Identification of C-Met Oncogene As a Broadly Expressed Tumor- Associated Antigen Recognized by Cytotoxic T-Lymphocytes

3658 Vol. 10, 3658–3666, June 1, 2004 Clinical Cancer Research

Featured Article Identification of C-Met Oncogene as a Broadly Expressed Tumor- Associated Antigen Recognized by Cytotoxic T-Lymphocytes

Kerstin Schag,1 Susanne M. Schmidt,1 INTRODUCTION Martin R. Mu¨ller,1 Toni Weinschenk,2 C-Met encodes a heterodimeric transmembranous receptor 1 1 with tyrosine kinase activity that is composed of an ␣ chain that Silke Appel, Markus M. Weck, ␤ 1 2 is disulfide-linked to a subunit (1, 2). Both subunits are Frank Gru¨nebach, Stefan Stevanovic, expressed on the surface; the heavy ␤ subunit is responsible for 2 1 Hans-Georg Rammensee, and Peter Brossart the binding of the ligand, hepatocyte growth factor (HGF), and 1Department of Hematology, Oncology and Immunology, University the ␣ subunit contains an intracellular domain that mediates the of Tu¨bingen, and 2Department of Immunology, Institute for Cell activation of different signal transduction pathways. Met signal- Biology, Tu¨bingen, Germany ing is involved in organ regeneration, as demonstrated for liver and kidney, embryogenesis, hematopoiesis, muscle development, and in the regulation of migration and adhesion of nor- ABSTRACT mally activated B cells and monocytes. Furthermore, numerous Purpose: C-Met proto-oncogene is a receptor tyrosine studies indicated the involvement of c-Met overexpression in kinase that mediates the oncogenic activities of the hepato- malignant transformation and invasiveness of malignant cells cyte growth factor. Using a DNA chip analysis of tumor (3–12). samples from patients with renal cell carcinoma and se- Using an integrated functional genomics approach that quencing of peptides bound to the HLA-A*0201 molecules combines gene expression profiling with analysis of MHC li- on tumor cells a peptide derived from the c-Met protein was gands by mass spectrometry to identify genes and corresponding identified recently. MHC ligands that are selectively expressed or overexpressed in Experimental Design: We used this novel HLA-A*0201 malignant tissues an HLA-A*0201-presented peptide derived peptide for the induction of specific CTLs to analyze the from the c-Met proto-oncogene could be identified (13). In the presentation of this epitope by malignant cells. present study we analyzed the possible function of this peptide Results: The induced CTL efficiently lysed target cells as a T-cell epitope and its presentation by malignant cells using pulsed with the cognate peptide, as well as HLA-A*0201- antigen-specific CTLs that were generated by in vitro priming matched tumor cell lines in an antigen-specific and HLA- with monocyte-derived dendritic cells (DCs) as antigen present- restricted manner. Furthermore, the induced c-Met-specific ing cells. We show here that the CTLs generated from several CTLs recognized autologous dendritic cells (DCs) pulsed healthy donors elicited an antigen-specific and HLA-A*0201- with the peptide or transfected with whole-tumor mRNA restricted cytolytic activity against tumor cells endogenously purified from c-Met-expressing cell lines. We next induced expressing the c-Met protein including renal cell carcinomas, c-Met-specific CTLs using peripheral blood mononuclear breast cancer, colon cancer, melanoma, and multiple myeloma cells and DC from an HLA-A*0201-positive patient with cells. Furthermore, they lysed autologous DCs pulsed with the plasma cell leukemia to determine the recognition of pri- antigenic peptide or electroporated with RNA isolated from c-Met-expressing tumor cell lines and primary autologous ma- mary autologous malignant cells. These CTLs lysed malig- lignant plasma cells while sparing nonmalignant B- and T- nant plasma cells while sparing nonmalignant B- and T- lymphocytes, monocytes, DCs, and bone marrow-derived or lymphocytes, monocytes, and DCs. mobilized CD34ϩ hematopoietic cells. Our results demonstrate Conclusion: Our results demonstrate that c-Met onco- that c-Met oncogene is a tumor rejection antigen recognized by gene is a novel tumor rejection antigen recognized by CTL CTLs and expressed on a broad variety of epithelial and hema- and expressed on a broad variety of epithelial and hemato- topoietic malignancies. poietic malignant cells. MATERIALS AND METHODS Tumor Cell Lines. Tumor cell lines used in the experiments were grown in RP10 medium (RPMI 1640 supplemented Received 11/25/03; revised 2/11/04; accepted 2/16/04. with 10% heat inactivated FCS and antibiotics). The following Grant support: Deutsche Forschungsgemeinschaft (SFB 510, Projekt c-Met-expressing tumor cell lines were used in experiments: B2) and Deutsche Krebshilfe. MCF-7 (breast cancer, HLA-A*0201ϩ, purchased from Amer- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked ican Type Culture Collection), A498 (renal cell carcinoma, advertisement in accordance with 18 U.S.C. Section 1734 solely to HLA-A*0201ϩ) and MZ1257 (renal cell carcinoma, HLA- indicate this fact. A*0201ϩ, kindly provided by Prof. Alexander Knuth, Frank- Note: K. Schag and S. Schmidt contributed equally to the manuscript. furt, Germany), U266 (multiple myeloma, HLA-A*0201ϩ), Requests for reprints: Peter Brossart, University of Tu¨bingen, Depart- ϩ ment of Hematology, Oncology and Immunology, Otfried-Mu¨ller- HCT116 (colon cancer, HLA-A*0201 ), Mel1479 (malignant Strasse-10, D-72076 Tu¨bingen, Germany. Phone: 49-7071-2982726; melanoma, HLA-A*0201ϩ, kindly provided by Prof. Graham Fax: 49-7071-295709; E-mail: [email protected] Pawelec, University of Tu¨bin, Tu¨bingen, Germany), and SK- Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2004 American Association for Cancer Research. Clinical Cancer Research 3659

