THE DEVELOPMENT OF NOVEL STR MINIPLEX PRIMER SETS FOR THE
ANALYSIS OF DEGRADED AND COMPROMISED DNA SAMPLES
A dissertation presented to
the faculty of
the College of Arts and Sciences of Ohio University
In partial fulfillment
of the requirements for the degree
Doctor of Philosophy
Denise T. Chung
August 2004 This dissertation entitled
THE DEVELOPMENT OF NOVEL STR MINIPLEX PRIMER SETS FOR THE
ANALYSIS OF DEGRADED AND COMPROMISED DNA SAMPLES
BY
DENISE T. CHUNG
has been approved for
the Department of Chemistry and Biochemistry
and the College of Arts and Sciences by
Bruce R. McCord
Associate Professor of Chemistry
Leslie A. Flemming
Dean, College of Arts and Sciences CHUNG, DENISE T. Ph.D. August 2004. Chemistry and Biochemistry
The Development of Novel STR Miniplex Primer Sets for the Analysis of Degraded and
Compromised DNA Samples (217 pp.)
Director of Dissertation: Bruce R. McCord
New Miniplex primer sets have been designed where the target sequence is much closer to the repeat region and will therefore produce smaller amplicons to facilitate the analysis of degraded DNA. The effectiveness of these primer sets on degraded DNA samples were tested on enzymatically degraded DNA, environmentally insulted bone samples, and real case work samples and compared to amplifications with a commercial multiplex kit. For both types of degraded DNA, the Miniplex primer sets were capable of producing more complete profiles due to the smaller amplicon size.
A concordance study of 532 DNA samples was performed to check for the existence of potential point mutations in the Miniplex primer binding region or insertion/deletion between commercial primers and Miniplex primers. Out of the 532 samples, there were 15 samples that showed discrepancies at one allele. DNA sequencing of these samples revealed the presence of new mutations and polymorphisms.
Another challenge associated with forensic samples is the presence of PCR inhibitors. The presence of these compounds can interfere with the amplification process resulting in preferential amplification of one locus, allele drop out or no amplification at all. The effect on amplification efficiency of the Miniplex primer sets due to several known PCR inhibitors was investigated. The use of BSA and LMT agarose to relieve
PCR inhibition of the Miniplex primer sets were also investigated. Lastly, validation studies in accordance with the TWGDAM guidelines were
performed to demonstrate the robustness of the Miniplex primer sets in typing
compromised forensic samples. The Miniplex primer sets have been optimized to work
with 100 pg/25 µL of DNA template.
Overall, these Miniplex primer sets have demonstrated improved signal with
degraded DNA in comparison to commercial sets. These Miniplex sets will provide a very useful tool to pick up loci that fail to amplify with commercial kits due to severe
DNA degradation, PCR inhibition, and low copy number of template. In addition, these primers can also be used to check for potential allele drop out due to primer binding site mutations, as the primer binding sites for these Miniplexes do not overlap with commercial kit primer locations.
Approved:
Bruce R. McCord
Associate Professor of Chemistry Acknowledgments
First of all, I would like to express my deepest gratitude to my research adviser,
Dr. Bruce McCord for giving me the opportunity to pursue my interest in forensic DNA typing. I never thought I would have the chance to make this dream come true because where I grew up, this area of research is not popular and in many case, not even heard of.
In the Philippines, lab equipment is close to obsolete, remote places do not even broadcast CSI (the show that brought forensics to mainstream consciousness), and forensic science seemed to be so foreign, distant and unattainable.
