53 Seladin-1 expression in rat adrenal gland: effect of adrenocorticotropic hormone treatment

Marie-Claude Battista, Claude Roberge, Me´lissa Otis and Nicole Gallo-Payet Service of Endocrinology, Department of Medicine, Faculte´ de me´decine et des sciences de la sante´, Universite´ de Sherbrooke, 3001, 12th Avenue North, Sherbrooke, Quebec, Canada J1H 5N4 (Requests for offprints should be addressed to N Gallo-Payet; Email: [email protected])

Abstract Seladin-1 (KIAA0018) gene is the seventh most highlyexpressed relocalization of Seladin-1 into specific nuclear regions. This gene in the adult adrenal gland, along with genes coding for ACTH-induced relocalization was abrogated by the pre- steroidogenic enzymes. The aim of the present study was to treatment of cells with 75 nM U18666A (an inhibitor of investigate the localization of the Seladin-1 protein in control Seladin-1). In addition, fasciculata cells exhibited an increase in and ACTH-treated rat adrenal glands and to verify whether the basal level of steroid secretion when cultured in the presence Seladin-1 is involved in secretion. Immunofluorescence studies of U18666A (25 and 75 nM), although ACTH-induced revealed that Seladin-1 was localized principally in the zona secretion was decreased. In summary, the present study fasciculata, cytoplasm, and nucleus. Expression of Seladin-1 was demonstrates that the protein expression of Seladin-1 is more increased by ACTH treatment, in vivo and in culture conditions. abundant in fasciculata cells than in glomerulosa cells and that Subcellular fractionation offasciculata cells showed that Seladin- the ACTH treatment increases both expression and nuclear 1 was mainly present in the nucleus, membrane, and localization of the protein. Results also suggest that depending cytoskeleton fractions and, to a lesser extent, in the cytosol. on its cellular localization, the D24-reductase activity of ACTH treatment decreased Seladin-1 expression in the cytosol, Seladin-1 may play a major role in steroid secretion in the with a concomitant increase in the nuclear fraction. In the adrenal gland. glomerulosa and fasciculata cells in culture, ACTH induced a Journal of Endocrinology (2007) 192, 53–66

Introduction fasciculata cells (Gallo-Payet & Payet 2003). ACTH acts not only on the immediate, transcription-independent stimu- The adult adrenal cortex is composed of three concentric lation of adrenal steroid synthesis and release, but also layers: the zona glomerulosa, the zona fasciculata, and the zona increases the expression of a number of genes including reticularis, all of which present different morphological and those involved in steroidogenesis (Sewer & Waterman 2003). functional properties. Zona glomerulosa is specialized in the Despite several studies using both animal and human production of aldosterone while zona fasciculata/reticularis glomerulosa and fasciculata cells, the precise molecular synthesize cortisol in humans and bovine, and corticosterone mechanisms by which ACTH stimulates growth and in rodents (for review, see Rainey 1999). The overall secretory activities are complex and poorly understood. production of aldosterone, however, is in the order of Over the past few years, studies on gene profiling and picomolar, compared with the micromolar range for regulation have provided key elements in our comprehension cortisol/corticosterone (Gallo-Payet & Payet 1989, Rainey as to how cell functions are regulated at the molecular level. 1999, Sewer & Waterman 2003). The adrenal gland undergoes For instance, Seladin-1 (K1AA0018) gene is the seventh most constant dynamic structural changes and is generally well highly expressed known gene in the human adult adrenal acknowledged that cellular proliferation is preferentially gland, along with genes coding for steroidogenic enzymes observed at the periphery of the gland (zona glomerulosa) (Hu et al. 2000). This gene is also expressed in the human fetal while cell death is increased in zona reticularis. The regulated adrenal gland with a fourfold increase in the expression when balance between proliferation and apoptosis is a prerequisite for compared with the adult (Rainey et al. 2001), thus being the the integrative functionality of the gland (for review, see highest expressed known gene in human fetal adrenal gland Wolkersdorfer & Bornstein 1998, Vinson 2003, 2004). (Rainey et al. 2002). This protein has also been identified in Aside from angiotensin II (Ang II), adrenocorticotropin the brain and termed Seladin-1, for SELective Alzheimer hormone (ACTH) is the most potent stimulus of aldosterone Disease INdicator 1, due to its propensity to protect neurons secretion by glomerulosa cells and of corticosterone by from b-amyloid peptide-induced toxicity, thus promoting cell

Journal of Endocrinology (2007) 192, 53–66 DOI: 10.1677/joe.1.07062 0022–0795/07/0192–053 q 2007 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access 54 M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands

survival (Greeve et al. 2000). Seladin-1 is a human homolog of (Caldwell, NJ, USA); angiotensin II from Bachem (Marina the Diminuto/Dwarf1 gene described in plants where it is Delphen, CA, USA). BrdU (5-bromo-2-deoxyuridine), anti- involved in growth and steroid synthesis (Takahashi et al. BrdU, the secondary antibodies (mouse and rabbits) coupled 1995, Klahre et al. 1998). In normal human adrenal cortex, to Alexa-Fluor-488, Alexa-Fluor-594, the lectin wheat germ Seladin-1 mRNA expression is present throughout the gland agglutinin (WGA), and 40,60-diamino-2-phenylindole although more intense in the zona fasciculata (Sarkar et al. (DAPI) were from Molecular Probes (Eugene, OR, USA). 2001). In adrenal glands from dexamethasone-treated rats The anti-actin was from Chemicon International, Inc. after ACTH treatment as well as in active human (Temecula, CA, USA); Vectamount from Vector Laboratories adrenocortical adenomas, Seladin-1/hDiminuto mRNA is (Burlingame, CA, USA); horseradish peroxidase-conjugated overexpressed conversely to a reduced expression in adrenal anti-rabbit and anti-mouse antibodies and enhanced chemi- carcinomas (Sarkar et al. 2001, Luciani et al. 2004). In the luminescence (ECL) system from Amersham. The ProteoEx- human adrenocortical cancer cell line H295R as well as in the tract Subcellular Proteome Extraction Kit and the Seladin-1 cultured human primary adrenocortical cells, Seladin-1 inhibitor, U18666A (3b-(2-diethylaminoethoxy)androst-5- mRNA is regulated by the ACTH/cAMP pathway (Sarkar en-17-one), were purchased from Calbiochem (San Diego, et al. 2001, Luciani et al. 2004). CA, USA) and the RNAaqueous-4PCR Kit from Ambion Seladin-1, a member of the flavin adenine dinucleotide- (Austin, TX, USA). [3H]aldosterone (76 Ci/mmol) and dependent oxidoreductases family, is also named 3-b- [3H]corticosterone (70 Ci/mmol) were obtained from New hydroxysterol D-24-reductase (DHCR24; Greeve et al. England Nuclear, Dupont (Boston, MA, USA) and the anti- 2000). This enzyme is known to catalyze the conversion of corticosterone from Medicorp (Montreal, Quebec, Canada). desmosterol to cholesterol (Waterham et al. 2001), the Aldosterone antiserum was purchased from ICN Bio- preferential pathway of cholesterol synthesis in the human chemicals (Costa Mesa, CA, USA). All the other chemicals and the rat fetal brain (Fumagalli & Paoletti 1963). In humans, were of A-grade purity. mutations of the DHCR24 gene result in a rare and severe recessive autosomic disorder called desmosterolosis. This Animals pathology is characterized by desmosterol accumulation in plasma and tissues, by multiple congenital anomalies, and by Long–Evans female rats weighing 200–250 g were purchased severe mental retardation (Waterham et al. 2001). Recently, from Charles River, St Constant, Quebec, Canada. Upon Seladin-1 was also described as a key regulator of Ras-induced arrival, the rats were kept under controlled light and senescence and responses to oncogenic and oxidative stress temperature in our institution’s animal care facilities for 2 (Wu et al. 2004). weeks prior to the start of the experimental procedure to There is limited data available relative to Seladin-1 at the allow the animals to adapt to their environment, thereby protein level in the adrenal gland, the tissue with the highest reducing stress. Rats were then randomly distributed in transcription level of Seladin-1 (Greeve et al. 2000). There- control or in ACTH-treated groups. Animals were treated fore, the first aim of the present study was to generate a once a day (1500 h) for 7 days either with saline (control) or specific antibody to investigate the expression and cellular/ with Synacthen Depot subcutaneously (8 IU/250 g body intracellular distribution of Seladin-1 protein in the adrenal weight per day) and killed by decapitation on the morning of gland of both control and ACTH-treated rats. The second the eighth day. All the protocols were approved by the Animal aim was to compare this distribution in primary cultures of Care and Ethics Committee of our faculty. A number of three adult rat glomerulosa and fasciculata cells, before and after to five animals were used for each experiment and three ACTH treatment. Using this model, we thereby explored different experiments were performed. whether Seladin-1 is possibly involved in selected adreno- cortical cell functions. Generation and characterization of Seladin-1 antiserum The Seladin-1 antiserum was produced by Affinity Bior- eagents (Golden CO, USA): rabbits were immunized with the Materials and Methods same peptide as the one used by Greeve et al. (2000), consisting of amino acid residues 203–218 of Seladin-1 H N- Chemicals 3 TPSENSDLFYAVPWSC-COOH, maleimide-conjugated The chemicals used in the present study were obtained from to keyhole-limpet hemocyanin. This sequence is identical the following sources: Tissue-Tek from Miles (Elkhart, IN, in human, rat, and mouse. Specificity of the antibody was USA); Minimum Essential Medium (MEM Eagle’s medium) confirmed by western blotting. Briefly, following electro- and OPTI-MEMw from Life Technologies; collagenase from phoresis and transfer, polyvinylidene difluoride membranes New England Nuclear (Boston, MA, USA); DNase from Sigma were incubated as described below with Seladin-1 antiserum Chemical Co.; ACTH 1–24 peptide (Cortrosyn) from (dilution 1:1000), with the pre-immune serum (dilution Organon (Toronto, Ont., Canada); ACTH 1–39 peptide 1:1000) or with the Seladin-1 antiserum neutralized by the (Synacthen Depot 100 IU/ml) from Ciba Pharmaceuticals peptide raised against at 175-fold molar excess. The

Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access Seladin-1 localization in rat adrenal glands . M-C BATTISTA and others 55 expression of Seladin-1 was compared with total rat adrenal cerebellum (60 and 47 kDa), these were deemed non-specific gland, brain, and cerebellum for equal protein loading bands. Therefore, the 77 kDa band observed in Fig. 1A (20 mg). Seladin-1 antiserum detected two bands (77 and appeared as specific for Seladin-1. With the peptide 47 kDa) in the adrenal gland (lane 2), and three bands (77, 60, neutralized-Seladin-1 antiserum, the 77 kDa band was no and 47 kDa) in the brain (lane 3) and cerebellum (lane 4; longer detected in the three tissues (Fig. 1C), indicating Fig. 1A). Lane 5 shows a negative control (Leammli buffer). specificity of this band. Similar observation was also made in Since the pre-immune serum (Fig. 1B) detected one band in the human fetal adrenal gland (data not shown). the adrenal gland (47 kDa) and two bands in the brain and Preparation of glomerulosa and fasciculata cell cultures A Glomerulosa and fasciculata cells were obtained from adrenal 1 2345 glands of female Long–Evans rats and isolated according to the 125 method previously described in detail (Gallo-Payet & Payet 85 1989). Isolation and cell dissociation of glomerulosa and fasciculata zones were performed in MEM (supplemented 77 with 2% fetal bovine serum (FBS), 100 U/ml penicillin, and 60 100 mg/ml streptomycin). After a 20-min incubation at 37 8C 47 with collagenase (2 mg/ml) and DNase (25 g/ml), cells were disrupted by gentle aspiration with a sterile 10 ml pipette, 38 filtered, and centrifuged for 10 min at 100 g. For western blot analyses (Fig. 6) from freshly isolated cells, 1!106 glomerulosa and fasciculata cells were immediately processed for subcellular B 12345 protein extraction, and frozen until western blotting. For cell cultures, cell pellets were resuspended in OPTI-MEMw 125 supplemented with 2% fetal bovine serum, 100 U/ml 85 penicillin, and 100 g/ml streptomycin. The glomerulosa and 77 fasciculata cells were plated in triplicate for immunofluores- 60 cence experiments (5!104 cells per dish). The cells were left 47 to adhere to the Petri dishes for 45 min before adding the 38 culture medium. The cells were cultured at 37 8Cina humidified atmosphere composed of 95% air–5% CO2. The 31 culture medium was changed 6 h after initial addition of the medium, and the cells were used after 3 days of culture. The glomerulosa cells were stimulated with either Ang II (100 nM) C 12345 or ACTH (10 nM) for 3-day treatments, twice a day and fasciculata cells were stimulated with ACTH (10 nM) for 3-day 125 treatments, also twice a day. Fasciculata cells (5!104 cells) were also treated for 3 dayswith 85 or without ACTH (10 nM, twice a day) alone or in the presence 77 of the Seladin-1 inhibitor, U18666A (25–75 nM, once a day). 60 U18666A, a cell-permeable, amphiphilic amino-steroid, is a 47 high-affinity binding inhibitor of the D24-reductase activity of 38 Seladin-1 (IC50:0.15 mM), resulting in desmosterol accumu- lation. At low concentrations (nanomolar range), U18666A inhibits the D24-reductase activity of Seladin-1, with no effect Figure 1 Representative western blot analysis of Seladin-1 on cell viability (Bae & Paik 1997, Fliesler et al. 2000, Cenedella expression. (A) Seladin-1 antiserum detection in rat adrenal gland et al. 2004). It inhibits the cholesterol metabolism activity of (lane 2), rat brain (lane 3), and rat cerebellum (lane 4) for equal Seladin-1. The cells were examined daily, and phase-contrast protein loading (20 mg). Lane 1 shows kaleidoscope markers and images were taken using a microscope (Leica Corp., Deerfield, lane 5 serves as a negative control (Laemmli Buffer). In the adrenal ! gland, both the 77 and the 47 kDa bands are present while in the IL, USA) equipped with a 32 objective. brain and cerebellum; there is an additional band at 60 kDa. (B) Immunoblot in the presence of pre-immune serum. In the adrenal gland, only the 77 kDa band is specific since the 60 and 47 kDa Immunofluorescence studies in whole glands and cultured cells bands are also detected with the pre-immune serum. (C) Peptide neutralization assay confirming the specificity of the 77 kDa band, Control and 7-day ACTH-treated female Long–Evans rats since the latter disappears in all three tissues. All the assays were were killed and adrenal glands dissected and retrieved. Glands performed at identical dilutions and exposure times. were either embedded in paraffin for hematoxylin–eosin www.endocrinology-journals.org Journal of Endocrinology (2007) 192, 53–66