OV-3 (ovarian cell line, HLA-A*03ϩ, kindly provided by O. J. (ILKEPVHGV, pol HIV-1 reverse transcriptase peptide, amino Finn, Pittsburgh, PA). The c-Met-negative cell lines T2 (HLA- acids 476–484) were synthesized using standard F-moc chem- A*0201ϩ, TAP-deficient) and Croft (EBV-immortalized B-cell istry on a peptide synthesizer (432A; Applied Biosystems, Weit- line, kindly donated by O. J. Finn, Pittsburgh, PA, HLA- erstadt, Germany) and analyzed by reversed-phase high-perfor- A*0201ϩ) were used as controls. K562 cells were used to mance liquid chromatography and mass spectrometry. determine the natural killer-cell activity. For CTL induction, 5 ϫ 105 DCs were pulsed with 50 Cell Isolation and Generation of DC from Adherent ␮g/ml of the synthetic c-Met peptide for 2 h, washed, and Peripheral Blood Mononuclear Cells (PBMNC). Genera- incubated with 2.5 ϫ 106 autologous PBMNC in RP10 medium. tion of DCs from peripheral blood monocytes was performed as After 7 days of culture, cells were restimulated with autologous described previously (14). In brief, PBMNCs were isolated by peptide-pulsed PBMNC, and 2 ng/ml human recombinant inter- Ficoll/Paque (Biochrom, Berlin, Germany) density gradient cen- leukin 2 (R&D Systems) was added on days 1, 3, and 5. The trifugation of blood obtained from buffy coat preparations of cytolytic activity of induced CTL was analyzed on day 5 after healthy donors from the blood bank of the University of Tu¨b- the last restimulation in a standard 51Cr-release assay. ingen. Cells were seeded (1 ϫ 107 cells/3 ml/well) into six-well CTL Assay. The standard 51Cr release assay was per- plates (BD Falcon, Heidelberg, Germany) in RP10 medium. formed as described (14). Target cells were pulsed with 50 ␮ 51 After2hofincubation at 37°C and 5% CO2, nonadherent cells g/ml peptide for 2 h and labeled with [ Cr]sodium chromate were removed, and the adherent blood monocytes were cultured in RP10 for1hat37°C. Cells (104) were transferred to a well in RP10 medium supplemented with the following cytokines: of a round-bottomed 96-well plate. Varying numbers of CTLs human recombinant granulocyte macrophage colony-stimulat- were added to give a final volume of 200 ␮l and incubated for ing factor (Leukomax, Novartis; 100 ng/ml), interleukin 4 4hat37°C. At the end of the assay supernatants (50 ␮l/well) (R&D, Wiesbaden, Germany; 20 ng/ml), and tumor necrosis were harvested and counted in a ␤-plate counter. The percentage factor ␣ (R&D; 10 ng/ml). The phenotype of DCs was analyzed of specific lysis was calculated as: 100 ϫ (experimental re- by flow cytometry after 7 days of culture (data not shown). lease Ϫ spontaneous release/maximal release Ϫ spontaneous Mobilized CD34ϩ hematopoietic progenitor cells, B- and release). Spontaneous and maximal release were determined in T-lymphocytes, as well as monocytes were isolated from pe- the presence of either medium or 2% Triton X-100, respectively. ripheral blood using magnetic cell sorting technology. Activa- Antigen specificity of tumor cell lysis was additionally tion of B and T cells was performed as described recently (15). determined in a cold target inhibition assay (14) by analyzing Monocytes were grown in RP10 medium with granulocyte the capacity of peptide-pulsed unlabeled T2 cells to block lysis macrophage colony-stimulating factor (Leukomax; Novartis; of tumor cells at a ratio of 20:1 (inhibitor:target ratio). 100 ng/ml) overnight before being used as targets. Bone marrow IFN-␥ Enzyme-Linked Immunospot Assay. C-Met- cells and CD34ϩ progenitor cells were incubated for 24–48 h specific CTLs were generated in vitro using autologous DCs with stem cell factor (SCF; R&D; 100 ng/ml). pulsed with the c-Met peptide. These CTLs were incubated at a Reverse Transcription-PCR (RT-PCR). RT-PCR was concentration of 2 ϫ 105 cells/well in a 96-well plate coated performed with some modifications as described recently (14). with antihuman IFN-␥ antibody (mAb 1-D1K, 10 ␮g/ml; Total RNA was isolated from cell lysates using Qiagen RNeasy Mabtech AB, Hamburg, Germany) together with autologous “Mini” anion-exchange spin columns (Qiagen GmbH, Hilden, PBMNCs pulsed for 1 h with the HLA-A2 binding peptides Germany) according to the instructions of the manufacturer and derived from the tumor antigens c-Met or adipophilin. For the was subjected to a 20-␮l cDNA synthesis reaction (Invitrogen, detection of spots, a biotin-labeled antihuman IFN-␥ antibody Karlsruhe, Germany). Oligodeoxythymidylic acid was used as (Mab 7-B6–1-Biotin, 2 ␮g/ml; Mabtech AB) was used. Spots primer. One ␮l of cDNA was used for PCR amplification in a were counted after 40–44 h incubation using an automated volume of 15 ␮l. To control the integrity of the RNA and the enzyme-linked immunospot reader (IMMUNOSPOT ANA- efficiency of the cDNA synthesis, 1 ␮l of cDNA was amplified LYZER; CTL Analyzers LLC, Cleveland, OH). ␤ by an intron-spanning primer pair for the 2-microglobulin Peptide Titration. C-Met-specific CTLs were generated gene. The PCR temperature profiles were as follows: 2 min as described above. For peptide titration, T2 cells were incu- Ϫ7 pretreatment at 94°C and 30 cycles at 94°C for 30 s, annealing bated with titrated amounts (10–10 ␮M) of the c-Met peptide. ␤ at 59°C for 30 s and 72°C for 60 s for the c-Met and 2- Corresponding specific CTLs were added to the target cells microglobulin cDNA. Primer sequences were deduced from incubated with the cognate peptide at a ratio of 10:1. ␤ Ј published cDNA sequences: 2-microglobulin: 5 GGGTT- PAGE and Western Blotting. Cells were lysed in TCATCCATCCGACAT 3Ј and 5Ј GATGCTGCTTACAT- buffer containing 1% Igepal, 50 mM HEPES (pH 7.5), 150 GTCTCGA 3Ј, c-Met: 5Ј AGTCAAGGTTGCTGATTTTGGT mM NaCl, 2 mM EDTA, 10% glycerol, 1 mM phenylmethyl- 3Ј and 5Ј ATGTGCTCCCCAATGAAAGTAGA 3Ј. Three to 5 sulfonyl fluoride, and 2 ␮g/ml aprotinin. Protein concentra- ␮l of the RT-PCR reactions were electrophoresed through a tion of cell lysates were determined using a BCA assay 2.5% agarose gel and stained with ethidium bromide for visu- (Pierce, Rockford, IL). Six to 30 ␮g of total protein were alization under UV light. separated on a 7.5–9% polyacrylamide gel, blotted on nitro- Induction of Antigen-Specific CTL Response Using cellulose membrane, and probed with a c-Met-specific poly- HLA-A*0201-Restricted Synthetic Peptides. The HLA- clonal antibody (h-Met, clone C-28, sc-161, polyclonal rab- A*0201 binding peptides derived from c-Met (YVDPVITSI, bit; Santa Cruz Biotechnology, Heidelberg, Germany). To amino acids 654–662; Ref. 13), adipophilin (SVASTITGV; ensure equal loading of the gel, the blots were reprobed using Ref. 13), survivin (ELTLGEFLKL; Ref. 16), and HIV a polyclonal actin antibody (clone I-19; Santa Cruz Biotech-