But somehow God had a way of making things happen and led me to this place called Athens, Ohio where my dream became a reality. In this journey, I have met people who have made me become the better person I am now. To Dr. John Butler of the NIST, I thank you for laying out the blueprint of this project. To Yin Shen, I thank you for educating the totally clueless person I was when I first came here. To Jiri Drabek and
Kerry Opel, I thank you for working on this project with me. Without the both of you, I would not have accomplished this much. To the members of my committee, Dr. Peter
Harrington, Dr. Nancy Tatarek, and Dr. Susan Evans, I thank you for all the ideas and professional aid you have given me. To the National Institute of Justice, I thank you for funding the research project and saving me from becoming a lab rat for the undergraduates. To my friends in the department, I thank you for keeping me alive and sane during these solitary years of being in graduate school. To my parents, I thank you for always believing in me and supporting me. And to God, I thank you for watching over me every day and giving me the strength to continue. As I move to the end of this journey, I just look forward to a new dream that I soon would be a part of once again. 6
Table of Contents
Abstract...... 3
Acknowledgments...... 5
List of Tables ...... 10
List of Figures...... 12
Abbreviations...... 15
Chapter 1 Introduction to DNA Typing...... 16 1.1 Brief History of DNA Typing...... 16 1.2 DNA Polymorphisms...... 17 1.3 Overview of Forensic DNA Typing Markers ...... 18 1.3.1 RFLP Analysis ...... 18 1.3.2 PCR-Based Assays...... 19 1.4 Biology of DNA...... 21 1.4.1 Basic Structure of DNA...... 22 1.4.2 Chromosomes, Genes, and DNA markers...... 23 1.4.3 Nomenclature for DNA markers ...... 24
Chapter 2 Introduction to Short Tandem Repeat Markers...... 26 2.1 Short Tandem Repeat Markers (STRs)...... 26 2.1.1 Characteristics of STRs Used in Forensic DNA Typing...... 27 2.1.2 Allelic Ladders...... 28 2.1.3 The 13 CODIS STR loci ...... 29 2.1.4 Commercial STR Kits...... 31 2.1.5 Additional STR loci...... 31 2.2 Issues with STR Markers...... 33 2.2.1 Stutter Products ...... 33 2.2.2 Non-Template Addition...... 34 2.2.3 Microvariants, Mutations, and Polymorphisms...... 35
Chapter 3 DNA degradation ...... 36 3.1 Process of degradation ...... 36 3.2 The Problem of Degraded DNA ...... 40
Chapter 4 Primer Design...... 47 4.1 Important Parameters to Consider When Designing Primers...... 47 4.1.1 Primer Length ...... 48 4.1.2 Melting Temperature (Tm)...... 48 7
4.1.3 GC Content ...... 49 4.1.4 Priming Efficiency ...... 49 4.1.5 Secondary Structures ...... 50 4.2 Multiplex STR Primer Design ...... 51 4.3 Miniplex Approach to the Problem of Degraded DNA...... 52 4.4 Miniplex Primer Design...... 54 4.5 Multiplexing Miniplex Primers...... 58
Chapter 5 Materials, Methods, and Technology...... 60 5.1 DNA Extraction ...... 60 5.1.1 DNA Extraction using Silica-Based Spin Columns ...... 60 5.1.2 Phenol Chloroform Isoamyl Alcohol (PCIA) Method of DNA extraction ...... 60 5.1.3 DNA Extraction from FTA™ Paper ...... 61 5.2 DNA Quantification...... 61 5.2.1 Quantiblot® Human DNA Quantitation Kit, ...... 61 5.2.2 Alu- Based Real Time PCR Method of DNA Quantification ...... 62 5.3 DNA Amplification ...... 64 5.4 Detection and Data Analysis...... 65
Chapter 6 Degradation Study...... 71
Chapter 7 Concordance Studies...... 80
