DOCSLIB.ORG

B Cell Differentiation Identification of Pax5 Target Genes in Early

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
B Cell Differentiation Identification of Pax5 Target Genes in Early Identification of Pax5 Target Genes in Early B Cell Differentiation Clare Pridans, Melissa L. Holmes, Matthew Polli, James M. Wettenhall, Aleksandar Dakic, Lynn M. Corcoran, Gordon This information is current as K. Smyth and Stephen L. Nutt of September 26, 2021. J Immunol 2008; 180:1719-1728; ; doi: 10.4049/jimmunol.180.3.1719 http://www.jimmunol.org/content/180/3/1719 Downloaded from References This article cites 61 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/180/3/1719.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Identification of Pax5 Target Genes in Early B Cell Differentiation1 Clare Pridans,2,3*† Melissa L. Holmes,2* Matthew Polli,* James M. Wettenhall,* Aleksandar Dakic,* Lynn M. Corcoran,* Gordon K. Smyth,* and Stephen L. Nutt4* The transcription factor Pax5 is essential for B cell commitment in the mouse, where it represses lineage-inappropriate gene expression while simultaneously activating the B cell gene expression program. In this study we have performed a global gene expression screen of wild-type and Pax5-deficient pro-B cells in an attempt to identify the crucial Pax5 targets in early B lym- phopoiesis. These studies have identified 109 Pax5 targets comprising 61% activated and 39% repressed genes. Interestingly, Pax5 directly regulates the genes encoding a number of transcription factors that are required at the pre-B cell stage of differentiation, including Irf8, Spib, and Ikzf3 (Aiolos), suggesting that a key function of Pax5 is to activate secondary transcription factors that further reinforce the B cell program. Pax5 is also required for the expression of many genes known to be involved in adhesion and Downloaded from signaling, indicating that Pax5 modulates the homing and or migration properties of B cell progenitors. Finally, Pax5 also represses a cohort of genes that are involved in multiple biological processes, many of which are not typically associated with B cells. These include the repression of the adhesion molecule Embigin, which is expressed in bone marrow progenitors, T cells, and myeloid cells but is specifically repressed by Pax5 in B cells. The Journal of Immunology, 2008, 180: 1719–1728. he B lymphocytes are produced in a stepwise process that they are not committed to the B cell lineage and are able to http://www.jimmunol.org/ from self-renewing hemopoietic stem cells (HSCs)5 in the differentiate into virtually all hemopoietic cell lineages in vitro and T fetal liver and postnatal bone marrow (BM). In recent in vivo (7–10). years it has become apparent that this process is controlled by a Pax5 promotes B lymphopoiesis by activating B cell-specific complex transcription factor network that both activates lineage- genes such as those involved in pre-BCR signaling, including specific gene expression (lineage specification) and restricts the Cd19 (11), Cd79a (mb-1) (4, 12), and Blnk (13), as well as Igll5 differentiation options of HSCs and their progeny (lineage com- and VpreB1 (14). Although the inability to express the pre-BCR mitment) (1–3). Although there has been extensive analysis of the was potentially the cause of the developmental block in the ab- transcription factors that regulate the initial steps in B lymphopoi- sence of Pax5, the introduction of functionally rearranged Igh