Ostm1 from Mouse to Human: Insights Into Osteoclast Maturation

Total Page:16

File Type:pdf, Size:1020Kb

Ostm1 from Mouse to Human: Insights Into Osteoclast Maturation International Journal of Molecular Sciences Review Ostm1 from Mouse to Human: Insights into Osteoclast Maturation Jean Vacher 1,2,3,*, Michael Bruccoleri 1,2 and Monica Pata 1 1 Institut de Recherches Cliniques de Montreal (IRCM), Montreal, QC H2W 1R7, Canada; [email protected] (M.B.); [email protected] (M.P.) 2 Departement de Medecine, Universite de Montreal, Montreal, QC H2W 1R7, Canada 3 Department of Medicine, Division of Experimental Medicine, McGill University, Montreal, QC H3A 1A3, Canada * Correspondence: [email protected] Received: 16 July 2020; Accepted: 4 August 2020; Published: 5 August 2020 Abstract: The maintenance of bone mass is a dynamic process that requires a strict balance between bone formation and resorption. Bone formation is controlled by osteoblasts, while osteoclasts are responsible for resorption of the bone matrix. The opposite functions of these cell types have to be tightly regulated not only during normal bone development, but also during adult life, to maintain serum calcium homeostasis and sustain bone integrity to prevent bone fractures. Disruption of the control of bone synthesis or resorption can lead to an over accumulation of bone tissue in osteopetrosis or conversely to a net depletion of the bone mass in osteoporosis. Moreover, high levels of bone resorption with focal bone formation can cause Paget’s disease. Here, we summarize the steps toward isolation and characterization of the osteopetrosis associated trans-membrane protein 1 (Ostm1) gene and protein, essential for proper osteoclast maturation, and responsible when mutated for the most severe form of osteopetrosis in mice and humans. Keywords: osteoclast; osteopetrosis; grey-lethal; Ostm1; bone resorption; trafficking 1. Introduction Osteoclasts derive from hematopoietic stem cells that are shared with early myeloid lineage precursors. Differentiation of osteoclast precursors is dependent on mature osteoblasts that produce macrophage colony-stimulating factor (M-CSF), receptor activator of NF-κB Ligand (RANKL), and osteoprotegerin (OPG) a soluble decoy receptor of RANKL [1–5]. Upon recruitment and attachment to bone, mononuclear pre-osteoclasts undergo a process of fusion and these newly-formed multinucleated cells are structurally and functionally induced to generate active osteoclasts [6]. Mature osteoclasts are large multinucleated cells with numerous mitochondria, vacuoles, and lysosomes, which resorb mineralized cartilage and bone [7]. The biochemical characterization of osteoclasts have been hampered by the fact that these giant cells are tightly attached to the bone matrix and are therefore difficult to isolate. Moreover, as these cells are terminally differentiated and non-proliferative, a large number of cells have to be isolated at once. However, despite these impediments, osteoclast specific markers have been defined and novel efficient tools have been developed to analyze osteoclast biology ex vivo and in vivo [8]. When osteoclasts are activated, a resorption cycle is induced causing several proteins to be relocalized along with cytoskeletal rearrangement. Active osteoclasts are polarized and show two cellular histo-morphologic characteristics: an actin ring and a ruffled border. The actin ring, devoided of organelles, is enriched in dynamic and adhesive projections of the cell membrane called podosomes and in αVβ3 integrins that allow spreading and tight attachment to the bone surface [9–11]. The plasma Int. J. Mol. Sci. 2020, 21, 5600; doi:10.3390/ijms21165600 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, 5600 2 of 14 membraneInt. J. Mol. in contactSci. 