Identification of Pax5 Target Genes in Early B Cell Differentiation Clare Pridans, Melissa L. Holmes, Matthew Polli, James M. Wettenhall, Aleksandar Dakic, Lynn M. Corcoran, Gordon This information is current as K. Smyth and Stephen L. Nutt of September 26, 2021. J Immunol 2008; 180:1719-1728; ; doi: 10.4049/jimmunol.180.3.1719 http://www.jimmunol.org/content/180/3/1719 Downloaded from References This article cites 61 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/180/3/1719.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Identification of Pax5 Target Genes in Early B Cell Differentiation1 Clare Pridans,2,3*† Melissa L. Holmes,2* Matthew Polli,* James M. Wettenhall,* Aleksandar Dakic,* Lynn M. Corcoran,* Gordon K. Smyth,* and Stephen L. Nutt4* The transcription factor Pax5 is essential for B cell commitment in the mouse, where it represses lineage-inappropriate gene expression while simultaneously activating the B cell gene expression program. In this study we have performed a global gene expression screen of wild-type and Pax5-deficient pro-B cells in an attempt to identify the crucial Pax5 targets in early B lym- phopoiesis. These studies have identified 109 Pax5 targets comprising 61% activated and 39% repressed genes. Interestingly, Pax5 directly regulates the genes encoding a number of transcription factors that are required at the pre-B cell stage of differentiation, including Irf8, Spib, and Ikzf3 (Aiolos), suggesting that a key function of Pax5 is to activate secondary transcription factors that further reinforce the B cell program. Pax5 is also required for the expression of many genes known to be involved in adhesion and Downloaded from signaling, indicating that Pax5 modulates the homing and or migration properties of B cell progenitors. Finally, Pax5 also represses a cohort of genes that are involved in multiple biological processes, many of which are not typically associated with B cells. These include the repression of the adhesion molecule Embigin, which is expressed in bone marrow progenitors, T cells, and myeloid cells but is specifically repressed by Pax5 in B cells. The Journal of Immunology, 2008, 180: 1719–1728. he B lymphocytes are produced in a stepwise process that they are not committed to the B cell lineage and are able to http://www.jimmunol.org/ from self-renewing hemopoietic stem cells (HSCs)5 in the differentiate into virtually all hemopoietic cell lineages in vitro and T fetal liver and postnatal bone marrow (BM). In recent in vivo (7–10). years it has become apparent that this process is controlled by a Pax5 promotes B lymphopoiesis by activating B cell-specific complex transcription factor network that both activates lineage- genes such as those involved in pre-BCR signaling, including specific gene expression (lineage specification) and restricts the Cd19 (11), Cd79a (mb-1) (4, 12), and Blnk (13), as well as Igll5 differentiation options of HSCs and their progeny (lineage com- and VpreB1 (14). Although the inability to express the pre-BCR mitment) (1–3). Although there has been extensive analysis of the was potentially the cause of the developmental block in the ab- transcription factors that regulate the initial steps in B lymphopoi- sence of Pax5, the introduction of functionally rearranged Igh and by guest on September 26, 2021 esis, relatively little is known about the molecular targets of these chimeric Igh-Ig␤ transgenes into the Pax5 mutant background was factors that ultimately mediate the commitment process. unable to progress B cell development beyond the early pro-B cell The transcription factor Pax5 is essential for B lymphopoiesis, stage (15). Pax5 also functions to repress genes whose expression as development is arrested at an early pro-B cell stage in the BM is not usually associated with the B cell program. The Pax5-de- Ϫ/Ϫ of Pax5-deficient mice (4, 5). These Pax5 pro-B cells can be pendent repression of the csf1r and Notch1 genes illustrates at the propagated in vitro in the presence of IL-7 and stromal cells and molecular level how developmental options are suppressed in maintain an early B cell phenotype characterized by the expression committed B lymphocytes, as these cells are no longer responsive ␭ of B cell-specific transcripts