nology) or a monoclonal glyceraldehyde-3-phosphate dehydrogenase antibody (clone 6C5; HyTest, Turku, Finland). Bands were visualized by enhanced chemiluminescence staining (Amersham Pharmacia, Freiburg, Germany). Electroporation of DCs with Whole Tumor-Derived RNA. Total RNA was isolated from tumor cell lysates using RNeasy Maxi anion-exchange spin columns (Qiagen GmbH) according to the protocol for isolation of total RNA from animal cells provided by the manufacturer. Quantity and purity of RNA were determined by UV spectrophotometry. Before electroporation on day 6, immature DCs (grown in RP10 medium in the presence of interleukin 4 and granulocyte macrophage colony- stimulating factor) were washed twice with serum-free X-VIVO 20 medium (BioWhittaker, Apen, Germany) and resuspended to 7 a final concentration of 2 ϫ 10 cells/ml. Subsequently, 200 ␮l Fig. 1 C-Met expression in human tumor cell lines. The expression of of the cell suspension were mixed with 10 ␮g of total RNA and c-Met mRNA was analyzed in human tumor cell lines by reverse electroporated ina4mmcuvette using an Easyject Plus unit transcription-PCR (A). Total RNA was subjected to cDNA synthesis. PCR products were run on a 2.5% agarose gel and visualized by (Peqlab, Erlangen, Germany). The physical parameters were: ␤ ␮ ⍀ ethidium bromide staining. Amplification of 2-microglobulin was per- voltage of 300 V, capacitance of 150 F, resistance of 1540 , formed as control. Western blot analysis using a c-Met-specific poly- and pulse time of 231 ms (17). After electroporation the cells clonal antibody was performed to determine the protein expression (B). were immediately transferred into RP10 medium and returned to To ensure equal loading of the gel, the blot was reprobed using a the incubator. polyclonal actin antibody. The following cell lines showed to be c-Met positive: A498 (renal cell carcinoma, HLA-A*0201ϩ), MZ1257 (renal cell carcinoma, HLA-A*0201ϩ), U266 (multiple myeloma, HLA- A*0201ϩ), Mel1479 (malignant melanoma, HLA-A*0201ϩ), and RESULTS K562 cells. T2 (HLA-A*0201ϩ, TAP-deficient) and Croft (EBV-im- Induction of c-Met-Specific CTLs Using Peptide-Pulsed mortalized B-cell line, HLA-A*0201ϩ) are c-Met negative. DCs. C-Met proto-oncogene was shown to be overexpressed in a variety of malignant cells of epithelial and hematopoietic origin and to be involved in the malignant phenotype and invasiveness of these cells (3, 18–20). As demonstrated in Fig. and effector cells were added after a preincubation time of 1 h 1, expression of c-Met mRNA and protein could be detected in at an E:T ratio of 10:1. As shown in Fig. 2C, the c-Met-specific several tested human tumor cell lines including malignant mel- CTL lysed the target cells in an antigen concentration-depend- anoma, renal cell carcinoma, and multiple myeloma. ing fashion with a sensitivity that ranged from 10 ␮M to 100 pM. Comparative analysis of gene expression profiling of a To additionally characterize the effector functions of the c-Met- tumor sample derived from a patient with renal cell carcinoma specific CTL we analyzed the secretion of cytokines using an and the corresponding autologous renal tissue was performed enzyme-linked immunospot assay. The stimulation of the CTL using DNA microarray technology followed by the character- resulted in an antigen-specific production of IFN-␥ as demon- ization of MHC ligands present in the tumor by mass spectrom- strated in Fig. 2D. etry. This resulted in the identification of an HLA-A*0201- To determine the frequency of c-Met-reactive T cells we presented peptide derived from the c-Met protein (YVDPVITSI, performed enzyme-linked immunospot assays using peripheral amino acids 654–662; Ref. 13). blood from healthy donors and 2 patients with malignant dis- To analyze the presentation of this epitope by tumor cells eases (chronic lymphocytic leukemia and plasma cell leukemia). and its recognition by CTLs we induced c-Met-specific CTLs in C-Met-specific T cells could be detected only in 2 of 10 healthy vitro using DCs derived from adherent PBMNCs of HLA- donors with 31 and 65 spots when 2 ϫ 106 PBMNCs were used A*0201-positive healthy donors. These monocyte-derived DCs in the analysis (data not shown). were pulsed with the HLA-A*0201 binding c-Met peptide and C-Met Peptide-Specific CTLs Efficiently Recognize Tu- used as antigen presenting cells for in vitro priming. Using this mor Cells Endogenously Expressing the c-Met Proto-Onco- approach c-Met-specific CTLs were generated in 8 of 9 healthy gene. We next analyzed the ability of the in vitro induced CTL donors. The cytotoxicity of the induced CTL was analyzed in a to lyse tumor cells that express the c-Met protein. We used the standard 51Cr release assay using peptide-loaded T2 cells and HLA-A*0201-positive cell lines HCT116 (colon cancer), A498, autologous DCs as targets. As shown in Fig. 2, the CTL line MZ1257 (renal cell carcinoma), MCF-7 (breast cancer), obtained after several restimulations demonstrated antigen- Mel1479 (malignant melanoma), and U266 (multiple myeloma) specific killing. The T cells only recognized T2 cells (Fig. 2A) that express c-Met as targets in a standard 51Cr release assay. or DCs (Fig. 2B) coated with the cognate peptide, whereas they The EBV-transformed B-cell line Croft (HLA-A*0201ϩ/c- did not lyse target cells pulsed with irrelevant HLA-A*0201 MetϪ) and the ovarian cancer cell line SK-OV-3 (HLA-A3ϩ/ binding peptides derived from survivin protein or HIV-1 reverse c-Metϩ) were included to determine the specificity and HLA- transcriptase confirming the specificity of the cytolytic activity. restriction of the CTL. As demonstrated in Fig. 3, A–D, the To analyze the avidity of the induced CTL lines T2 cells c-Met peptide-specific CTLs were able to efficiently lyse ma- were incubated with titrated amounts of the synthetic peptide, lignant cells expressing both HLA-A*0201 and c-Met. There