2020, with21, x FOR the PEER bone REVIEW surface enlarges into the ruffled border that induces polarization 2 of 14 of the osteoclast. Following this attachment, the osteoclast secretory lysosomes, also found in immune cells andinduces melanocytes polarization [12 ,of13 ],th wille osteoclast. associate Following and move this along attachment the microtubules,, the osteoclast fuse secretory to the plasma lysosomes, membrane,also found and thenin immune participate cells inand ru fflmelanocytesed border formation [12,13], will [14 associate,15]. The and ruffl moveed border along is the an infoldedmicrotubules, finger-likefuse to distortion the plasma of themembrane, plasma membraneand then participate adjacent toin theruffled bone border surface formation that participates [14,15]. The with ruffled lysosomalborder proton is an pumpinfolded H+ finger-like/V-ATPase anddistortion chloride of exchangerthe plasma ClC-7 membrane in acidification adjacent ofto thethe extracellularbone surface that resorbingparticipates lacunae towith ensure lysosomal bone matrix proton demineralization pump H+/V-ATPase [16–18 and]. In chloride the lacunae, exchanger release ClC-7 from in secretory acidification lysosomesof the ofextracellular tartrate resistant resorbing acid lacunae phosphatase to ensure (Trap), bone matrix matrix metallopeptidases demineralization [16–18]. (Mmp 9,14)In the [19 lacunae,], and cathepsinrelease Kfrom (Ctsk) secretory result in osteoidlysosomes degradation of tartrate which resistant is principally acid type phosphatase I collagen [ 20(Trap),] whereas matrix high aciditymetallopeptidases potentiates (Mmp dissolution 9,14) of[19], hydroxyapatite, and cathepsin theK (Ctsk) bone mineralresult in component. osteoid degradation The protein which is and mineralprincipally degradation type I collagen products [20] are whereas phagocytosed high acidity at the potentiates ruffled border dissolution into of of the hydroxyapatite, osteoclast as the digestivebone vacuole. mineral Thus, component. bone resorption The protein involves and exocytosismineral degradation and endocytosis products at the are ru fflphagocytoseded border and at the exocytosisruffled on border the contralateral into of the sideosteoclast of osteoclasts as digestive [10,21 vacuole.]. Importantly, Thus, bone osteoclast resorption bone resorptioninvolves exocytosis has been demonstratedand endocytosis to beat the critical ruffled for normalborder hematopoieticand exocytosis progenitorson the contralateral recruitment side and of osteoclasts proliferation [10,21]. that linkImportantly, bone remodeling osteoclast to hematopoiesisbone resorption regulation has been [22]. demonstrated Furthermore, numerousto be critical fundamental for normal bone–immunehematopoietic interactions progenitors through recruitment shared factors and prolifer have beenation discovered that link andbone are remodeling the subject to of hematopoiesis the field of osteoimmunologyregulation [22]. [23Furthermore,–26]. numerous fundamental bone–immune interactions through shared Defectivefactors have osteoclast been discovered differentiation and are or the generation subject of of the ine fieldfficient of os osteoclaststeoimmunology leads to[23–26] the severe bone pathologyDefective called osteoclast osteopetrosis, differentiation a heterogenous or generation inherited of inefficient disease of osteoclasts bone metabolism leads to [27 the,28 ].severe This diseasebone pathology was first describedcalled osteopetrosis, by Albers-Schönberg a heterogenous [29] and inherited results indisease accumulation of bone ofmetabolism mineralized [27,28]. osteoidThis and disease cartilage was due first to described loss of bone by Albers-Schönberg resorption [4,30]. Di[29]fferent and results forms ofin osteopetrosisaccumulation have of mineralized been characterizedosteoid and in variouscartilage vertebrate due to loss species of bone [ 31resorption–33] and [4,30]. mouse Different models forms were essentialof osteopetrosis toward have our been understandingcharacterized of mammalian in various vertebrate osteoclast formationspecies [31– and33] functionand mouse [12, 34models]. In humans, were essential three clinicaltoward our groupsunderstanding have been defined: of mammalian osteoclast formation and function [12,34]. In humans, three clinical groups have been defined: infantile-malignant autosomal recessive (ARO) which is fatal within the first few years of life; • intermediate• infantile-malignant recessive (IRO) autosomal which appears recessive during (ARO) the which first decade is fatal ofwithin life but the does first notfew mediate years of a life; • malignant• intermediate response; recessive (IRO) which appears during the first decade of life but does not mediate autosomala malignant dominant response; (ADO), with full-life expectancy but with major bone