such as Cd79b (B29), Igll5 ( 5), and to the myeloid cytokine M-CSF or to the T cell-inducing Notch1 VpreB1 and D-J recombination events at the Igh locus (4, 6). Pax5- ligand Delta-like 1 (7, 16, 17). Pax5 also functions to repress genes deficient pro-B cells, however, display a remarkable phenotype in associated with multipotency such as Flt3, which, although re- quired for early hemopoiesis, must be silenced by Pax5 to allow B *The Walter and Eliza Hall Institute of Medical Research, Parkville, Australia; and lymphopoiesis to proceed (18). A more global approach to iden- † University of Western Sydney, Richmond, Australia tifying target genes using cDNA microarray technology has con- Received for publication September 4, 2007. Accepted for publication November firmed that many Pax5-repressed genes are normally expressed in 28, 2007. non-B cell lineages and interestingly found that a number of those The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance are reactivated during the physiological down-regulation of Pax5 with 18 U.S.C. Section 1734 solely to indicate this fact. during plasma cell differentiation, whereas many B cell-specific 1 This work was supported by a Pfizer Australia Research Fellowship (to S.L.N.), and genes are positively regulated by Pax5 (19, 20). the National Health and Medical Research Council of Australia. As an alternative approach to identify potential Pax5 target 2 C.P. and M.L.H. contributed equally to this work. genes, we performed a screen of a mature B cell cDNA microarray 3 Current address: Cambridge Institute for Medical Research, Department of to compare gene expression between wild-type and Pax5Ϫ/Ϫ pro-B Haematology, Hills Road, Cambridge CB2 OXY, U.K. cells. This screen has resulted in the identification of Ͼ100 genes 4 Address correspondence and reprint requests to Dr. Stephen L. Nutt, The Walter and Eliza Hall Institute of Medical Research, 1G Royal Parade, Parkville, Victoria, representing both Pax5-activated and -repressed targets, many of Australia 3050. E-mail address: [email protected] which were not detected in the previous studies. These genes are 5 Abbreviations used in this paper: HSC, hemopoietic stem cell; BM, bone marrow; known or predicted to perform a diverse range of functions within CLP, common lymphoid progenitor; EMB, Embigin; ER, estrogen receptor; NIA 15k, the cell and highlight the dual function of Pax5 to repress inap- 15,000 clone mouse cDNA library of National Institute of Aging; Sdc4, syndecan-4. propriate gene expression while further activating essential com- Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 ponents of the B cell program. www.jimmunol.org 1720 GENE REGULATION BY Pax5 Table I. Oligonucleotide primer sequences used in semiquantitative RT-PCR analysis of potential Pax5 target genesa 5Ј Primer Sequence 3Ј Primer Sequence Gene (5Ј33Ј) (5Ј33Ј) Ikzf3 ATGACAACAGCAGACCAACCAG TGTAGTTGGCATCGAAGCAGTG Arpc5l GAACGAGCCCAGGGTGTAGTCC TGGTCCATTGTCAGTCCCTTCTTC Blr1 GACATGGGCTCCATCACATA GTGCCTCTCCAGGATTACCA Cbfb GACCAGAGGAGCAAGTTCGAG GAGTTCTTCTTCGAGCCTCTTC Cd19 GAGAGGCACGTGAAGGTCATTG CATGGCTCTGAGCTCCAGTATC Tcfe2a TGGCACTTACAGTGGGACTTC ATGGAGACCTGCATCGTAGTTG Ebf1 ATGTTTGGGATCCAGGAAAGC CAGGGTTCTTGTCTTGGCCTT Emb TGTACACAGGGACCAACGGAGACG TGTTGCCCATTTTAGTTGTATTGA Ep400 GAGCTGGCTGACTTTATGGAAC GCTCCTTCCTCACATAAACAGG Flt3 GTGACTGGCCCCCTGGATAACGAG TCCAAGGGCGGGTGTAACTGAACT Frmd4b GGGCTCGAGGTGGCAAGTT CCAGTGGGGGTATGAGGTAGTTTA Gpx1 GGTTTCCCGTGCAATCAGTTCG GCCGCCTTAGGAGTTGCCAGAC Hprt GGGGGCTATAAGTTCTTTGC TCCAACACTTCGAGAGGTCC Lax1 GAACTCAGAGCCCAGCACTCGG GGAGGCAGAGTCAACGATGGAG Lcp1 TATCGGAGGTGGACAGAAGG ACCCTTGCTCCGATTTTTCT Lsp1 GAGAGTTCTCACCAAGCCAAAG TTCTGCTCCCACAGACTTTTCT Nfatc1 CCGATAGCACTCTGGACCTG GTAGCTGCACAATGGGGTGT Downloaded from Plcg2 GTGGAGACGAAGGCAGACAG CTGCAGGACGTAGCCTGTTC Pten GCTGAGAGACATTATGACACCG GCGCCTCTGACTGGGAATTGTG Spib GCTGGCTTCAAGCTCATGACAC TTGGCCTGTAGCACTTGAACGG Syvn1 GTGATGGGCAAGGTGTTCTT CACGGAGTGCAGCACATACT Tmsb10 GGCTCTTCCTCCACATCACGA AAGAAAACCGAGACGCAGGAGAAG Irf8 CAGGAGGTGGATGCTTCCATC GCACAGCGTAACCTCGTCTTC Blnk CTGCCGCACCATCCCCACTAC GTCACAGGCGCCAGCATACCAG http://www.jimmunol.org/ Atp1b1 CGAGGCCTACGTGCTAAACAT GTATCCGCCCATCCCAAAGTA Ccnd3 CAGCGCTGCGAGGAGGATGTCTTC CACGGCAGCCAGGTCCCACTTGAG Sdc4 AGCCTCCCCGACGACGAAGAT