Chapter 8 PCR Inhibition...... 91 8.1 Types of PCR Inhibitors ...... 91 8.2 Mechanisms of PCR Inhibition...... 92 8.3 Common Methods for Removal of PCR Inhibitors ...... 94 8.3.1 Spin Column Filters ...... 94 8.3.2 Magnetic Beads...... 95 8.3.3 Sodium Hydroxide (NaOH) Studies...... 96 8.3.4 Bovine Serum Albumin (BSA) ...... 96 8.3.5 Low-Melting Temperature (LMT) Agarose ...... 97 8.4 PCR Inhibitor Preparation...... 98 8.5 Inhibition Studies with Miniplex Primers...... 98 8.5.1 Threshold Inhibitor Concentration...... 99 8.5.2 Relief of Inhibition by the Addition of BSA to the Miniplex PCR Mixture...... 101 8.5.3 Use of LMT Agarose for PCR Inhibitor Removal...... 114
Chapter 9 Validation Studies ...... 120 9.1 Standard Specimens and Reproducibility ...... 122 9.2 Sensitivity Studies...... 123 9.3 Peak Balance Studies ...... 130 8
9.4 Primer Concentration...... 137 9.5 Cycle Number Study...... 138 9.6 Reaction Volume Study ...... 143 9.7 Magnesium Titration...... 146 9.8 Variation in Annealing Temperature ...... 148 9.9 AmpliTaq Gold® Polymerase Titration ...... 148 9.10 Environmental Studies...... 151 9.11 Matrix Studies...... 152 9.12 Mixture Studies...... 152 9.13 Stutter Peaks...... 154 9.14 Non-Human Studies...... 159 9.15 Preferential and Differential Amplification...... 159 9.16 Problems with Dye Blobs ...... 161 9.17 Sizing Precision of GeneScan-500 ROX Size Standard...... 162
Chapter 10 Application of Miniplex Primer Sets to Real Samples ...... 166 10.1 Effect of Environmental Factors on DNA Preservation ...... 166 10.2 DNA profiling of Human Skeletal Remains...... 167 10.2.1 Sample Collection and Preparation...... 167 10.2.2 DNA Quantification ...... 168 10.2.3 Test for PCR Inhibition...... 171 10.2.4 Test for DNA Degradation...... 172 10.3 Case Report...... 177
Conclusion ...... 180
Future Work...... 182
References...... 185
Appendices
Appendix I. Protocols ...... 197
I.A. DNA Extraction...... 197 I.A.1. DNA Extraction using the QIAamp® Blood Maxi Kit ...... 197 I.A.2. DNA Extraction from Agarose Gel using the QIAquick® Gel Extraction Kit...... 199 I.A.3. DNA Extraction using the Phenol/Chloroform Method...... 201 I.A.4. DNA Extraction from Bone Samples ...... 203 I.A.5. DNA Extraction from FTA™ Paper using the Standard FTA™ Method ...... 206 I.A.6. DNA Extraction from FTA™ Paper using DNAzol Method...... 207
9
I.B. DNA Quantification...... 208 I.B.1. DNA Quantification using the Perkin Elmer Quantiblot® Human DNA Quantification Kit...... 208 I.B.2. Alu-Based Real-Time PCR Method of DNA Quantification ...... 211
I.C. Edge Biosystems DTR Spin Column Procedure for Dye Blob Removal....213
I.D. Low-Melting Temperature Agarose Method ...... 214
I.E. Microcon Concentration...... 215
Appendix II. Composition of Buffers and Solutions ...... 216 10
List of Tables
Table 2-1 Summary Information on the 13 CODIS core STR loci ...... 30
Table 2-2 Summary information on the PowerPlex® 16 system and AmpFlSTR® Identifiler™ kit...... 32
Table 4-1 Information on re-designed Miniplex primers ...... 53
Table 4-2 Miniplex primer sequences...... 55
Table 4-3 STR loci combination in Miniplexes...... 59
Table 7-1 Summary of 15 discordant STR profiling results observed in this study between commercial kits and our Miniplex assays...... 82
Table 7-2 Eight representative samples from discrepant loci chosen for DNA sequencing...... 83
Table 7-3 Primer sequences used for sequencing discrepant alleles ...... 84
Table 8-1 Threshold inhibitory concentrations of hematin, indigo, melanin, humic acid, collagen, and calcium amplified with Miniplex 2, Miniplex 4, and Big Mini multiplex sets ...... 108
Table 8-2 ANOVA results for the different types of agaroses used to clean-up positive control DNA extracts from blood ...... 118
Table 8-3 ANOVA results for the different types of agaroses used to clean-up degraded DNA extracts from bone...... 119