Fig. 2 Induction of c-Met-specific CTL responses in vitro using peptide-pulsed dendritic cells (DC) as antigen presenting cells. DCs generated from adherent peripheral blood mononuclear cells in the presence of granulocyte macrophage colony-stimulating factor, interleukin 4, and tumor necrosis factor ␣ were pulsed with the synthetic peptide derived from the c-Met protein and used for CTL induction. Cytotoxic activity of induced CTL was analyzed in a standard 51Cr release assay using T2 cells (A) or autologous DCs (B) pulsed with the cognate c-Met peptide (closed symbols)oran irrelevant peptide (HIV or survivin, open symbols) as targets. To analyze the avidity of the induced CTL lines, T2 cells were incubated with titrated amounts of the synthetic peptide, and effector cells were added after a preincubation time of1hatanE:Tratio of 10:1 (C). To analyze the antigen-specific secretion of IFN-␥ by the in vitro-induced CTL an enzyme-linked immunospot assay was performed (D). The HLA-A2-binding adipophilin peptide was used as a negative control in this experiment.

Fig. 3 Antigen-specific lysis of human tumor cell lines endogenously expressing c-Met by c- Met-specific CTLs. Human HLA-A*0201ϩ/c-Metϩ colon cell carcinoma cells HCT116, renal cell carcinoma (MZ1257 and A498), melanoma (Mel1479), breast cancer cell line MCF-7, multiple myeloma (U266) cell line, and the EBV-immortalized Croft cells (HLA-A*0201ϩ/c- MetϪ) as well as the ovarian cancer cell line SK-OV-3 (HLA- A*0201-/c-Metϩ) were used as targets in a standard 51Cr release assay. K562 cells were included to determine the natural killer cell activity.

was no recognition of the ovarian cancer cells SK-OV-3 or Croft cells demonstrating that the presentation of c-Met peptide in the context of HLA-A*0201 molecules on the tumor cells is required for the efficient lysis of target cells and confirming the antigen specificity and MHC restriction of the CTLs. The in vitro-induced T cells did not recognize the K562 cells indicating that the cytotoxic activity was not natural killer-cell mediated. To additionally verify the antigen specificity and MHC restriction of the in vitro-induced CTL lines we performed cold target inhibition assays (Fig. 4, A and B). The lysis of the target cells (U266, Fig. 4A, and A498, Fig. 4B) could be blocked in cold target inhibition assays. The addition of cold (not labeled with 51Cr) T2 cells pulsed with the cognate peptide reduced the lysis of tumor cells, whereas T2 cells pulsed with an irrelevant peptide showed no effect. Fig. 5 C-Met-specific CTLs recognize autologous dendritic cells (DC) transfected with total RNA isolated from A498 or MCF-7 tumor cells. C-Met-Specific CTLs Can Lyse Autologous DCs Trans- Autologous DCs from a healthy HLA-A*0201ϩ donor generated from fected with Whole Tumor RNA. To determine the cytotoxic peripheral blood monocytes were electroporated with total tumor RNA activity of the CTLs in an autologous setting and test the isolated from the c-Met-expressing MCF-7 or A498 tumor cell lines. 51 presentation of c-Met-specific T-cell epitopes upon transfection These DCs were used as target cells in a standard Cr release assay (closed symbols). DCs electroporated with RNA derived from the c- with whole tumor RNA we used autologous DCs, generated Met-negative Croft cell line were used as controls in the assay (open from the same PBMNCs that were used for CTL induction, as symbols). target cells. As shown in Fig. 5, CTLs efficiently lysed autologous DCs electroporated with the whole tumor RNA isolated