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access 56 M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands

counterstaining in order to identify morphological structures protein fractionation (cytosol, membranes, nucleus, and or frozen and embedded in a cryoprotectant optimal cutting cytoskeleton fractions) was done using the ProteoExtract temperature (OCT Tissue-Tek) for immunofluorescence Subcellular Proteome Extraction Kit according to the studies. Tissue sections (5 mm) or glomerulosa and fasciculata manufacturer’s instructions (Calbiochem). This kit contains cells grown in culture for immunofluorescence were fixed in four extraction buffers prepared with ultra-pure chemicals 3.7% formaldehyde, permeabilized in PBS–0.2% Triton to ensure high reproducibility, protease inhibitor cocktail to X-100, and blocked in PBS–0.5% BSA, 0.2% Triton. Tissue prevent protein degradation and benzonase nuclease to sections and cells were then incubated with the primary anti- remove contaminating nucleic acids. ProteoExtract Subcel- Seladin-1 antiserum or with the pre-immune serum (both lular Proteome Extraction Kit yields the total proteome 1:1000) followed by incubation with a secondary conjugated fractionated into four subproteomes of decreased complexity. anti-rabbit antibody coupled with Alexa-Fluor-594 nm This kit has a high efficiency for subcellular fractionation (1:500; red, frozen tissue) or Alexa-Fluor-488 nm (1:500; (Abdolzade-Bavil et al. 2004) and is widely used (Singh et al. green, cultured cells) for 1 h at room temperature. The cells 2004, Zhang & Insel 2004). All samples were assayed for were also incubated with the lectin WGA, known as a Golgi protein content before western blotting. Equivalent amounts apparatus marker (5 mg/ml; red) coupled to Alexa-594 (1:500, of proteins (15–30 mg for each fraction of subcellular red; Kovacs et al. 2004). Tissues and cells were also stained with fractionation of isolated cells and 15 mg for total tissue protein DAPI (1:1000; blue) for visualization of nuclei. Slides were extraction) were compared in each experiment. mounted with Vectashieldmounting medium and images were acquired with a Hamamatsu, ORCA-ER digital camera and Western blotting examined under a fluorescence Nikon Eclipse 2000 inverted microscope (Nikon, Mississauga, ON, Canada) equipped for All the samples were separated on 12% SDS-polyacrylamide epi-illumination. Tissue images were acquired using a !10 or gels and proteins transferred electrophoretically onto poly- !20 objectives, whereas cell images were acquired using a vinylidene difluoride membranes. After two washes with !100 objective. Images were processed with Metamorph Tris-buffered saline (pH 7.5)–Tween 20 (0.05%; TBS-T), (version 4.6r10) software (Universal Imaging Corporation, membranes were blocked with 5% milk/TBS-T. Membranes Downingtown, PA, USA). In all the cases, no specific staining were incubated with Seladin-1 antiserum (dilution 1:1000). was observed when primary antiserum was replaced by pre- Detection was performed by reaction with horseradish immune serum at the same dilution and exposure time. Images peroxidase-conjugated anti-rabbit secondary antibody and were acquired using identical camera settings for contrast and visualized by enhanced chemiluminescence (ECL system) brightness. To better evaluate Seladin-1 nuclear expression according to the manufacturer’s instructions. Immunoreactive within the zona glomerulosa (under the capsule, four to five bands were scanned by laser densitometry and expressed in cell layers), zona fasciculata, and zona reticularis, results were arbitrary units. expressed as the percentage of Seladin-1-stained nuclei found For whole zona glomerulosa and zona fasciculata protein within each cortical zone when compared with the total extracts, since the cell volume of glomerulosa cells is lower number of nuclei present in that zone. Seladin-1 staining than that of fasciculata cells, quantification of blots were within the nuclei was defined as the resulting pink color normalized to actin. For whole gland lysate immunoblotting, obtained by the superposition of DAPI and anti-Seladin-1, after Seladin-1 incubation, membranes were stripped for 2 h while total number included blue-colored nuclei. with glycine 0.2 M (pH 2.5) at 70 8C, then washed, blocked in 1% gelatin, and further incubated with the anti-actin antibody for 16 h (dilution 1:1000). In the experiments Tissue protein extraction and subcellular fractionation involving subcellular fractionation, the results are expressed The glomerulosa and fasciculata zones were isolated from the as the percentage of Seladin-1 protein within each adrenal gland and separately snap-frozen in liquid nitrogen subcellular fraction relative to total Seladin-1 content within and stored at K80 8C for tissue protein extraction, or cells the cell. were immediately processed for subcellular protein fraction- ation, as described below. The zona fasciculata fraction also RNA extraction and quantitative real-time PCR contains the zona reticularis, which is difficult to separate from the medulla which we attempted to discard with two Total RNA from glomerulosa and fasciculata zones, obtained small scapel cuts, but remnants are always possible. Since this from control and ACTH-treated rats, was extracted and fraction contains predominantly fasciculata, it is referred to as treated with DNase I (to digest contaminating genomic zona fasciculata throughout the text. Total tissue protein DNA) using RNAaqueous-4PCR Kit according to the extraction was performed after addition of boiling 2% manufacturer’s recommendations. RNA content was SDS/1% Triton/PBS solution to the zona glomerulosa and measured spectrophotometrically while RNA quality was zona fasciculata tissues (0.2 g tissue/ml). Tissues were assessed by electrophoresis on denaturing 1% agarose gel. homogenized using a Teflon potter and heated at 100 8C Total RNA (0.5 mg) was denatured (65 8C, 5 min) in the for 5 min. This procedure was repeated thrice. Subcellular presence of 0.5 mg oligo(deoxythymidine)12–18 (Invitrogen)

Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access Seladin-1 localization in rat adrenal glands . M-C BATTISTA and others 57 and 0.5 mM dNTP (Amersham Pharmacia Biotech) and Proliferation assays reverse transcribed at 42 8C for 60 min in 20 mlof1! first The cell proliferation was measured using fluorescence BrdU strand buffer (250 mM Tris–HCl (pH 8.3), 375 mM KCl, incorporation as previously described (Otis et al. 2005). The 15 mM MgCl ) containing 10 mM dithiothreitol, 40 U 2 glomerulosa and fasciculata cells were plated in 24-well plates RNAse OUT inhibitor (Invitrogen), and 200 U SuperScript (30!104 cells/well). The cells were treated daily for 3 days II Reverse Transcriptase (Invitrogen). Inactivation of the with or without ACTH (10 nM twice a day) alone or in the enzyme (70 8C, 15 min) was followed by glyceraldehyde-3- presence of the inhibitor, U18666A (25–75 nM, once a day). phosphate dehydrogenase (GAPDH) PCR to asses the quality Onthethirdday,cellswerefixedwith3.7% (v/v) of the template cDNA. Real-time PCR primers for rat formaldehyde in HBS for 10 min at room temperature and Seladin-1 and GAPDH (Invitrogen) were designed with permeabilized for 10 min with 0.2% Triton X-100 in HBS. Beacon Designer 2.0 software (PREMIER, Biosoft Inter- The cells were then incubated with anti-BrdU Alexa-Fluor- national, Palo Alto, CA, USA). Primer pairs are located on 594 (1:500). Fluorescence intensity was determined using a both sides of an intron or on an exon–exon junction. Microplate Fluorescence Reader FL600 (Bio-Tek; excitation: GAPDH: sense, TGGTGCCAAAAGGGTCATC; antisense, 560/40 nm; emission: 645/40 nm). CTTCCACGATGCCAAAGTTG; and Seladin-1: sense, GGGTGTTTGTGTGCCTCTTCC; antisense, GCTCCT- TCCACTCCCGTACC. Real-time PCR was performed Data analysis with an iCycler iQ Detection System using iQ SYBR Green The data are presented as meansGS.E.M. of the number of Supermix (Bio-Rad Laboratories) according to the manu- experiments indicated in parentheses. Statistical analyses of facturer’s instructions and as described previously (Salzmann the data were performed using one-way ANOVA, followed et al. 2004). Annealing temperature was 60.4 8C. Real-time by a test of simple effects when appropriate. Homogeneity of PCR products were analyzed on 1! Tris/acetate/EDTA- variance was assessed by Bartlett’s test and P values were buffered 2.5% agarose gel and visualized by ethidium bromide obtained by Tukey honestly significant differences. For simple staining. To ensure the specificity of each real-time PCR, comparisons between two groups, Student’s t-test was prior melting curve analyses were performed for all detected performed. products with only a single peak recorded corresponding to a unique melting temperature specific to each product. Sizes of the amplicons obtained were 176 pb for GAPDH and 156 pb for Seladin-1. Results