Table 9-1 Two factor ANOVA of average peak heights for Miniplex 2, Miniplex 4, and Big Mini...... 129
Table 9-2 Two factor ANOVA of average peak balance ratio for Miniplex 2, Miniplex 4, and Big Mini ...... 135
Table 9-3 Single factor ANOVA for average peak balance ratio between concentrations .. and between loci for Big Mini ...... 136
Table 9-4 23 factorial design for optimization of CSF1PO, D21S11, D7S820 loci in Big Mini...... 139
11
Table 9-5 Optimal primer concentration for each Miniplex locus when using 33 cycles for amplification ...... 141
Table 10-1 Sample information and conditions of bone samples from the Forensic Anthropology Center, University of Tennessee, Knoxville...... 169
Table 10-2 Sample information and conditions of bone samples from the Franklin County Coroner’s Office, Columbus, Ohio ...... 170
Table 10-3 Summary of profiling results grouped by sample source...... 174
12
List of Figures
Figure 3-1 DNA strand scission due to hydrolysis ...... 37
Figure 3-2 Deamination of cytosine and 5-methylcytosine...... 39
Figure 3-3 DNA strand breakage resulting from oxidant attack on the sugar moiety...... 41
Figure 3-4 Mispairing of 8-oxy-7,8-dihydroguanine and adenine...... 42
Figure 3-5 Decay curve of degraded DNA...... 46
Figure 5-1 Block diagram of the ABI 310 genetic analyzer...... 67
Figure 5-2 Example of a matrix file from the ABI Prism 310 instrument generated using the four dye system used for the Miniplex primer sets...... 70
Figure 6-1 DNA degraded with DNaseI over different time periods ...... 72
Figure 6-2 Amplification of different fragment sizes with Miniplex primer sets and PowerPlex® 16 system...... 75-78
Figure 6-3 Effect of cycle number on amplification efficiency of DNA fragments...... 79
Figure 7-1 Four base TGTC and TATC deletion at the D13S317 locus ...... 86
Figure 7-2 Eight base pair CCATCCAT deletion in the vWA locus ...... 87
Figure 7-3 Closer look at the eight base deletion in the vWA locus ...... 88
Figure 7-4 Original D5S818 Miniplex primers ...... 90
Figure 7-5 New D5S818 Miniplex primers ...... 90
Figure 8-1 The effect of increasing hematin, indigo, melanin, humic acid, collagen, and calcium concentration on the electropherogram signal intensity of Miniplex 2, Miniplex 4, and Big Mini loci...... 102-107
Figure 8-2 Comparison of amplifications using the Big Mini multiplex set and the CTTv system ...... 109-110
Figure 8-3 Effect of adding 1 µg/25 µL BSA to the Miniplex 2, Miniplex 4, and Big Mini reaction mixture containing the different inhibitors ...... 112
13
Figure 8-4 Effect of adding different amounts of BSA to the Big Mini reaction mixture ...... 113
Figure 8-5 Low-melting temperature agarose clean-up of PCR inhibitors...... 115
Figure 8-6 Comparison of DNA loss for four different types of agaroses using positive control DNA extracts from blood ...... 118
Figure 8-7 Comparison of DNA loss for four different types of agaroses using degraded DNA extracts from bone...... 119
Figure 9-1 Non-specific binding observed at the Penta E locus of Miniplex 5...... 121
Figure 9-2 Sensitivity studies for Miniplex 2 ...... 126
Figure 9-3 Sensitivity studies for Miniplex 4 ...... 127
Figure 9-4 Sensitivity studies for Big Mini ...... 128
Figure 9-5 Peak balance ratio for Miniplex 2 ...... 131
Figure 9-6 Peak balance ratio for Miniplex 4 ...... 132
Figure 9-7 Peak balance ratio for Big Mini ...... 133
Figure 9-8 Big Mini primer titration ...... 140
Figure 9-9 Cycle number study for Miniplex 2 and Miniplex 4...... 144
Figure 9-10 Miniplex 2 reaction volume study...... 145