malformations. • • autosomal dominant (ADO), with full-life expectancy but with major bone malformations. Each form of the disease is characterized by a reduced bone marrow compartment leading to hematopoieticEach defects form of including the disease anemia is characterized and high susceptibility by a reduced to infections bone marrow [35,36]. compartment Characterization leading of to autosomalhematopoietic recessive defects osteopetrotic including mutations anemia and in high mouse susc modelseptibility and to infections in human [35,36]. patients Characterization defined ‘osteoclast-poor’of autosomal (impaired recessive osteoclastosteopetrotic diff mutationserentiation) in andmouse ‘osteoclast-rich’ models and in (inactive human osteoclasts)patients defined osteopetrosis‘osteoclast-poor’ leading to (impaired more targeted osteoclast therapies differentiation) [37–39]. and ‘osteoclast-rich’ (inactive osteoclasts) osteopetrosis leading to more targeted therapies [37–39]. 2. Osteopetrotic Grey-Lethal Mouse Model 2. Osteopetrotic Grey-Lethal Mouse Model The spontaneous osteopetrotic grey-lethal
Recommended publications
  • Broad and Thematic Remodeling of the Surface Glycoproteome on Isogenic
    bioRxiv preprint doi: https://doi.org/10.1101/808139; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Broad and thematic remodeling of the surface glycoproteome on isogenic cells transformed with driving proliferative oncogenes Kevin K. Leung1,5, Gary M. Wilson2,5, Lisa L. Kirkemo1, Nicholas M. Riley2,4, Joshua J. Coon2,3, James A. Wells1* 1Department of Pharmaceutical Chemistry, UCSF, San Francisco, CA, USA Departments of Chemistry2 and Biomolecular Chemistry3, University of Wisconsin- Madison, Madison, WI, 53706, USA 4Present address Department of Chemistry, Stanford University, Stanford, CA, 94305, USA 5These authors contributed equally *To whom correspondence should be addressed bioRxiv preprint doi: https://doi.org/10.1101/808139; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract: The cell surface proteome, the surfaceome, is the interface for engaging the extracellular space in normal and cancer cells. Here We apply quantitative proteomics of N-linked glycoproteins to reveal how a collection of some 700 surface proteins is dramatically remodeled in an isogenic breast epithelial cell line stably expressing any of six of the most prominent proliferative oncogenes, including the receptor tyrosine kinases, EGFR and HER2, and downstream signaling partners such as KRAS, BRAF, MEK and AKT.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Hexosaminidase a in Tay–Sachs Disease
    Journal of Genetics (2020)99:42 Ó Indian Academy of Sciences https://doi.org/10.1007/s12041-020-01208-8 (0123456789().,-volV)(0123456789().,-volV) RESEARCH ARTICLE In silico analysis of the effects of disease-associated mutations of b-hexosaminidase A in Tay–Sachs disease MOHAMMAD IHSAN FAZAL1, RAFAL KACPRZYK2 and DAVID J. TIMSON3* 1Brighton and Sussex Medical School, University of Sussex, Falmer, Brighton BN1 9PX, UK 2School of Biological Sciences, Queen’s University Belfast, Medical Biology Centre, 97 Lisburn Road, Belfast BT9 7BL, UK 3School of Pharmacy and Biomolecular Sciences, University of Brighton, Huxley Building, Lewes Road, Brighton BN2 4GJ, UK *For correspondence. E-mail: [email protected]. Received 6 September 2019; revised 25 February 2020; accepted 24 April 2020 Abstract. Tay–Sachs disease (TSD), a deficiency of b-hexosaminidase A (Hex A), is a rare but debilitating hereditary metabolic disorder. Symptoms include extensive neurodegeneration and often result in death in infancy. We report an in silico study of 42 Hex A variants associated with the disease. Variants were separated into three groups according to the age of onset: infantile (n=28), juvenile (n=9) and adult (n=5). Protein stability, aggregation potential and the degree of conservation of residues were predicted using a range of in silico tools. We explored the relationship between these properties and the age of onset of TSD. There was no significant relationship between protein stability and disease severity or between protein aggregation and disease severity. Infantile TSD had a significantly higher mean con- servation score than nondisease associated variants. This was not seen in either juvenile or adult TSD.