and by guest on September 26, 2021 esis, relatively little is known about the molecular targets of these chimeric Igh-Ig␤ transgenes into the Pax5 mutant background was factors that ultimately mediate the commitment process. unable to progress B cell development beyond the early pro-B cell The transcription factor Pax5 is essential for B lymphopoiesis, stage (15). Pax5 also functions to repress genes whose expression as development is arrested at an early pro-B cell stage in the BM is not usually associated with the B cell program. The Pax5-de- Ϫ/Ϫ of Pax5-deficient mice (4, 5). These Pax5 pro-B cells can be pendent repression of the csf1r and Notch1 genes illustrates at the propagated in vitro in the presence of IL-7 and stromal cells and molecular level how developmental options are suppressed in maintain an early B cell phenotype characterized by the expression committed B lymphocytes, as these cells are no longer responsive ␭ of B cell-specific transcripts such as Cd79b (B29), Igll5 ( 5), and to the myeloid cytokine M-CSF or to the T cell-inducing Notch1 VpreB1 and D-J recombination events at the Igh locus (4, 6). Pax5- ligand Delta-like 1 (7, 16, 17). Pax5 also functions to repress genes deficient pro-B cells, however, display a remarkable phenotype in associated with multipotency such as Flt3, which, although re- quired for early hemopoiesis, must be silenced by Pax5 to allow B *The Walter and Eliza Hall Institute of Medical Research, Parkville, Australia; and lymphopoiesis to proceed (18). A more global approach to iden- † University of Western Sydney, Richmond, Australia tifying target genes using cDNA microarray technology has con- Received for publication September 4, 2007. Accepted for publication November firmed that many Pax5-repressed genes are normally expressed in 28, 2007. non-B cell lineages and interestingly found that a number of those The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance are reactivated during the physiological down-regulation of Pax5 with 18 U.S.C. Section 1734 solely to indicate this fact. during plasma cell differentiation, whereas many B cell-specific 1 This work was supported by a Pfizer Australia Research Fellowship (to S.L.N.), and genes are positively regulated by Pax5 (19, 20). the National Health and Medical Research Council of Australia. As an alternative approach to identify potential Pax5 target 2 C.P. and M.L.H. contributed equally to this work. genes, we performed a screen of a mature B cell cDNA microarray 3 Current address: Cambridge Institute for Medical Research, Department of to compare gene expression between wild-type and Pax5Ϫ/Ϫ pro-B Haematology, Hills Road, Cambridge CB2 OXY, U.K. cells. This screen has resulted in the identification of Ͼ100 genes 4 Address correspondence and reprint requests to Dr. Stephen L. Nutt, The Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Victoria, representing both Pax5-activated and -repressed targets, many of Australia 3050. E-mail address: [email protected] which were not detected in the previous studies. These genes are 5 Abbreviations used in this paper: HSC, hemopoietic stem cell; BM, bone marrow; known or predicted to perform a diverse range of functions within CLP, common lymphoid progenitor; EMB, Embigin; ER, estrogen receptor; NIA 15k, the cell and highlight the dual function of Pax5 to repress inap- 15,000 clone mouse cDNA library of National Institute of Aging; Sdc4, syndecan-4. propriate gene expression while further activating