from the c-Met-expressing A498 or MCF-7 tumor cell lines indicating that the identified c-Met peptide is processed and presented after transfection of DCs with RNA derived from c-Met-positive tumor cells. In the next set of experiments we analyzed the cytolytic activity of the induced CTLs against human HLA-A*0201 matched bone marrow cells and mobilized CD34ϩ peripheral blood progenitor cells before and after incubation with SCF that was shown to induce differentiation of the progenitor cells and up-regulation of c-Met protein (10). As demonstrated in Fig. 6, c-Met-specific CTLs recognized autologous DCs pulsed with the antigenic peptide as well as HLA-A*0201-matched allogeneic malignant plasma cells expressing c-Met while ignoring HLA-A*0201-positive bone marrow cells or mobilized CD34ϩ peripheral blood progenitor cells that were stimulated with SCF or left untreated. We next performed RT-PCR and Western blot analysis to determine the expression of c-Met in human mobilized CD34ϩ progenitor and bone marrow cells before and after exposure to SCF (Fig. 7). No expression of c-Met could be detected in CD34ϩ cells. Expression of c-Met was found to be very low in bone marrow cells compared with high expression in the renal cell carcinoma line (A498). C-Met-Specific CTLs Recognize Autologous Malignant Cells. RT-PCR analysis revealed that malignant cells from a HLA-A*0201ϩ patient with plasma cell leukemia that developed from previously diagnosed multiple myeloma express c- Fig. 4 Antigen-specific lysis of tumor cells in cold target inhibition Met (data not shown). The malignant plasma cells represented assays. The antigen-specific lysis of the U266 (A) and A498 (B) tumor Ͼ90% of the blood population. Using PBMNCs derived from cell lines by the in vitro-induced CTL lines was analyzed in cold target earlier time points we were able to generate c-Met-specific inhibition assays using unlabeled T2 cells pulsed with the cognate c-Met peptide (U266 ϩ T2/C-Met and A498 ϩ T2/C-Met) or the irrelevant CTLs that lysed the autologous malignant cells, whereas they survivin peptide (U266 ϩ T2/Survivin and A498 ϩ T2/Survivin)atan spared the nonmalignant autologous B-cells, T-cells, monocytes inhibitor:target ratio of 20:1. and DCs (Fig. 8).

reports have shown that nonepithelial cells such as hematopoietic, neural, and skeletal cells respond to HGF and hematological malignancies like multiple myeloma, Hodgkin disease, leu- kemias, and lymphomas express the c-Met protein (37–41). Deregulated control of the invasive growth phenotype by onco- genically activated c-Met provoked by c-Met-activating muta- tions, c-Met amplification/overexpression, and the acquisition of HGF/c-Met autocrine loops confers invasive and metastatic properties to malignant cells. Notably, constitutive activation of c-Met in HGF-overexpressing transgenic mice promotes broad tumorigenesis (42, 43). Therefore, targeting of c-Met and/or c-Met oncogenic transduction pathways could represent a prom- Fig. 6 C-Met-specific CTLs recognize primary malignant cells while ising therapeutic option. sparing bone marrow cells and mobilized CD34ϩ progenitor cells. We show that c-Met-specific CTLs recognizing tumor cells Dendritic cells (DC) generated from adherent peripheral blood mono- in an antigen-specific and MHC-restricted manner can be in- nuclear cells of an HLA-A*0201-positive healthy donor in the presence of granulocyte macrophage colony-stimulating factor, interleukin 4, and duced in vitro suggesting that c-Met proto-oncogene is a novel tumor necrosis factor ␣ were pulsed with the synthetic peptide derived tumor rejection antigen. We used the previously identified c- from the c-Met protein and used for CTL induction. Cytotoxic activity Met-derived HLA-A*0201-binding ligand for CTL induction of induced CTL was analyzed in a standard 51Cr release assay using and were able to demonstrate that this c-Met epitope is ex- autologous DCs pulsed with the cognate c-Met peptide or an irrelevant pressed on a broad spectrum of epithelial and hematological peptide (adipophilin, Ad) as targets. HLA-A*0201 matched allogeneic bone marrow cells (BM), mobilized CD34ϩ peripheral blood progenitor malignancies including renal cell carcinomas, breast cancer, cells and malignant plasma cells from a patient with multiple myeloma colon cancer, malignant melanoma, and multiple myeloma in- (MM) were included in the assay. Bone marrow cells and CD34ϩ dicating that this c-Met peptide is an interesting candidate for peripheral blood progenitor cells were additionally incubated for 48 h the development of a broadly applicable vaccination therapy. with stem cell factor (SCF) to induce differentiation of the cells. PBPC, peripheral blood progenitor cells. The specificity of the elicited CTL responses was confirmed in cold target inhibition assays. Furthermore, we performed the experiments in an autologous setting and used autologous DCs that were either pulsed with the cognate peptide or electropo- DISCUSSION rated with RNA isolated from c-Met-expressing tumor cell lines Therapeutic vaccinations of patients with malignant dis- as targets. The in vitro-induced c-Met peptide-specific CTL eases aim at stimulation of antitumor-directed immune responses, mainly CTLs, capable of recognizing and eliminating malignant cells. During the last years considerable efforts have been made to identify antigens specifically recognized by CTLs using reverse immunology, expression cloning, or Serex technology. However, with the exception of some tumor-associated antigens most of the identified T-cell epitopes are restricted to a limited set of malignancies (21–23). Comparative expression profiling of a tumor and its corresponding autologous healthy tissue by DNA microarray technology allows the identification of antigens selectively expressed or overexpressed in malignant cells making these proteins suitable targets for immunotherapeutic approaches. Combination of this genetic analysis with mass spectrometric analysis of HLA ligands enables the characterization of antigenic peptides encoded by these antigens. Using this integrated functional genomics approach an HLA-A*0201-presented peptide derived from the c-Met proto-oncogene was identified (13). C-Met is a heterodimeric tyrosine kinase receptor that mediates the multifunctional and potentially oncogenic activities of the HGF/scatter factor including promotion of cell growth, motility, survival, extracellular matrix dissolution, and angiogenesis (1–3). Binding of HGF to the receptor induces Fig. 7 Comparison of c-Met expression in CD34ϩ progenitor cells, autophosphorylation of c-Met and activates downstream signal- bone marrow cells, and tumor cells. A part of the cells was incubated ing events including the ras, phosphatidylinositol 3Ј-kinase, with stem cell factor (SCF) for 24 h. A, c-Met expression was analyzed phospholipase C ␥, and mitogen-activated protein kinase-related by Western blot analysis with a polyclonal c-Met antibody. To ensure pathways (4, 5, 24–27). The c-Met gene is expressed predom- equal loading of the gel, the blot was reprobed using a monoclonal glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody. B, inantly in epithelial cells and is overexpressed in several malig- analysis of c-Met mRNA level by reverse transcription-PCR. Amplifi- nant tissues and cell lines (28–36). An increasing number of cation of ␤2-microglobulin was performed as control.

