx.doi.org/10.1007/ s002270100579 Uthicke S, Benzie JAH. 2003. Gene flow and population history in high dispersal marine invertebrates: mitochondrial DNA analysis of Holothuria nobilis (Echinodermata: Holothuroidea) populations from the Indo-Pacific. Mol Ecol. 12(10):2635–2648. PMid:12969467. http:// dx.doi.org/10.1046/j.1365-294X.2003.01954.x Uthicke S, O’Hara TD, Byrne M. 2004. Species composition and molecular phylogeny of the Indo-Pacific teatfish (Echinodermata: Holothuroidea) bêche-de-mer fishery. Mar Freshwat Res. 55(8):837–848. http://dx.doi.org/10.1071/MF04226 378 Bulletin of Marine Science. Vol 90, No 1. 2014

Uthicke S, Purcell S. 2004. Preservation of genetic diversity in restocking of the sea cucumber Holothuria scabra investigated by allozyme electrophoresis. Canadian J Fish Aquat Sci. 61(4):519–528. http://dx.doi.org/10.1139/f04-013 Uthicke S, Schaffelke B, Byrne M. 2009. A boom-bust phylum? Ecological and evolutionary consequences of density variations in echinoderms. Ecol Monogr. 79:3–24. http://dx.doi. org/10.1890/07-2136.1 Weersing KA, Toonen RJ. 2009. Population genetics, larval dispersal, and demographic connectivity in marine systems. Mar Ecol Prog Ser. 393:1–12. http://dx.doi.org/10.3354/ meps08287 White C, Selkoe KA, Watson J, Siegel DA, Zacherl DC, Toonen RJ. 2010. Ocean currents help explain population genetic structure. Proc Roy Soc B: Biol Sci. 277:1685–1694. PMid:20133354. PMCid:PMC2871860. http://dx.doi.org/10.1098/rspb.2009.2214

Whitlock MC, McCauley DE. 1999. Indirect measures of gene flow and migration:F ST ≠ 1/(4Nm + 1). Heredity. 82(2):117–125. PMid:10098262. http://dx.doi.org/10.1038/sj.hdy.6884960 Ziegler AC. 2002. Hawaiian natural history, ecology and evolution. University of Hawaii Press, Honolulu HI, USA. 477 p.

B M S