essential com- Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 ponents of the B cell program. www.jimmunol.org 1720 GENE REGULATION BY Pax5 Table I. Oligonucleotide primer sequences used in semiquantitative RT-PCR analysis of potential Pax5 target genesa 5Ј Primer Sequence 3Ј Primer Sequence Gene (5Ј33Ј) (5Ј33Ј) Ikzf3 ATGACAACAGCAGACCAACCAG TGTAGTTGGCATCGAAGCAGTG Arpc5l GAACGAGCCCAGGGTGTAGTCC TGGTCCATTGTCAGTCCCTTCTTC Blr1 GACATGGGCTCCATCACATA GTGCCTCTCCAGGATTACCA Cbfb GACCAGAGGAGCAAGTTCGAG GAGTTCTTCTTCGAGCCTCTTC Cd19 GAGAGGCACGTGAAGGTCATTG CATGGCTCTGAGCTCCAGTATC Tcfe2a TGGCACTTACAGTGGGACTTC ATGGAGACCTGCATCGTAGTTG Ebf1 ATGTTTGGGATCCAGGAAAGC CAGGGTTCTTGTCTTGGCCTT Emb TGTACACAGGGACCAACGGAGACG TGTTGCCCATTTTAGTTGTATTGA Ep400 GAGCTGGCTGACTTTATGGAAC GCTCCTTCCTCACATAAACAGG Flt3 GTGACTGGCCCCCTGGATAACGAG TCCAAGGGCGGGTGTAACTGAACT Frmd4b GGGCTCGAGGTGGCAAGTT CCAGTGGGGGTATGAGGTAGTTTA Gpx1 GGTTTCCCGTGCAATCAGTTCG GCCGCCTTAGGAGTTGCCAGAC Hprt GGGGGCTATAAGTTCTTTGC TCCAACACTTCGAGAGGTCC Lax1 GAACTCAGAGCCCAGCACTCGG GGAGGCAGAGTCAACGATGGAG Lcp1 TATCGGAGGTGGACAGAAGG ACCCTTGCTCCGATTTTTCT Lsp1 GAGAGTTCTCACCAAGCCAAAG TTCTGCTCCCACAGACTTTTCT Nfatc1 CCGATAGCACTCTGGACCTG GTAGCTGCACAATGGGGTGT Downloaded from Plcg2 GTGGAGACGAAGGCAGACAG CTGCAGGACGTAGCCTGTTC Pten GCTGAGAGACATTATGACACCG GCGCCTCTGACTGGGAATTGTG Spib GCTGGCTTCAAGCTCATGACAC TTGGCCTGTAGCACTTGAACGG Syvn1 GTGATGGGCAAGGTGTTCTT CACGGAGTGCAGCACATACT Tmsb10 GGCTCTTCCTCCACATCACGA AAGAAAACCGAGACGCAGGAGAAG Irf8 CAGGAGGTGGATGCTTCCATC GCACAGCGTAACCTCGTCTTC Blnk CTGCCGCACCATCCCCACTAC GTCACAGGCGCCAGCATACCAG http://www.jimmunol.org/ Atp1b1 CGAGGCCTACGTGCTAAACAT GTATCCGCCCATCCCAAAGTA Ccnd3 CAGCGCTGCGAGGAGGATGTCTTC CACGGCAGCCAGGTCCCACTTGAG Sdc4 AGCCTCCCCGACGACGAAGAT
Load more

Recommended publications
  • PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
    [CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24).
    [Show full text]
  • HEF1 (NEDD9) Mouse Monoclonal Antibody [Clone ID: 2G9] Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA319568 HEF1 (NEDD9) Mouse Monoclonal Antibody [Clone ID: 2G9] Product data: Product Type: Primary Antibodies Clone Name: 2G9 Applications: IF, WB Recommend Dilution: ELISA: 1:5,000 - 1:20,000, WB: 1:5,000, IF: 1:500, IP: 1:1,000 Reactivity: Human Host: Mouse Clonality: Monoclonal Immunogen: Anti-HEF1 monoclonal antibody was produced by repeated immunizations with a synthetic peptide corresponding to amino acid residues 82-398 of human HEF1 protein (hHEF1, 843 aa, predicted MW 92.8 kDa). Formulation: 0.02 M Potassium Phosphate, 0.15 M Sodium Chloride, pH 7.2 Concentration: 1 mg/ml Gene Name: neural precursor cell expressed, developmentally down-regulated 9 Database Link: NP_001135865 Entrez Gene 4739 Human Synonyms: CAS-L; CAS2; CASL; CASS2; HEF1 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2020 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 HEF1 (NEDD9) Mouse Monoclonal Antibody [Clone ID: 2G9] – TA319568 Note: HEF1, also known as Enhancer of filamentation 1, CRK-associated substrate-related protein, CAS-L, CasL, p105 and Neural precursor cell expressed developmentally down-regulated 9 is the product of the NEDD9 (CASGL) gene. HEF1 functions as a docking protein that plays a central coordinating role for tyrosine-kinase-based signaling related to cell adhesion. HEF1 may also function in transmitting growth control signals between focal adhesions at the cell periphery and the mitotic spindle in response to adhesion or growth factor signals initiating cell proliferation.