Fig. 8 Antigen-specific killing of autologous malignant cells from a patient with plasma cell leukemia. In vitro-generated c-Met-specific CTL were induced using peripheral blood mononuclear cells from an HLA-A*0201-positive patient with multiple myeloma who developed a plasma cell leukemia. The malignant cell represented Ͼ90% of peripheral blood mononuclear cells at the time of diagnosis. C-met-specific CTLs recognize autologous malignant cells plasma cells (MM, multiple myeloma; B) and the c-Met-positive tumor cell line A498 (A) as well as dendritic cells (DC) loaded with the cognate peptide (DC ϩ c-Met), whereas DC loaded with the irrelevant adipophilin peptide (DC ϩ Ad) are spared (A). The c-Met-specific CTL do not lyse autologous monocytes and resting or activated B and T cells. K562 cells were included as a control, indicating that the lysis is not natural killer cell mediated (B).

efficiently lysed peptide-pulsed autologous DCs and DCs trans- ability of the in vitro-generated CTLs to recognize and lyse fected with whole tumor RNA, thus demonstrating that the c-Met-presenting target cells. peptide used for CTL induction is also processed and presented In several clinical vaccination trials using DCs presenting upon transfection of DCs with whole tumor RNA and might, tumor-associated antigens or adoptive transfer of tumor-reactive therefore, represent a very useful epitope in cancer vaccinations. CTLs generated ex vivo, it was shown that these approaches can Using our in vitro priming approach with peptide-pulsed induce antitumor immunity in patients with malignant diseases DCs we were able to generate c-Met-specific CTLs that lysed (22, 23, 44–48). However, with the exception of some reports autologous malignant cells from a HLA-A*0201ϩ patient with in malignant melanoma trials where induction of vitiligo was plasma cell leukemia, whereas they spared the nonmalignant observed after vaccinations with DCs even when antigens that autologous B cells, T cells, monocytes, and DC. are expressed in normal tissues like MUC1 or Her-2/neu were Previous studies have shown that under normal conditions applied there has been thus far no evidence for the development c-Met gene can be found in many epithelial tissues, and its of autoimmune reactions in these patients (49). In conclusion, in expression can be induced by treatment with phorbol esters, our study we describe the identification of a novel broadly serum, and in a paracrine fashion by mesenchymally derived expressed T-cell epitope derived from a proto-oncogene that is HGF. HGF/scatter factor-Met signaling is required for normal an interesting candidate to be applied in immunotherapies of development of liver, skeletal muscle, and placenta (37). In the human malignancies. hematopoietic system, HGF is produced by stromal bone marrow cells and together with other cytokines and growth factors ACKNOWLEDGMENTS induces proliferation and differentiation of a subset of c-Met- positive progenitor cells. The c-Met/HGF interaction plays an We thank Bruni Schuster and Sylvia Stephan for excellent techni- cal assistance. We thank Tina Wiesner, Andreas M. Boehmler, and important role in the lymphoid microenvironment and induces Hans-Joerg Buehring for providing CD34ϩ and bone marrow cells. adhesion as well as migration of normally activated B cells and monocytes (3–12). These observations indicate that the c-Met/HGF network REFERENCES promotes pleiotropic effects in normal cells and is not a cancer- 1. Bottaro DP, Rubin JS, Faletto DL, Chan AM, Kmiecik E, Vande specific antigen, and caution is required when targeting this Woude GF, Aaronson SA. Identification of the hepatocyte growth factor protein in clinical vaccination trials. However, we were not able receptor as the c-met proto-oncogene product. Science 1991;251:802– 804. to detect any significant recognition of nonmalignant B and T 2. Rubin JS, Bottaro DP, Aaronson SA. Hepatocyte growth factor/ lymphocytes, DCs, monocytes, or hematopoietic progenitor scatter factor and its receptor, the c-met proto-oncogene product. Bio- cells by c-Met-specific CTLs in our in vitro assays. chim Biophys Acta 1993;1155:357–371. As mentioned above it was demonstrated recently that bone 3. Zarnegar R, Michalopoulos GK. The many faces of hepatocyte marrow cells can up-regulate the expression of c-Met upon growth factor: from hepatopoiesis to hematopoiesis. J Cell Biol 1995; treatment with SCF. However, these cells were not recognized 129:1177–1180. by the in vitro-induced c-Met-specific CTLs as shown in Fig. 6. 4. Naldini L, Vigna E, Narsimhan RP, Gaudino G, Zarnegar R, Micha- lopoulos GK, Comoglio PM. Hepatocyte growth factor (HGF) stimu- PCR and Western blot analysis demonstrated low C-Met ex- lates the tyrosine kinase activity of the receptor encoded by the proto- pression in bone marrow cells as compared with the A498 renal oncogene c-MET. Oncogene 1991;6:501–504. cell carcinoma cell line indicating that the level of antigen 5. Montesano R, Soriano JV, Malinda KM, Ponce ML, Bafico A, expression that is higher in malignant cells correlates with the Kleinman HK, Bottaro DP, Aaronson SA. Differential effects of hepa-

