Functional Consequences of Complete Gsk-3 Ablation in Mouse Embryonic Fibroblasts

FUNCTIONAL CONSEQUENCES OF COMPLETE GSK-3 ABLATION IN MOUSE EMBRYONIC FIBROBLASTS

Ioana M Miron

A thesis submitted in conformity with the requirements for the degree of Master of Science, Graduate Department of Medical Biophysics in the University of Toronto

©Copyright by Ioana M Miron 2008

Abstract

Functional consequences of complete GSK-3 ablation in mouse embryonic fibroblasts

Master of Science, 2008. Ioana M. Miron, Department of Medical Biophysics, University of Toronto

Glycogen Synthase Kinase-3 (GSK-3) is a highly conserved serine/threonine kinase comprised of two mammalian homologues, GSK-3α and β, encoded by independent genes. This thesis reports the characterization of GSK-3-null primary mouse embryonic fibroblasts (MEFs) generated by gene targeting to gain insight into the physiological functions of this protein kinase. Combined inactivation of both alleles of GSK-3α and GSK-β led to elevated sensitivity to TNFα-induced apoptosis, altered organization of focal adhesion complexes, defects in cell spreading on fibronectin, decreased cell growth associated with altered cell cycle progression through the G2/M phase and increased spontaneous apoptosis. Future work will focus on unraveling the molecular mechanisms responsible for these effects and identifying the common and distinct cellular roles for GSK-3α and β, and specific variants of these isoforms.

Table of Contents

Abstract ______ii Table of Contents ______iii List of Tables______vi List of Figures ______vii Abbreviations ______viii

Chapter 1: Introduction______1 1.1 Therapeutic Potential of Protein Kinases ______2 1.2 Glycogen Synthase Kinase-3 Isoforms______2 1.3 GSK-3 Substrates ______4 1.4 Regulation of GSK-3 ______6 1.5 Role of GSK-3 in Cellular Functions ______9 1.5.1 Cell Cycle Progression ______9 1.5.2 Intrinsic and Extrinsic Apoptosis______11 1.5.3 Cellular Architecture and Motility______14 1.5.4 Mitogen-Activated Protein Kinase (MAPK) Signaling______16 1.6 GSK-3 and Disease______17 1.8 Rationale and Thesis Objective ______19

Chapter 2: Materials and Methods______21 2.1 Cell Culture______22 2.2 Adenovirus Production ______22 2.3 Generation of Embryos Harbouring Conditional Alleles of GSK-3α and β ______22 2.4 Isolation of Embryonic Fibroblasts from GSK-3 αFL/FL/βFL/FL Mice ______23 2.5 Preparation of Lysates and Cytosolic β-Catenin Isolation ______24 2.6 TCF-Reporter Assay______24 2.7 Immunoblotting ______25 2.8 Immunofluorescence______25 2.9 Microarray Analysis of GSK-3 Knockout MEFs ______26 2.10 Alamar Blue Proliferation Assay ______27 2.11 Senescence Associated β-Galactosidase Staining ______27 2.12 Cell Cycle Analysis and BrdU Incorporation______27 2.13 Annexin V Assay ______28

iii

2.14 Time-Lapse Microscopy______28 2.15 Adhesion Assay ______29 2.16 Cell Spreading Assay ______29 2.17 Cell Migration Assay ______30 2.18 Rho Activity Assay______30 2.19 MAPK Activation______31 2.20 Statistical Analysis ______31

Chapter 3: Results ______32 3.1 Generation of GSK-3 Conditional Mouse Embryonic Fibroblasts______32 3.2 Microarray Analysis ______36 3.3 Effect of GSK-3 Deficiency on Cell Proliferation ______36 3.4 Cell Cycle Regulation in GSK-3 Depleted Cells ______36 3.5 Effect of GSK-3 Depletion on Apoptosis______38 3.6 TNF sensitivity in GSK-3 Deficient Cells ______40 3.7 Cellular Morphology and Focal Adhesion Formation in the Absence of GSK-3 ______43 3.8 The Role of GSK-3 in Cell Adhesion, Spreading and Migration______47 3.9 Effect of Loss of GSK-3 on MAPK signaling ______51

Chapter 4: Discussion and Future Directions ______54 4.1 Summary______55 4.2 Proliferation ______56 4.3 Cell Cycle Progression ______57 4.4 Stimuli-Induced Apoptosis______58 4.5 Actin Organization and Focal Adhesion assembly______58 4.6 MAPK Signaling ______61 4.7 Adipocyte Differentiation______62 4.8 GSK-3 Isoforms and Mutants______62

References ______65

Appendix: Identification of Novel GSK-3 Substrates ______82 A.1 Introduction ______83 A.2 Materials and Methods ______85

A.2.1 Immunoprecipitation of BCLAF1 ______85 A.2.2 In-gel Enzymatic Cleavage and Extraction of Peptides ______86 A.2.3 Quantification of BCLAF1 Phosphorylation ______86 A.3 Results ______87 A.4 Discussion ______90 A.4 References ______91

List of Tables

Table 1.1: Putative GSK-3 substrates______5

Table 4.1 List of GSK-3α and β variants ______64

Table A.1: Predicted GSK-3 phosphorylation sites on BCLAF1 identified using NetworKin.__84

List of Figures

Figure 1.1: A schematic representation of the mammalian GSK-3 isoforms, α and β. ______3

Figure 1.2: Schematic representation of the Wnt signaling pathway. ______8

Figure 3.1: Treatment of GSK-3 α(FL/FL) / β(FL/FL) MEFs with AdCre results in compound knockouts of GSK-3α and β, stabilization of β-catenin and β-catenin/TCF-transactivation activity. ______35

Figure 3.2: Functional analysis of microarray data. ______37

Figure 3.3: GSK-3 is critical for primary MEF proliferation. ______37

Figure 3.4: Role of GSK-3 in cell cycle regulation in MEFs. ______39

Figure 3.5: GSK-3 deletion induces spontaneous apoptosis. ______41

Figure 3.6: Enhanced TNFα-induced apoptosis in GSK-3 deficient MEFs. ______42

Figure 3.7: Morphology of GSK-3 DKO MEFs in regular culture conditions. ______44

Figure 3.8: F-actin distribution and focal complex assembly in GSK-3-null cells in normal culture conditions. ______45

Figure 3.9: Normal Rho activity in GSK-3 DKO MEFs after LPA stimulation. ______46

Figure 3.10: Deletion of GSK-3 does not cause defective cell adhesion. ______48

Figure 3.11: GSK-3-null MEFs exhibit abnormal spreading on fibronectin.______50

Figure 3.12: Migration of MEFs is not impeded by lack of GSK-3. ______52

Figure 3.13: Effects of loss of GSK-3 expression on ERK, JNK/SAPK and p38 MAPK activities.______53

Figure A.1: BCLAF1 phosphorylation sites identified using mass spectrometry.______88

Figure A.2: Quantitative measurement of GSK-3-dependent phosphorylation of BCLAF1. __ 89

vii

Abbreviations

7-AAD 7-amino-actinomycin D AdCre adenovirus encoding cre recombinase AdLacZ adenovirus expressing LacZ ADD1 adipocyte determination- and differentiation-dependent factor 1 AIP Aurora-A-interacting protein Ala alanine ANOVA analysis of variance APC adenomatous polyposis coli Apo apoptosis-inducing ligand ATP adenosine triphosphate BCLAF1 Bcl-2-associated transcription factor 1 BCL-2 B-cell lymphoma-2 BCL-3 B-cell lymphoma 3-encoded protein BrdU 5-bromo-2-deoxyuridine BSA bovine serum albumin BUB1 budding uninhibited by benzimidazole 1 βTrCP β-transducin repeat-containing protein CAMP cyclic adenosine monophosphate CDC cell division cycle CdGAP CDC42 GTPase-activating protein CDK cyclin–dependent protein kinase C/EBP CCAAT/enhancer-binding protein CENP-E centromere-associated protein E CK1 casein kinase 1 CLASP2 cytoplasmic linker associated protein 2 CRIB Cdc42 Rac interactive binding CRMP collapsin response mediator protein dH20 distilled water DKO double knockout DAPI 4,6-diamidino-2-phenylindole DISC death-inducing signaling complex Dvl dishevelled DMEM Dulbecco’s modified eagle medium DMSO dimethyl sulfoxide DNA deoxyribonucleic acid DR death receptor Dvl dishevelled DTT dithiothreitol E embryonic day EDTA ethylenediaminetetraacetic acid EGF epidermal growth factor eIF2B eukaryotic initiation factor 2B ER endoplasmic reticulum ERK extracellular signal-regulated kinase FACS flow cytometry analysis

viii

FADD fas-associated death domain FAK focal adhesion kinase FBS fetal bovine serum GAPDH glyceraldehyde-3-phosphate dehydrogenase G1 gap phase 1 of the cell cycle (interphase) G2 gap phase 2 of the cell cycle GAP GTPase-activating protein GSK-3 glycogen synthase kinase-3 GTP guanosine 5'-triphosphate HIPK3 homeodomain-interacting protein kinase-3 HSF-1 heat shock factor-1 I-κBα inhibitor kappa B alpha IKK I-κBα kinase IL interleukin K lysine KCl potassium chloride kDa kilodalton LacZ gene encoding β-galactosidase LCK lymphocyte-specific protein-tyrosine kinase LoxP locus of crossover in P1 LiCl lithium chloride LPA lysophosphatidic acid LRP5/6 low-density lipoprotein receptor-related protein 5/6 M mitotic phase of the cell cycle MAPK mitogen-activated protein kinase MCL-1 myeloid cell leukemia sequence 1 MDM2 murine double min-2 MgCl2 magnesium chloride MEF mouse embryonic fibroblast MNK MAPK-interacting kinase MPM2 mitotic protein monoclonal 2 MRM multiple reaction monitoring MS/MS tandem mass spectrometry MTOC microtubule organising centre NaCl sodium chloride Nek2 NIMA-related kinase 2 NF-κB Nuclear Factor-κB NH4HCO3 ammonium hydrogen carbonate NIMA never in mitosis NP-40 Nonidet P-40 PAK1 (p21)-activated kinase p90Rsk 90 kDa ribosomal S6 kinase PAK p21-activated protein kinase PBS phosphate-buffered saline PBD p21-binding domain PCR polymerase chain reaction PI3K phosphatididylinositol 3-kinase PKB protein kinase B

PKC protein kinase C PMA phorbol 12-myristate 13-acetate PI propidium iodide PINCH2 particularly interesting new cysteine-histidine rich protein PLK1 polo-like kinase 1 PPAR peroxisome proliferators-activated receptor PE phycoerythrin PS phosphatidylserine RNAi interfering ribonucleic acid R arginine Rpm revolutions per minute RT room temperature S serine S-phase synthesis phase of the cell cycle SAPK stress-activated protein kinase SA-β-Gal senescence-associated β-Galactosidase staining SAM significance analysis of microarray SD standard deviation SDS sodium dodecyl sulfate SDS-PAGE SDS-polyacrylamide gel electrophoresis SEM standard error of the mean Ser serine SMAD a composite term derived from Sma genes from Caenorhabditis elegans and Mad gene (Drosophila melanogaster) SmMLCK smooth muscle myosin light chain kinase TBS tris-buffered saline TCF T-cell factor TCID50 tissue culture infectious dose50 TGF transforming growth factor TIMAP TGF-β1 inhibited, membrane-associated protein TNF tumor necrosis factor TRAIL tumor necrosis factor-related apoptosis-inducing ligand Tyr tyrosine vHL Von Hippel-Lindau WT wildtype X-gal 5-bromo-4-chloro-3-indolyl-ß-D-galactoside Y tyrosine

Chapter 1: Introduction

1 2

1.1 Therapeutic Potential of Protein Kinases

Cell signalling is the process by which an external stimulus elicits a response by triggering a series of molecular events within a cell. Protein kinases are responsible for direct or indirect control of almost every signaling pathway in cells by catalyzing the transfer of the γ- phosphate group of ATP or GTP to the hydroxyl group of serine, threonine, or tyrosine, thus altering the function of the target protein. Protein phosphatases remove the phosphate group, reverting the target protein back to its original state. Cellular functions such as gene expression, differentiation, motility, cell adhesion, cell cycle progression and apoptosis are controlled by the highly regulated interplay of protein kinases and phosphatases. Aberrant protein kinase signalling is a hallmark of many human diseases, and much effort has been made to develop kinase inhibitors for therapeutic applications (reviewed in [1]). The current work focuses on improving our understanding of the consequences of inhibiting Glycogen Synthase Kinase-3

(GSK-3), a key regulator of many signalling pathways, for assessing its potential as a drug target and predicting possible side-effects.

1.2 Glycogen Synthase Kinase-3 Isoforms

GSK-3 is a highly conserved serine/threonine protein kinase that is encoded by two genes that yield two related proteins termed GSK-3α and β. Both isoforms are ubiquitously expressed although some cells vary in their relative proportions of the two proteins [2]. The two isoforms are highly homologous within their protein kinase domains (98% identical) but share only 36% identity in the last 76 C-terminal residues. GSK-3α (52 kDa) is 5 kDa larger than

GSK-3β (47 kDa) due to a glycine-rich extension at the N-terminus [3] (Figure 1.1).

Although structurally similar, the two isoforms do not appear to be entirely functionally identical. Knock-out of GSK-3β in mice causes mouse embryonic lethality due to TNF

Glycine- rich Kinase domain

GSK-3 α (52 kDa)

S21 Y279 GSK-3β (47 kDa) S9 Y216

Figure 1.1: A schematic representation of the mammalian GSK-3 isoforms, α and β. Inhibitory serine phosphorylation sites (S9 in GSK-3α and S21 in GSK-3β) and activating tyrosine phosphorylation sites (Y279 in GSK-3α and Y216 in GSK-3β) are indicated with arrowheads. The glycine rich region in GSK-3α and the kinase domain shared by both isoforms are highlighted in blue and red respectively.

4 hypersensitivity in the liver and patterning defects in the heart ([4], [Force et al., in preparation]). On the other hand, GSK-3α knockout mice are viable and fertile, suggesting that the phenotype observed in GSK-3β null mice is due to a failure in GSK-3α compensation for the lack of GSK-3β rather than the mere decrease in protein expression [5]. However, given that

GSK-3α and β have similar substrate specificities and virtually identical kinase domains, many functions of these two isoforms are probably shared. There has been a bias in literature for focusing on the GSK-3β isoform. However, small molecule inhibitors are unlikely to discriminate between the two isoforms and many functions attributed in the literature to GSK-3β are likely shared by GSK-3α [2].

1.3 GSK-3 Substrates

GSK-3 was first identified as an enzyme capable of phosphorylating glycogen synthase to inhibit glycogen synthesis [6], but it has subsequently been found to phosphorylate many other proteins, over 60 to date (Table 1.1). Most of these putative substrates remain to be fully characterized and established as physiological substrates of GSK-3 based on the criteria set out by Frame and Cohen [7]. However, the large number and diversity of substrates illustrates that

GSK-3 is likely implicated in many cellular processes. GSK-3 phosphorylation generally has inhibitory effects on its substrates, rendering GSK-3 as a suppressor in many signalling pathways.

Comparison of the identified GSK-3 phosphorylation sites on its target proteins does not reveal a strict consensus [8]. The enzyme tends to phosporylate serine/threonine residues in a proline-rich environment but does not display absolute dependence on this amino acid.

However, GSK-3 has an unusual preference to phosphorylate protein substrates that have been previously phosphorylated by another protein kinase at a “priming” residue located 4 residues

C- terminal to the site phosphorylated by GSK-3 [28]. The consensus sequence is Ser/Thr-X-X-

Putative Substrate Proposed Effects of Phosphorylation by GSK-3 References Adenomatous polyposis coli Increaed binding to β-catenin; decreased microtubule binding [9, 10] Amyloid precursor protein Increases cleavage by γ-secretase and production of Aβ peptide [11] Aurora-A-interacting protein Not reported [12] Axin Increases affinity for β-catenin and increased axin stability [13-15] ATP-cytrate lyase Inactivates enzyme [16, 17] Bicaudal-D Prevents binding to dynein [18] Cdc25A Targets for degradation [19] Cdc42 GTPase-activating protein Upregulates protein levels [20] Cyclin D1 Increases nuclear export; targets for degradation [21] Cyclin E Targets for degradation [22] Cytidine triphosphate synthetase Inhibits activity [23] Cubits interruptus Causes proteolytic cleavage [24] eIF-2B Inhibits activity [25, 26] Focal adhesion kinase Inhibits activity [27] Glycogen synthase Inhibits enzyme activity [28, 29] Heterogeneous nuclear ribonucleoprotein D Inhibits transactivation activity [30] Insulin receptor substrate 1 Inhibits insulin receptor signaling [31] Inhibitor-2 Activates phosphatase [32] Nucleoporin p62 Modulates nuclear pore; few details [33] Microtubule affinitiy regulating kinase 2 Inhibits enzyme activity [34] Mixed lineage kinase 3 Activates enzyme [35] Myeloid cell leukemia sequence 1 Targets for degradation [36] p21 Increases proteosomal degradation [37]

Metabolic and Signaling Proteins Signaling Proteins Metabolic and Presenilin-1 Increases degradation of C-terminal PS1 fragment [38] Protein phosphatase I Activates phosphatase [29, 39] Pyruvate dehydrogenase Inactivates enzyme [40] P27kip1 Increases protein stability [41] P190A RhoGAP Inhibits activity [42] Retinoblastoma-like 2 (p130) Increases protein stability [43] Tankyrase Not reported [44] TGF-beta1 inhibited, membrane associated protein Decreases binding to protein phosphatase 1 [45] Tuberous sclerosis 2 Not reported [46] Von Hippel-Lindau protein Decreased microtubule stability [47] Astrin Promotes spindle and kinetochore accumulation of astrin [48] Collapsin response mediator protein-2 and 4 Reduced microtubule binding of CRMP2; Enhanced axonal [49] elongation High molecular weight mucin-like glycoprotein (DF3/Muc) Decreased binding to β-catenin (junctional) [50] Dynamin-like protein Not reported [51] GCP5 Regulates protein localization [52] Low-density lipoprotein (LDL)-receptor-related protein 6 Activates receptor resulting in axin binding [53] Microtubule associated protein 1B Destabilizes microtubules [54, 55] Microtubule associated protein 2 Prevents microtubule bundling [56, 57] Neural cell-adhesion molecule Not reported [58] Ninein Not reported [59] Structural Proteins Proteins Structural Paxillin Not reported [60] Tau Reduced microtubule binding; decreased microtubule stability [61] Telokin / Kinase related protein Not reported [62] ADD1/SREBP1c Inhibits transcriptional activity [63] B-cell lymphoma 3-encoded protein Targets for degradation [64] β-catenin Targets for degradation [65] CAMP response element binding protein Increased transcription factor activity [66] CCAAT/enhancer-binding protein α and β Not reported for CEBPα; reduced activity of CEBPβ [67, 68] c-Jun Decreased DNA binding and transactivation [69] c-Myc Targets for degradation [70, 71] GATA4 Induces nuclear export [72] Glucocorticoid receptor Inhibits transcriptional activity [73] Heat Shock Factor-1 Inactivation transcription factor activity [74] Hypoxia inducible factor 1 Downregulates by reducing accumulation [75] Microphthalmia-associated transcription factor Increased binding to tyrosine promoter [76, 77] NeuroD (Xenopus) Inhibits transcription factor activity [78] Nuclear factor of activated T-cells Decreased DNA binding; increased nuclear export [79, 80] NF-κB (p65 and p105) Negatively regulates basal p65 activity; stabilizes p105 under [81, 82] resting conditions but destabilizes after TNFα treatment N-myc downstream regulated gene 1 Unreported [83] Transcription Factors Factors Transcription Notch Downregulates activity; destabilizes [84, 85] p53 Activates transcriptional activity [86] SMAD3 Targets for degradation [87] Snail Targets for degradation; regulates localization [88] Timeless Increases heterodimerization with clock gene called period or [89] increased nuclear transport v-maf musculoaponeurotic fibrosarcoma oncogene homolog Targets for degradation [90] A

Table 1.1: Putative GSK-3 substrates

X-Ser/Thr-P where the first Ser/Thr is the target residue, X is any amino acid, and the righthand- most (C-terminal) Ser-P/Thr-P is the priming phosphorylation site. Structural studies have revealed that the catalytic loop of the enzyme comprises three positively charged residues (R96,

R180 and K205) that together form a “positive binding pocket”, which facilitates efficient binding of the phosphorylated residue of the primed substrate [91, 92]. This optimizes the orientation of the kinase domains and places the substrate in the correct position within the catalytic groove.