    [Show full text]
  • Bilateral Gene Interaction Hierarchy Analysis of the Cell Death Gene
    White et al. BMC Genomics (2016) 17:130 DOI 10.1186/s12864-016-2412-0 RESEARCH ARTICLE Open Access Bilateral gene interaction hierarchy analysis of the cell death gene response emphasizes the significance of cell cycle genes following unilateral traumatic brain injury Todd E. White1, Monique C. Surles-Zeigler1, Gregory D. Ford2, Alicia S. Gates1, Benem Davids1, Timothy Distel1,4, Michelle C. LaPlaca3 and Byron D. Ford1,4* Abstract Background: Delayed or secondary cell death that is caused by a cascade of cellular and molecular processes initiated by traumatic brain injury (TBI) may be reduced or prevented if an effective neuroprotective strategy is employed. Microarray and subsequent bioinformatic analyses were used to determine which genes, pathways and networks were significantly altered 24 h after unilateral TBI in the rat. Ipsilateral hemi-brain, the corresponding contralateral hemi-brain, and naïve (control) brain tissue were used for microarray analysis. Results: Ingenuity Pathway Analysis showed cell death and survival (CD) to be a top molecular and cellular function associated with TBI on both sides of the brain. One major finding was that the overall gene expression pattern suggested an increase in CD genes in ipsilateral brain tissue and suppression of CD genes contralateral to the injury which may indicate an endogenous protective mechanism. We created networks of genes of interest (GOI) and ranked the genes by the number of direct connections each had in the GOI networks, creating gene interaction hierarchies (GIHs). Cell cycle was determined from the resultant GIHs to be a significant molecular and cellular function in post-TBI CD gene response.
    [Show full text]
  • Further Delineation of Chromosomal Consensus Regions in Primary
    Leukemia (2007) 21, 2463–2469 & 2007 Nature Publishing Group All rights reserved 0887-6924/07 $30.00 www.nature.com/leu ORIGINAL ARTICLE Further delineation of chromosomal consensus regions in primary mediastinal B-cell lymphomas: an analysis of 37 tumor samples using high-resolution genomic profiling (array-CGH) S Wessendorf1,6, TFE Barth2,6, A Viardot1, A Mueller3, HA Kestler3, H Kohlhammer1, P Lichter4, M Bentz5,HDo¨hner1,PMo¨ller2 and C Schwaenen1 1Klinik fu¨r Innere Medizin III, Zentrum fu¨r Innere Medizin der Universita¨t Ulm, Ulm, Germany; 2Institut fu¨r Pathologie, Universita¨t Ulm, Ulm, Germany; 3Forschungsdozentur Bioinformatik, Universita¨t Ulm, Ulm, Germany; 4Abt. Molekulare Genetik, Deutsches Krebsforschungszentrum, Heidelberg, Germany and 5Sta¨dtisches Klinikum Karlsruhe, Karlsruhe, Germany Primary mediastinal B-cell lymphoma (PMBL) is an aggressive the expression of BSAP, BOB1, OCT2, PAX5 and PU1 was extranodal B-cell non-Hodgkin’s lymphoma with specific clin- added to the spectrum typical of PMBL features.9 ical, histopathological and genomic features. To characterize Genetically, a pattern of highly recurrent karyotype alterations further the genotype of PMBL, we analyzed 37 tumor samples and PMBL cell lines Med-B1 and Karpas1106P using array- with the hallmark of chromosomal gains of the subtelomeric based comparative genomic hybridization (matrix- or array- region of chromosome 9 supported the concept of a unique CGH) to a 2.8k genomic microarray. Due to a higher genomic disease entity that distinguishes PMBL from other B-cell non- resolution, we identified altered chromosomal regions in much Hodgkin’s lymphomas.10,11 Together with less specific gains on higher frequencies compared with standard CGH: for example, 2p15 and frequent mutations of the SOCS1 gene, a notable þ 9p24 (68%), þ 2p15 (51%), þ 7q22 (32%), þ 9q34 (32%), genomic similarity to classical Hodgkin’s lymphoma was þ 11q23 (18%), þ 12q (30%) and þ 18q21 (24%).
    [Show full text]
  • Open Dogan Phdthesis Final.Pdf
    The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues.