Incubation and measurement of aldosterone and corticosterone Localization and protein expression of Seladin-1 in adrenal tissue secretion and cells from control and ACTH-treated rats Fasciculata and glomerulosa cells were plated in 24-well Using the Seladin-1 antibody characterized in Fig. 1, the plates (50!104 cells/well) and were treated daily for 3 days distribution and cellular localization of Seladin-1 were first with or without ACTH (10 nM, twice a day) alone or in the studied by immunofluorescence on frozen adult rat adrenal presence of the Seladin-1 inhibitor, U18666A (25–75 nM, glands. As shown in Fig. 2A, the highest expression of once a day). After 3 days, the incubation medium was Seladin-1 was found at the periphery of the adrenal gland, removed by aspiration and stored at K20 8C for RIAs. For in the zona glomerulosa and zona fasciculata, while the acute stimulations, on the third day of cell culture, cells were lowest expression was found in the zona reticularis and stimulated with or without ACTH (10 nM) alone or in the medulla. To better differentiate intracellular expression, presence of U18666A (25–75 nM), during a 2-h period. colocalization with nuclear labeling (Fig. 2B) highlighted Prior to each experiment, the medium from cultured cells that, in zona glomerulosa (Fig. 2B, inset a) and zona was aspirated, and the cells washed twice with cold Hanks’ fasciculata (Fig. 2B, inset b), labeling was observed in both buffered saline (HBS; 130 mM NaCl, 3.5 mM KCl, 1.8mM the nucleus (arrow) and the cytoplasm (arrowhead). CaCl2,0.5 mM MgCl2,2.5 mM NaHCO3, and 5 mM However, labeling in the nucleus was greater and stronger HEPES) supplemented with 1 g/l glucose and 0.5% BSA. in zona fasciculata than in zona glomerulosa. In zona The cells were incubated in a 1 ml solution consisting of reticularis (Fig. 2B, inset c), nuclear labeling was present but 0.9 ml HBS-glucose supplemented with 0.5% BSA– less in the other zones while cytoplasmic labeling was very 0.1 mg/ml bacitracin and 0.1 ml stimuli. After a 2-h weak. In the medulla, Seladin-1 labeling was practically incubation at 37 8C in a 95% air–5% CO2 environment, absent. A 7-day treatment with ACTH increased overall the incubation medium was removed by aspiration and expression of Seladin-1 throughout the gland (Fig. 2C and stored at K20 8C until assayed for steroid content D). As shown in corresponding insets (Fig. 2D, insets a, b determined by RIA, using specific antiserum and tritiated and c), labeling was increased in the nuclei in the three steroid as tracer. zones. Labeling was completely abrogated when Seladin-1 www.endocrinology-journals.org Journal of Endocrinology (2007) 192, 53–66

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access 58 M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands

A B a C D * * a ZG ZG ZG ZG

b b

ZF ZF

ZF ZF

c

ZR ZR c

ZR ZR ZR

V V V V M M M M

E B inset a D inset a

ZG ZG inset b inset b

ZF ZF inset c inset c

ZR ZR Figure 2 Immunofluoresence detection of Seladin-1 in rat adrenal gland. Frozen sections were processed as described in Materials and Methods. Seladin-1 labeling was detected using anti-Seladin-1 (1:1000) antibody coupled to Alexa-Fluor-594 nm (A, C, red) or combined with visualization of nuclei with DAPI (blue) (B, D, merged images) in zona glomerulosa (ZG), zona fasciculata (ZF), zona reticularis (ZR), and medulla (M) of control (A and B) and ACTH-treated rats (8 IU/250 g body weight/day per 7 days) (C and D). The resulting pink color in merged images indicates colocalization of Seladin-1 within the nucleus. Non-specific labeling of Seladin-1 pre-immune serum (E). Insets a, b, and c are magnifications of selected areas of zona glomerulosa (ZG), zona fasciculata (ZF), and zona reticularis (ZR) of B and D. Arrows identify labeling in the nucleus, while arrowheads indicate labeling in the cytoplasm. V, central vein in the medulla. Images were acquired with a !10 objective. Scale bars, 50 mm for A and B, 150 mm for C and D, 25 mm for E, and 10 mm for insets a, b, and c. *Saturated signal.

Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access Seladin-1 localization in rat adrenal glands . M-C BATTISTA and others 59

clearly distinct, while after ACTH treatment, zonation was A not as clearly delineated. A progressive change from small to large cells was observed, which rendered the separation from ZG zona glomerulosa to zona fasciculata difficult to identify. Results from Fig. 4 confirm that the basal level of expression in the nucleus was similar between zona glomerulosa and ZF fasciculata and lower in zona reticularis. ACTH treatment did not modify the number of Seladin-1-labeled nuclei in zona glomerulosa, while increasing the number of labeled nuclei from 67.5G1.8to84.6G4.4% (P!0.05) in zona fasciculata B and from 32.1G7.6to58.0G5.2% (P!0.05) in the zona reticularis. Western blotting further confirmed the morpho- ZG logical observations that the overall expression of Seladin-1 was higher in the zona fasciculata than in the glomerulosa. Seladin-1 protein appeared as a single band of 77 kDa, with expression levels fivefold higher in the zona fasciculata than in ZF the zona glomerulosa (Fig. 5A and B; P!0.05). ACTH treatment increased overall expression in both zona glomer- Figure 3 Hematoxylin–eosin staining of control (A) and ACTH- ulosa and zona fasciculata (Fig. 5C and D). treated (8 IU/250 g body weight/day per 7 days) (B) rat adrenal The above results on protein expression were also glands from the capsule to the mid-fasciculata zone. Lines delineate corroborated with real-time PCR analysis of Seladin-1 zona glomerulosa (ZG) from zona fasciculata (ZF). mRNA expression, which indicated that the expression in zona fasciculata was indeed twofold greater than in zona antiserum was replaced by its pre-immune serum at glomerulosa and that ACTH increased Seladin-1 expression matching dilution and similar exposure time (Fig. 2E). by twofold, in both zona glomerulosa and zona fasciculata For quantification of Seladin-1 expression in the various (Table 1). Together, these results indicate that in vivo, Seladin- adrenal zones, histological comparisons with hematoxylin– 1 is largely expressed in the zona fasciculata and to a lesser eosin staining was used to clearly delineate zones in frozen extent in the zona glomerulosa. Following ACTH treatment, sections, which were then identified by dashed lines in Fig. 2. a preferential localization of Seladin-1 was observed in the As shown in Fig. 3A and B, in adrenal glands from control nucleus of fasciculata cells. animals, the zona glomerulosa and zona fasciculata were Since specific functions are associated with specific intracellular structures, subcellular fractionation followed by 100 Control western blotting was performed on isolated zona glomerulosa ACTH * and zona fasciculata, obtained from control and ACTH-treated rats. As shown in Fig. 6A, in glomerulosa cells, Seladin-1 was 80 mainly present in the membrane and nuclear fractions and, to a lesser extent in the cytosol and cytoskeleton. ACTH treatment * decreased Seladin-1 expression in the cytosol (from 19.4G1.8 60 to 1.7G0.5%; P!0.001) and membrane fraction (from 30.5G1.9to18.6G1.8%; P!0.01), with a concomitant increase in the cytoskeletal fraction (from 18.6G1.2to38.8G 40 4.4%; P!0.001). Although Seladin-1 was also increased in the nuclear fraction, it did not reach statistical significance. In Seladin-1 in nucleus (% of total expression) fasciculata cells (Fig. 6B), Seladin-1 was mainly present in the 20 nucleus, and to a lesser extent in the cytoskeleton and membrane fractions. ACTH treatment decreased cytosolic content and increased nuclear localization of Seladin-1 (37.5G0.3to48.0G 0 ZG ZF ZR 5.0%; P!0.05). Therefore, in control conditions, the cytoplasmic distribution was higher in zona glomerulosa than Figure 4 Quantification of Seladin-1 immunofluorescence labeling in whole frozen adrenal gland sections. Results represent the in zona fasciculata, while the association with cytoskeleton was percentage of nuclei labeled with Seladin-1 protein relative to the higher in zona fasciculata when compared with zona total number of nuclei within each adrenocortical section of zona glomerulosa. On the other hand, ACTH-treatment favored glomerulosa (ZG), zona fasciculata (ZF), and zona reticularis (ZR) cytoskeletal localization within glomerulosa cells and as from control (nZ3) and ACTH-treated rats (8 IU/250 g body weight/day per 7 days; nZ3). Results are expressed as meansG demonstrated previously in vivo, nuclear localization within S.E.M. Statistical significance when compared with respective fasciculata cells. Such observations could be associated with control conditions: *P!0.05. differential effects for each respective zone. www.endocrinology-journals.org Journal of Endocrinology (2007) 192, 53–66