1.4 Regulation of GSK-3

An unusual property of GSK-3 is that, unlike many protein kinases, it is active under resting conditions and its’ activity is acutely regulated by inactivation [2]. Stringent regulation of GSK-3 affects the ability of the kinase to differentially target its’ numerous substrates. The most well-defined regulatory mechanism is by phosphorylation of Ser9 in GSK3β and Ser21 in

GSK3α in response to external stimuli. The phosphatidylinositol 3-kinase (PI3K)/PKB signaling pathway is a major regulator of GSK-3 such that PKB phosphorylates and inactivates GSK-3 in response to insulin. Several other protein kinases can also phosphorylate these regulatory serine residues, including protein kinase C, protein kinase A, and p90Rsk among others [93, 94]. The crystal structure of GSK-3β suggests a mechanism for the inhibitory role of the serine phosporylation. The phosphorylated N-terminus of the enzyme serves as a pseudosubstrate that binds to the positively charged pocket, competing with primed substrates for binding to the catalytic groove [91, 92]. In contrast to the inhibitory effects of serine phosphorylation, direct phosphorylation of a tyrosine residue (Tyr216 for GSK-3β and Tyr279 for GSK-3α) located within the catalytic domain is associated with an increase in kinase activity, although it is not strictly required, and the mechanisms regulating this modification are not well understood [95,

96]. Additional mechanisms besides phosphorylation are also employed in regulation of GSK-3

- one of these is the control of subcellular localization. For example, GSK-3 is predominantly cytoplasmic during G1 phase of the cell cycle, but a significant fraction enters the nucleus during S phase, promoting its ability to phosphorylate cyclin D1 in the nucleus [21]. There also appears to be subcellular regulation of GSK-3 activity, such as in the nucleus and mitochondria of neuroblastoma SH-SY5Y cells where GSK-3 was found to be highly active [97]. Another mode of regulation is by tethering GSK-3 within protein complexes and the best characterized of these is the “canonical” Wnt signaling pathway. This pathway transduces signals from secreted glycoproteins, termed Wnts, which bind to receptor proteins (Frizzled and LRP5/6) on the exterior of a cell and propagate a signal to the nucleus, via a protein termed β-catenin, which modulates the cellular transcription program to affect growth, survival and differentiation [98].

The signal transduction pathway is limted by the availability of the transcriptional transducer β- catenin, the protein level of which is tightly controlled through proteosomal degradation (Figure

1.2). In resting cells, a fraction of GSK-3 (~3-6%) is found in a multiprotein complex that includes β-catenin, the scaffold protein Axin, and Adenomatous Polyposis Coli (APC) [99].

Phosphorylation of β-catenin by GSK-3 on residues Ser33, Ser37 and Thr41 takes place after a priming phosphorylation step by another protein kinase, CK1α, on Ser45 [65, 100, 101].

Phosphorylated β-catenin is subsequently recognized by the F-box protein βTrCP, a component of the E3 ubiquitin ligase complex, and is targeted for protesomal degradation [102]. The detailed mechanism(s) by which Wnts inhibit degradation of β-catenin following engagement of the Frizzled and LRP5/6 co-receptors remain partly unclear. The current mechanism stipulates that Disheveled is recruited to the Frizzled receptor, engaging the Axin-GSK-3 complex, thereby promoting sequential phosporylation of the LRP6 co-receptor on PPPSPxS motifs (P, proline; S, serine or threonine; x, any residue) by GSK-3 and CK1α. Phosphorylated PPPSPxS motifs recruit additional Axin–GSK3 complex to promote further PPPSPxS phosphorylation

Figure 1.2: Schematic representation of the Wnt signaling pathway. The left panel shows the pathway in the absence of Wnt ligands, where β-catenin is phosphorylated by CK1 and GSK-3 in the context of a destruction complex with APC and Axin, and is consequently targeted for ubiquitination and degraded. Upon ligand binding (right panel), Dishevelled recruits the Axin-GSK-3 complex, resulting in the sequential phosphorylation of LRP6 by CK1 and GSK-3. Phoshorylated LRP6 serves as a docking site for additional Axin-GSK-3 complex, resulting in the disassembly of the destruction complex. Stabilized β-catenin translocates to the nucleus where it activates transcription of target genes together with LEF/TCFs.

[53, 103, 104]. The association of the Axin-GSK-3 complex with phosphorylated LRP6 leads to the inactivation/dissolution of the destruction complex and hence to inhibition of β-catenin degradation. The stabilized β-catenin translocates to the nucleus, binds to the members of the

TCF/LEF transcription factor family and initiates transcription of Wnt target genes [98, 105].

1.5 Role of GSK-3 in Cellular Functions

1.5.1 Cell Cycle Progression

The cell cycle consists of four distinct phases: G1, S, G2 (collectively known as interphase) and M phase. Interphase begins as a cell enters a period of growth in which the biosynthetic activities occur at a high rate (G1 phase) before DNA replication occurs (S phase).

The M phase (mitosis) commences after a brief period in the G2 phase. The nuclear envelope breakdown signals the beginning of mitosis, and is closely followed by the subsequent stage, prophase (reviewed in [106]). During this stage, previously duplicated centrosomes travel in opposite directions, facing each other and forming the mitotic spindle. In the next stage, termed prometaphase, the highly dynamic microtubules emanating from the centrosomes probe space in all directions and their “plus-ends” are captured by kinetochores (protein complexes on the centromeres of sister chromatids). Once all the kinetochores have correctly attached to the mitotic spindle, the chromosomes align along the “metaphase” plate. Sister chromatids are then pulled towards the poles (anaphase I) followed by elongation of the spindle itself (anaphase II).

The chromatids begin to de-condense, the nuclear envelope re-forms and the mitotic spindle disassembles (telophase). During telophase the cell itself ends the process of cytokinesis in which the cell’s cytoplasm divides to form two genetically identical daughter cells. The proper order and correct execution of all these cell-cycle events are ensured by cell cycle checkpoints, three of which are well characterized (reviewed in [107]). These surveillance mechanisms

10 ensure that critical cell cycle events are completed before allowing subsequent cell cycle transitions to occur. For example, the 'DNA structure checkpoint' arrests cells at the G1/S or

G2/M transition in response to unreplicated DNA or DNA damage, and the 'spindle assembly checkpoint' prevents anaphase onset as long as chromosomal kinetochores do not show a correct bipolar attachment.

GSK-3 has an impact on the cell-cycle regulatory network by phosphorylating critical proteins involved in cell cycle progression. Several studies indicate GSK-3 triggers the proteolysis of certain proteins which promote the G1 to S transition of the cell cycle. For example, nuclear levels of GSK-3 are highest during S phase when this kinase phosphorylates nuclear cyclin D1, causing a redistribution of cyclin D1 from the cell nucleus to the cytoplasm and its subsequent proteolysis [21]. GSK-3 also phosphorylates and promotes proteolysis of

CDC25A, thereby negatively regulating entry of cells into S phase [19].

Loss-of-function studies in a number of systems have shown that cell division occurs in the absence of GSK-3 but the process is more prone to error and delay [108]. Evidence in eukaryotic cells suggests that GSK-3 regulation of microtubule dynamics is required during mitosis to orient and assemble spindle apparatus that accurately segregates chromosomes.

Phospho-GSK-3 (Ser9/Ser21) was specifically found to be restricted to centrosomes and spindle poles [109]. Presumably, this would allow centrosomes to become the dominant site of microtubule growth by stabilisation of microtubules in this area. Conversely, GSK-3 would remain active along the length of the spindle, de-stabilising microtubules further away from the poles, as microtubules undertake their highly dynamic search for chromosomes. GSK-3 inhibitors promote global microtubule stabilization generating defects in astral microtubule length and delaying chromosomal alignment during prometaphase [109, 110]. However,

11 anaphase is often initiated in the presence of unaligned chromosomes, suggesting an attenuation of the spindle checkpoint in GSK-3 treated cells [110].

The substrates phosphorylated by GSK-3 that lead to destabilisation of spindle microtubules during mitosis are still elusive. GSK-3 has been shown to negatively regulate microtubule stabilization through phosphorylation of microtubule-associated proteins APC and von Hippel-Lindau protein (vHL) [10, 47]. Another potential target is microtubule-associated protein CLASP2. GSK-3 decreases the accumulation of CLASP2 at the plus end of microtubules, again leading to their stabilisation [111]. It has been suggested that GSK-3 also controls the formation of proper mitotic spindles through a novel substrate named GCP5, a component of the γ-tubulin ring complex [52]. Inhibition of GSK-3 activity enhances the recruitment of the γ-tubulin complex to the spindle poles in mitotic cells, thereby leading to an increase in the microtubule nucleation activity. Most recently, Fumoto et al. [12] demonstrated that GSK-3 modulates the early mitotic Aurora-A kinase levels through binding and phosphorylating Aurora-A-interacting protein (AIP). A decrease of Aurora-A function upon

GSK-3 inhibition is another potential contributing factor to chromosome misalignment. Another interacting partner and candidate substrate for GSK-3 in spindle microtubule assembly is Astrin

[48]. Inhibition of GSK-3 impairs spindle and kinetochore accumulation of Astrin and spindle formation at mitosis.

1.5.2 Intrinsic and Extrinsic Apoptosis

The most established association between GSK-3 and apoptosis involves the role of

GSK-3 in promoting the intrinsic apoptosis signaling pathway. In this pathway, cellular stresses cause the activation of pro-apoptotic members of BCL-2 family, disrupting mitochondrial integrity and leading to activation of caspases, the central executioners of apoptosis (reviewed in

[112]). The involvement of GSK-3 in this pathway was first convincingly shown by

12 overexpression of GSK-3β in PC12 cells and Rat1 fibroblasts which was sufficient to cause apoptosis without additional toxic insults [113]. Later studies demonstrated that endogenous

GSK-3 does not alone induce apoptosis but greatly facilitates pro-apoptotic signaling activities in response to a range of stimuli including DNA damage [114], hypoxia [115], endoplasmic reticulum (ER) stress [116], platelet activating factor [117], and staurosporine [118].

Many GSK-3 substrates have been shown to be involved in apoptosis regulation indicating that GSK-3 has multiple actions that together serve to facilitate apoptosis. GSK-3 targets several proteins that regulate mitochondrial integrity including Bax, a pro-apoptotic

BCL-2 family member, promoting its localization to the mitochondria and subsequent apoptosis in cerebellar granule neurons [119]. Conversely, GSK-3 enhances the degradation of the anti- apoptotic Bcl-2 family member MCL-1 [36]. Furthermore, inhibition of protein synthesis through the phosphorylation and inhibition of eIF2B by GSK-3 has been shown to contribute to

GSK-3 induced apoptosis [120]. GSK-3 also elicits responses to cellular stresses by inhibiting the activation of many pro-survival transcription factors. For instance, GSK-3 has been found to directly phosphorylate p53 but can also promote p53 activity indirectly through the phosphorylation of the p53-regulating protein MDM2 [86, 121, 122]. Although many studies have shown that GSK-3 promotes p53 activity, the mechanisms involved are still obscure. GSK-

3 forms a complex with nuclear and mitochondrial p53, promotes p53-mediated transcription of specific genes, and regulates the intracellular localization of p53 [114, 121, 123, 124]. Another survival-promoting transcription factor phosphorylated by GSK-3 is heat shock factor-1 (HSF-

1) [74]. GSK-3 inhibits HSF-1 transcriptional activity, thereby reducing expression of heat shock proteins, an action that can facilitate apoptosis [125].

Conversely, GSK-3 appears to inhibit the death receptor-mediated extrinsic apoptotic signaling pathway. Death receptors belong to the tumor necrosis factor (TNF) receptor gene

13 superfaily and contain a homologous cytoplasmic sequence critical for transmitting apoptosis signals initiated by specific "death ligands" (reviewed in [126]). Some of the best characterized death receptors are Fas (also called CD95 or Apo1), DR4 (also called TRAIL-R1), and DR5

(also called TRAIL-R2, Apo2, TRICK2 or KILLER). Each receptor is stimulated by its own specific ligand and this causes recruitment of the adaptor molecule FADD and procaspase-8, which form the death-inducing signaling complex (DISC) where procaspase-8 is activated.

Caspase 8 activation directly mobilizes downstream caspases to trigger apoptosis, and may also involve the mitochondrial apoptotic program, depending on the cell type. The involvement of

GSK-3 in extrinsic apoptotic signaling was first identified with TNF-induced apoptosis in MEFs where complete loss of GSK-3β resulted in apoptosis due to a failure to activate the TNF/NF-

κB survival signaling pathway [4]. Inhibition of GSK-3 also potentiated TNFα-induced apoptosis in hepatocytes [127]. Subsequently, GSK-3 was found to be an anti-apoptotic regulator of many other apoptosis inducing members of the death receptor family. TRAIL- induced apoptosis is potentiated by GSK-3 inhibitors and by knockdown of the GSK-3β protein using RNAi in human prostate cancer cell lines [128]. Moreover, treatment of Jurkat cells and differentiated, immortalized hippocampal neurons with GSK-3 inhibitors increases apoptosis signaling induced by Fas-activation [129].

The site of action of GSK3β responsible for attenuating death receptor-induced apoptotic signaling remains controversial. Several studies reported that the inhibition of GSK-3 enhances the extrinsic apoptotic signaling pathway in the early stages of signaling, upstream of caspase-8 activation [127, 128]. However, the most evidence comes from studies that focused on the NF-

κB transcription factor. The connection was first established when TNFα failed to activate

NFκB-mediated gene transcription in MEFs lacking GSK-3β or using the GSK-3 inhibitor

Lithium chloride (LiCl) [130, 131]. Steinbrecher et al. [132] later confirmed these findings by

14 demonstrating that the modulatory effect of GSK-3 is promoter-selective so that GSK-3 promotes the transcription of only a subset of NF-κB-induced genes. Moreover, numerous reports have implicated GSK-3β in the control of various signaling pathways upstream of NF-

κB DNA binding, including regulation of p105 stability and IKK activity [82, 133, 134].

Overall, it is evident that GSK-3 regulates NF-κB signaling in a context- and cell type-specific manner.

1.5.3 Cellular Architecture and Motility

Cellular polarity is a tightly regulated component of diverse processes, including development, chemotaxis and wound healing. In isolated neurons, the polarized flow of membrane proteins and organelles occurs before a single axon forms from multiple neurites due to a dynamic actin cytoskeleton that allows polymerization and protrusion of microtubules within the axon (reviewed in [135]). During cellular migration, the polarized cell shape is characterized by the reorientation of the microtubule-organising centre (MTOC, structure containing the centrosome) and the Golgi apparatus towards the migrating direction, the capture and stabilization of specific microtubule plus ends near the leading edge, and the formation of actin-mediated protrusions at the front [136]. Each of the aforementioned steps in polarity is regulated by many intracellular proteins, including GSK-3.

Studies which analyzed the effects of global GSK-3 inhibition have demonstrated the requirement for GSK-3 in organizing cellular polarity. Globalized inhibition of GSK-3 in astrocytes blocks MTOC polarity, and microtubule protrusions are randomly oriented [137].

Inhibition of GSK-3 also induces the formation of stable microtubules which are not polarized toward the leading edge in migrating fibroblasts [138] and suppresses the migration of various cell types [139, 140]. Treatment of neurons with GSK-3 inhibitors results in the formation of multiple axons during neuronal development [141, 142]. Unlike total inhibition, localized GSK-

3 inhibition is seemingly important in the migratory process and for establishing and maintaining polarity during axon formation. At the leading edge of migrating astrocytes, CDC42 activates Par6-PKCζ, leading to Ser9 phosphorylation of GSK-3β and subsequent inactivation

[137]. Ser9 phosphorylated GSK-3β also accumulates more strongly at the tip of the presumptive axon [141, 143]. However, it has recently been reported that neurons from double knock-in mice in which Ser9 and Ser21 of the two GSK-3 isoforms have been replaced by Ala develop normally [142]. This indicates that while regulation of GSK-3 activity is important, serine phosphorylation alone is not sufficient to determine the identity of the axon.

The role of GSK-3 in microtubule dynamics is likely to partly be responsible for the effect of GSK-3 on polarity. APC binds and stabilizes microtubules at the leading edge of migrating astorcytes and this is dependent on the inhibition of GSK-3 [137]. APC was also found to accumulate preferentially at the tip of the presumptive axon and could act by conferring early asymmetry on microtubule dynamics [141, 142]. However, the effect of GSK-3 on the establishment of polarity is likely to also be explained by the less characterized effects of

GSK-3 on actin stability. An inactive phosphorylated pool of GSK-3 was found to co-localize with F-actin at the leading edge of both neuronal and nonneuronal cells [144]. Complete inhibition of GSK-3 slows growth cone filopodia dynamics in dorsal root ganglion neurons, which are dependent on actin filament dynamics and myosin motor activity [145]. This is consistent with the finding that the inhibitory guidance molecule Semaphorin 3A activates GSK-

3 at the leading edge of neuronal growth cone and this is important for Semaphorin 3A-induced growth cone collapse. This process was established to be dependent on F-actin rather than microtubule dynamics [144, 146]. The GSK-3 substrates CRMP2 and CRMP4 were identified as downstream targets of Semaphorin 3A sigalling, and phosphorylation of these proteins reduced their ability to stabilize growth cones via the actin cytoskeleton [49, 147, 148].

GSK-3 also plays a role in regulating focal adhesions, which are important structures for regulating integrin-mediated cell spreading and migration. New adhesions form at the leading edge of the migrating cells as adhesions at the rear disassemble to allow the cell to move forward. GSK-3 has been found to act as a negative regulator in focal adhesion formation by some studies. For instance, GSK-3 phosphorylates paxillin to promote spreading [60]. GSK-3 also forms a complex with h-prune, vinculin and paxillin at focal adhesions, regulating the disassembly of focal adhesion to promote cell migration [140]. However, GSK-3 was found to impede cell spreading and migration by phosphorylating FAK and reducing its activity [27].

These contradictory effects of GSK-3 may be due to the cyclic transient activation and inactivation of GSK-3, and the cell-type specific mechanisms that may regulate focal adhesions.

1.5.4 Mitogen-Activated Protein Kinase (MAPK) Signaling

Mitogen-activated protein kinases (MAPKs), a family of serine/threonine kinases, play important roles in diverse biological processes including embryonic development, cell division, apoptosis and differentiation [149, 150]. Three primary MAP kinase cascades that converge on extracellular signal-regulated protein kinase (ERK1/2), c-Jun N-terminal kinase (JNK/SAPK) and p38 MAP kinase (p38) have been extensively characterized in mammalian cells. The

MAPKs are activated by phosphorylation in response to a wide array of extracellular stimuli.