    [Show full text]
  • Enhancer Variants Reveal a Conserved Transcription Factor Network Governed by PU.1 During Osteoclast Differentiation
    Enhancer variants reveal a conserved transcription factor network governed by PU.1 during osteoclast differentiation The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Carey, H. A., B. E. Hildreth, J. A. Geisler, M. C. Nickel, J. Cabrera, S. Ghosh, Y. Jiang, et al. 2018. “Enhancer variants reveal a conserved transcription factor network governed by PU.1 during osteoclast differentiation.” Bone Research 6 (1): 8. doi:10.1038/ s41413-018-0011-1. http://dx.doi.org/10.1038/s41413-018-0011-1. Published Version doi:10.1038/s41413-018-0011-1 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:37067793 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Bone Research www.nature.com/boneres ARTICLE OPEN Enhancer variants reveal a conserved transcription factor network governed by PU.1 during osteoclast differentiation Heather A. Carey1, Blake E. Hildreth III 1,2,3, Jennifer A. Geisler1,2, Mara C. Nickel1, Jennifer Cabrera1, Sankha Ghosh1, Yue Jiang1, Jing Yan4, James Lee1, Sandeep Makam1, Nicholas A. Young5, Giancarlo R. Valiente5, Wael N. Jarjour5, Kun Huang6, Thomas J. Rosol2, Ramiro E. Toribio2, Julia F. Charles4, Michael C. Ostrowski1,3 and Sudarshana M. Sharma 1,3 Genome-wide association studies (GWASs) have been instrumental in understanding complex phenotypic traits. However, they have rarely been used to understand lineage-specific pathways and functions that contribute to the trait.
    [Show full text]
  • In Silico Prediction and Experimental Validation of Natural Antisense Transcripts in Two Cancer-Associated Regions of Human Chromosome 6
    1099-1108 27/2/2009 01:48 ÌÌ ™ÂÏ›‰·1099 INTERNATIONAL JOURNAL OF ONCOLOGY 34: 1099-1108, 2009 In silico prediction and experimental validation of natural antisense transcripts in two cancer-associated regions of human chromosome 6 LAURA MONTI1*, RAFFAELLA CINQUETTI1*, ALESSANDRO GUFFANTI2*, FRANCESCO NICASSIO3, MATTIA CREMONA4, GIOVANNI LAVORGNA5, FABRIZIO BIANCHI3, FRANCESCA VIGNATI1, DAVIDE CITTARO6, ROBERTO TARAMELLI1 and FRANCESCO ACQUATI1 1Department of Biotechnology and Molecular Sciences, University of Insubria, Via JH Dunant 3, I-21100 Varese; 2Nanotechnologies Group, Institute of Biomedical Technologies, CNR, Via Fantoli 16/15, I-20138 Milano; 3IFOM - FIRC Institute of Molecular Oncology, Via Adamello 16, I-20139 Milano; 4Proteomic Unit, Department of Experimental Oncology, National Institute of Cancer, Via Venezian 21, I-20133 Milano; 5DIBIT, San Raffaele Hospital, Via Olgettina 58, I-20132 Milano; 6HPC and Bioinformatics Systems @ Informatics Core, FIRC Insitute of Molecular Oncology (IFOM), Via Adamello 16, I-20139 Milano, Italy Received August 28, 2008; Accepted October 27, 2008 DOI: 10.3892/ijo_00000237 Abstract. Antisense transcription has long been recognized human malignancies, such as non-Hodgkin's lymphomas, as a mechanism involved in the regulation of gene expression. melanoma and carcinomas of the mammary gland, ovary, Therefore, several human diseases associated with abnormal uterus, stomach, kidney and salivary gland (1-3). The involve- patterns of gene expression might display antisense RNA- ment of this chromosome in the pathogenesis of the above- mediated pathogenetic mechanisms. Such issue could be mentioned cancer types has been demonstrated by LOH particularly relevant for cancer pathogenesis, since deregulated studies and chromosome-transfer assays, which led to the gene expression has long been established as a hallmark of identification of several regions of minimal deletion spanning cancer cells.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Genome-Wide Haplotype-Based Association Analysis of Major Depressive Disorder in Generation Scotland and UK Biobank David M
    Howard et al. Translational Psychiatry (2017) 7:1263 DOI 10.1038/s41398-017-0010-9 Translational Psychiatry ARTICLE Open Access Genome-wide haplotype-based association analysis of major depressive disorder in Generation Scotland and UK Biobank David M. Howard 1,LynseyS.Hall1, Jonathan D. Hafferty1, Yanni Zeng1,2,MarkJ.Adams 1, Toni-Kim Clarke1, David J. Porteous 3,RekaNagy2, Caroline Hayward 2,4, Blair H. Smith 4,5, Alison D. Murray4,6,NiamhM.Ryan3, Kathryn L. Evans3,7, Chris S. Haley 2, Ian J. Deary4,7,8, Pippa A. Thomson 3,7 and Andrew M. McIntosh 1,4,7 Abstract Genome-wide association studies using genotype data have had limited success in the identification of variants associated with major depressive disorder (MDD). Haplotype data provide an alternative method for detecting associations between variants in weak linkage disequilibrium with genotyped variants and a given trait of interest. A genome-wide haplotype association study for MDD was undertaken utilising a family-based population cohort, Generation Scotland: Scottish Family Health Study (n = 18,773), as a discovery cohort with UK Biobank used as a population-based replication cohort (n = 25,035). Fine mapping of haplotype boundaries was used to account for overlapping haplotypes potentially tagging the same causal variant. Within the discovery cohort, two haplotypes exceeded genome-wide significance (P <5×10−8) for an association with MDD. One of these haplotypes was nominally significant in the replication cohort (P < 0.05) and was located in 6q21, a region which has been previously associated with bipolar disorder, a psychiatric disorder that is phenotypically and genetically correlated with MDD.