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access 60 M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands

A Control B 5 Zona glomerulosa Zona fasciculata 4 * 3 77 kDa seladin-1 2 1 43 kDa

actin Ratio seladin-1/actin 0 Zona glomerulosa Zona fasciculata

C D ACTH treatment 5 4 * Zona glomerulosa Zona fasciculata 3 77 kDa 2 1 43 kDa Ratio seladin-1/actin 0 Figure 5 Western blotting of Seladin-1 in adrenal zona glomerulosa and zona fasciculata from control (A and B) and ACTH-treated rats (C and D). Samples were obtained from experiments shown in Fig. 2. Analyses were performed on whole frozen sections as described in Materials and Methods. The cell lysates containing 15 mg proteins were subjected to western blotting using specific antibodies against Seladin-1 (1:1000) and actin (1:1000). Representative immunoblot of Seladin-1 expression in adrenal glands of control animals (A) and ACTH-treated rats (C). Seladin-1 was detected at approximately 77 kDa and actin at 43 kDa. Densitometric quantification of Seladin-1 expression in control animals (B) and in ACTH-treated animals (D). Results are expressed as meansGS.E.M.(nZ3). Statistical significance when compared with respective control conditions: *P!0.05.

Localization of Seladin-1 in primary cultures of glomerulosa and stimulated with Ang II, without any modification relative to fasciculata cells control conditions (data not shown). The Seladin-1 inhibitor, U18666A, which results in Since Seladin-1 has been described for its involvement in desmosterol accumulation, was used to better evaluate whether senescence (Wu et al. 2004), it appeared important to use D primary cell cultures rather than cell lines or transfected cell lines the 24-reductase activity of Seladin-1 is implicated in as a more appropriate tool to better understand its role in ACTH-induced relocalization into specific nuclear regions. In cellular functions. Figure 7 illustrates the results from fasciculata cells pre-incubated with 75 nM U18666A, local- fasciculata cells, although glomerulosa cells also exhibited ization of Seladin-1 in control cells was not modified (Fig. 7E). similar labeling (data not shown). Control cells exhibited both cytoplasmic and nuclear labeling (Fig. 7A), and all the cells responded to ACTH treatment with a Seladin-1 relocalization Table 1 Expression of Seladin-1 mRNA in zona glomerulosa and in specific nuclear regions (Fig. 7B). To better delineate zona fasciculata in adrenal glands from control and ACTH-treated rats intracellular Seladin-1 localization, studies were focused on single cells. In control conditions, Seladin-1 labeling was ZF/ZG ratio ZG (fold increase) ZF (fold increase) localized within the cytoplasm and the nucleus (Fig. 7C). In the cytoplasm, labeling was associated with specific cellular Treatment Control 2.00 – – structures. Double immunofluorescence studies with the ACTH 1.91 WGA lectin revealed a colocalization of Seladin-1 with the ACTH/control rats – 2.13 2.03 Golgi apparatus as depicted by the overlapping yellow color in the merged images. In the nucleus, labeling was mostly Quantitative real-time PCR performed on in vivo rat adrenal gland zona diffused, except in certain particular foci (Fig. 7C). In ACTH- glomerulosa (ZG) and zona fasciculata (ZF) from control and ACTH-treated rats (8 IU/250 g body weight/day per 7 days). Glands were processed as treated cells, Seladin-1 remained localized to the Golgi, which described in Materials and Methods. The results indicate the fold difference was more condensed around the nuclei, as well as in the in Seladin-1 mRNA expression between zona fasciculata versus zona glomerulosa (ZF/ZG ratio) in control (nZ3) and ACTH-treated cells (nZ3) nucleus, concentrated into specific nuclear regions (Fig. 7D). and the fold increase of Seladin-1 mRNA expression in ACTH-treated versus Similar cultures were also performed on glomerulosa cells control rats in zona glomerulosa and zona fasciculata.

Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access Seladin-1 localization in rat adrenal glands . M-C BATTISTA and others 61

60 treated with or without ACTH alone or with U18666A (25 A and 75 nM), either for 2 h or 3 days. Results from Fig. 8 indicate that both 2-h and 3-day treatments with U18666A 50 † increased basal steroid output in glomerulosa and fasciculata cells, but decreased ACTH-induced aldosterone and corti- 40 costerone secretion. The inhibitory action of U18666A on ACTH-induced steroid secretion was more pronounced 30 however after 3 days than after acute 2-h treatment, and was more pronounced for aldosterone secretion in glomer- 20 * ulosa cells than for corticosterone secretion in fasciculata cells

% of Seladin-1 protein (63 versus 43% reduction respectively). These results suggest

in subcellular compartments that Seladin-1 is differentially implicated in basal and in 10 ACTH-induced steroid secretion. On the other hand, 3-day † treatment with U18666A did not modify active cell 0 proliferation observed in cultured cells (data not shown). cytosol nucleus membrane cytoskeleton Discussion Control ACTH This study characterizes for the first time the expression, B 60 distribution, intracellular localization, and dynamics of * Seladin-1 protein in adrenal glands and in primary cultures 50 of adrenocortical cells, in control and in ACTH-treated rats. The most notable findings of this study are that Seladin-1 (1) 40 is localized both in the cytoplasm and in the nucleus; (2) subcellular localization is regulated by ACTH; and (3) is differentially involved in basal and in ACTH-stimulated 30 steroid secretion. In virtually all studies, Seladin-1 has been studied at the 20 mRNA level in transfected or retroviral-transducted cells,

% of Seladin-1 protein under non-physiological stimulations (Greeve et al. 2000, Wu

in subcellular compartments 10 et al. 2004)orin vivo in normal and pathological conditions in * human (Sarkar et al. 2001, Fuller et al. 2005, Luciani et al. 0 2005). Herein, the antibody generated to conduct the present investigations revealed a single band with a molecular weight cytosol nucleus membrane cytoskeleton (MW) of 77 kDa band for Seladin-1 in the rat adrenal gland, Figure 6 Western blot analysis of Seladin-1 performed in brain, and cerebellum. This band was not detected when subcellular fractions of adrenocortical cells. Subcellular fraction- Seladin-1 antiserum was replaced by the pre-immune serum ation was performed from isolated zona glomerulosa cells (A) and at same dilution and exposure time or when the Seladin-1 zona fasciculata cells (B). Results are expressed as the percentage of antiserum was neutralized by the peptide raised against Seladin-1 protein expression within each subcellular fraction Seladin-1, indicating specificity of the antibody. A previous relative to total intracellular expression of Seladin-1 in control and ACTH-treated rats (8 IU/250 g body weight/day per 7 days). Results study had reported a Seladin-1 MWof 60 kDa in normal and are expressed as meansGS.E.M. of three different experiments. Alzheimer’s disease brain tissues from 62- to 92-year-old Statistical significance when compared with respective control patients (Greeve et al. 2000). The differences between these ! . † ! . conditions: *P 0 05; P 0 01. values may be related to differences in species (human versus rat) or age. However, we cannot rule out the presence of the However, in ACTH-stimulated cells, Seladin-1 was retained in 60 kDa Seladin-1 band in the rat brain and cerebellum since it the Golgi apparatus (Fig. 7F), indicating that pre-incubation could be masked by the strong non-specific 60 kDa band with U18666A abrogated the ACTH-induced relocalization of observed in those rat tissues with the pre-immune serum and Seladin-1 into specific nuclear regions. the Seladin-1 antiserum. This observation is strengthened by the fact that the intensity of 60 kDa band was reduced by the Effect of Seladin-1 inhibitor (U18666A) on steroid secretion and antiserum neutralization assay. Since there is no stop codon proliferation before the putative initiation codon for the 60 kDa Seladin-1 transcripts (human, rat, and mouse), the putative 50- In order to investigate the possible involvement of Seladin-1 unstranslated Seladin-1 mRNA extremity may be a coding in steroid secretion, glomerulosa and fasciculata cells were sequence for the actual amino-terminal end of Seladin-1. www.endocrinology-journals.org Journal of Endocrinology (2007) 192, 53–66