The ERKs are typically activated by various mitogens and are generally thought to regulate cell growth and differentiation. The JNK/SAPK and p38 pathways are activated by cytokines and cellular stresses resulting in inflammation and apoptosis. Inhibition of GSK-3 has been found to have conflicting effects on this stress signaling pathway, depending on cell type and type of extracellular stimuli. In the case of the JNK pathway, GSK-3 has been shown to activate the mitogen-activated protein kinase kinase kinase, MEKK1, an activator of JNK, and thereby to promote signaling by the stress-activated protein kinase pathway [151]. In contrast, GSK-3β

17 was reported to negatively regulate JNK activation in response to growth factors such as lysophsophatidic acid (LPA), sphingosin-1-phosphate (S1P) or epidermal growth factor (EGF)

[152]. GSK-3 was also found to negatively regulate the phosphorylation of ERK1/2 in human intestinal cells and rat astrocytes [153, 154]. Takada et al. [134] reported GSK-3β had an opposite effect on TNF-induced ERK1/2 phosphorylation in fibroblasts derived from GSK-3β gene-deleted mice. However, the absence of GSK-3β did not alter LPA, S1P or EGF-induced

ERK1/2 or p38 activation [152].

1.6 GSK-3 and Disease

Given that abnormal function of GSK-3 has been implicated in the pathology of mood disorders, Alzheimer’s disease, diabetes, and cancer, GSK-3 inhibitors may prove useful for alleviating these diseases and the chronic inflammation that contributes to these conditions

(reviewed in [155, 156]). Furthermore, the widespread regulatory role of GSK-3 in apoptosis suggests a potential use of such inhibitors in the treatment of head trauma and stroke.

Lithium, the best characterized GSK-3 inhibitor [130, 131], competes with magnesium

(Mg2+) for the Mg2+-binding region of GSK-3. Lithium inhibits GSK-3 in the millimolar range but also inhibits a number of other protein kinases with only slightly lower potency than GSK-3, including smMLCK, MNK1, MNK2 and HIPK3 [157] and some non-kinase targets, such as inositol monophosphatase and histone deacetylase [158]. In the past few years, many more

GSK-3 inhibitors have been developed, including indirubins [159], paullones [160], and

SB216763/SB415286 compounds [161], most of which are ATP competitive. Although these inhibitors are more potent and specific than lithium, they do inhibit different protein kinases from those affected by lithium, including cyclin–dependent protein kinases (CDKs) [157, 159,

160] to which GSK-3 is most closely related in sequence. The most potent and specific inhibitor

18 of GSK-3 to date is CHIR 99021, although it has still been shown to inhibit CDK2-cyclin A, albeit 50-fold less potently than GSK-3 [157].

The use of GSK-3 inhibitors has shown great promise for the treatment of a myriad of conditions, however, there is the concern of undesirable side effects. GSK-3 inhibitors are expected to mimic Wnt signalling, and therefore be potentially oncogenic as many components of the Wnt signalling pathway are overexpressed or mutated in several types of cancer

(reviewed in [162]). For example, mutations in APC and β-catenin, which render it resistant to degradation, are found in both sporadic and inherited cancers. In addition to β-catenin, GSK-3 phosphorylates other transcription factors associated with cellular transformation, including cyclin D1 [21], c-Myc [71], Snail [88], CDC25A [19], and BCL-3 [64]. Inhibiting GSK-3 would be expected to lead to the accumulation and activation of these proto-oncogenes. In addition to promoting proliferative signals, GSK-3 inhibitors may inhibit apoptotic signals in tumors given the pro-apoptotic property of the enzyme. Findings that GSK-3 itself is inhibited in some cancers reinforce the tumorigenic potential of GSK-3 inhibitors. Constitutive inhibition of GSK-

3β activity has been reported in human hepatocellular carcinoma [163] and GSK-3 expression was found to be downregulated in squamous cell carcinoma of the tongue [164] and in advanced prostate cancer [165]. Inhibition of GSK-3 promotes tumorigenesis in vivo as transgenic mice overexpressing a kinase-inactive GSK-3β under the control of the mouse mammary tumor virus- long terminal repeat overexpress β-catenin and develop mammary tumors [166]. A recent study demonstrated that inhibition of GSK-3 promotes epidermal cell transformation in vitro and in vivo, supporting the role of GSK-3 as a “tumor suppressor” [167]. Although anti-GSK-3 therapy raises concerns that inhibition of this enzyme could lead to tumorigenesis, patients treated with lithium do not spontaneously develop more tumors than the general population [168], and

Chiron inhibitors do not elevate the levels of β-catenin in diabetic rodents [169]. These and

19 other findings suggest the effect of GSK-3 inhibitors on GSK-3 activity may only be partial in vivo, thus insufficient for oncogenic induction, or that a prior induction of the tumor is required.

1.8 Rationale and Thesis Objective

Elucidating the full spectrum of functions that GSK-3 is involved in is important for evaluating the therapeutic potential of GSK-3 inhibitors and to identify possible side effects from the use of these inhibitors. RNA interference (RNAi), the process by which dsRNA silences gene expression, has become a powerful tool to dissect gene function, however, numerous shortcomings remain. Expression profiling revealed off-target gene regulation by

RNAi, through cross-reaction with targets of limited sequence similarity [170]. Another disadvantage is the incompleteness of gene silencing which may be insufficient to cause deficiency for at least a fraction of the functions regulated by GSK-3. For instance, gene dosage analysis demonstrated that more than 75% inhibition of GSK-3 is required for significant β- catenin/TCF-mediated signalling [171]. Moreover, as described above, chemical inhibitors of

GSK-3 vary in efficiency of inhibition and are prone to non-specific “off-target” effects that become more pronounced as the working concentration of inhibitor increases [157]. Thus, it is highly desirable to use genetic approaches with minimal perturbation of endogenous cellular environment to study GSK-3 function.

Genetic support for the role of GSK-3 in mammalian cells has so far been limited to the use of an immortalized MEF cell line that lacks GSK-3β isoform only. This has not been an ideal system for several reasons. As GSK-3α and β seem to have a high degree of similarity and functional overlap, the assessment of the full spectrum of GSK-3 functions requires the removal of both isoforms. In addition, primary cells would offer the advantage of not having signaling perturbences caused by the immortalization process. The central aim of the current study was to

20 examine the functional consequences of the removal of all four GSK-3 alleles using loxP/Cre technology in primary MEFs.

Chapter 2: Materials and Methods

21 22

2.1 Cell Culture

All cell lines were grown at 37°C in a tissue culture incubator with a humidified atmosphere containing 5% CO2. MEFs were cultured in Dulbecco’s Modified Eagle Medium

(DMEM) supplemented with 10% fetal bovine serum (FBS, Wisent) and antibiotics (50 U

Penicillin and 50 µg Streptomycin, Invitrogen). HEK293 cells (Qbiogene) were grown in

DMEM supplemented with 10% FBS, antibiotics, 0.1 mM nonessential amino acids (Invitrogen) and 1 mM sodium pyruvate (Invitrogen).

2.2 Adenovirus Production

AdCre (Vector Biolabs) and the control AdLacZ (Becton Dickinson) stocks were propagated using HEK293 cells according to the AdEasy protocol from Qbiogene. Adenovirus produced in the third round of amplification was used for all experiments. The viral titer was

determined using the tissue culture infectious dose50 (TCID50) method according to the manufacturer's protocol.

2.3 Generation of Embryos Harbouring Conditional Alleles of GSK-3α and β

Mice expressing conditional alleles of GSK-3α or GSK-3β were generated by introducing LoxP sites into the introns flanking exon 2 of the GSK-3α or GSK-3β gene, which encodes the majority of the kinase domain (described previously in [171], [172]).

GSK-3α(FL/FL)/β(FL/FL) mice were inter-crossed or crossed with GSK-3α(FL/+)/β(FL/FL) mice to generate GSK-3α(FL/FL)/β(FL/FL) embryos. GSK-3α(+/+)/β(+/+) (wildtype) embryos were obtained by crossing GSK-3α(+/+)/β(+/+) with GSK-3α(+/+)/β(FL/+) mice. To determine the genotype of the mice, genomic DNA was isolated by incubating a portion of the embryos in digestion buffer (1X

HotMaster Taq PCR buffer (Eppendorf), 0.45% NP40, 0.45% Tween20 and 1 mg/ml proteinase

K) for 1 h at 60°C. Genotyping of the mice was carried out using multiplex PCR with

23 HotMaster Taq DNA polymerase (Eppendorf). The PCR parameters were 1 cycle at 94°C for 2 min, 35 cycles of 30 sec at 94°C, 30 sec at 56°C and 25 sec at 68°C, followed by 10 min at 68°C and a final 4°C incubation. Samples were run on a 2.0% agarose gel.

GENE PRIMER SEQUENCE (5’-3’) EXPECTED SIZE GSK-3α Fwd: CCCCCACCAAGTGATTTCACTGCTA FL/FL 750 bp; +/+ 600 bp; Rev: AACATGAAATTCCGGGCTCCAACTCTAT +/FL 750 bp and 500 bp

GSK-3β Fwd: GGGGCAACCTTAATTTCATT FL/FL 1100 bp; +/+ 895 Rev: TCTGGGCATAGCTATCTAGTAACG bp; +/FL 1100 bp and 895 bp

2.4 Isolation of Embryonic Fibroblasts from GSK-3 αFL/FL/βFL/FL Mice

GSK-3α(+/+)/β(+/+) MEFs and GSK-3α(FL/FL)/β(FL/FL) MEFs were derived from embryonic day 13.5-15.5 fetuses. Embryos were dissected from maternal tissue in sterile PBS followed by decapitation and removal of organs and limbs. The embryos were then minced using a 15.5 gauge needle and syringe and individually digested in two changes of 0.05% trypsin EDTA

(Gibco) for 20 minutes. Following trypsin inactivation with FBS, the tissue was further dissociated with a 15.5 gauge needle, passed through a cell strainer (BD Falcon) into the wells of a 6-well culture dish in the presence of DMEM containing 10% FBS. MEFs were split the next day into 3 x 60 mm dishes and subsequently split every 3 days 1:3 in 1 x 60 mm dish to maintain the culture. Aliquots from cells at passages 1-3 were frozen down in DMEM with 30%

FBS and 10% high quality dimethyl sulfoxide (DMSO, Sigma). MEFs were passaged maximally six times.

GSK-3α(FL/FL)/β(FL/FL) MEFs were trypsinized, counted and allowed to adhere for 4 h before infection with adenoviral Cre recombinase (AdCre) or the control AdLacZ at a

Multiplicity of Infection (MOI) of 1000-1250. Recombination between the loxP sites catalyzed by the Cre recombinase results in deletion of the intervening region and hence elimination of

24 GSK-3 protein expression. Complete removal of the GSK-3 alleles was achieved without detectable toxicity. All experiments were performed 4-7 days post infection when the amount of residual GSK-3 protein was minimal.

2.5 Preparation of Lysates and Cytosolic β-Catenin Isolation

Cells were extracted in lysis buffer (1% Triton X-100, 50 mM Tris [pH 7.5], 150 mM

NaCl, 2 mM EDTA, 2 mM MgCl2,10 mM β-glycerolphosphate, 1 mM sodium pyrophosphate,

10 mM NaF, 500 μM sodium orthovanadate, phosphatase inhibitor cocktail 1 (Sigma), and one mini complete EDTA-free protease inhibitor cocktail tablet/10 ml). Lysates were centrifuged at

16,000 g, 4°C for 10 min, and protein concentration was determined by Lowry assay (Bio-Rad

Laboratories).

Cytosolic lysates were prepared by rinsing cells three times with PBS, then scraping them into a minimal volume of ice-cold hypotonic lysis buffer (50 mM Tris [pH 7.4], 2 mM

EDTA) containing a cocktail of protease and phosphatase inhibitors (mini complete EDTA-free protease inhibitor tablet (Roche), phosphatase inhibitor cocktail 1(Sigma); 1 mM Na- orthovanadate, 10 mM NaF, 10 mM β-glycerophosphate). Cells were pelleted by centrifuging for 1 h at maximum speed in a bench-top microfuge at 4°C. Cytoplasm expelled from the cells was retrieved by collecting the supernatant, taking care not to aspirate any insoluble material located in the pellet.

2.6 TCF-Reporter Assay

MEFs were cotransfected in 12 well plates with optimal (TOP) or mutated (FOP) plasmids (450 ng), driving firefly luciferase production, and a pRL-CMV (50 ng), driving constitutive expression of renilla luciferase for normalization. Cells were lysed two days after transfection with 1× passive reporter lysis buffer. Firefly and renilla reporter activities were

25 measured by using a 96-well-based luminometer and were detected as per manufacturer's instructions (Promega Dual-Light system).

2.7 Immunoblotting

Lysates were boiled with sodium dodecyl sulfate (SDS)-containing sample buffer, resolved by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to polyvinylidene difluoride membranes (Millipore) using a Trans-Blot SD semi-dry electrophoretic transfer cell

(Hoefer). Membranes were blocked for 30 min at room temperature with 5% nonfat dry milk in

TBS-T buffer (10 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.1% Tween 20). Membranes were probed with the appropriate antibody overnight at 4 °C: GAPDH, ab8245 antibody (Abcam); β– actin (Abcam); Rho antibody (Cytoskeleton); GSK-3 and β-catenin (clone 14) antibodies (BD

Biosciences); caspase 3, ERK, P-ERK, SAPK, P-SAPK, p38, and P-p38 antibodies (Cell

Signalling Transduction). After TBS-T washing to remove excess primary antibodies, the blots were incubated in horseradish peroxidase-coupled secondary antibody (Bio-Rad) diluted in 5% nonfat dry milk in TBS-T buffer for 1 h. Proteins were visualized using the SuperSignal West

Pico enhanced chemiluminescence kit according to manufacturers’ protocol (Pierce).

2.8 Immunofluorescence

Cells were seeded onto coverslips and the cells were immunostained with extensive PBS washes performed between each step. Cells were fixed by incubation with 4% paraformaldehyde for 10 minutes, permeabilized by incubation with 0.2% Triton X-100 for 2 minutes and blocked for 1 h in PBS 1% BSA at room temperature. Primary antibodies were diluted in PBS 1% BSA and used for immunostaining for 1 h at room temperature. Cells were immunostained by incubation with 1:200 dilution of vinculin antibody (Sigma) or 1:1000 β- catenin antibody (BD Biosciences) Cells were incubated with goat species specific Alexa 488 antibody (Molecular Probes) at a dilution of 1:500 in PBS 1% BSA for 1 hr at room

26 temperature. The F-actin structures of the cells were visualized by rhodamine-conjugated phalloidin (Molecular Probes) staining (1:200 dilution in PBS 1% BSA) for 20 min at 37°C.

Specimens were mounted with ProLong gold anti-fade reagent containing DAPI (Molecular

Probes). Immunofluorescence was observed under a ZEISS LSM510 laser scanning confocal microscope and images were captured with LSM 5 Software.

2.9 Microarray Analysis of GSK-3 Knockout MEFs

Primary MEFs at passage 2 were infected with AdLacZ or AdCre and 4 days post infection RNA was extracted from cells using RNeasy miniprep kit (Qiagen). RNA concentration and purity were assessed with OD 260 nm/280 nm on a Nanodrop SD1000

Steptrophotometer (Thermo Scientific) and with an Agilent BioAnalyser. 500 ng of total RNA per sample was used to make Cyanine 3 or Cyanine 5-labeled cRNA using the Agilent Low

RNA Input Fluorescent Linear Amplification Plus Kit. The labelled cRNA was purified using the Qiagen RNEasy kit and 825 ng was used for hybridization on 44K mouse microarrays using the In Situ Hybridization Kit. Arrays were incubated at 65°C for 17 h in Agilent's microarray hybridization chambers. After hybridization, arrays were washed according to the Agilent protocol. Microarray chips were scanned with Agilent’s DNA Microarray Scanner and SureScan technology. Hybridization signals were quantified (Feature Extraction 9.5) and Lowess normalized (GeneSpring software). Statistical analysis and annotations were performed using

Genespring software. Significance Analysis of Microarray (SAM analysis) was used on the microarray data in Excel. Functional analysis identified the biological functions that were most significant to the data set and were generated through the use of Ingenuity Pathway Analysis

(Ingenuity Systems, www.ingenuity.com). Genes from the dataset that were modulated more than two-fold and were associated with biological functions in the Ingenuity Pathways

Knowledge Base were considered for analysis. Fischer’s exact test was used to calculate a p-

27 value determining the probability that each biological function assigned to that data set is due to chance alone. A p-value less than 0.05 indicates a statistically significant, non-random association.

2.10 Alamar Blue Proliferation Assay

Primary MEFs were seeded at 750 cells per well in quadruplicate on a 96 well plate

(Nunc). Cells were allowed to attach for 6 h and alamar blue was added in an amount equal to

10% of the culture volume. The cells were cultured for 24 h and daily fluorescence measurements were recorded using Pherastar microplate reader (Fisher Scientific) at λex=544 nm and λem=590 nm. Wells containing growth medium served as the background.

2.11 Senescence Associated β-Galactosidase Staining

Cells were washed twice in PBS, fixed for 10 min at room temperature in 3% formaldehyde, washed with PBS, and stained with fresh senescence associated β-Gal (SA-β-

Gal) solution: 1 mg/mL X-gal (Invitrogen)/40 mM citric acid/sodium phosphate, pH 6.0/5 mM potassium ferrocyanide/5 mM potassium ferricyanide/150 mM NaCl/2 mM MgCl2. To detect lysosomal β-Gal (positive control), the citric acid/sodium phosphate was used at pH 4.0. Cells were incubated overnight at 37°C (no C02) and cell imaging was performed on the Leica DMLS microscope equipped with a Leica IM50 software and Leica DC300 camera, using a 20x phase contrast objective lens.

2.12 Cell Cycle Analysis and BrdU Incorporation

Sub-confluent cells were BrdU-labeled in complete cell culture media by incubation

with 10 µM BrdU at 37°C in 5% CO2 for 3 h. Cells were harvested and processed using an anti-

BrdU monoclonal primary antibody followed by a goat anti-mouse FITC-conjugated secondary according to the manufacturer’s directions (FITC BrdU Flow Kit, BD Pharmingen). Staining

28 with 7-amino-actinomycin D (7-AAD) dye which binds total DNA was coupled with BrdU staining. The percentage of cells in each cell cycle phase was determined by DNA profiling on a

FACSCalibur flow cytometer (Becton Dickinson).

2.13 Annexin V Assay

MEFs (2X105 cells/well) were seeded into 6 well dishes. After 48 h cells a flow cytometric analysis of Annexin V-PE/PI-stained cells was performed using an apoptosis detection kit (BD Pharmingen Co.) as recommended by the manufacturer. Cells were washed with PBS and re-suspended in 100 μl of 1× binding buffer. 10 μl of annexin V-PE and PI were added to the cells for 15 min. at RT. Then, 400 μl of 1× binding buffer was added and the cells were analyzed for annexinV binding within 1 h by using flow cytometry.

To assess sensitivity to TNF, the cells were cultured with different amounts of TNFα

(R&D Systems, Minneapolis, MI) and 0.25 μg/ml cyclohexamide (Sigma) one day after plating the cells. Cell death was assessed using the Annexin-V kit after 24 h.