    [Show full text]
  • Genomic Profiling of Adult Acute Lymphoblastic Leukemia by Single
    SUPPLEMENTARY APPENDIX Genomic profiling of adult acute lymphoblastic leukemia by single nucleotide polymorphism oligonucleotide microarray and comparison to pediatric acute lymphoblastic leukemia Ryoko Okamoto,1 Seishi Ogawa,2 Daniel Nowak,1 Norihiko Kawamata,1 Tadayuki Akagi,1,3 Motohiro Kato,2 Masashi Sanada,2 Tamara Weiss,4 Claudia Haferlach,4 Martin Dugas,5 Christian Ruckert,5 Torsten Haferlach,4 and H. Phillip Koeffler1,6 1Division of Hematology and Oncology, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, CA, USA; 2Cancer Genomics Project, Graduate School of Medicine, University of Tokyo, Tokyo, Japan; 3Department of Stem Cell Biology, Graduate School of Medical Science, Kanazawa University 4MLL Munich Leukemia Laboratory, Munich, Germany; 5Department of Medical Informatics and Biomathematics, University of Münster, Münster, Germany; 6Cancer Science Institute of Singapore, National University of Singapore, Singapore Citation: Okamoto R, Ogawa S, Nowak D, Kawamata N, Akagi T, Kato M, Sanada M, Weiss T, Haferlach C, Dugas M, Ruckert C, Haferlach T, and Koeffler HP. Genomic profiling of adult acute lymphoblastic leukemia by single nucleotide polymorphism oligonu- cleotide microarray and comparison to pediatric acute lymphoblastic leukemia. Haematologica 2010;95(9):1481-1488. doi:10.3324/haematol.2009.011114 Online Supplementary Data ed by PCR of genomic DNA and subsequent direct sequencing of SNP in a region of CNN-LOH in an ALL sample versus the corresponding Design and Methods matched normal sample (Online Supplementary
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A PAX5-OCT4-PRDM1 Developmental Switch Specifies Human Primordial Germ Cells
    A PAX5-OCT4-PRDM1 Developmental Switch Specifies Human Primordial Germ Cells Fang Fang1,2, Benjamin Angulo1,2, Ninuo Xia1,2, Meena Sukhwani3, Zhengyuan Wang4, Charles C Carey5, Aurélien Mazurie5, Jun Cui1,2, Royce Wilkinson5, Blake Wiedenheft5, Naoko Irie6, M. Azim Surani6, Kyle E Orwig3, Renee A Reijo Pera1,2 1Department of Cell Biology and Neurosciences, Montana State University, Bozeman, MT 59717, USA 2Department of Chemistry and Biochemistry, Montana State University, Bozeman, MT 59717, USA 3Department of Obstetrics, Gynecology and Reproductive Sciences, University of Pittsburgh, School of Medicine; Magee Women’s Research Institute, Pittsburgh, PA, 15213, USA 4Genomic Medicine Division, Hematology Branch, NHLBI/NIH, MD 20850, USA 5Department of Microbiology and Immunology, Montana State University, Bozeman, MT 59717, USA. 6Wellcome Trust Cancer Research UK Gurdon Institute, Tennis Court Road, University of Cambridge, Cambridge CB2 1QN, UK. Correspondence should be addressed to F.F. (e-mail: [email protected]) 1 Abstract Dysregulation of genetic pathways during human germ cell development leads to infertility. Here, we analyzed bona fide human primordial germ cells (hPGCs) to probe the developmental genetics of human germ cell specification and differentiation. We examined distribution of OCT4 occupancy in hPGCs relative to human embryonic stem cells (hESCs). We demonstrate that development, from pluripotent stem cells to germ cells, is driven by switching partners with OCT4 from SOX2 to PAX5 and PRDM1. Gain- and loss-of-function studies revealed that PAX5 encodes a critical regulator of hPGC development. Moreover, analysis of epistasis indicates that PAX5 acts upstream of OCT4 and PRDM1. The PAX5-OCT4-PRDM1 proteins form a core transcriptional network that activates germline and represses somatic programs during human germ cell differentiation.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Immunohistochemical Expression of NEDD9, E-Cadherin and Γ-Catenin and Their Prognostic Significance in Pancreatic Ductal Adenocarcinoma (PDAC)