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access 62 M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands

Control ACTH

A B Lower magnification

Seladin-1Golgi apparatus Merge

C Control

D ACTH

E U18666A

F U18666A+ACTH

Figure 7 Immunofluorescence detection of Seladin-1 in 3-day zona fasciculata cultured cells. Impact of ACTH and U18666A (Seladin-1 inhibitor). The cells were cultured for 3-days in the absence (control, A, C) or in the presence of ACTH (10 nM) (B and D) and in the presence of 75 nM U18666A alone (E) or in combination with ACTH (F). After formaldehyde fixation and permeabilization with 0.1% Triton X-100, the cells were processed for immunofluorescence detection of Seladin-1 (1:1000) coupled to Alexa-488 (1:500, green), Golgi apparatus by the use of wheat germ agglutinin (WGA) lectin coupled to Alexa-594 (1:500, red) and nucleus (DAPI, blue). The resulting yellow color in merged images indicates colocalization of Seladin-1 with the WGA (Golgi apparatus) while the resulting light blue color indicates colocalization of Seladin-1 with DAPI (nucleus). All images were acquired with a !100 objective. Scale bars, 5.6 mm (magnification: !3500 for C, D and !4500 for E, F).

Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access Seladin-1 localization in rat adrenal glands . M-C BATTISTA and others 63

2 h stimulation 3-days stimulation B A 20 20

15 15

‡ 10 § 10 § § Aldosterone Aldosterone 5 5 † † †

* (Fold increase over control) (Fold increase over control) 0 0 none 25 nM 75 nM none 25 nm 75 nm U18666A U18666A Control ACTH

2 h stimulation D 3-days stimulation C 20 20

15 15

‡ 10 ‡ 10 Corticosterone Corticosterone 5 5 † (Fold increase over control) (Fold increase over control) * 0 0 none 25 nM 75 nM none 25 nM 75 nM U18666A U18666A Figure 8 Impact of Seladin-1 inhibitor, U18666A, on steroid secretion by zona glomerulosa cells (aldosterone) (A and B) and zona fasciculata cells (corticosterone) (C and D) cultured for 3 days. Steroids were measured by RIA as described in Materials and Methods. Secretion was measured after stimulation for 2 h (A and C) or after 3-day treatment (B and D) with ACTH (10 nM) or in the absence or in the presence of 25 and 75 nM U18666A. Results are expressed as meansGS.E.M.(nZ4). Statistical significance when compared with respective control conditions: *P!0.05; †P!0.01, comparison between control U18666A groups of cells; ‡P!0.05; §P!0.01, comparison between ACTH-treated cells.

There are currently a number of Seladin-1 mRNA sequences presence is more important for adrenocortical than for adrenal and predictive sequences that are now associated with a medullar functions. Seladin-1 protein larger than 60 kDa. For example, two In control glomerulosa cells, Seladin-1 was mostly recent predictive rat Seladin-1 sequences were shown to have expressed in the membrane and nuclear fractions. Upon a calculated MW of 86 kDa, hence clearly over 60 kDa. ACTH-treatment, the protein was greatly reduced in the At both the mRNA and the protein levels, Seladin-1 was cytosolic and membrane compartments, while conversely observed to be more abundant in the zona fasciculata of increasing in the cytoskeletal fraction. In fasciculata cells, the control and ACTH-treated animals. This result is in protein was localized mainly in nuclear, cytoskeletal, and agreement with previous studies conducted on human membrane fractions. ACTH treatment reduced expression in adrenal gland and human fasciculata cells in culture, at the the cytoplasm, with a concomitant relocalization into the mRNA level (Sarkar et al. 2001, Luciani et al. 2004). nuclear fraction. These results suggest that the nuclear Moreover, the present results indicate that Seladin-1 is Seladin-1 function is more important in fasciculata than in localized both in the cytoplasm and in the nucleus, with a glomerulosa cells. Through the use of WGA lectin as a marker differential gradient of expression from the outer to the inner of the Golgi apparatus, immunofluorescence studies demon- portion of the gland. Our hypothesis is that Seladin-1 strate that, in the cytoplasm, the protein was mainly associated localization is ubiquitous in the adrenal gland and that its with the Golgi apparatus. Such localization has also been www.endocrinology-journals.org Journal of Endocrinology (2007) 192, 53–66

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access 64 M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands

reported by Greeve et al. (2000) where, in a transfected Indeed, Ang II stimulates aldosterone secretion by 2- to human neuroglioma H4 cell line, Seladin-1–enhanced green 5-fold, compared with the 30- to 60-fold increase observed fluorescent protein was localized in the endoplasmic with ACTH (Gallo-Payet & Payet 1989, Campbell et al. reticulum and to the Golgi complex. Localization of 2003). Seladin-1 in Golgi may be correlated with a role in The role of Seladin-1 in steroid secretion was assessed steroidogenesis since it is well known that in adrenocortical herein through the use of U18666A. At low concentrations cells, the Golgi apparatus plays important functional and (nM–mM), U18666A is a high-affinity binding inhibitor of regulatory roles in corticosterone synthesis and that ACTH the D24-reductase activity of Seladin-1, resulting in stimulation often leads to Golgi hypertrophy (Magalhaes et al. desmosterol accumulation (Bae & Paik 1997, Fliesler et al. 1991, Cheng & Kowal 1997). These data may explain why a 2000, Cenedella et al. 2004). In the present study, U18666A modification in Golgi structure is observed in cells stimulated was used at concentrations ranging from 25 to 75 nM with ACTH in the present model. This may suggest that the because, at this concentration, it does not induce adrenal cell Seladin-1 localization to the Golgi apparatus is important for toxicity and has little impact on cholesterol trafficking (Feng steroid secretion. et al. 2003). Our results indicate that U18666A increases basal Furthermore, when glomerulosa and fasciculata cells in steroid secretion, but decreases ACTH-responsiveness for culture are stimulated with ACTH, there is a relocalization of both aldosterone and corticosterone. The observation that Seladin-1 in specific nuclear regions. Wu et al. (2004) have U18666A effects on basal- and on ACTH-stimulated cells are recently described a massive translocation of Seladin-1 from more pronounced on aldosterone production than on the cytoplasm to the nucleus in Seladin-1-transfected corticosterone production may stem from a lower expression fibroblasts, in cells exposed to 0.5mMH2O2. The authors level of Seladin-1 in zona glomerulosa cells, resulting in less attributed a major role of Seladin-1 in the cellular response to residual functional Seladin-1 following U18666A treatment. oxidative stress, due to its ability to bind both the tumor Stimulation of basal secretion by this inhibitor may be due suppressor p53 and the E3-ubiquitin-ligase Mdm2 and to to desmosterol accumulation produced by U18666A-induced displace Mdm2 from p53, thus protecting p53 from Mdm2- Seladin-1 inhibition. Desmosterol is a better substrate than induced degradation and enabling p53 accumulation (Wu cholesterol for steroidogenesis. It is more efficiently esterified et al. 2004). It is well established that intense steroidogenesis in than cholesterol, an essential step in sterol transport (Nordby zona fasciculata leads to oxidative stress due to the occurrence & Norum 1975), and is fourfold more efficient as a substrate of lipid peroxidation and the production of reactive oxygen for the side chain cleavage reaction that produces precursors species and toxic derivatives, such as isocaproaldehyde for steroidogenesis (Arthur et al. 1976, Mason et al. 1978). (Hornsby & Crivello 1983, Lefrancois-Martinez et al. However, desmosterol has also been recently identified as a 1999). This may explain the important quantity of major negative regulator of cholesterol metabolism, being a endogenous anti-oxidant compounds (vitamin E, strong inhibitor of sterol-regulatory element-binding protein b-carotene, and vitamin C; Hornsby & Crivello 1983) and 2 processing and a strong repressor of hydroxy-methyl- the presence of enzymes implicated in the endogenous glutaryl-coenzymeA (HMG-CoA) reductase and low-density detoxification of steroidogenesis by-products (Martinez et al. lipoprotein receptor expression (Yang et al. 2006). Therefore, 2001) in the adrenal gland. Since Seladin-1 is an oxido- by controlling desmosterol levels, the D24-reductase activity reductase enzyme (Mushegian & Koonin 1995), and in of Seladin-1 may play a major and dual role in regulating agreement with the results of Wu et al. (2004), the present cholesterol uptake and biosynthesis, thereby modulating results of a prominent Seladin-1 accumulation in specific steroidogenesis. From these observations, low desmosterol nuclear regions may thus reflect an ACTH-induced concentrations may have positive effects on steroidogenesis, as regulation of Seladin-1 association with nuclear partners, a better substrate than cholesterol, which may explain the such as p53 and Mdm2. The ACTH-induced Seladin-1 observed U18666A-induced increase in basal secretion. relocalization into specific nuclear regions is inhibited by However, in ACTH-treated cells, the U18666A-induced U18666A suggesting an implication of the D24-reductase desmosterol accumulation may impair the larger ACTH- activity of Seladin-1. This hypothesis is supported by the induced increase in steroidogenic machinery. Seladin-1 may observation that ACTH has a protective effect against therefore act as a negative regulator of basal steroidogenesis oxidative stress (Pomeraniec et al. 2004). Together, the when localized in the Golgi. Conversely, ACTH actions on observation that ACTH induces relocalization in specific Seladin-1 expression and subcellular localization may have intranuclear compartments raises the hypothesis that Seladin- two complementary effects: the first being the removal of the 1 may play a major role in protecting adrenocortical cells inhibition of secretion in the cytoplasm, whereas the second against negative side effects due to intense steroidogenesis, action would be associated with protection against ACTH- either as a new major participant in the p53-Mdm2 interplay induced oxidative stress. and/or through its own oxidoreductase activity. Such nuclear Seladin-1 expression has also been reported to be altered in relocalization was not observed with Ang II treatment in adrenocortical adenomas and carcinomas, being overex- glomerulosa cells, further supporting the notion that nuclear pressed or repressed depending on tumor type (Sarkar et al. relocalization is associated with intense steroidogenesis. 2001, Luciani et al. 2004). However, Seladin-1 is also

Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access Seladin-1 localization in rat adrenal glands . M-C BATTISTA and others 65 abundantly expressed in mesenchymal stem cells (Benvenuti et Campbell S, Otis M, Coˆte´ M, Gallo-Payet N & Payet M 2003 Connection al. 2006). On the other hand, U18666A induces apoptosis in between integrins and cell activation in rat adrenal glomerulosa cells. A role for RGD peptide in the activation of the p42/p44MAPK pathway and of cortical neurons in primary cultures (Koh & Cheung 2006). intracellular calcium. Endocrinology 144 486–495. These observations suggest that Seladin-1 is involved in the Cenedella RJ, Jacob R, Borchman D,TangD,Neely AR, Samadi A, Mason RP balance between proliferation and apoptosis. However, such a & Sexton P 2004 Direct perturbation of lens membrane structure may role was not observed in glomerulosa cell cultures, since contribute to cataracts caused by U18666A, an oxidosqualene cyclase U18666A treatment had no effect on the high level of inhibitor. Journal of Lipid Research 45 1232–1241. Cheng B & Kowal J 1997 Role of the Golgi complex in adrenocortical proliferation. steroidogenesis. Microscopy Research and Technique 36 503–509. In summary, the results obtained in the present study are Feng B, Yao PM, Li Y, Devlin CM, Zhang D, Harding HP, Sweeney M, the first to assess Seladin-1 expression and distribution in the Rong JX, Kuriakose G, Fisher EA et al. 2003 The endoplasmic reticulum is adrenal gland in vivo and in the rat primary cultures of the site of cholesterol-induced cytotoxicity in macrophages. Nature Cell adrenocortical cells. Using a multi-faceted approach, the Biology 5 781–792. Fliesler SJ, Richards MJ, Miller C, Peachey NS & Cenedella RJ 2000 Retinal study demonstrates that the protein expression of Seladin-1 is structure and function in an animal model that replicates the biochemical more abundant in fasciculata cells than in glomerulosa cells hallmarks of desmosterolosis. Neurochemical Research 25 685–694. and that ACTH treatment increases both expression and Fuller P, Alexiadis M, Jobling T & McNeilage J 2005 Seladin-1/DHCR24 nuclear localization of Seladin-1. Taken together, the results expression in normal ovary, ovarian epithelial and granulosa tumours. Clinical Endocrinology 63 111–115. obtained herein, combined with previous data, suggest that Fumagalli R & Paoletti R 1963 The identification and significance of depending on its cellular localization, Seladin-1 plays a major desmosterol in the developing human and animal brain. Life Sciences 5 role in steroid secretion in the adrenal gland. It is proposed 291–295. that the D24-reductase activity of Seladin-1 may be engaged Gallo-Payet N & Payet MD 1989 Excitation–secretion coupling: involvement in maintaining low levels of steroidogenesis. ACTH treatment of potassium channels in ACTH-stimulated rat adrenocortical cells. Journal of Endocrinology 120 409–421. induces a relocalization of Seladin-1 into the nucleus, thus Gallo-Payet N & Payet MD 2003 Mechanism of action of ACTH: beyond facilitating ACTH-induced stimulation of steroidogenesis in cAMP. Microscopy Research and Technique 61 275–287. the cytoplasm. Concomitantly, Seladin-1, in the nucleus, Greeve I, Hermans-Borgmeyer I, Brellinger C, Kasper D, Gomez-Isla T, could be involved (through possible association with p53 and Behl C, Levkau B & Nitsch RM 2000 The human DIMINUTO/ DWARF1 homolog seladin-1 confers resistance to Alzheimer’s disease- Mdm2 as partners), in protection against ACTH-induced associated neurodegeneration and oxidative stress. Journal of Neuroscience 20 oxidative stress, an undesirable consequence of intense 7345–7352. steroidogenesis. Hornsby P & Crivello J 1983 The role of lipid peroxidation and biological antioxidants in the function of the adrenal cortex. Part 2. Molecular and Cellular Endocrinology 30 123–147. Hu RM, Han ZG, Song HD,Peng YD,HuangQH, Ren SX, GuYJ, Huang CH, Acknowledgements Li YB, Jiang CL et al. 2000 Gene expression profiling in the human hypothalamus–pituitary–adrenal axis and full-length cDNA cloning. PNAS 97 The authors thank Lucie Chouinard for her invaluable 9543–9548. experimental assistance and stimulating discussions. This Klahre U, Noguchi T, Fujioka S, Takatsuto S, Yokota T, Nomura T, Yoshida S & Chua NH 1998 The Arabidopsis DIMINUTO/DWARF1 gene encodes work was supported by grants from the Fondation pour la a protein involved in steroid synthesis. Plant Cell 10 1677–1690. Recherche sur les Maladies Infantiles and the Canadian Koh CH & Cheung NS 2006 Cellular mechanism of U18666A-mediated Research Chair Program to. N G-P is also a recipient of a apoptosis in cultured murine cortical neurons: bridging Niemann-Pick Canada Research Chair in Endocrinology of the Adrenal disease type C and Alzheimer’s disease. Cellular Signalling 18 1844–1853. Gland. The authors declare that there is no conflict of interest Kovacs WJ, Schrader M, Walter I & Stangl H 2004 The hypolipidemic compound cetaben induces changes in Golgi morphology and vesicle that would prejudice the impartiality of this scientific work. movement. Histochemistry and Cell Biology 122 95–109. Lefrancois-Martinez AM, Tournaire C, Martinez A, Berger M, Daoudal S, Tritsch D, Veyssiere G & Jean C 1999 Product of side-chain cleavage of References cholesterol, isocaproaldehyde, is an endogenous specific substrate of mouse vas deferens protein, an aldose reductase-like protein in adrenocortical cells. Abdolzade-Bavil A, Hayes S, Goretzki L, Kroger M, Anders J & Hendriks R Journal of Biological Chemistry 274 32875–32880. 2004 Convenient and versatile subcellular extraction procedure, that Luciani P, Ferruzzi P, Arnaldi G, Crescioli C, Benvenuti S, Nesi G, Valeri A, facilitates classical protein expression profiling and functional protein Greeve I, Serio M, Mannelli M et al. 2004 Expression of the novel analysis. Proteomics 4 1397–1405. adrenocorticotropin-responsive gene selective Alzheimer’s disease Arthur JR, Blair HA, Boyd GS, Mason JI & Suckling KE 1976 Oxidation of indicator-1 in the normal adrenal cortex and in adrenocortical adenomas cholesterol and cholesterol analogues by mitochondrial preparations of and carcinomas. Journal of Clinical Endocrinology and Metabolism 89 steroid-hormone-producing tissue. Biochemical Journal 158 47–51. 1332–1339. Bae SH & Paik YK 1997 Cholesterol biosynthesis from lanosterol: Luciani P,Gelmini S, Ferrante E, Lania A, Benvenuti S, Baglioni S, Mantovani G, development of a novel assay method and characterization of rat liver Cellai I, Ammannati F,Spada A et al. 2005 Expression of the antiapoptotic gene microsomal lanosterol delta 24-reductase. Biochemical Journal 326 609–616. seladin-1 and octreotide-induced apoptosis in growth hormone-secreting and Benvenuti S, Saccardi R, Luciani P, Urbani S, Deledda C, Cellai I, Francini F, nonfunctioning pituitary adenomas. Journal of Clinical Endocrinology and Squecco R, Rosati F, Danza G et al. 2006 Neuronal differentiation of Metabolism 90 6156–6161. human mesenchymal stem cells: changes in the expression of the Magalhaes M, Serra T, Pinto P & Magalhaes M 1991 The effects of monensin Alzheimer’s disease-related gene seladin-1. Experimental Cell Research 312 on Golgi complex of adrenal cortex and steroidogenesis. Tissue and Cell 23 2592–2604. 209–215. www.endocrinology-journals.org Journal of Endocrinology (2007) 192, 53–66