2.14 Time-Lapse Microscopy

The cells were serum starved overnight in DMEM 0.5% FBS, harvested with 0.05% trypsin/EDTA, washed once in DMEM 0.5% FBS and replated at a density of 25,000 cells/well in the same medium in the wells of a 6 well plate. The wells were previously coated overnight with 10 ug/ml fibronectin (Sigma) at 4°C and blocked for 1 h with 1% BSA/PBS. Immediately after plating, the cells were maintained at 37°C, 5% CO2 and 80% humidity using LiveCell TM system (Pathology Devices, Westminster, MD). Cell spreading was imaged on an Axiovert

200M Inverted Microscope (Carl Zeiss) equipped with Volocity v.4.2 software

(Improvision, Waltham, MA). Images were acquired at 3-min intervals using a Zeiss LD Plan-

NEOFLUAR 20X/0.4NA PH2 phase contrast objective lens.

29 2.15 Adhesion Assay

MEFs were cultured in DMEM 0.5% FBS for 16-24 h, harvested with 0.05% trypsin/EDTA (Gibco), washed once with DMEM 0.5% FBS and resuspended in the same medium. A 96-well plate was previously coated overnight at 4°C with 10 μg/ml fibronectin, 20

μg/ml collagen (Sigma) and 100 μg/ml poly-L-lysine (Sigma) and remaining binding sites were blocked by adding 1.0% BSA in PBS for 30 min at room temperature. The wells were washed three times with PBS and 3000 cells (100 μl/well) were added to the 96-well plate in triplicate and incubated at 37°C for 30 min. The unattached cells were washed away four times with PBS and the attached cells were fixed with 96% ethanol for 10 min and stained with 0.1% crystal violet for 30 min at room temperature followed by extensive washing. The cells were lysed in

50 μl 0.2% Triton X in dH20 and the absorbance was read with a Spectramax PLUS microplate spectrophotometer (Molecular Devices) at λ570 nm.

2.16 Cell Spreading Assay

Coverglasses were coated overnight at 4°C with 10 μg/ml fibronectin and remaining binding sites were blocked by incubating with 1.0% BSA in PBS for 30 min at room temperature. Cells were cultured in DMEM 0.5% FBS for 16-24 h, harvested with 0.05% trypsin/EDTA, washed once with DMEM 0.5% FBS and resuspended in the same medium before plating onto fibronectin-coated coverglasses. Cells were immunostained as described above at the indicated timepoints. Immunofluorescence was observed under a ZEISS LSM510 laser scanning confocal microscope and images were captured with LSM 5 Software. For quantification analysis, digitised images were acquired with a FLUAR 20x/0.75 NA objective on an Axiovert 200M microscope (Carl Zeiss) equipped with the Roper Scientific CoolSnap HQ

CCD camera controlled by InVivo software. The composite image was used to quantify the cell area and the ratio of cell area to the area of the bounding box on Image-ProPlus v6.2 software.

30 2.17 Cell Migration Assay

MEFs were seeded at 1.75x105 per 35 mm dish and infected the same day with AdLacZ or AdCre. The cells were grown to confluence until the third day post infection and were serum starved for another 24 hours in DMEM 0.5% FBS. Wounds were created by scraping the monolayer with P20 disposable plastic pipette tips. The cells were washed twice in serum free media, and incubated in DMEM 0.5% FBS. Phase images of each wound were captured immediately and at various times after wounding with LEICA DM IRBE microscope equipped with a Hamamatsu camera and Volocity 4 software using a phase contrast 10x objective lens.

Care was taken to photograph the wound in the same region at each time point.

2.18 Rho Activity Assay

Cells were seeded at approximately 2x106 cells per 150 mm2 dish two days post infection. The next day cells were incubated in media with 1% FBS for 24-36 hours and were rendered quiescent by growing in serum-free media for another 16-20 h. After incubation with or without 1 μm LPA (Sigma) for 12 minutes, Rho activity was determined using the Rho activation assay kit (Cytoskeleton). Cells were washed twice in ice-cold PBS and lysed in lysis buffer containing protease inhibitors at 4°C. The cell lysates were precleared and samples of supernatant were withdrawn for protein quantification. The remaining supernatant was flash- frozen in liquid nitrogen and stored at –80ºC. 400 μg of protein was incubated with 15 µg of

GST-PAK-CRIB protein immobilized on glutathione-Sepharose beads at 4°C for 60 min. The beads were washed twice with washing buffer, and were resuspended in 2x gel sample buffer.

The extent of GTP-bound Rho was determined by Western blot using anti-Rho antibody. This experiment was performed in duplicate.

31 2.19 MAPK Activation

MEFs were serum starved overnight and stimulated with 500 mM sorbitol for 30 minutes or 10 ng/ml EGF for 10 minutes and 100 mM PMA for 10 minutes. Cells were lysed and subjected to SDS–PAGE/western blotting as described earlier.

2.20 Statistical Analysis

For multiple comparisons, statistical analysis was performed using either two-way analysis of variance (ANOVA) followed by a Bonferroni post test, or one-way ANOVA followed by Tukey post teset, or unpaired student’s t-tests. Data analysis was performed using

GraphPad Prism. The number of replicates and statistical significance are indicated in Results and in the figure legends.

Chapter 3: Results

32 32

3.1 Generation of GSK-3 Conditional Mouse Embryonic Fibroblasts

To clarify the role of GSK-3 in a primary cell setting, loxP/Cre technology was used to generate primary MEFs which lack both alleles of GSK-3α and GSK-3β. Primary MEFs were prepared from E13.5-15.5 mouse embryos of GSK-3α(FL/FL)/β(FL/FL) or GSK-3α(+/+)/β(+/+) genotypes. To efficiently excise the loxP-flanked exon 2, the GSK-3α(FL/FL)/β(FL/FL) cells were infected using an adenovirus encoding Cre recombinase (AdCre) or the corresponding LacZ

(AdLacZ) control (Figure 3.1A). Five days after infection, GSK-3 expression was analyzed by immunoblotting of the cell lysates with an anti-GSK-3 antibody from BD Biosciences. As shown in Figure 3.1B, typically over 95% of endogenous GSK-3α and β in the MEFs was removed at an MOI of 1000 when compared to noninfected control.

As GSK-3 is a key component of the Wnt signal transduction pathway, the impact of

GSK-3 deletion on β-catenin was evaluated. GSK-3 directly phosphorylates the transcriptional regulator β-catenin in the context of a destruction complex, marking β-catenin for proteosomal degradation. When GSK-3 is totally absent (DKO), there are no functional destruction complexes, and β-catenin accumulates in the cytoplasm and nucleus. The DKO MEFs exhibited a massive increase in cytosolic β-catenin levels as shown by immunoblot analysis (Figure 3.1C).

Immunofluorescence confirmed that cytosolic and nuclear β-catenin reached very high levels as a result of GSK-3 depletion (Figure 3.1D). To assess whether the observed changes in cytosolic and nuclear levels of β-catenin correlated with functional changes in β-catenin activity, a luciferase-based reporter was used to measure TCF-mediated transcription. In GSK-

3α(FL/FL)/β(FL/FL) cells infected with AdCre there was a dramatic increase in TCF-reporter activity compared to the AdLacZ control (Figure 3.1E).

33 A

34 C

AdLacZ AdCre

Figure 3.1: Treatment of GSK-3 α(FL/FL)/β(FL/FL) MEFs with AdCre results in compound knockouts of GSK-3α and β, stabilization of β-catenin and β-catenin/TCF-transactivation activity. (A) Generation of GSK-3α(-/-)/β(-/-) MEFs by a loxP/Cre recombinase system. The conditional GSK-3α and β alleles contain two loxP sites flanking exon 2 of the GSK-3 genes which is excised upon the expression of Cre recombinase. (B) Immunoblot of lysates from noninfected and AdCre infected GSK-3α(FL/FL)/β(FL/FL) MEFs probed with GSK-3 and GAPDH antibodies 5 days post infection. (C) Cytosolic β-catenin levels in GSK-3 knockout MEFs. GSK-3α(FL/FL)/β(FL/FL) MEFs infected with AdCre or AdLacZ or non-infected were lysed in hypotonic lysis buffer and the supernatant was subjected to immunoblotting with β-catenin, GSK-3 and GAPDH. (D) Immunofluorescence analysis of AdLacZ or AdCre-infected GSK- 3α(FL/FL)/β(FL/FL) stained for β-catenin and DAPI (nuclei). (E) TCF-reporter assay. GSK- 3α(FL/FL)/β(FL/FL) MEFs infected with AdLacZ or AdCre were cotransfected with optimal (TOP) or mutated (FOP) luciferase reporter plasmids and analyzed for TCF-dependent transcription by measuring luciferase activity. The ratio of the specific versus control signals (corrected for transfection efficiencies), termed TOP/FOP, is shown. The experiment was performed in duplicate and the samples were read twice by the luminometer. Error bars = SEM. Asterisks signify statistically significant changes compared to AdLacZ control, where *** p < 0.001

3.2 Microarray Analysis

To obtain a global view of the number of genes regulated by GSK-3, we hybridized differentially labeled RNA from AdLacZ MEFs versus AdCre-infected GSK-3α(FL/FL)/β(FL/FL)

MEFs to a 44K mouse microarray from the UHN microarray centre in Toronto using Agilent technology. Analysis of the expression microarray data revealed 123 and 384 genes were upregulated and downregulated, respectively, by at least two-fold in GSK-3-deficient MEFs.

Functional analysis identified the biological functions that were most significant to the dataset

(Figure 3.2). The top biological functions associated with the data set were: cell cycle; cellular assembly and organization; DNA replication, recombination and repair; cell death; cellular growth and proliferation; cellular movement.

3.3 Effect of GSK-3 Deficiency on Cell Proliferation

Growth rate of MEFs under normal cell culture conditions was assessed with the Alamar

Blue assay from days 3 to 7 post adenovirus infection. GSK-3α(FL/FL)/β(FL/FL) cells infected with

AdCre showed drastic growth defects compared to the noninfected or AdLacZ-treated cells

(Figure 3.3). GSK-3α(+/+)/β(+/+) cells infected with AdCre had a growth rate comparable to the other controls indicating that the defect in proliferation a consequence of the loss of GSK-3 and not a toxicity effect caused by the Cre recombinase.

3.4 Cell Cycle Regulation in GSK-3 Depleted Cells

The reduced proliferative potential of the cells due to loss of GSK-3 expression may be associated to previously characterized GSK-3 function in cell cycle regulation. To this end, early passage primary MEFs were first examined for evidence of the cellular senescence phenotype by senescence-assocated β-galactosidase (SA-β-gal) staining. Both non-infected and

AdCre-infected GSK-3α(FL/FL)/β(FL/FL) cells displayed low levels of SA-β-gal staining at passage

Figure 3.2: Functional analysis of microarray data. Biological functions that were most significant to the dataset were distilled through the use of Ingenuity Pathway Analysis. A p- value (Fischer’s exact test) lower than 0.05 indicated a statistically significant, non-random association.

Figure 3.3: GSK-3 is critical for primary MEF proliferation. Wild-type MEFs were infected with AdCre and GSK-3α(FL/FL)/β(FL/FL) MEFs were infected with AdCre or AdLacZ or noninfected. Cells were plated in 96 well plates in quadruplicate in normal serum conditions at day 2 post infection. Alamar blue was added 6 h after plating and the proliferative activity was determined at the indicated time points beginning at day 3 post infection using a spectrofluorometer. Mean values ± SEM are plotted for two separate experiments, where * P<0.05, *** P<0.001 compared to AdLacZ infected GSK-3α(FL/FL)/β(FL/FL) MEFs or GSK-3α(+/+)/ β(+/+) MEFs infected with AdCre.

38 3 (Figure 3.4A). As expected, there was more SA-β-gal positive staining in noninfected cells at a later passage, as cells were reaching crisis. The involvement of GSK-3 in the primary MEF cell cycle was further examined by BrdU labeling followed by anti-BrdU staining in conjunction with 7-AAD staining. FACS analysis permitted the enumeration of cells that were actively synthesizing DNA (BrdU incorporation) in terms of their cell cycle position (ie, G0/1, S, or

G2/M phases) defined by 7-AAD staining intensities. The G2/M population of AdCre-infected

GSK-3α(FL/FL)/β(FL/FL) cells displayed a more marked increase in the staining profiles (n=2), indicating that the depletion of GSK-3 activity may have affected the G2/M phase transition

(Figure 3.4B).

3.5 Effect of GSK-3 Depletion on Apoptosis

The level of apoptosis was assessed in order to determine if loss-of cell survival contributed to the dramatic decrease in cell proliferation observed in GSK-3 depleted MEFs.

Because caspase 3 is thought to be one of the main executioner caspases in cells, apoptosis was first assessed by determining the level of caspase 3 activation in the DKO MEFs. GSK-3

αFL/FL/βFL/FL cells infected with AdCre were lysed on alternate days post infection up to day 11, and the presence of cleaved (active) caspase-3 fragments was visualized by immunoblotting using an antibody that recognizes both the uncleaved and cleaved forms of caspase 3. Lysates from TNFα treated hepatocytes were used as positive controls for the caspase 3 antibody. There was no evidence of caspase 3 cleavage in GSK-3 DKO cells by immunoblot analysis (Figure

3.5A). One of the earliest indications of apoptosis is the translocation of membrane phospholipid phosphatidylserine (PS) from the inner to the outer leaflet of the plasma membrane. The translocation to the extracellular surface can be assessed by measuring binding of Annexin V, conjugated to the fluorochrome PE, to the extracellular PS. This is used in

Figure 3.4: Role of GSK-3 in cell cycle regulation in MEFs. (A) Ablation of GSK-3 expression does not affect SA-b-gal activity. GSK-3α(FL/FL)/β(FL/FL) MEFs were infected with AdCre and stained for SA-β-gal or lysosomal β-gal (positive control) at passages 3 or 8 and compared to noninfected control. (B) GSK-3 knockout MEFs exhibit delay in the G2/M phase of the cell cycle. GSK-3α(FL/FL)/β(FL/FL) MEFs non-infected or infected with AdLacZ or AdCre were exposed to BrdU for 3 h in constant 10% serum. Cells were then stained with anti-BrdU FITC-conjugated antibody and 7-AAD. The proportion of cells in G1, S, and G2/M was determined by the flow cytometric analysis of DNA content. Results are mean ± S.D. of two separate experiments.

40 conjunction with Propidium Iodide (PI) staining which binds to nucleic acids, but can only penetrate the plasma membrane when membrane integrity is breached as occurs in late apoptosis or necrosis. Cells that are in early apoptosis (Annexin V-positive and PI-negative) can be identified by flow cytometry. To compare between experiments, the percentage of apoptotic cells for the AdLacZ-infected GSK-3α(+/+)/β(+/+) MEFs was set at 1 for each experiment and all other values were expressed as a ratio to this. As shown in Figure 3.5B, GSK-3α(FL/FL)/β(FL/FL) cells infected with AdCre displayed a ~1.9 fold increase in spontaneous apoptosis compared to

AdLacZ control under normal serum conditions. GSK-3α(+/+)/β(+/+) cells infected with AdCre showed a similar apoptotic profile as the matched AdLacZ-infected cells indicating the apoptotic effect of the GSK-3 depleted MEFs was not related to AdCre infection. The results suggest that loss of GSK-3 expression causes a marginal, but significant increase in cell apoptosis.

3.6 TNF sensitivity in GSK-3 Deficient Cells

To investigate the role of GSK-3 in TNFα-induced apoptosis, adenovirus infected primary MEFs were incubated with TNFα plus cyclohexamide (CHX) for 24 h. AdCre infected

GSK-3α(FL/FL)/β(FL/FL) cells displayed typical morphological features of apoptosis in the presence of TNFα and CHX treatment (Figure 3.6A). Flow cytometry was also performed using Annexin

V binding and PI staining to determine the proportion of cells exhibiting evidence of early apoptosis (AnnexinV+ PI-). AdCre-treated and control cells were unaffected by the addition of

0.25 μg/ml CHX (Figure 3.6B). AdCre-infected cells displayed ~1.5 fold more apoptotic markers compared to AdLacZ controls after treatment with CHX in conjunction with the maximum amount of TNF (40 ng/ml).

Figure 3.5: GSK-3 deletion induces spontaneous apoptosis. (A) Assessment of caspase 3 cleavage. Immunoblot for caspase 3 from lysates of GSK-3α(FL/FL)/β(FL/FL) MEFs 1-11 days after AdCre infection with GAPDH used as loading control. (B) Annexin V-PE staining. Cells were stained with Annexin V-PE and PI as described in Materials and Methods and analyzed with a flow cytometer by quantifying the percentage of Annexin V+ PI– cells. The apoptotic cells were quantified and presented as the relative ratio to that of the control. The results are shown as ratios to GSK-3α(+/+)/β(+/+) cells infected with AdLacZ. Ratios are expressed as means ± SEM from three independent analyses where * P<0.05.

Figure 3.6: Enhanced TNFα-induced apoptosis in GSK-3 deficient MEFs. (A) GSK- 3α(FL/FL)/β(FL/FL) MEFs infected with AdCre exhibited more apoptosis-like morphologies than AdLacZ-infected cells after TNFα treatment. Phase contrast images were acquired 24 h after cells were treated with either 40 ng/ml of TNFα and 0.25 μg/ml CHX or CHX alone. Bar = 100 μm. (B) Apoptosis was analyzed 24 h after TNFα treatment using Annexin V-PE assay. The values are expressed as the mean ± SEM from two independent experiments, where * P<0.05.

3.7 Cellular Morphology and Focal Adhesion Formation in the Absence of GSK-3

GSK-3α(FL/FL)/β(FL/FL) cells showed a clear spreading defect after AdCre infection in regular culture conditions. Four days after AdCre infection most cells began to retract and 7 days after AdCre infection the cells were smaller, whereas AdLacZ-infected MEFs were flat and well spread (Figure 3.7).

In addition to the spreading defect, GSK-3-null MEFs exhibited fewer and more localized focal adhesions, as determined by vinculin immunostaining. GSK-3-null cells contained abundant actin stress fibers similar to control cells, but with a slight accumulation in the cortical area as visualized after phalloidin staining (Figure 3.8).

Rho, Rac and Cdc42, three members of the Rho family of small GTPases, are best known for controlling the assembly and disassembly of the actin cytoskeleton and of associated integrin adhesion complexes, and have been also shown to contribute to the regulation of other cellular functions, including gene transcription, cell cycle, vesicle transport, and polarity [173].

Rho has specifically been shown to be essential for the coordinated assembly of focal adhesion formation and stress fibers in response to a variety of extracellular stimuli such as lysophosphatidic acid (LPA) or integrin engagement [174]. To examine if Rho activity was affected by the loss of GSK-3 expression in MEFs, an effector domain-binding assay was used to compare the amount of active Rho in the AdCre and AdLacZ-infected GSK-3α(FL/FL)/β(FL/FL) cells. However, deletion of GSK-3 has no effect on activity or expression changes of Rho in either the serum-starved or LPA stimulated state (Figure 3.9).

Figure 3.7: Morphology of GSK-3 DKO MEFs in regular culture conditions. Five days after AdCre infection most GSK-3α(FL/FL)/β(FL/FL) cells began to retract and seven days after AdCre infection the cells were smaller, whereas AdLacZ-infected MEFs were flat and well spread. Bar = 100 μm.

F-actin Vinculin F-actin + Vinculin

AdLa cZ

AdCre

Figure 3.8: F-actin distribution and focal complex assembly in GSK-3-null cells in normal culture conditions. GSK-3-null and control MEFs were grown on coverslips, fixed in 4% paraformalehyde, permeabilized with 0.2% Triton X-100, and the F-actin and the focal adhesion complex were visualized with with rhodamine-conjugated phalloidin and anti-vinculin antibody respectively.