tocyte growth factor isoforms on epithelial and endothelial tubulogen- dylinositol 3-kinase binding mediates its association with the hepatocyte esis. Cell Growth Differ 1998;9:355–365. growth factor/scatter factor receptor. Mol Cell Biol 1993;13:4600– 6. Schmidt C, Bladt F, Goedecke S, Brinkman V, Zschiesche W, Sharpe 4608. M, Gherardi E, Birchmeier C. Scatter factor/hepatocyte growth factor is 26. Dong G, Chen Z, Li Z-Y, Yeh NT, Bancroft CC, Van Waes C. essential for liver development. Nature 1995;373:699–702. Hepatocyte growth factor/scatter factor-induced activation of MEK and 7. Uehara Y, Minowa O, Mori C, Shiota K, Kuno J, Noda T, Kitamura PI3K signal pathways contributes to expression of proangiogenic cyto- N. Placental defect and embryonic lethality in mice lacking hepatocyte kines interleukin-8 and vascular endothelial growth factor in head and growthfactor/scatter factor. Nature 1995;373:702–705. neck squamous cell carcinoma Cancer Res 2001;61:5911–5918. 8. Bladt F, Rlethmacher D, Isenmann S, Aguzzi A, Birchmeier C. 27. Furge KA, Kiewlich D, Le P, Vo MN, Faure M, Howlett AR, Essential role for the c-met receptor in the migration of myogenic Lipson KE, Vande Woude GF, Webb CP. Suppression of Ras-mediated precursor cells into the limb bud. Nature 1995;376:768–771. tumorigenicity and metastasis through inhibition of the Met receptor 9. Takayama H, LaRochelle WJ, Anver M, Bockman DE, Merlino G. tyrosine kinase. Proc Natl Acad Sci 2001;98:10722–10727. Scatter factor/hepatocyte growth factor as a regulator of skeletal muscle 28. Di Renzo MF, Olivero M, Giacomini A, Porte H, Chastre E, and neural crest development. Proc Natl Acad Sci 1996;93:5866–5871. Mirossay L, Nordlinger B, Bretti S, Bottardi S, Giordano S. Overex- 10. Mizuno K, Higuchi O, Ihle JN, Nakamura T. Hepatocyte growth pression and amplification of the met/HGF receptor gene during the factor stimulates growth of hematopoietic progenitor cells. Biochem progression of colorectal cancer. Clin Cancer Res 1995;1:147–154. Biophys Res Commun 1993;194:178–186. 29. Ferracini R, Di Renzo MF, Scotlandi K, Baldini N, Olivero M, 11. van der Voort R, Taher TE, Keehnen RM, Smit L, Groenink M, Pals Lollini P, Cremona O, Campanacci M, Comoglio PM. The Met/HGF ST. Paracrine regulation of germinal center B cell adhesion through the receptor is over-expressed in human osteosarcomas and is activated by c-met-hepatocyte growth factor/scatter factor pathway J Exp Med 1997; either a paracrine or an autocrine circuit. Oncogene 1995;10:739–749. 185:2121–2131. 30. Tuck AB, Park M, Sterns EE, Boag A, Elliott BE. Coexpression of 12. Beilmann M, Vande Woude GF, Dienes HP, Schirmacher P. Hep- hepatocyte growth factor and receptor (Met) in human breast carcinoma. atocyte growth factor-stimulated invasivness of monocytes. Blood 2000; Am J Pathol 1996;148:225–232. 95:3964–3969. 31. Koochekpour S, Jeffers M, Rulong S, Taylor G, Klineberg E, 13. Weinschenk T, Gouttefangeas C, Schirle M, Obermayr F, Walter S, Hudson EA, Resau JH, Vande Woude GF. Met and hepatocyte growth Schoor O, Kurek R, Loeser W, Bichler KH, Wernet D, Stevanovic S, factor/scatter factor expression in human gliomas. Cancer Res 1997;57: Rammensee HG. Integrated functional genomics approach for the de- 5391–5398. sign of patient-individual antitumor vaccines. Cancer Res 2002;62: 5818–27. 32. Li G, Schaider H, Satyamoorthy K, Hanakawa Y, Hashimoto K, Herlyn M. Downregulation of E-cadherin and desmoglein 1 by auto- 14. Brossart P, Schneider A, Dill P, Schammann T, Grunebach F, crine hepatocyte growth factor during melanoma development. Onco- Wirths S, Kanz L, Buhring HJ, Brugger W. The epithelial tumor antigen gene 2001;20:8125–8135. MUC1 is expressed in hematological malignancies and is recognized by MUC1-specific cytotoxic T-lymphocytes. Cancer Res 2001;61:6846– 33. Fischer J, Palmedo G, von Knobloch R, Burgert P, Prayer-Galetti T, 50. Pagano F, Kovacs G. Duplication and overexpression of the mutant allel of the MET proto-oncogene in multiple hereditary papillary renal cell 15. Schmidt SM, Schag K, Muller MR, Weck MM, Appel S, Kanz L, Grunebach F, Brossart P. Survivin is a shared tumor associated antigen tumours. Oncogene 1998;17:733–739. expressed in a broad variety of malignancies and recognized by specific 34. Maulik G, Kijima T, Ma PC, Ghosh SK, Lin J, Shapiro GI, Schaefer cytotoxic T-cells Blood 2003;102:571–576. E, Tibaldi E, Johnson BE, Sagia R. Modulation of the c-Met/Hepatocyt 16. Schmitz M, Diestelkoetter P, Weigle B, Schmachtenberg F, Growth Factor Pathway in small lung cell cancer. Clin Cancer Res Stevanovic S, Ockert D, Rammensee HG, Rieber EP. Generation of 2002;8:620–627. survivin-specific CD8ϩ T effector cells by dendritic cells pulsed with 35. Qian CN, Gua X, Cao B, Kort EJ, Lee CC, Chen J, Wang LM, Mai protein or selected peptides. Cancer Res 2000;60:4845–9. WJ, Min HQ, Hong MH, Vande Woude GF, Resau JH, The B. T. Met 17. Gru¨nebach F, Mu¨ller MR, Nencioni A, Brossart P. Delivery of protein expression level correlates with survival in patients with late- tumor derived RNA for induction of cytotoxic T-lymphocytes. Gene stage nasopharyngeal carcinoma Cancer Res 2002;62:589–596. Ther., in press 36. Ramirez R, Hsu D, Patel A, Fenton C, Dinauer C, Tuttle RM, 18. Jeffers M, Rong S, Vande Woude GF. Hepatocyte growth factor/ Francis GL. Over-expression of hepatocyte growth factor/scatter factor scatter factor-Met signaling in tumorigenicity and invasion/metastasis. J (HGF/SF) and the HGF/SF receptor (cMet) are associated with a high Mol Med 1996;74:505–513. risk of metastasis and recurrence for children and young adults with 19. Rong S, Bodescot M, Blair D, Dunn J, Nakamura T, Mizuno K, papillary thyroid carcinoma. Clin Endocrinol 2000;53:635–644. Park M, Chan A, Aaronson S, Vande Woude GF. Tumorigenicity of the 37. Gherardi E, Stoker M. Hepatocyte growth factor-scatter factor: met proto-oncogene and the gene for hepatocyte growth factor. Mol Cell mitogen, motogen, and met. Cancer Cells 1991;3:227–232. Biol 1992;12:5152–5158. 38. Teofili L, Di Febo AL, Pierconti F, Maggiano N, Bendandi M, 20. Giordano S, Zhen Z, Medico E, Galimi F, Comoglio PM. Transfer Rutella S, Cingolani A, Di Renzo N, Musto P, Pileri S, Leone G, of motogenic and invasive response to scatter factor/hepatocyte growth Larocca LM. Expression of the c-MET proto-oncogene and its ligand, factor by transfection of human MET protooncogene. Proc Natl Acad hepatocyte growth factor, in Hodgkin disease. Blood 2001;97:1063– Sci 1993;90:649–653. 1069. 21. Gilboa E. The makings of a tumor rejection antigen. Immunity 39. Borset M, Seidel C, Hjorth-Hansen H, Waage A, Sundan A. The 1999;11:263–70. role of hepatocyte growth factor and its receptor c-met in multiple 22. Jager E, Jager D, Knuth A. Clinical cancer vaccine trials. Curr Opin myeloma and other blood malignancies. Leuk Lymphoma 1999;32: Immunol 2002;14:178–82. 249–256. 23. Brossart P, Wirths S, Brugger W, Kanz L. Dendritic cells in cancer 40. Jucker M, Gunther A, Gradl G, Fonatsch C, Krueger G, Diehl V, vaccines. Exp Hematol 2001;29:1247–55. Tesch H. The Met/hepatocyte growth factor receptor (HGFR) gene is 24. Furge KA, Zhang YW, Vande Woude GF. Met receptor tyrosine overexpressed in some cases of human leukemia and lymphoma. Leuk kinase: enhanced signaling through adapter proteins. Oncogene 2000; Res 1994;18:7–16. 19:5582–5589. 41. Pons E, Uphoff CC, Drexler HG. Expression of hepatocyte growth 25. Ponzetto C, Bardelli A, Maina F, Longati P, Panayotou G, Dhand R, factor and its receptor c-met in human leukemia-lymphoma cell lines. Waterfield MD, Comoglio PMA. novel recognition motif for phosphati- Leuk Res 1998;22:797–804.