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access 66 M-C BATTISTA and others . Seladin-1 localization in rat adrenal glands

Martinez A, Aigueperse C, Val P, Dussault M, Tournaire C, Berger M, Singh LP, Green K, Alexander M, Bassly S & Crook ED 2004 Hexosamines Veyssiere G, Jean C & Lefrancois Martinez A 2001 Physiological functions and TGF-beta1 use similar signaling pathways to mediate matrix protein and hormonal regulation of mouse vas deferens protein (AKR1B7) in synthesis in mesangial cells. American Journal of Physiology. Renal Physiology steroidogenic tissues. Chemico-Biological Interactions 130–132 903–917. 286 F409–F416. Mason JI, Arthur JR & Boyd GS 1978 Control of sterol metabolism in rat Takahashi T, Gasch A, Nishizawa N & Chua NH 1995 The DIMINUTO adrenal mitochondria. Biochemical Journal 174 1045–1051. gene of Arabidopsis is involved in regulating cell elongation. Genes and Mushegian A & Koonin E 1995 A putative FAD-binding domain in a distinct Development 9 97–107. group of oxidases including a protein involved in plant development. Protein Vinson GP 2003 Adrenocortical zonation and ACTH. Microscopy Research and Science 4 1243–1244. Technique 61 227–239. Nordby G & Norum KR 1975 Substrate specificity of lecithin:cholesterol Vinson GP 2004 Glomerulosa function and aldosterone synthesis in the rat. acyltransferase. Esterification of desmosterol, b-sitosterol, and cholecalci- Molecular and Cellular Endocrinology 217 59–65. ferol in human plasma. Scandinavian Journal of Clinical and Laboratory Waterham HR, Koster J, Romeijn GJ, Hennekam RC, Vreken P,Andersson HC, Investigation 35 677–682. FitzPatrick DR, Kelley RI & Wanders RJ 2001 Mutations in the 3beta- Otis M, Campbell S, Payet MD & Gallo-Payet N 2005 Angiotensin II hydroxysterol Delta24-reductase gene cause desmosterolosis, an autosomal stimulates protein synthesis and inhibits proliferation in primary cultures of recessive disorder of cholesterol biosynthesis. American Journal of Human Genetics rat adrenal glomerulosa cells. Endocrinology 146 633–642. 69 685–694. Pomeraniec Y, Grion N, Gadda L, Pannunzio V, Podesta EJ & Cymeryng CB Wolkersdorfer G & Bornstein S 1998 Tissue remodelling in the adrenal gland. 2004 Adrenocorticotropin induces heme oxygenase-1 expression in adrenal Biochemical Pharmacology 56 163–171. cells. Journal of Endocrinology 180 113–124. Wu C, Miloslavskaya I, Demontis S, Maestro R & Galaktionov K 2004 Rainey WE 1999 Adrenal zonation: clues from 11beta-hydroxylase and Regulation of cellular response to oncogenic and oxidative stress by aldosterone synthase. Molecular and Cellular Endocrinology 151 151–160. Seladin-1. Nature 432 640–645. Rainey WE, Carr BR, Wang ZN & Parker CR Jr 2001 Gene profiling of Yang C, McDonald JG, Patel A, Zhang Y,Umetani M, Xu F,Mangelsdorf DJ, human fetal and adult adrenals. Journal of Endocrinology 171 209–215. Westover EJ, Covey DF, Cohen JC et al. 2006 Sterol intermediates from Rainey WE, Parker CR Jr, Rehman K & Carr BR 2002 The adrenalgenetic cholesterol biosynthetic pathway as LXR ligands. Journal of Biological puzzle: how do the fetal and adult pieces differ? Endocrine Research 28 611–622. Salzmann C, Otis M, Long H, Roberge C, Gallo-Payet N & Walker CD 2004 Chemistry 281 27816–27826. Inhibition of steroidogenic response to adrenocorticotropin by leptin: Zhang L & Insel PA 2004 The pro-apoptotic protein Bim is a convergence implications for the adrenal response to maternal separation in neonatal rats. point for cAMP/protein kinase A- and glucocorticoid-promoted apoptosis Endocrinology 145 1810–1822. of lymphoid cells. Journal of Biological Chemistry 279 20858–20865. Sarkar D, Imai T, Kambe F, Shibata A, Ohmori S, Siddiq A, Hayasaka S, Funahashi H & Seo H 2001 The human homolog of Diminuto/Dwarf1 gene (hDiminuto): a novel ACTH-responsive gene overexpressed in benign cortisol-producing adrenocortical adenomas. Journal of Clinical Endocrinology Received in final form 17 October 2006 and Metabolism 86 5130–5137. Sewer M & Waterman M 2003 ACTH modulation of transcription factors Accepted 20 October 2006 responsible for steroid hydroxylase gene expression in the adrenal cortex. Made available online as an Accepted Preprint Microscopy Research and Technique 61 300–307. 30 October 2006

Journal of Endocrinology (2007) 192, 53–66 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/24/2021 01:33:00PM via free access