Figure 3.9: Normal Rho activity in GSK-3 DKO MEFs after LPA stimulation. AdLacZ and AdCre-infected GSK-3α(FL/FL)/β(FL/FL) MEFs were serum starved, stimulated with 1 μm LPA, lysed, and GST-CRIB was used to precipitate endogenous GTP-bound Rho. Immunoblots were performed using Rho-specific antibody. Immunoblots of whole cell lysates retained from the GST-CRIB pull-down lysates were performed using the same antibody. Results shown are representative of two separate experiments.

3.8 The Role of GSK-3 in Cell Adhesion, Spreading and Migration

Given the morphology of the GSK-3 knockout cells and the effects on focal adhesions and the cortical cytoskeleton, we were prompted to investigate cell attachment and spreading after trypsinization. To analyze cell attachment at different time points, time-lapse phase contrast microscopy revealed that attachment and focal complex formation occurred in <15 min for GSK-3α(FL/FL)/β(FL/FL) cells infected with AdCre as well as the AdLacZ control (Figure

3.10A). Consistent with these observations, cell adhesion assays showed that the lack of GSK-3 expression does not impair adhesion to fibronectin, collagen or poly-L-lysine (Figure 3.10B).

To analyze cell spreading at different time points, cells were also fixed and stained with vinculin and rhodamine at different times after seeding on fibronectin. The actin and vinculin staining delineated the shape of the cells and was used to quantify the cell area. The AdCre infected GSK-3α(FL/FL)/β(FL/FL) MEFs increased in area over time during spreading, but after the

20 min time point there was a reduced mean area when compared to AdLacZ treated cells

(Figure 3.11A and B).

Time-lapse phase contrast microscopy as well as vinculin and actin co-staining revealed an abnormal shape during spreading of GSK-3 double knockout MEFs (Figure 3.10A; Figure

3.11A). When plated on fibronectin, most AdLacZ-infected MEFs spread uniformly with a combination of lamellipodia and short filopodia around the cell periphery. AdCre-infected

MEFs showed non-uniform cell spreading with the appearance of long pseudopodia-like protrusions and almost absent lamellipodial structures. A combination of aberrant long bundles of actin filaments and elongated focal adhesions contributed to this phenotype. The length of cellular protrusions is indirectly proportional to the ratio of cell area to the area of the bounding box and was quantified at different time points (Figure 3.11C). In the initial stages of spreading

48 A

11’ 17’ 23’ 32’ 40’

AdLacZ

11’ 17’ 23’ 32’ 40’

AdCre

Figure 3.10: Deletion of GSK-3 does not cause defective cell adhesion. (A) 25x104 of serum- starved GSK-3α(FL/FL)/β(FL/FL) MEFs previously infected with AdLacZ or AdCre were plated on fibronectin-coated 6-well plates. The cell morphologies were imaged using an Axiovert microscope at the indicated time points. (B) Serum-starved AdLacZ and AdCre infected GSK- 3α(FL/FL)/β(FL/FL) MEFs (3x104) were plated onto 96-well plates pre-coated with fibronectin, collagen I and poly-L-lysine for 0.5 h. The attached cells were fixed, stained with crystal violet and quantified using a spectrometer at λ570.

A dLacZ

20’ 40’ 90’

AdCre

20’ 40’ 90’

50 B

Figure 3.11: GSK-3-null MEFs exhibit abnormal spreading on fibronectin. (A) GSK-3 deficient and control cells were serum starved and re-plated on fibronectin coated coverslips. At the indicated time-points, the cells were fixed and F-actin and vinculin distribution was visualized using rhodamine-conjugated phalloidin and anti-vinculin antibody. The cell area (B) and the ratio of cell area to the area of the bounding box (C) were calculated using fluorescent- based thresholding in Image-Pro Plus software from n=50 cells per time point. Results are the mean of two independent experiments. Error bars, SEM. *<0.05 , ** P<0.01.

51 control (0.683+/-0.016) as cells have a round shape before the initiation of spreading. As spreading progressed, the ratio for the AdLacZ-infected cells decreased slightly as the cells began to acquire a fibroblast shape exhibiting a combination of lamaellopodial expansion and spike-like protrusions. However, AdCre-infected MEFs began to exhibit longer and more numerous protrusions and at the 120 min time point the ratio was 0.52+/-0.019 compared to

0.63+/-0.003 for the control.

The finding that GSK-3 functions in cell spreading prompted us to test whether GSK-3 is required for cell motility, a cellular process that is critically involved in normal development as well as a variety of pathological processes. The process of wound closure by GSK-3-null cell was monitored after wounding near confluent cells. GSK-3α(FL/FL)/β(FL/FL) MEFs infected with

AdCre had an equal ability to migrate into the wound as the AdLacz-infected controls (Figure

3.12), demonstrating that GSK-3 is not essential for migration in MEFs. However, in contrast to the control, AdCre-infected MEFs had perturbed coordination, migrating less as a sheet and more as individual cells.

3.9 Effect of Loss of GSK-3 on MAPK signaling

To begin to examine the signaling pathways that are affected by GSK-3 depletion in

MEFs, the phosphorylation states of ERK, p38 MAPK and JNK/SAPK were probed by immunoblotting. The ERK1/2 response to EGF and PMA was unaffected in the GSK-

3α(FL/FL)/β(FL/FL) cells infected with AdCre (Figure 3.13A). The response of p38 MAPK to sorbitol was also unchanged in GSK-3 null MEFs (Figure 3.13B). There was a slight but reproducible decrease in JNK/SAPK phosphorylation following sorbitol stimulation in GSK-3 depleted cells, which was not seen in wild-type cells infected with AdCre (Figure 3.13B).

t = 0 h t = 12 h t = 24 h

AdLacZ

AdCre

Figure 3.12: Migration of MEFs is not impeded by lack of GSK-3. Migration of GSK- 3α(FL/FL)/β(FL/FL) MEFs infected with AdLacZ or AdCre was monitored, in media containing 0.5% FBS, over 24 h using a scratch wound assay.

53 A

Figure 3.13: Effects of loss of GSK-3 expression on ERK, JNK/SAPK and p38 MAPK activities. (A) Normal ERK phosphorylation after EGF and PMA treatment. GSK- 3α(FL/FL)/β(FL/FL) MEFs infected with AdLacZ (lanes 1 to 3) or AdCre (lanes 4 to 6) were treated with 10 ng/mL EGF (lanes 2 and 5) or 100 mM PMA (lanes 3 and 6) for 10 min or were left untreated (lanes 1 and 4) after a 16 h serum withdrawal. MEFs were harvested and immunoblotted for p-ERK1/2, ERK1/2, GSK-3 and β actin. Results shown are representative of two separate experiments. (B) Normal p38 activation and slightly perturbed SAPK signaling in DKO MEFs. GSK-3α(+/+)/β(+/+) or GSK-3α(FL/FL)/β(FL/FL) MEFs infected with AdLacZ or AdCre were treated with 500 mM sorbitol for 30 min after a 16 h serum withdrawal. MEFs were harvested and immunoblotted for p-p38 MAPK, p-JNK/SAPK1/2 and relevant controls. Results shown are representative of two separate experiments.

Chapter 4: Discussion and Future Directions

54 55

4.1 Summary

Although the cellular functions of GSK-3 have been investigated by using inhibitors and siRNA approaches, there are experimental limitations to these methods that could lead to erroneous interpretations. In this present study, the phenotype of GSK-3-null primary MEFs was analyzed to better define the functions of GSK-3 in mammalian cells. GSK-3-null MEFs were generated in vitro in a highly efficient and specific manner through use of the Cre-loxP recombination system. . The MOI of 1000 required for efficient excision was surprisingly high and may be due to the chromatin structure not being easily accessible by the Cre recombinase at the GSK-3 loci. A plaque assay was used to establish the viral titer for one batch of virus and similar results were obtained as the end point dilution assay, hence erroneous determination of viral titer is unlikely to be a factor. However, the high MOI was not deemed to be a concern due to the lack of observable toxicity. Given that recombination induced by Cre in the GSK-3 alleles will generate complete null alleles it is expected that there is no GSK-3 expression four days after infection in the vast majority of the AdCre-treated cells. Any residual GSK-3 expression in the population of cells as a whole is contributed by rare cells in which recombination has not occurred or which have escaped viral infection. Thus, there is expected to be a small number of cells with various doses of GSK-3 depending how many alleles failed to be excised after the addition of Cre. As expected, a high increase in β-catenin expression and transactivation activity was observed, validating the effective ablation of GSK-3 activity. Using this system, we also found a profound defect in cellular growth, which can be attributed to a possible delay at the

G2/M stage of the cell cycle and a slight increase in spontaneous apoptosis. We also found

GSK-3 to be critically involved in actin organization and focal adhesion assembly during regular serum conditions and during cell spreading. In contrast, wound closure and MAPK signaling were less dependent on GSK-3 than previously suggested by previous studies.

56 4.2 Proliferation

The recent effort in developing GSK-3 inhibitors for therapeutic purposes has raised concerns about the tumorigenic potential of such inhibitors (reviewed in [155, 156]). While this work was in progress, conditionally targeted GSK-3α and β mice were crossed with an

Albumen-Cre stain that targeted Cre to the hepatocytes in liver. The resulting mice lacked GSK-

3 in hepatocytes and died two weeks post-natally from an enlarged liver. An increase in BrdU incorporation was observed indicating enhanced proliferation in the liver (Satish Patel, personal communication). In contrast, our study has found a negative effect of GSK-3 ablation on proliferation in primary MEFs. These observations are in accordance with other studies that reported a similar effect in primary endothelial and fibroblast cells [175, 176], as well as numerous cancer cell lines (reviewed in [177]). These studies are in opposition with the supposed role of GSK-3 as a tumor suppressor due to its role in inhibiting numerous substrates involved in oncogenesis. One possibility is that in the cell types where GSK-3 inhibition results in growth defects, other effects of GSK-3 inhibition may override the oncogenic potential of β- catenin and other tumorigenic substrates. In line with this, GSK-3 is overexpressed and is required for colon cancer cell proliferation and survival although β-catenin dysregulation is involved in the pathogenesis of the tumor [178]. Defects in NF-κB activation or induction of p53 activity have been reported as possible mechanisms for the proliferation defects caused by

GSK-3 inhibition. Paradoxically, another possible mechanism for the proliferation defect is through β-catenin signaling. Although β-catenin has mostly a positive involvement in cell proliferation, overexpression of a mutant stable form of β-catenin (S33Y) has been shown to promote apoptosis and cell cycle arrest in several cell systems [179-181]. A siRNA specific for

β-catenin will be used in the DKO GSK-3 MEFs to test if the proliferation defect can be rescued. Alternatively, a dominant-negative TCF4 could be used to inhibit β-catenin/TCF function using a retroviral expression system. The dominant-negative TCF4 lacks 31 amino

57 acids from the N-terminus which mediates binding to β-catenin. In this system, the β-catenin functions that are independent of its transactivation ability remain intact. We will also examine if p53-mediated mechanisms are implicated in the proliferation defect by determining p53 protein stability, the phosphorylation status of the GSK-3 phosphorylated sites and transactivation activity.

4.3 Cell Cycle Progression

A number of studies indicate that inhibition of GSK-3 leads to either an accelerated S- phase entry [19, 21, 41] or senescence at the G1/S stage of the cell cycle [176]. In primary

MEFs, the lack of GSK-3 has no apparent effect on G1/S progression and neither does it prevent cell division. The trend observed in our studies indicates a delay at the G2/M stage of the cell cycle. Inhibition of GSK-3 appears to affect entry of cells into mitosis (G2/M transition), or alternatively, their exit from mitosis (spindle assembly checkpoint) [110, 180]. Evidence pointing to an activated spindle assembly checkpoint come from studies that demonstrated inhibiton of GSK-3 affects spindle morphology and chromosome alignment resulting in an increase in the chromosome missegregation rate [109, 110]. However, mitotic cells exhibited large differences in the extent of metaphase defects depending on the GSK-3 inhibitor used. To analyze the specific point where the arrest is induced, the GSK-3 DKO primary MEFs will be synchronized in early S-phase using a double thymidine block then released into drug-free media. Cells in G2 and M phases will be distinguished based on reactivity with mitotic protein monoclonal 2 (MPM-2) antibodies. Over the next 24 hours, cells will be harvested at regular intervals, fixed, incubated with anti-MPM-2 antibodies, and analyzed by flow cytometry to observe mitotic index kinetics. Mitotic index is defined as the percentage of MPM-2 positive cells.

58 Previous studies found GSK-3 to phosporylate and regulate the activity of several proteins involved in mitosis, including Astrin [48], GCP5 [52], and Aurora-A-interacting protein

[12]. In addition, our microarray data revealed numerous significant changes in the transcription of genes encoding proteins that are directly involved in this process (data not shown). These include CDC25C, cyclin B1, PLK1, Aurora kinase A, Aurora kinase B, NEK2, BUB1 and

CENP-E. To validate the genes identified as changers in the microarray analysis of the primary

MEFs, real-time quantitative PCR analysis needs to be used in conjunction with immunoblot analysis.

4.4 Stimuli-Induced Apoptosis

The DKO MEFs displayed increased sensitivity to TNFα-induced apoptosis, consistent with previous data that have shown GSK-3β KO MEFs have elevated susceptibility to TNFα- mediated cell death and defects in NF-κB signalling [4, 134]. However, in these previous reports, the GSK-3β KO MEF were more prone to TNF-mediated cytotoxicity than in our study and this can potentially be attributed to differences in cell confluency which can affect TNFα sensitivity. GSK-3 has also been shown to amplify intrinsic apoptotic signaling following many types of cellular insults (reviewed in [182]) and we will therefore examine whether GSK-3

DKO MEFs exhibit decreased apoptosis compared to control after treatment with a range of pro- apoptotic agents.

4.5 Actin Organization and Focal Adhesion assembly

Deletion of GSK-3 in MEFs did not affect the adhesion of the cells to different substrates but led to altered cellular morphology and impaired spreading on fibronectin with dramatic changes in the organization of focal adhesions and the actin cytoskeleton. To begin to determine the molecular mechanisms of how the loss of GSK-3 affects focal adhesion assembly,

59 we will investigate the protein levels and phosporylation states of FAK and paxillin, two focal adhesion components found to be directly regulated by GSK-3. There have been conflicting reports regarding FAK regulation by GSK-3. GSK-3 was found to phosphorylate FAK on

Ser722 negatively regulating FAK activity and cell spreading [27]. Conversely, FAK is activated via autophosphorylation at Tyr397 and phosphorylation at this site was decreased during spreading on collagen in GSK-3β knock-out cells [140]. Paxillin was found to be phosphorylated on Ser126 by GSK-3 and promoted cell spreading. We will thus examine the phosphorylation status of FAK on Tyr397 and Ser722, and paxillin on Ser126 in the GSK-3-null cells. Furthermore, as paxillin is an adapter molecule [174] we will examine its ability to form a stable molecular complex with vinculin and FAK, which is known to be important for focal adhesion formation.

Rho GTPases have been shown to be key regulators of the organization of actin cytoskeleton and associated integrin adhesion complexes among other cellular processes.

Previous studies have shown that GSK-3 functions downstream of Rho [138]and Cdc42 [137] to control cellular polarity but recent work has shown that GSK-3 may in turn also regulate the activity of RhoGTPases. Jiang et al. [42] reported that phosphorylation and inhibition of p190A

RhoGAP by GSK-3 is another means by which GSK-3 regulates cellular polarization in migrating cells. RhoGAPs inactivate RhoGTPases by converting them to an inactive GDP- bound form. Inhibition of GSK-3 would thus be expected to also inhibit activity of Rho

GTPases by promoting the activity of p190 RhoGAP. Another novel mechanism by which

GSK-3 may control the Cdc42/Rac1 GTPase signaling pathway is through Cdc42 GTPase- activating protein (CdGAP), a new putative GSK-3 substrate and a negative regulator of this pathway [20]. GSK-3 phosphorylates and up-regulates the protein levels of CdGAP upon serum stimulation, but the physiological significance of this relationship has yet to be elucidated.

60 Inactivation of Rho has been implicated in loosening of adhesions eventually leading to cell rounding [174, 183]. We investigated the activation status of Rho given the decreased spreading of the DKO MEFs observed in normal serum conditions, however, we did not observe

GSK-3-dependent changes in Rho activity in the basal state or after LPA stimulation. The activation status of the other major RhoGTPases, namely Rac and Cdc42 requires further investigation and both have been shown to be activated during cell spreading [184]. Cdc42 induces actin filament assembly and filopodia formation, whereas Rac regulates actin polymerization at the plasma membrane where lamellipodia is formed. Deletion of GSK-3 in

MEFs led to an increase in filopodia formation and an associated decrease in lamaellopodial structures during cell spreading. Thus, upregulation of Cdc42 is a possible explanation for the observed phenotype in the GSK-3-null MEFs. Similar to the GSK-3 knockout MEFs, the upregulation of endogenous Cdc42 activity in primary MEFs has also been shown to promote actin filament assembly and filopodia formation during cell spreading [185]. The morphology of the GSK-3 depleted cells also resembles that of Rac-null MEFs during spreading suggesting that the observed phenotype can alternatively be caused by a down-regulation of Rac-induced lamellipodia formation [186]. In support of this hypothesis, inhibition of GSK-3 in HeLa S3 cells causes a reduction in Rac activation during spreading [140]. In addition, the inhibition of

GSK-3 appears to shift the balance towards Cdc42-mediated filopodia formation by preventing the function of Rac to form extended lamellipodia in human HaCaT keratinocytes [187]. In order to determine the activation status of Rac and Cdc42, the p21-binding domain (PBD) of

(p21)-activated kinase PAK1 fused to glutathione S-transferase (GST) can be used to precipitate a complex containing the GST-PBD bound to the active GTPase (Rac-GTP or Cdc42-GTP) at various timepoints during the spreading process. The precipitated GTPases will then be quantified by immunoblotting, using specific anti-GTPase antibodies.

61 The ability of GSK-3-null cells to migrate during the scratch assay did not seem impaired, however, given that quantification was not performed, it is possible that minor alterations in migration were not detected. The normal migration of GSK-3-null fibroblasts is somewhat surprising given previous evidence demonstrating GSK-3’s role in cellular polarity and migration, and that cells defective in organizing their actin skeleton and focal adhesions are generally expected to show altered motility. It is worth noting that loss of PINCH2 expression in

MEFs results in reduced adhesion and defective cell spreading on several substrates but retension of normal migration, indicating that abnormal actin cytoskeleton and focal adhesion morphology are not always associated with impaired migration [188].

4.6 MAPK Signaling

In this study ERK phosphorylation was not found to be specifically increased in GSK-3- null MEFs following stimulation with PMA or EGF. This is in agreement with anoter study that demonstrated no change in ERK1/2 phosphorylation following EGF, LPA and S1P stimulation.

Possible explanation of the discrepancies between our observations and other previous studies which found GSK-3 acted as a negative regulator of ERK activation may be the cell-type differences and the off-target effects caused by GSK-3 inhibitors [151, 153, 154]. As deletion of

GSK-3β in MEFs abrogates ERK activation following TNF induction, it is plausible that GSK-3 specifically represses stress-induced, but has no effect on growth factor-induced, ERK activation [134]. We also found that GSK-3 knockout cells exhibited normal p38 MAPK signaling and slightly dampened JNK/SAPK signaling upon sorbitol treatment. This finding is compatible with the previous observations that GSK-3β promotes stress-induced JNK/SAPK activation [134, 151], but has no effect on p38 phosphorylation [152].