    [Show full text]
  • Broad and Thematic Remodeling of the Surfaceome and Glycoproteome on Isogenic Cells Transformed with Driving Proliferative Oncogenes
    Broad and thematic remodeling of the surfaceome and glycoproteome on isogenic cells transformed with driving proliferative oncogenes Kevin K. Leunga,1 , Gary M. Wilsonb,c,1, Lisa L. Kirkemoa, Nicholas M. Rileyb,c,d , Joshua J. Coonb,c, and James A. Wellsa,2 aDepartment of Pharmaceutical Chemistry, University of California, San Francisco, CA 94143; bDepartment of Chemistry, University of Wisconsin–Madison, Madison, WI 53706; cDepartment of Biomolecular Chemistry, University of Wisconsin–Madison, Madison, WI 53706; and dDepartment of Chemistry, Stanford University, Stanford, CA 94305 Edited by Benjamin F. Cravatt, Scripps Research Institute, La Jolla, CA, and approved February 24, 2020 (received for review October 14, 2019) The cell surface proteome, the surfaceome, is the interface for tumors. For example, lung cancer patients with oncogenic EGFR engaging the extracellular space in normal and cancer cells. Here mutations seldom harbor oncogenic KRAS or BRAF mutations we apply quantitative proteomics of N-linked glycoproteins to and vice versa (9). Also, recent evidence shows that oncogene reveal how a collection of some 700 surface proteins is dra- coexpression can induce synthetic lethality or oncogene-induced matically remodeled in an isogenic breast epithelial cell line senescence, further reinforcing that activation of one oncogene stably expressing any of six of the most prominent prolifera- without the others is preferable in cancer (10, 11). tive oncogenes, including the receptor tyrosine kinases, EGFR There is also substantial
    [Show full text]
  • An Expanded Proteome of Cardiac T-Tubules☆
    Cardiovascular Pathology 42 (2019) 15–20 Contents lists available at ScienceDirect Cardiovascular Pathology Original Article An expanded proteome of cardiac t-tubules☆ Jenice X. Cheah, Tim O. Nieuwenhuis, Marc K. Halushka ⁎ Department of Pathology, Division of Cardiovascular Pathology, Johns Hopkins University SOM, Baltimore, MD, USA article info abstract Article history: Background: Transverse tubules (t-tubules) are important structural elements, derived from sarcolemma, found Received 27 February 2019 on all striated myocytes. These specialized organelles create a scaffold for many proteins crucial to the effective Received in revised form 29 April 2019 propagation of signal in cardiac excitation–contraction coupling. The full protein composition of this region is un- Accepted 17 May 2019 known. Methods: We characterized the t-tubule subproteome using 52,033 immunohistochemical images covering Keywords: 13,203 proteins from the Human Protein Atlas (HPA) cardiac tissue microarrays. We used HPASubC, a suite of Py- T-tubule fi Proteomics thon tools, to rapidly review and classify each image for a speci c t-tubule staining pattern. The tools Gene Cards, Caveolin String 11, and Gene Ontology Consortium as well as literature searches were used to understand pathways and relationships between the proteins. Results: There were 96 likely t-tubule proteins identified by HPASubC. Of these, 12 were matrisome proteins and 3 were mitochondrial proteins. A separate literature search identified 50 known t-tubule proteins. A comparison of the 2 lists revealed only 17 proteins in common, including 8 of the matrisome proteins. String11 revealed that 94 of 127 combined t-tubule proteins generated a single interconnected network. Conclusion: Using HPASubC and the HPA, we identified 78 novel, putative t-tubule proteins and validated 17 within the literature.