42. Wang R, Ferrell LD, Faouzi S, Maher JJ, Bishop JM. Activation of 46. Brossart P, Wirths S, Stuhler G, Reichardt VL, Kanz L, Brugger W. the Met Receptor by cell attachment induces and sustains hepatocellular Induction of cytotoxic T-lymphocyte responses in vivo after vaccina- carcinomas in transgenic mice J Cell Biol 2001;153:1023–1033. tions with peptide-pulsed dendritic cells. Blood 2001;96:3102–8. 43. Takayama H, LaRochelle WJ, Sharp R, Otsuka T, Kriebel P, Anver 47. Dudley ME, Wunderlich JR, Robbins PF, Yang JC, Hwu P, M, Aaronson SA, Merlino G. Diverse tumorigenesis associated with Schwartzentruber DJ, Topalian SL, Sherry R, Restifo NP, Hubicki AM, aberrant development in mice overexpressing hepatocyte growth factor/ Robinson MR, Raffeld M, Duray P, Seipp CA, Rogers-Freezer L, scatter factor. Proc Natl Acad Sci 1997;94:701–706. Morton KE, Mavroukakis SA, White DE, Rosenberg SA. Cancer re- 44. Nestle FO, Alijagic S, Gilliet M, Sun Y, Grabbe S, Dummer R, gression and autoimmunity in patients after clonal repopulation with Burg G, Schadendorf D. Vaccination of melanoma patients with pep- antitumor lymphocytes. Science 2002;298:850–4. tide- or tumor lysate-pulsed dendritic cells. Nat Med 1998;4:328–32. 48. Holtl L, Zelle-Rieser C, Gander H, Papesh C, Ramoner R, Bartsch 45. Schuler-Thurner B, Schultz ES, Berger TG, Weinlich G, Ebner S, G, Rogatsch H, Barsoum AL, Coggin JH. Jr., Thurnher, M. Immuno- Woerl P, Bender A, Feuerstein B, Fritsch PO, Romani N, Schuler G. Rapid therapy of metastatic renal cell carcinoma with tumor lysate-pulsed induction of tumor-specific type 1 T helper cells in metastatic melanoma autologous dendritic cells Clin Cancer Res 2002;8:3369–3376. patients by vaccination with mature, cryopreserved, peptide-loaded 49. Gilboa E. The risk of autoimmunity associated with tumor immuno- monocyte-derived dendritic cells. J Exp Med 2002;195:1279–88. therapy. Nat Immunol 2001;2:789–92.

Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2004 American Association for Cancer Research. Identification of C-Met Oncogene as a Broadly Expressed Tumor-Associated Antigen Recognized by Cytotoxic T-Lymphocytes

Kerstin Schag, Susanne M. Schmidt, Martin R. Müller, et al.

Clin Cancer Res 2004;10:3658-3666.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/10/11/3658

Cited articles This article cites 48 articles, 25 of which you can access for free at: http://clincancerres.aacrjournals.org/content/10/11/3658.full#ref-list-1

Citing articles This article has been cited by 3 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/10/11/3658.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/10/11/3658. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.