62 4.7 Adipocyte Differentiation

While this work was in progress, DKO embryonic stem cells were found to be severly compromised in their ability to differentiate [171]. Moreover, the expression of a T-cell specific

LCK-Cre recombinase in double-floxed GSK-3 mice resulted in an early positive selection defect that preceeded differentiation of double positive into single positive CD4+ and CD8+ cells (Michael Parsons, personal communication). It is of interest to determine if a similar differentiation block occurs in the DKO GSK-3 cells. A role for GSK-3 in regulating adipocyte differentiation was proposed in view of its ability to directly regulate several critical transcription factors, including C/EBPα [189], C/EBPβ [190], CREB [66, 191], and

ADD/SREBP1c [63]. Wnt10 has been shown to inhibit adipogenesis and its expression is suppressed during this process [67, 192]. Various GSK-3 inhibitors were shown to inhibit adipogenesis [189, 190, 192] suggesting that the Wnt signalling pathway blocks preadipocyte differentiation through GSK-3. However, lithium has been shown to stabilize C/EBPα through a

GSK-3-independent pathway [193] demonstrating that the use of inhibitors has limitations due to their non-specific mechanism of action. We will examine the adipogenesis potential by treating confluent AdLacZ and AdCre infected GSK-3α(FL/FL)/β(FL/FL) MEFs with differentiation media composed of glucocorticoids, insulin and agents that elevate cAMP. After allowing the

MEFs to undergo differentiation to mature fat cells over a 7-10 day period, the cells will be fixed and stained with Oil Red-O to visually assess the cytoplasmic triacylglycerol. We will also perform immunoblot analysis to determine the expression of several adipocyte markers, i.e.

C/EBPα, C/EBPβ, C/EBPδ, PPARγ and 422/aP2.

4.8 GSK-3 Isoforms and Mutants

The analysis of the individual GSK-3 isoforms is still in its infancy due to the reliance on

GSK-3 inhibitors that are unable to discriminate between the two isoforms. We will undertake a

63 genetic analysis approach to identify the common and distinct roles for GSK-3α and β in various cellular functions including proliferation, G2/M transition, cell spreading, TNF-induced cytotoxicity and intrinsic apoptotic signaling. This will be achieved by treating GSK-3α(FL//FL)/β

(+/+) and GSK-3α(+/+)/β(FL/FL) MEFs with AdCre and AdLacZ to obtain GSK-3α(-/-)/β(+/+) (GSK-

3α KO) and GSK-3α(+/+)/β(-/-) (GSK-3β KO) MEFs. We will also generate retroviruses expressing a series of GSK-3 mutants expressing variants of GSK-3α and β (Table 4.1) to test the ability of these mutants to rescue the phenotype of the DKO cells and thus gain further insight into the role of specific regulatory mechanisms in cellular functions. The effects of genetic depletion of GSK-3 on cellular functions will also be compared to the reversible inhibition of GSK-3 using a range of small molecule inhibitors.

GSK-3α Variant GSK-3β Variant Type of Mutation GSK-3α WT +/- GFP N-term GSK-3β WT +/- GFP N- Wild type or GFP fusion for fusion term fusion visualization GSK-3α S21A GSK-3β S9A Prevents inactivating phosphorylation of pseudosubstrate GSK-3α S21D GSK-3β S9D Mimics pseudosubstrate site phosphorylation GSK-3α R159A GSK-3β R96A Prevents phosphorylation of primed substrates GSK-3α Y282F GSK-3β Y276F Prevents phosphorylation of tyrosine GSK-3α V330G; E331R GSK-3β V266G; E267R Unable to bind to axin GSK-3α K148A GSK-3β K85A ATP binding site mutant

Table 4.1 List of GSK-3α and β variants

References

65 66

1. Sridhar, R., O. Hanson-Painton, and D.R. Cooper, Protein kinases as therapeutic targets. Pharm Res, 2000. 17(11): p. 1345-53.

2. Kockeritz, L., et al., Glycogen synthase kinase-3--an overview of an over-achieving protein kinase. Curr Drug Targets, 2006. 7(11): p. 1377-88.

3. Woodgett, J.R., Molecular cloning and expression of glycogen synthase kinase-3/factor A. Embo J, 1990. 9(8): p. 2431-8.

4. Hoeflich, K.P., et al., Requirement for glycogen synthase kinase-3beta in cell survival and NF-kappaB activation. Nature, 2000. 406(6791): p. 86-90.

5. MacAulay, K., et al., Glycogen synthase kinase 3alpha-specific regulation of murine hepatic glycogen metabolism. Cell Metab, 2007. 6(4): p. 329-37.

6. Embi, N., D.B. Rylatt, and P. Cohen, Glycogen synthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur J Biochem, 1980. 107(2): p. 519-27.

7. Frame, S. and P. Cohen, GSK3 takes centre stage more than 20 years after its discovery. Biochem J, 2001. 359(Pt 1): p. 1-16.

8. Plyte, S.E., et al., Glycogen synthase kinase-3: functions in oncogenesis and development. Biochim Biophys Acta, 1992. 1114(2-3): p. 147-62.

9. Rubinfeld, B., et al., Binding of GSK3beta to the APC-beta-catenin complex and regulation of complex assembly. Science, 1996. 272(5264): p. 1023-6.

10. Zumbrunn, J., et al., Binding of the adenomatous polyposis coli protein to microtubules increases microtubule stability and is regulated by GSK3 beta phosphorylation. Curr Biol, 2001. 11(1): p. 44-9.

11. Phiel, C.J., et al., GSK-3alpha regulates production of Alzheimer's disease amyloid-beta peptides. Nature, 2003. 423(6938): p. 435-9.

12. Fumoto, K., et al., AIP regulates stability of Aurora-A at early mitotic phase coordinately with GSK-3beta(*). Oncogene, 2008.

13. Yamamoto, H., et al., Phosphorylation of axin, a Wnt signal negative regulator, by glycogen synthase kinase-3beta regulates its stability. J Biol Chem, 1999. 274(16): p. 10681-4.

14. Ikeda, S., et al., Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. Embo J, 1998. 17(5): p. 1371-84.

15. Jho, E., S. Lomvardas, and F. Costantini, A GSK3beta phosphorylation site in axin modulates interaction with beta-catenin and Tcf-mediated gene expression. Biochem Biophys Res Commun, 1999. 266(1): p. 28-35.

16. Hughes, K., et al., Identification of multifunctional ATP-citrate lyase kinase as the alpha-isoform of glycogen synthase kinase-3. Biochem J, 1992. 288 ( Pt 1): p. 309-14.

17. Benjamin, W.B., et al., ATP citrate-lyase and glycogen synthase kinase-3 beta in 3T3-L1 cells during differentiation into adipocytes. Biochem J, 1994. 300 ( Pt 2): p. 477-82.

18. Fumoto, K., C.C. Hoogenraad, and A. Kikuchi, GSK-3beta-regulated interaction of BICD with dynein is involved in microtubule anchorage at centrosome. Embo J, 2006. 25(24): p. 5670-82.

19. Kang, T., et al., GSK-3 beta targets Cdc25A for ubiquitin-mediated proteolysis, and GSK-3 beta inactivation correlates with Cdc25A overproduction in human cancers. Cancer Cell, 2008. 13(1): p. 36-47.

20. Danek, E.I., et al., Glycogen synthase kinase-3 phosphorylates CdGAP at a consensus ERK 1 regulatory site. J Biol Chem, 2007. 282(6): p. 3624-31.

21. Diehl, J.A., et al., Glycogen synthase kinase-3beta regulates cyclin D1 proteolysis and subcellular localization. Genes Dev, 1998. 12(22): p. 3499-511.

22. Welcker, M., et al., Multisite phosphorylation by Cdk2 and GSK3 controls cyclin E degradation. Mol Cell, 2003. 12(2): p. 381-92.

23. Higgins, M.J., P.R. Graves, and L.M. Graves, Regulation of human cytidine triphosphate synthetase 1 by glycogen synthase kinase 3. J Biol Chem, 2007. 282(40): p. 29493-503.

24. Price, M.A. and D. Kalderon, Proteolysis of the Hedgehog signaling effector Cubitus interruptus requires phosphorylation by Glycogen Synthase Kinase 3 and Casein Kinase 1. Cell, 2002. 108(6): p. 823-35.

25. Welsh, G.I. and C.G. Proud, Glycogen synthase kinase-3 is rapidly inactivated in response to insulin and phosphorylates eukaryotic initiation factor eIF-2B. Biochem J, 1993. 294 ( Pt 3): p. 625-9.

26. Singh, L.P., N.D. Denslow, and A.J. Wahba, Modulation of rabbit reticulocyte guanine nucleotide exchange factor activity by casein kinases 1 and 2 and glycogen synthase kinase 3. Biochemistry, 1996. 35(10): p. 3206-12.

27. Bianchi, M., et al., Regulation of FAK Ser-722 phosphorylation and kinase activity by GSK3 and PP1 during cell spreading and migration. Biochem J, 2005. 391(Pt 2): p. 359-70.

28. Fiol, C.J., et al., Formation of protein kinase recognition sites by covalent modification of the substrate. Molecular mechanism for the synergistic action of casein kinase II and glycogen synthase kinase 3. J Biol Chem, 1987. 262(29): p. 14042-8.

29. Dent, P., et al., Identification of three in vivo phosphorylation sites on the glycogen- binding subunit of protein phosphatase 1 from rabbit skeletal muscle, and their response to adrenaline. FEBS Lett, 1990. 259(2): p. 281-5.

30. Tolnay, M., Y.T. Juang, and G.C. Tsokos, Protein kinase A enhances, whereas glycogen synthase kinase-3 beta inhibits, the activity of the exon 2-encoded transactivator domain of heterogeneous nuclear ribonucleoprotein D in a hierarchical fashion. Biochem J, 2002. 363(Pt 1): p. 127-36.

31. Eldar-Finkelman, H. and E.G. Krebs, Phosphorylation of insulin receptor substrate 1 by glycogen synthase kinase 3 impairs insulin action. Proc Natl Acad Sci U S A, 1997. 94(18): p. 9660-4.

32. Park, I.K. and A.A. DePaoli-Roach, Domains of phosphatase inhibitor-2 involved in the control of the ATP-Mg-dependent protein phosphatase. J Biol Chem, 1994. 269(46): p. 28919-28.

33. Miller, M.W., et al., Phosphorylation and glycosylation of nucleoporins. Arch Biochem Biophys, 1999. 367(1): p. 51-60.

34. Timm, T., et al., Glycogen synthase kinase (GSK) 3-beta directly phosphorylates serine 212 in the regulatory loop and inhibits microtubule affinity regulating kinase (MARK) 2. J Biol Chem, 2008.

35. Mishra, R., et al., Glycogen synthase kinase-3beta induces neuronal cell death via direct phosphorylation of mixed lineage kinase 3. J Biol Chem, 2007. 282(42): p. 30393-405.

36. Maurer, U., et al., Glycogen synthase kinase-3 regulates mitochondrial outer membrane permeabilization and apoptosis by destabilization of MCL-1. Mol Cell, 2006. 21(6): p. 749-60.

37. Rossig, L., et al., Glycogen synthase kinase-3 couples AKT-dependent signaling to the regulation of p21Cip1 degradation. J Biol Chem, 2002. 277(12): p. 9684-9.

38. Kirschenbaum, F., et al., Glycogen synthase kinase-3beta regulates presenilin 1 C- terminal fragment levels. J Biol Chem, 2001. 276(33): p. 30701-7.

39. Villa-Moruzzi, E., F. Puntoni, and O. Marin, Activation of protein phosphatase-1 isoforms and glycogen synthase kinase-3 beta in muscle from mdx mice. Int J Biochem Cell Biol, 1996. 28(1): p. 13-22.

40. Hoshi, M., et al., Regulation of mitochondrial pyruvate dehydrogenase activity by tau protein kinase I/glycogen synthase kinase 3beta in brain. Proc Natl Acad Sci U S A, 1996. 93(7): p. 2719-23.

41. Surjit, M. and S.K. Lal, Glycogen synthase kinase-3 phosphorylates and regulates the stability of p27kip1 protein. Cell Cycle, 2007. 6(5): p. 580-8.

42. Jiang, W., et al., P190A RHOGAP is a glycogen synthase kinase-3beta substrate required for polarized cell migration. J Biol Chem, 2008.

43. Litovchick, L., A. Chestukhin, and J.A. DeCaprio, Glycogen synthase kinase 3 phosphorylates RBL2/p130 during quiescence. Mol Cell Biol, 2004. 24(20): p. 8970-80.

44. Yeh, T.Y., J.I. Sbodio, and N.W. Chi, Mitotic phosphorylation of tankyrase, a PARP that promotes spindle assembly, by GSK3. Biochem Biophys Res Commun, 2006. 350(3): p. 574-9.

45. Li, L., et al., Phosphorylation of TIMAP by glycogen synthase kinase-3beta activates its associated protein phosphatase 1. J Biol Chem, 2007. 282(35): p. 25960-9.

46. Inoki, K., et al., TSC2 integrates Wnt and energy signals via a coordinated phosphorylation by AMPK and GSK3 to regulate cell growth. Cell, 2006. 126(5): p. 955- 68.

47. Hergovich, A., et al., Priming-dependent phosphorylation and regulation of the tumor suppressor pVHL by glycogen synthase kinase 3. Mol Cell Biol, 2006. 26(15): p. 5784- 96.

48. Cheng, T.S., et al., Glycogen synthase kinase 3beta interacts with and phosphorylates the spindle-associated protein astrin. J Biol Chem, 2008. 283(4): p. 2454-64.

49. Cole, A.R., et al., GSK-3 phosphorylation of the Alzheimer epitope within collapsin response mediator proteins regulates axon elongation in primary neurons. J Biol Chem, 2004. 279(48): p. 50176-80.

50. Li, Y., et al., Interaction of glycogen synthase kinase 3beta with the DF3/MUC1 carcinoma-associated antigen and beta-catenin. Mol Cell Biol, 1998. 18(12): p. 7216- 24.

51. Chen, C.H., et al., Three rat brain alternative splicing dynamin-like protein variants: interaction with the glycogen synthase kinase 3beta and action as a substrate. Biochem Biophys Res Commun, 2000. 268(3): p. 893-8.

52. Izumi, N., et al., GSK-3beta regulates proper mitotic spindle formation in cooperation with a component of the gamma-tubulin ring complex, GCP5. J Biol Chem, 2008. 283(19): p. 12981-91.

53. Zeng, X., et al., A dual-kinase mechanism for Wnt co-receptor phosphorylation and activation. Nature, 2005. 438(7069): p. 873-7.

54. Lucas, F.R., et al., Inhibition of GSK-3beta leading to the loss of phosphorylated MAP- 1B is an early event in axonal remodelling induced by WNT-7a or lithium. J Cell Sci, 1998. 111 ( Pt 10): p. 1351-61.

55. Goold, R.G., R. Owen, and P.R. Gordon-Weeks, Glycogen synthase kinase 3beta phosphorylation of microtubule-associated protein 1B regulates the stability of microtubules in growth cones. J Cell Sci, 1999. 112 ( Pt 19): p. 3373-84.

56. Sanchez, C., et al., Phosphorylation and dephosphorylation in the proline-rich C- terminal domain of microtubule-associated protein 2. Eur J Biochem, 1996. 241(3): p. 765-71.

57. Sanchez, C., M. Perez, and J. Avila, GSK3beta-mediated phosphorylation of the microtubule-associated protein 2C (MAP2C) prevents microtubule bundling. Eur J Cell Biol, 2000. 79(4): p. 252-60.

58. Mackie, K., et al., Identification of two protein kinases that phosphorylate the neural cell-adhesion molecule, N-CAM. J Neurosci, 1989. 9(6): p. 1883-96.

59. Hong, Y.R., et al., Cloning and characterization of a novel human ninein protein that interacts with the glycogen synthase kinase 3beta. Biochim Biophys Acta, 2000. 1492(2- 3): p. 513-6.

60. Cai, X., et al., Glycogen synthase kinase 3- and extracellular signal-regulated kinase- dependent phosphorylation of paxillin regulates cytoskeletal rearrangement. Mol Cell Biol, 2006. 26(7): p. 2857-68.

61. Hanger, D.P., et al., Glycogen synthase kinase-3 induces Alzheimer's disease-like phosphorylation of tau: generation of paired helical filament epitopes and neuronal localisation of the kinase. Neurosci Lett, 1992. 147(1): p. 58-62.

62. Krymsky, M.A., et al., Phosphorylation of kinase-related protein (telokin) in tonic and phasic smooth muscles. J Muscle Res Cell Motil, 2001. 22(5): p. 425-37.

63. Kim, K.H., et al., Regulatory role of glycogen synthase kinase 3 for transcriptional activity of ADD1/SREBP1c. J Biol Chem, 2004. 279(50): p. 51999-2006.

64. Viatour, P., et al., GSK3-mediated BCL-3 phosphorylation modulates its degradation and its oncogenicity. Mol Cell, 2004. 16(1): p. 35-45.

65. Yost, C., et al., The axis-inducing activity, stability, and subcellular distribution of beta- catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev, 1996. 10(12): p. 1443-54.

66. Fiol, C.J., et al., A secondary phosphorylation of CREB341 at Ser129 is required for the cAMP-mediated control of gene expression. A role for glycogen synthase kinase-3 in the control of gene expression. J Biol Chem, 1994. 269(51): p. 32187-93.

67. Ross, S.E., et al., Inhibition of adipogenesis by Wnt signaling. Science, 2000. 289(5481): p. 950-3.

68. Piwien-Pilipuk, G., et al., Growth hormone regulates phosphorylation and function of CCAAT/enhancer-binding protein beta by modulating Akt and glycogen synthase kinase- 3. J Biol Chem, 2001. 276(22): p. 19664-71.

69. Boyle, W.J., et al., Activation of protein kinase C decreases phosphorylation of c-Jun at sites that negatively regulate its DNA-binding activity. Cell, 1991. 64(3): p. 573-84.

70. Sears, R., et al., Multiple Ras-dependent phosphorylation pathways regulate Myc protein stability. Genes Dev, 2000. 14(19): p. 2501-14.

71. Pulverer, B.J., et al., Site-specific modulation of c-Myc cotransformation by residues phosphorylated in vivo. Oncogene, 1994. 9(1): p. 59-70.

72. Morisco, C., et al., Glycogen synthase kinase 3beta regulates GATA4 in cardiac myocytes. J Biol Chem, 2001. 276(30): p. 28586-97.

73. Rogatsky, I., C.L. Waase, and M.J. Garabedian, Phosphorylation and inhibition of rat glucocorticoid receptor transcriptional activation by glycogen synthase kinase-3 (GSK- 3). Species-specific differences between human and rat glucocorticoid receptor signaling as revealed through GSK-3 phosphorylation. J Biol Chem, 1998. 273(23): p. 14315-21.

74. Chu, B., et al., Sequential phosphorylation by mitogen-activated protein kinase and glycogen synthase kinase 3 represses transcriptional activation by heat shock factor-1. J Biol Chem, 1996. 271(48): p. 30847-57.

75. Mottet, D., et al., Regulation of hypoxia-inducible factor-1alpha protein level during hypoxic conditions by the phosphatidylinositol 3-kinase/Akt/glycogen synthase kinase 3beta pathway in HepG2 cells. J Biol Chem, 2003. 278(33): p. 31277-85.

76. Takeda, K., et al., Ser298 of MITF, a mutation site in Waardenburg syndrome type 2, is a phosphorylation site with functional significance. Hum Mol Genet, 2000. 9(1): p. 125- 32.

77. Khaled, M., et al., Glycogen synthase kinase 3beta is activated by cAMP and plays an active role in the regulation of melanogenesis. J Biol Chem, 2002. 277(37): p. 33690-7.

78. Moore, K.B., M.L. Schneider, and M.L. Vetter, Posttranslational mechanisms control the timing of bHLH function and regulate retinal cell fate. Neuron, 2002. 34(2): p. 183- 95.