    [Show full text]
  • Network-Based Method for Drug Target Discovery at the Isoform Level
    www.nature.com/scientificreports OPEN Network-based method for drug target discovery at the isoform level Received: 20 November 2018 Jun Ma1,2, Jenny Wang2, Laleh Soltan Ghoraie2, Xin Men3, Linna Liu4 & Penggao Dai 1 Accepted: 6 September 2019 Identifcation of primary targets associated with phenotypes can facilitate exploration of the underlying Published: xx xx xxxx molecular mechanisms of compounds and optimization of the structures of promising drugs. However, the literature reports limited efort to identify the target major isoform of a single known target gene. The majority of genes generate multiple transcripts that are translated into proteins that may carry out distinct and even opposing biological functions through alternative splicing. In addition, isoform expression is dynamic and varies depending on the developmental stage and cell type. To identify target major isoforms, we integrated a breast cancer type-specifc isoform coexpression network with gene perturbation signatures in the MCF7 cell line in the Connectivity Map database using the ‘shortest path’ drug target prioritization method. We used a leukemia cancer network and diferential expression data for drugs in the HL-60 cell line to test the robustness of the detection algorithm for target major isoforms. We further analyzed the properties of target major isoforms for each multi-isoform gene using pharmacogenomic datasets, proteomic data and the principal isoforms defned by the APPRIS and STRING datasets. Then, we tested our predictions for the most promising target major protein isoforms of DNMT1, MGEA5 and P4HB4 based on expression data and topological features in the coexpression network. Interestingly, these isoforms are not annotated as principal isoforms in APPRIS.
    [Show full text]
  • Program in Human Neutrophils Fails To
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 is online at: average * The Journal of Immunology Anaplasma phagocytophilum , 20 of which you can access for free at: 2005; 174:6364-6372; ; from submission to initial decision 4 weeks from acceptance to publication J Immunol doi: 10.4049/jimmunol.174.10.6364 http://www.jimmunol.org/content/174/10/6364 Insights into Pathogen Immune Evasion Mechanisms: Fails to Induce an Apoptosis Differentiation Program in Human Neutrophils Dori L. Borjesson, Scott D. Kobayashi, Adeline R. Whitney, Jovanka M. Voyich, Cynthia M. Argue and Frank R. DeLeo cites 28 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2005/05/03/174.10.6364.DC1 This article http://www.jimmunol.org/content/174/10/6364.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* • Why • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Insights into Pathogen Immune Evasion Mechanisms: Anaplasma phagocytophilum Fails to Induce an Apoptosis Differentiation Program in Human Neutrophils1 Dori L.
    [Show full text]
  • Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss
    cells Review Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss 1, 1, 1 1,2,3 1 Gayle B. Collin y, Navdeep Gogna y, Bo Chang , Nattaya Damkham , Jai Pinkney , Lillian F. Hyde 1, Lisa Stone 1 , Jürgen K. Naggert 1 , Patsy M. Nishina 1,* and Mark P. Krebs 1,* 1 The Jackson Laboratory, Bar Harbor, Maine, ME 04609, USA; [email protected] (G.B.C.); [email protected] (N.G.); [email protected] (B.C.); [email protected] (N.D.); [email protected] (J.P.); [email protected] (L.F.H.); [email protected] (L.S.); [email protected] (J.K.N.) 2 Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand 3 Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand * Correspondence: [email protected] (P.M.N.); [email protected] (M.P.K.); Tel.: +1-207-2886-383 (P.M.N.); +1-207-2886-000 (M.P.K.) These authors contributed equally to this work. y Received: 29 February 2020; Accepted: 7 April 2020; Published: 10 April 2020 Abstract: Inherited retinal degeneration (RD) leads to the impairment or loss of vision in millions of individuals worldwide, most frequently due to the loss of photoreceptor (PR) cells. Animal models, particularly the laboratory mouse, have been used to understand the pathogenic mechanisms that underlie PR cell loss and to explore therapies that may prevent, delay, or reverse RD. Here, we reviewed entries in the Mouse Genome Informatics and PubMed databases to compile a comprehensive list of monogenic mouse models in which PR cell loss is demonstrated.
    [Show full text]