    BOSNIAN JOURNAL of Basic Medical Sciences RESEARCH ARTICLE WWW.BJBMS.ORG Immunohistochemical expression of NEDD9, E-cadherin and γ-catenin and their prognostic significance in pancreatic ductal adenocarcinoma (PDAC) Petra Radulović*, Božo Krušlin Department of Pathology and Cytology, Sestre Milosrdnice University Hospital, Zagreb, Croatia ABSTRACT Extensive research is being conducted to identify novel diagnostic, predictive and prognostic biomarkers for pancreatic ductal adenocarcinoma (PDAC), as only a few markers have been routinely used so far with limited success. Our aim was to assess the expression of neural precur- sor cell expressed developmentally down-regulated protein 9 (NEDD9), E-cadherin, and γ-catenin in PDAC in relation to clinicopathological parameters and patient survival. We also investigated if there is a correlation of NEDD9 expression with E-cadherin or γ-catenin. The protein expression was determined by immunohistochemistry in 61 PDAC and 61 samples of normal pancreatic tissue. The log rank test and Kaplan- Meier survival curve were used for survival analysis. E-cadherin and γ-catenin expressions were reduced in PDAC, and completely retained in normal pancreatic tissue. Expression of NEDD9 was significantly increased in PDAC (strong expression in 78.7% of cases and moderate in 21.3%) and reduced in normal pancreatic tissue (strong positivity in 45.9% of cases, moderate in 31.1%, and weak in 23%). There was a positive correlation between reduced E-cadherin and γ-catenin expression in PDAC (p = 0.015). The loss or reduced expression of E-cadherin had a negative impact on patient survival (p = 0.020). A negative correlation between E-cadherin expression and tumor grade was also observed (p = 0.011).
    [Show full text]
  • Involvement of DPP9 in Gene Fusions in Serous Ovarian Carcinoma
    Smebye et al. BMC Cancer (2017) 17:642 DOI 10.1186/s12885-017-3625-6 RESEARCH ARTICLE Open Access Involvement of DPP9 in gene fusions in serous ovarian carcinoma Marianne Lislerud Smebye1,2, Antonio Agostini1,2, Bjarne Johannessen2,3, Jim Thorsen1,2, Ben Davidson4,5, Claes Göran Tropé6, Sverre Heim1,2,5, Rolf Inge Skotheim2,3 and Francesca Micci1,2* Abstract Background: A fusion gene is a hybrid gene consisting of parts from two previously independent genes. Chromosomal rearrangements leading to gene breakage are frequent in high-grade serous ovarian carcinomas and have been reported as a common mechanism for inactivating tumor suppressor genes. However, no fusion genes have been repeatedly reported to be recurrent driver events in ovarian carcinogenesis. We combined genomic and transcriptomic information to identify novel fusion gene candidates and aberrantly expressed genes in ovarian carcinomas. Methods: Examined were 19 previously karyotyped ovarian carcinomas (18 of the serous histotype and one undifferentiated). First, karyotypic aberrations were compared to fusion gene candidates identified by RNA sequencing (RNA-seq). In addition, we used exon-level gene expression microarrays as a screening tool to identify aberrantly expressed genes possibly involved in gene fusion events, and compared the findings to the RNA-seq data. Results: We found a DPP9-PPP6R3 fusion transcript in one tumor showing a matching genomic 11;19-translocation. Another tumor had a rearrangement of DPP9 with PLIN3. Both rearrangements were associated with diminished expression of the 3′ end of DPP9 corresponding to the breakpoints identified by RNA-seq. For the exon-level expression analysis, candidate fusion partner genes were ranked according to deviating expression compared to the median of the sample set.
    [Show full text]