79. Beals, C.R., et al., Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science, 1997. 275(5308): p. 1930-4.

80. Neal, J.W. and N.A. Clipstone, A constitutively active NFATc1 mutant induces a transformed phenotype in 3T3-L1 fibroblasts. J Biol Chem, 2003. 278(19): p. 17246-54.

81. Buss, H., et al., Phosphorylation of serine 468 by GSK-3beta negatively regulates basal p65 NF-kappaB activity. J Biol Chem, 2004. 279(48): p. 49571-4.

82. Demarchi, F., et al., Glycogen synthase kinase-3 beta regulates NF-kappa B1/p105 stability. J Biol Chem, 2003. 278(41): p. 39583-90.

83. Murray, J.T., et al., Exploitation of KESTREL to identify NDRG family members as physiological substrates for SGK1 and GSK3. Biochem J, 2004. 384(Pt 3): p. 477-88.

84. Espinosa, L., et al., Phosphorylation by glycogen synthase kinase-3 beta down-regulates Notch activity, a link for Notch and Wnt pathways. J Biol Chem, 2003. 278(34): p. 32227-35.

85. Foltz, D.R., et al., Glycogen synthase kinase-3beta modulates notch signaling and stability. Curr Biol, 2002. 12(12): p. 1006-11.

86. Turenne, G.A. and B.D. Price, Glycogen synthase kinase3 beta phosphorylates serine 33 of p53 and activates p53's transcriptional activity. BMC Cell Biol, 2001. 2: p. 12.

87. Guo, X., et al., Axin and GSK3- control Smad3 protein stability and modulate TGF- signaling. Genes Dev, 2008. 22(1): p. 106-20.

88. Zhou, B.P., et al., Dual regulation of Snail by GSK-3beta-mediated phosphorylation in control of epithelial-mesenchymal transition. Nat Cell Biol, 2004. 6(10): p. 931-40.

89. Martinek, S., et al., A role for the segment polarity gene shaggy/GSK-3 in the Drosophila circadian clock. Cell, 2001. 105(6): p. 769-79.

90. Han, S.I., et al., MafA stability in pancreatic beta cells is regulated by glucose and is dependent on its constitutive phosphorylation at multiple sites by glycogen synthase kinase 3. Mol Cell Biol, 2007. 27(19): p. 6593-605.

91. ter Haar, E., et al., Structure of GSK3beta reveals a primed phosphorylation mechanism. Nat Struct Biol, 2001. 8(7): p. 593-6.

92. Dajani, R., et al., Crystal structure of glycogen synthase kinase 3 beta: structural basis for phosphate-primed substrate specificity and autoinhibition. Cell, 2001. 105(6): p. 721-32.

93. Grimes, C.A. and R.S. Jope, The multifaceted roles of glycogen synthase kinase 3beta in cellular signaling. Prog Neurobiol, 2001. 65(4): p. 391-426.

94. Thornton, T.M., et al., Phosphorylation by p38 MAPK as an alternative pathway for GSK3beta inactivation. Science, 2008. 320(5876): p. 667-70.

95. Hughes, K., et al., Modulation of the glycogen synthase kinase-3 family by tyrosine phosphorylation. Embo J, 1993. 12(2): p. 803-8.

96. Pearl, L.H. and D. Barford, Regulation of protein kinases in insulin, growth factor and Wnt signalling. Curr Opin Struct Biol, 2002. 12(6): p. 761-7.

97. Bijur, G.N. and R.S. Jope, Glycogen synthase kinase-3 beta is highly activated in nuclei and mitochondria. Neuroreport, 2003. 14(18): p. 2415-9.

98. Seidensticker, M.J. and J. Behrens, Biochemical interactions in the wnt pathway. Biochim Biophys Acta, 2000. 1495(2): p. 168-82.

99. Hinoi, T., et al., Complex formation of adenomatous polyposis coli gene product and axin facilitates glycogen synthase kinase-3 beta-dependent phosphorylation of beta- catenin and down-regulates beta-catenin. J Biol Chem, 2000. 275(44): p. 34399-406.

100. Liu, C., et al., Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell, 2002. 108(6): p. 837-47.

101. Peifer, M., L.M. Pai, and M. Casey, Phosphorylation of the Drosophila adherens junction protein Armadillo: roles for wingless signal and zeste-white 3 kinase. Dev Biol, 1994. 166(2): p. 543-56.

102. Wu, G. and X. He, Threonine 41 in beta-catenin serves as a key phosphorylation relay residue in beta-catenin degradation. Biochemistry, 2006. 45(16): p. 5319-23.

103. Bilic, J., et al., Wnt induces LRP6 signalosomes and promotes dishevelled-dependent LRP6 phosphorylation. Science, 2007. 316(5831): p. 1619-22.

104. Zeng, X., et al., Initiation of Wnt signaling: control of Wnt coreceptor Lrp6 phosphorylation/activation via frizzled, dishevelled and axin functions. Development, 2008. 135(2): p. 367-75.

105. Behrens, J., et al., Functional interaction of beta-catenin with the transcription factor LEF-1. Nature, 1996. 382(6592): p. 638-42.

106. Pines, J. and C.L. Rieder, Re-staging mitosis: a contemporary view of mitotic progression. Nat Cell Biol, 2001. 3(1): p. E3-6.

107. Elledge, S.J., Cell cycle checkpoints: preventing an identity crisis. Science, 1996. 274(5293): p. 1664-72.

108. Forde, J.E. and T.C. Dale, Glycogen synthase kinase 3: a key regulator of cellular fate. Cell Mol Life Sci, 2007. 64(15): p. 1930-44.

109. Wakefield, J.G., D.J. Stephens, and J.M. Tavare, A role for glycogen synthase kinase-3 in mitotic spindle dynamics and chromosome alignment. J Cell Sci, 2003. 116(Pt 4): p. 637-46.

110. Tighe, A., et al., GSK-3 inhibitors induce chromosome instability. BMC Cell Biol, 2007. 8: p. 34.

111. Akhmanova, A., et al., Clasps are CLIP-115 and -170 associating proteins involved in the regional regulation of microtubule dynamics in motile fibroblasts. Cell, 2001. 104(6): p. 923-35.

112. Hengartner, M.O., The biochemistry of apoptosis. Nature, 2000. 407(6805): p. 770-6.

113. Pap, M. and G.M. Cooper, Role of glycogen synthase kinase-3 in the phosphatidylinositol 3-Kinase/Akt cell survival pathway. J Biol Chem, 1998. 273(32): p. 19929-32.

114. Watcharasit, P., et al., Direct, activating interaction between glycogen synthase kinase- 3beta and p53 after DNA damage. Proc Natl Acad Sci U S A, 2002. 99(12): p. 7951-5.

115. Loberg, R.D., E. Vesely, and F.C. Brosius, 3rd, Enhanced glycogen synthase kinase- 3beta activity mediates hypoxia-induced apoptosis of vascular smooth muscle cells and is prevented by glucose transport and metabolism. J Biol Chem, 2002. 277(44): p. 41667-73.

116. Song, L., P. De Sarno, and R.S. Jope, Central role of glycogen synthase kinase-3beta in endoplasmic reticulum stress-induced caspase-3 activation. J Biol Chem, 2002. 277(47): p. 44701-8.

117. Tong, N., et al., Activation of glycogen synthase kinase 3 beta (GSK-3beta) by platelet activating factor mediates migration and cell death in cerebellar granule neurons. Eur J Neurosci, 2001. 13(10): p. 1913-22.

118. Bijur, G.N., P. De Sarno, and R.S. Jope, Glycogen synthase kinase-3beta facilitates staurosporine- and heat shock-induced apoptosis. Protection by lithium. J Biol Chem, 2000. 275(11): p. 7583-90.

119. Linseman, D.A., et al., Glycogen synthase kinase-3beta phosphorylates Bax and promotes its mitochondrial localization during neuronal apoptosis. J Neurosci, 2004. 24(44): p. 9993-10002.

120. Pap, M. and G.M. Cooper, Role of translation initiation factor 2B in control of cell survival by the phosphatidylinositol 3-kinase/Akt/glycogen synthase kinase 3beta signaling pathway. Mol Cell Biol, 2002. 22(2): p. 578-86.

121. Qu, L., et al., Endoplasmic reticulum stress induces p53 cytoplasmic localization and prevents p53-dependent apoptosis by a pathway involving glycogen synthase kinase- 3beta. Genes Dev, 2004. 18(3): p. 261-77.

122. Kulikov, R., K.A. Boehme, and C. Blattner, Glycogen synthase kinase 3-dependent phosphorylation of Mdm2 regulates p53 abundance. Mol Cell Biol, 2005. 25(16): p. 7170-80.

123. Watcharasit, P., et al., Glycogen synthase kinase-3beta (GSK3beta) binds to and promotes the actions of p53. J Biol Chem, 2003. 278(49): p. 48872-9.

124. Beurel, E., et al., GSK-3beta inhibition by lithium confers resistance to chemotherapy- induced apoptosis through the repression of CD95 (Fas/APO-1) expression. Exp Cell Res, 2004. 300(2): p. 354-64.

125. Bijur, G.N. and R.S. Jope, Opposing actions of phosphatidylinositol 3-kinase and glycogen synthase kinase-3beta in the regulation of HSF-1 activity. J Neurochem, 2000. 75(6): p. 2401-8.

126. Ashkenazi, A. and V.M. Dixit, Death receptors: signaling and modulation. Science, 1998. 281(5381): p. 1305-8.

127. Schwabe, R.F. and D.A. Brenner, Role of glycogen synthase kinase-3 in TNF-alpha- induced NF-kappaB activation and apoptosis in hepatocytes. Am J Physiol Gastrointest Liver Physiol, 2002. 283(1): p. G204-11.

128. Liao, X., et al., Glycogen synthase kinase-3beta suppression eliminates tumor necrosis factor-related apoptosis-inducing ligand resistance in prostate cancer. Mol Cancer Ther, 2003. 2(11): p. 1215-22.

129. Song, L., T. Zhou, and R.S. Jope, Lithium facilitates apoptotic signaling induced by activation of the Fas death domain-containing receptor. BMC Neurosci, 2004. 5: p. 20.

130. Stambolic, V., L. Ruel, and J.R. Woodgett, Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells. Curr Biol, 1996. 6(12): p. 1664-8.

131. Klein, P.S. and D.A. Melton, A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci U S A, 1996. 93(16): p. 8455-9.

132. Steinbrecher, K.A., et al., Glycogen synthase kinase 3beta functions to specify gene- specific, NF-kappaB-dependent transcription. Mol Cell Biol, 2005. 25(19): p. 8444-55.

133. Sanchez, J.F., et al., Glycogen synthase kinase 3beta-mediated apoptosis of primary cortical astrocytes involves inhibition of nuclear factor kappaB signaling. Mol Cell Biol, 2003. 23(13): p. 4649-62.

134. Takada, Y., et al., Genetic deletion of glycogen synthase kinase-3beta abrogates activation of IkappaBalpha kinase, JNK, Akt, and p44/p42 MAPK but potentiates apoptosis induced by tumor necrosis factor. J Biol Chem, 2004. 279(38): p. 39541-54.

135. Bradke, F. and C.G. Dotti, Establishment of neuronal polarity: lessons from cultured hippocampal neurons. Curr Opin Neurobiol, 2000. 10(5): p. 574-81.

136. Vincente-Manzanares, M., D.J. Webb, and A.R. Horwitz, Cell migration at a glance. J Cell Sci, 2005. 118 (Pt. 21): p. 4917-4919.

137. Etienne-Manneville, S. and A. Hall, Cdc42 regulates GSK-3beta and adenomatous polyposis coli to control cell polarity. Nature, 2003. 421(6924): p. 753-6.

138. Eng, C.H., T.M. Huckaba, and G.G. Gundersen, The formin mDia regulates GSK3beta through novel PKCs to promote microtubule stabilization but not MTOC reorientation in migrating fibroblasts. Mol Biol Cell, 2006. 17(12): p. 5004-16.

139. Farooqui, R., S. Zhu, and G. Fenteany, Glycogen synthase kinase-3 acts upstream of ADP-ribosylation factor 6 and Rac1 to regulate epithelial cell migration. Exp Cell Res, 2006. 312(9): p. 1514-25.

140. Kobayashi, T., et al., Glycogen synthase kinase 3 and h-prune regulate cell migration by modulating focal adhesions. Mol Cell Biol, 2006. 26(3): p. 898-911.

141. Jiang, H., et al., Both the establishment and the maintenance of neuronal polarity require active mechanisms: critical roles of GSK-3beta and its upstream regulators. Cell, 2005. 120(1): p. 123-35.

142. Gartner, A., X. Huang, and A. Hall, Neuronal polarity is regulated by glycogen synthase kinase-3 (GSK-3beta) independently of Akt/PKB serine phosphorylation. J Cell Sci, 2006. 119(Pt 19): p. 3927-34.

143. Shi, S.H., et al., APC and GSK-3beta are involved in mPar3 targeting to the nascent axon and establishment of neuronal polarity. Curr Biol, 2004. 14(22): p. 2025-32.

144. Eickholt, B.J., F.S. Walsh, and P. Doherty, An inactive pool of GSK-3 at the leading edge of growth cones is implicated in Semaphorin 3A signaling. J Cell Biol, 2002. 157(2): p. 211-7.

145. Owen, R. and P.R. Gordon-Weeks, Inhibition of glycogen synthase kinase 3beta in sensory neurons in culture alters filopodia dynamics and microtubule distribution in growth cones. Mol Cell Neurosci, 2003. 23(4): p. 626-37.

146. Fritsche, J., et al., Differential cytoskeletal changes during growth cone collapse in response to hSema III and thrombin. Mol Cell Neurosci, 1999. 14(4-5): p. 398-418.

147. Rosslenbroich, V., et al., Collapsin response mediator protein-4 regulates F-actin bundling. Exp Cell Res, 2005. 310(2): p. 434-44.

148. Uchida, Y., et al., Semaphorin3A signalling is mediated via sequential Cdk5 and GSK3beta phosphorylation of CRMP2: implication of common phosphorylating mechanism underlying axon guidance and Alzheimer's disease. Genes Cells, 2005. 10(2): p. 165-79.

149. Schaeffer, H.J. and M.J. Weber, Mitogen-activated protein kinases: specific messages from ubiquitous messengers. Mol Cell Biol, 1999. 19(4): p. 2435-44.

150. Pearson, N.K., et al., The effect of a domiciliary denture service on oral health related quality of life: a randomised controlled trial. Br Dent J, 2007. 203(2): p. E3; discussion 100-1.

151. Kim, J.W., et al., Glycogen synthase kinase 3 beta is a natural activator of mitogen- activated protein kinase/extracellular signal-regulated kinase kinase kinase 1 (MEKK1). J Biol Chem, 2003. 278(16): p. 13995-4001.

152. Liu, S., et al., Glycogen synthase kinase 3beta is a negative regulator of growth factor- induced activation of the c-Jun N-terminal kinase. J Biol Chem, 2004. 279(49): p. 51075-81.

153. Wang, Q., et al., Glycogen synthase kinase-3 is a negative regulator of extracellular signal-regulated kinase. Oncogene, 2006. 25(1): p. 43-50.

154. Kim, S.D., et al., Inhibition of GSK-3beta mediates expression of MMP-9 through ERK1/2 activation and translocation of NF-kappaB in rat primary astrocyte. Brain Res, 2007. 1186: p. 12-20.

155. Cohen, P. and M. Goedert, GSK3 inhibitors: development and therapeutic potential. Nat Rev Drug Discov, 2004. 3(6): p. 479-87.

156. Jope, R.S., C.J. Yuskaitis, and E. Beurel, Glycogen synthase kinase-3 (GSK3): inflammation, diseases, and therapeutics. Neurochem Res, 2007. 32(4-5): p. 577-95.

157. Bain, J., et al., The selectivity of protein kinase inhibitors: a further update. Biochem J, 2007. 408(3): p. 297-315.

158. Phiel, C.J. and P.S. Klein, Molecular targets of lithium action. Annu Rev Pharmacol Toxicol, 2001. 41: p. 789-813.

159. Polychronopoulos, P., et al., Structural basis for the synthesis of indirubins as potent and selective inhibitors of glycogen synthase kinase-3 and cyclin-dependent kinases. J Med Chem, 2004. 47(4): p. 935-46.

160. Leost, M., et al., Paullones are potent inhibitors of glycogen synthase kinase-3beta and cyclin-dependent kinase 5/p25. Eur J Biochem, 2000. 267(19): p. 5983-94.

161. Coghlan, M.P., et al., Selective small molecule inhibitors of glycogen synthase kinase-3 modulate glycogen metabolism and gene transcription. Chem Biol, 2000. 7(10): p. 793- 803.

162. Polakis, P., Wnt signaling and cancer. Genes Dev, 2000. 14(15): p. 1837-51.

163. Boissan, M., et al., Overexpression of insulin receptor substrate-2 in human and murine hepatocellular carcinoma. Am J Pathol, 2005. 167(3): p. 869-77.

164. Goto, H., et al., Expression of cyclin D1 and GSK-3beta and their predictive value of prognosis in squamous cell carcinomas of the tongue. Oral Oncol, 2002. 38(6): p. 549- 56.

165. Mulholland, D.J., et al., PTEN and GSK3beta: key regulators of progression to androgen-independent prostate cancer. Oncogene, 2006. 25(3): p. 329-37.

166. Farago, M., et al., Kinase-inactive glycogen synthase kinase 3beta promotes Wnt signaling and mammary tumorigenesis. Cancer Res, 2005. 65(13): p. 5792-801.

167. Ma, C., et al., The role of glycogen synthase kinase 3beta in the transformation of epidermal cells. Cancer Res, 2007. 67(16): p. 7756-64.

168. Cohen, Y., et al., Cancer morbidity in psychiatric patients: influence of lithium carbonate treatment. Med Oncol, 1998. 15(1): p. 32-6.

169. Cline, G.W., et al., Effects of a novel glycogen synthase kinase-3 inhibitor on insulin- stimulated glucose metabolism in Zucker diabetic fatty (fa/fa) rats. Diabetes, 2002. 51(10): p. 2903-10.

170. Jackson, A.L. and P.S. Linsley, Noise amidst the silence: off-target effects of siRNAs? Trends Genet, 2004. 20(11): p. 521-4.

171. Doble, B.W., et al., Functional redundancy of GSK-3alpha and GSK-3beta in Wnt/beta- catenin signaling shown by using an allelic series of embryonic stem cell lines. Dev Cell, 2007. 12(6): p. 957-71.

172. Patel, S., et al., Tissue-specific role of glycogen synthase kinase-3b in glucose homeostasis and insulin action. 2008.

173. Hall, A., Rho GTPases and the control of cell behaviour. Biochem Soc Trans, 2005. 33(Pt 5): p. 891-5.

174. Petit, V. and J.P. Thiery, Focal adhesions: structure and dynamics. Biol Cell, 2000. 92(7): p. 477-94.

175. Mao, C.D., P. Hoang, and P.E. DiCorleto, Lithium inhibits cell cycle progression and induces stabilization of p53 in bovine aortic endothelial cells. J Biol Chem, 2001. 276(28): p. 26180-8.

176. Damalas, A., et al., Excess beta-catenin promotes accumulation of transcriptionally active p53. Embo J, 1999. 18(11): p. 3054-63.

177. Ougolkov, A.V. and D.D. Billadeau, Targeting GSK-3: a promising approach for cancer therapy? Future Oncol, 2006. 2(1): p. 91-100.

178. Shakoori, A., et al., Deregulated GSK3beta activity in colorectal cancer: its association with tumor cell survival and proliferation. Biochem Biophys Res Commun, 2005. 334(4): p. 1365-73.

179. Kim, K., et al., Overexpression of beta-catenin induces apoptosis independent of its transactivation function with LEF-1 or the involvement of major G1 cell cycle regulators. Mol Biol Cell, 2000. 11(10): p. 3509-23.

180. Olmeda, D., et al., Beta-catenin regulation during the cell cycle: implications in G2/M and apoptosis. Mol Biol Cell, 2003. 14(7): p. 2844-60.

181. Ahmed, Y., et al., Regulation of armadillo by a Drosophila APC inhibits neuronal apoptosis during retinal development. Cell, 1998. 93(7): p. 1171-82.

182. Beurel, E. and R.S. Jope, The paradoxical pro- and anti-apoptotic actions of GSK3 in the intrinsic and extrinsic apoptosis signaling pathways. Prog Neurobiol, 2006. 79(4): p. 173-89.

183. Paterson, H.F., et al., Microinjection of recombinant p21rho induces rapid changes in cell morphology. J Cell Biol, 1990. 111(3): p. 1001-7.

184. Price, L.S., et al., Activation of Rac and Cdc42 by integrins mediates cell spreading. Mol Biol Cell, 1998. 9(7): p. 1863-71.

185. Yang, L., L. Wang, and Y. Zheng, Gene targeting of Cdc42 and Cdc42GAP affirms the critical involvement of Cdc42 in filopodia induction, directed migration, and proliferation in primary mouse embryonic fibroblasts. Mol Biol Cell, 2006. 17(11): p. 4675-85.

186. Vidali, L., et al., Rac1-null mouse embryonic fibroblasts are motile and respond to platelet-derived growth factor. Mol Biol Cell, 2006. 17(5): p. 2377-90.

187. Koivisto, L., et al., Glycogen synthase kinase-3 regulates cytoskeleton and translocation of Rac1 in long cellular extensions of human keratinocytes. Exp Cell Res, 2004. 293(1): p. 68-80.

188. Stanchi, F., et al., Consequences of loss of PINCH2 expression in mice. J Cell Sci, 2005. 118(Pt 24): p. 5899-910.

189. Ross, S.E., et al., Glycogen synthase kinase 3 is an insulin-regulated C/EBPalpha kinase. Mol Cell Biol, 1999. 19(12): p. 8433-41.

190. Tang, Q.Q., et al., Sequential phosphorylation of CCAAT enhancer-binding protein beta by MAPK and glycogen synthase kinase 3beta is required for adipogenesis. Proc Natl Acad Sci U S A, 2005. 102(28): p. 9766-71.

191. Reusch, J.E., L.A. Colton, and D.J. Klemm, CREB activation induces adipogenesis in 3T3-L1 cells. Mol Cell Biol, 2000. 20(3): p. 1008-20.

192. Bennett, C.N., et al., Regulation of Wnt signaling during adipogenesis. J Biol Chem, 2002. 277(34): p. 30998-1004.

193. Shim, M. and R.C. Smart, Lithium stabilizes the CCAAT/enhancer-binding protein alpha (C/EBPalpha) through a glycogen synthase kinase 3 (GSK3)-independent pathway involving direct inhibition of proteasomal activity. J Biol Chem, 2003. 278(22): p. 19674-81.

194. Linding, R., et al., Systematic discovery of in vivo phosphorylation networks. Cell, 2007. 129(7): p. 1415-26.

195. Kasof, G.M., L. Goyal, and E. White, Btf, a novel death-promoting transcriptional repressor that interacts with Bcl-2-related proteins. Mol Cell Biol, 1999. 19(6): p. 4390- 404.

196. Liu, H., et al., Protein kinase C delta induces transcription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. Mol Cell Biol, 2007. 27(24): p. 8480-91.

197. Anderson, L. and C.L. Hunter, Quantitative mass spectrometric multiple reaction monitoring assays for major plasma proteins. Mol Cell Proteomics, 2006. 5(4): p. 573- 88.

198. Cox, D.M., et al., Multiple reaction monitoring as a method for identifying protein posttranslational modifications. J Biomol Tech, 2005. 16(2): p. 83-90.

199. Cole, A.R., et al., Distinct priming kinases contribute to differential regulation of collapsin response mediator proteins by glycogen synthase kinase-3 in vivo. J Biol Chem, 2006. 281(24): p. 16591-8.

Appendix: Identification of Novel GSK-3 Substrates

82 83

A.1 Introduction

Decades of proteome-wide mapping studies using mass spectrometry as well as lower throughput analyses have identified thousands of in vivo phosphorylation sites, and have prompted the development of computational methods to determine which specific kinase is responsible for the phosphorylation of an observed site [194]. These methods are based on the consensus sequence motifs recognized by the active site of kinase catalytic domain. However, the specificity of consensus motifs per se is limited since substrate specificities of protein kinases are also influenced by contextual factors, such as auxiliary protein interactions, scaffolds, coexpression and colocalization. An integrative computational approach, NetworKin, has recently been developed to improve the accuracy of the predictions by using context, represented by a probabilistic functional protein association network extracted from the

STRING database, in addition to consensus sequence motifs. This method has been shown to significantly improve the accuracy of prediction and to pinpoint a specific kinase product rather than the general family of the responsible kinase.

GSK-3 was predicted to have over 500 substrates using NetworKIN and represents the kinase with the highest number of predicted targets using this algoithm. This is a factor of the relatively loose substrate consensus for the kinase as well as its relative promiscuity compared to many kinases that have a very narrow range of targets One of the novel predicted GSK-3 substrates is BCL-2-associated transcription factor 1 (BCLAF1), a protein initially found to interact with several members of the BCL-2 family of proteins and that interferes with the transcriptional repression activity and death-promoting function of BLCAF1 [195]. More evidence to support the pro-apoptotic function of BCLAF1 has recently been provided in a study that demonstrated protein kinase C (PKC ) activates and interacts with BCLAF1 to induce p53

Site Peptide Motif Context S177 EGEPQEESLKSKSQ 0.516 0.972

S222 GLSAYDNSRSPHSP 0.516 0.972

S285 GNGSSRYSSQNSPI 0.510 0.972

S318 EGEPQEESLKSKSQ 0.516 0.972

S531 KSTFREESLRIKMI 0.505 0.972

S658 IHRRIDISSTLRKH 0.505 0.972

S757 RSSSSSASSSPSSR 0.505 0.972

S760 SSSASPSSSSREEK 0.510 0.972

Table A.1: Predicted GSK-3 phosphorylation sites on BCLAF1 identified using NetworKin. The score assigned by NetworKin based on consensus motif, and the score augmented by the contextual factors are indicated for eight BCLAF1 sites predicted to be phosphorylated by GSK-3.

85 promoter activity during DNA damage [196]. However, little is known about the kinases that target this protein. As shown in table A.1, NetworKIN predicted several BCLAF1 serine sites.be phosphorylated by GSK-3. The aim of this study was to utilize mass spectrometry to validate the prediction of BCLAF1 as a novel GSK-3 substrate, hence providing validation of the utility of

NetworKin as a bioinformatics tool. A mass-spectrometric scan mode called multiple reaction monitoring (MRM) is well suited to correlate quantified changes in the phosphorylation level of specific monitored sites in the presence or absence of LiCl, a well-established GSK-3 inhibitor

[130, 131]. The MRM assay approach has been used applied to the measurement of specific peptides in complex mixtures, such as for verifying candidate biomarker proteins in blood [197].

Its more recent application to protein mass spectrometry allows semi-quantitative analysis of phosphopeptides [198]. We employed this approach to evaluate the phosphorylation state of

BCLAF1 with and without inhibition of GSK-3.

A.2 Materials and Methods

A.2.1 Immunoprecipitation of BCLAF1

HEK293 were treated with 20 mM LiCl for 2 h or left untreated and then harvested and resuspended in a lysis buffer containing 1% Triton X-100, 50 mM Tris pH 7.5, 150 mM NaCl,

50 mM β-glycerolphosphate, 10 mM sodium pyrophosphate, 30 mM NaF, 2 mM EDTA, 2 mM

MgCl2, 1 mM DTT, 100 uM sodium orthovanadate, phosphatase inhibitor cocktail 1 (Sigma), and mini complete EDTA-free protease inhibitor cocktail (Roche). Lysates were passed through a 22.5 gauge needle and were cleared by centrifugation for 10 minutes at 40,000 g. The supernatant was precleared with GammaBind Plus Sepharose (GE Healthcare) before endogenous BCLAF1 was immunoprecipitated with a rabbit anti-BCLAF1 antibody (Bethyl

Laboratories, A300-608A). Immunoprecipitates were washed and boiled in reducing gel sample

86 buffer prior to separation on an 8-16% SDS-PAGE gel. Gels were stained with GelCode Blue

(Pierce), destained, and excised gel bands containing BCLAF1 protein were cut into smaller pieces.

A.2.2 In-gel Enzymatic Cleavage and Extraction of Peptides

Gel pieces were incubated with 50 μl of 100mM NH4HCO3 for 10 min on ice. The supernatant was removed followed by incubation with 50 μl of 95% ethanol and 5% 100mM

NH4HCO3 solution for 20 min on ice to dehydrate the samples. 40 μl of 5mM DTT in 100 mM

NH4HCO3 was then added to the samples for 30 min at 50°C to reduce cysteines. Samples were dehydrated for 10 min and cysteines were modified by incubating with 40 μl 55mM iodoacetamide in 100 mM NH4HCO3 for 45 min in the dark at room temperature. 50 μl of 95% ethanol and 5% 100mM NH4HCO3 solution was added in between each step for 10 min on ice to shrink the gel pieces. After a final dehydration step, 50 μl of 12.5 ng/ul of trypsin (Promega) in 50 mM NH4HCO3 and 5mM CaCl2 was incubated with each gel piece for 20 min on ice. The trypsin solution was removed and the samples were incubated with 15 μl of digestion buffer (50 mM NH4HCO3 and 5mM CaCl2) overnight in the 37°C waterbath. The supernatant was combined with the solution from the peptide extraction. The peptides were extracted in two rounds, by incubating the gel pieces each time with 40 μl of 5% formic acid for 20 min on ice.

The combined solution was lyophilized using a speed vac on no heat for 2 h.

A.2.3 Quantification of BCLAF1 Phosphorylation

Following lyophilization, the tryptic peptides were analyzed by liquid chromatography mass spectrometry utilizing an ABI/Sciex Tempo 1Dplus LC (Applied Biosystems, Foster City,

CA) into an ABI/Sciex QSTAR Elite mass spectrometer (ABI/Sciex, Foster City, CA). One clearly identified peptide containing a predicted GSK-3 site, STFREEsPLR, was selected for

87 further quantitative assay. Briefly, a targeted MRM analysis of the selected S531 peptide

STFREESPLR and the corresponding phosphopeptide (STFREEsPLR) was performed using the most predominant product ion fragment identified from the full scan MS/MS spectra. An MRM assay for the parent ion masses and proline promoted fragment ions of the unmodified (b7) and phosphorylated (b7-98) peptide was performed using an ABI/Sciex Tempo 1Dplus LC into an

ABI/Sciex 4000QTRAP. The extracted ion currents (XIC) of the BCLAF1 peptides were integrated using Analyst 2.0 software (ABI/Sciex), and the ratio of phosphorylated/nonphosphorylated peptide amounts were calculated and compared to the same ratio calculated after inhibition of GSK-3 with LiCl. The experiment was repeated twice on different days on different cell populations.

A.3 Results

A mass spectrometry full scan was first employed to identify predicted GSK-3 phosphorylation sites on the BCLAF1 protein. HEK293 cells (20x107) were either untreated or treated with LiCl for 2 h to inhibit GSK-3 function and BCLAF1 was immunoprecipitated with a commercial antibody. Following gel purification BCLAF1 was subjected to proteolytic peptide fragmentation and mass spectrometry analysis to identify phosphorylated peptides. In this analysis, 17 and 10 BCLAF1 phosphorylation sites were identified in the nontreated and

LiCl treated samples respectively (Figure A.1).

S531 on the phopho-peptide STFREEsPLR was one sites predicted to be GSK-3 site by

NetworKIN. The most predominant ion fragment was used for targeted MRM analysis of the

S531 site using ABI/Sciex 4000QTRAP. The extracted ion currents indicate the relative amounts of phosphorylated/nonphosphorylated peptides in an untreated sample (Figure A.2A; upper section) or a sample treated with the GSK-3 inhibitor LiCl (Figure A.2A; lower section).

Figure A.1: BCLAF1 phosphorylation sites identified using mass spectrometry. Untreated or LiCl treated 293 cells were lysed, followed by immunoprecipitation of BCLAF1. The immunoprecipitates were separated on a gel and the excised gel bands containing BCLAF1 were digested with trypsin. The resulting peptides were analyzed by liquid chromatography mass spectrometry. The identified phosphorylation sites (S and T) are highlighted in green and the peptides containing phosphorylation sites are highlighted in yellow. The phosphopeptide containing a predicted GSK-3 phosphorylation site, STFREEsPLR, is also shown.

Figure A.2: Quantitative measurement of GSK-3-dependent phosphorylation of BCLAF1. (A) Multiple reaction monitoring of S531 on BCLAF1. HEK293 cells were left untreated (upper panel) or treated (lower panel) with LiCl. Each curve (extracted ion currents) represents an MRM elution profile corresponding to the phosphorylated (blue, STFREEsPLR) and nonphosphorylated (red, STFREESPLR) peptides. (B) The calculation of phosphorylation levels is given by the ratio of the integrated ion currents.(C) Treatment with LiCl results in a 3.7-fold decrease of phosphorylation of BCLAF1 at S531. The error bars show standard deviations.

In order to calculate the relative change in phosphorylation of S531, the peak integral was calculated (Figure A.2B). The results based on two biological repeats are shown as the ratio of phospho/nonphospho peptide (Figure A.2C), which indicates a 3.7-fold decrease upon LiCl treatment. This observation, together with the NetworKIN prediction that GSK-3 directly phosphorylates BCLAF1, suggests that BCLAF1 is a novel target of this kinase.

A.4 Discussion

The prediction accuracy of the NetworKin algorithm was determined to be 64% by incorporating contextual information compared to 25% using only the consensus sequence motifs. Given there are a total of eight BCLAF1 sites predicted to be phosphorylated by GSK-3, it is likely that BCLAF1 is a novel GSK-3 substrate. Our mass spectrometry observations indicate that GSK-3 phopshporylates BCLAF1 on the S531 site and the other predicted sites have yet to be investigated. It is notable that a serine or threonine residue is not present 4 residues C-terminal to the S531 site on BCLAF1, suggesting that priming phosphorylation may not be required for this protein. Other substrates have also been shown to not require pre- phosphorylation, and these include c-Jun, c-Myc, and Tau [8, 199].

The approach presented here does not give definitive proof that a predicted kinase is the relevant in vivo enzyme, as it cannot exclude that phosphorylation may occur via another kinase, or another kinase that is, in turn, phosporylated by GSK-3. This problem will diminish as more kinase consensus motifs are added to the algorithm, as it will then be possible to apply exclusion principles [194]. Moreover, LiCl inhibits other protein kinases in addition to GSK-3 [157, 158], including other kinases that may be responsible for phosphorylation of BCLAF1. In vitro kinase assays and site-directed mutagenesis studies are the next steps towards convincingly establishing BCLAF1 as a novel GSK-3 substrate.

Previous studies showed that BCLAF1 is a death-promoting transcription factor, although the downstream targets and mechanisms of BCLAF1-induced apoptosis remain poorly understood. Numerous studies have shown that at physiological levels GSK-3 generally promotes the expression of pro-apoptotic proteins and inhibits the expression of anti-apoptotic proteins, to lower the threshold for the induction of mitochondria-mediated apoptosis (reviewed in [182]). It is thus conceivable that GSK-3 promotes BCLAF1 activity during apoptosis. GSK-

3 has been shown to positively regulate other transcription factors by increasing transcriptional activity of p53 [123] and cAMP response element binding protein [66] and enhancing binding of

Microphthalmia-associated transcription factor to tyrosinase promoter [76]. GSK-3 may exert similar regulatory mechanisms on BCLAF1. BCLAF1 protein levels were unchanged in GSK-

3α(FL/FL)/β(FL/FL) MEFs treated with AdCre compared to the AdLacZ control (data not shown), suggesting that GSK-3 phosphorylation is unlikely to affect BCLAF1 protein stability. In addition, BCLAF1 was recently shown to interact with the p53 promoter in vivo and this interaction was associated with the activation of p53 gene transcription during DNA damage

[196]. It is attractive to speculate that accumulation of p53 protein levels through GSK-3 mediated BCLAF1 activation may be an alternative mechanism for the established role of GSK-

3 in promoting p53-mediated apoptosis during DNA damage.

A.4 References

1. Linding, R., et al., Systematic discovery of in vivo phosphorylation networks. Cell, 2007. 129(7): p. 1415-26.

2. Kasof, G.M., L. Goyal, and E. White, Btf, a novel death-promoting transcriptional repressor that interacts with Bcl-2-related proteins. Mol Cell Biol, 1999. 19(6): p. 4390- 404.

3. Liu, H., et al., Protein kinase C delta induces transcription of the TP53 tumor suppressor gene by controlling death-promoting factor Btf in the apoptotic response to DNA damage. Mol Cell Biol, 2007. 27(24): p. 8480-91.

4. Stambolic, V., L. Ruel, and J.R. Woodgett, Lithium inhibits glycogen synthase kinase-3 activity and mimics wingless signalling in intact cells. Curr Biol, 1996. 6(12): p. 1664-8.

5. Klein, P.S. and D.A. Melton, A molecular mechanism for the effect of lithium on development. Proc Natl Acad Sci U S A, 1996. 93(16): p. 8455-9.

6. Anderson, L. and C.L. Hunter, Quantitative mass spectrometric multiple reaction monitoring assays for major plasma proteins. Mol Cell Proteomics, 2006. 5(4): p. 573- 88.

7. Cox, D.M., et al., Multiple reaction monitoring as a method for identifying protein posttranslational modifications. J Biomol Tech, 2005. 16(2): p. 83-90.

8. Plyte, S.E., et al., Glycogen synthase kinase-3: functions in oncogenesis and development. Biochim Biophys Acta, 1992. 1114(2-3): p. 147-62.

9. Cole, A.R., et al., Distinct priming kinases contribute to differential regulation of collapsin response mediator proteins by glycogen synthase kinase-3 in vivo. J Biol Chem, 2006. 281(24): p. 16591-8.

10. Phiel, C.J. and P.S. Klein, Molecular targets of lithium action. Annu Rev Pharmacol Toxicol, 2001. 41: p. 789-813.

11. Bain, J., et al., The selectivity of protein kinase inhibitors: a further update. Biochem J, 2007. 408(3): p. 297-315.

12. Beurel, E. and R.S. Jope, The paradoxical pro- and anti-apoptotic actions of GSK3 in the intrinsic and extrinsic apoptosis signaling pathways. Prog Neurobiol, 2006. 79(4): p. 173-89.

13. Watcharasit, P., et al., Glycogen synthase kinase-3beta (GSK3beta) binds to and promotes the actions of p53. J Biol Chem, 2003. 278(49): p. 48872-9.

14. Fiol, C.J., et al., A secondary phosphorylation of CREB341 at Ser129 is required for the cAMP-mediated control of gene expression. A role for glycogen synthase kinase-3 in the control of gene expression. J Biol Chem, 1994. 269(51): p. 32187-93.

15. Takeda, K., et al., Ser298 of MITF, a mutation site in Waardenburg syndrome type 2, is a phosphorylation site with functional significance. Hum Mol Genet, 2000. 9(1): p. 125- 32.