Figure 9-11 Magnesium titrations for Big Mini multiplex set...... 147
Figure 9-12 Effect of variation in annealing temperature for Miniplex 2, Miniplex 4, and Big Mini...... 149
Figure 9-13 Miniplex 2 titration of AmpliTaq® Gold DNA polymerase ...... 150
Figure 9-14 Mixture study of the Miniplex primer sets...... 155
Figure 9-15 Average stutter calculated for each locus of the Miniplex 2, Miniplex 4, and Big Mini multiplex set ...... 156
14
Figure 9-16 Stutter percentage for the alleles of the Miniplex 2, Miniplex 4, and Big Mini loci...... 157-158
Figure 9-17 Mouse DNA samples amplified with Miniplex 2 and Miniplex 4...... 160
Figure 9-18 Dye blob artifacts encountered in Big Mini amplification...... 163
Figure 9-19 Sizing precision of GeneScan-500 ROX size standard...... 165
Figure 10-1 Amplicon size ranges of the PowerPlex® 16 system and Miniplex primer sets showing percentages of amplification success per locus...... 175
Figure 10-2 Bone sample with 60 pg/25 µL of DNA amplified with Miniplex 2, Miniplex 4, Big Mini and the PowerPlex® 16 system at 33 cycles ..... 178-179 15
Abbreviations
ANOVA Analysis of Variance AP Apurinic/Apyrimidinic CODIS Combined DNA Index System BLAST Basic Local Alignment Search Tool BLAT Basic Local Alignment Tool BSA Bovine Serum Albumin CCD Charged Coupled Device dNTP Dideoxy Nucleotide Tri Phosphate DNA Deoxyribonucleic Acid FAC Forensic Anthropology Center FCCO Franklin County Coroner’s Office LMT Low Melting Temperature MALDI- TOF Matrix-Assisted Laser Desorption Time-of-Flight Mass Spectrometry mtDNA Mitochondrial DNA NCBI National Center for Biotechnology Information NIST National Institute of Standards and Technology PAGE Polyacrylamide Gel Electrophoresis PCIA Phenol Chloroform Isoamyl Alcohol PCR Polymerase Chain Reaction RFLP Restriction Fragment Length Polymorphism SEB Stain Extraction Buffer STR Short Tandem Repeats RFU Relative Fluorescence Units TBE Tris-Borate EDTA TWGDAM Technical Working Group on DNA Analysis Methods VNTR Variable Number of Tandem Repeats 16
Chapter 1. Introduction to DNA Typing
1.1. Brief History of DNA Typing
Recent developments in modern DNA (deoxyribonucleic acid) technology have
improved the ability of the forensic community to perform human identity testing. The
use of human identification techniques can be used to identify the people responsible for
violent crimes such as murder and rape, to resolve paternity issues, and to identify the
remains of missing persons or victims of mass disasters.
The foundation for the concept was established by the discovery of Wyman and
White of a DNA locus with variable-length restriction fragments1. These variations were called Restriction Fragment Length Polymorphisms (RFLP). In 1980, David Botstein and his co-workers made use of these variations to serve as genetic landmarks to construct a human gene map2. And in 1985, while searching for disease markers, Alec Jeffreys, an
English geneticist, studied the application of RFLP markers to the science of DNA profiling. He discovered that certain regions of DNA contain repetitive sequences that
vary from one individual to another1,3. These DNA repeat regions were called VNTRs, which stands for variable number of tandem repeats. Dr. Jeffreys used the RFLP technique to examine the length variation of these DNA sequences1. The use of VNTR loci for DNA typing by RFLP analysis became the popular method of human identification during the late 1980’s through most of the 1990’s4. With the discovery of
the polymerase chain reaction (PCR) technique by Kary Mullis in 19855, DNA analyses became more sensitive, faster, simpler, and amenable to automation. Both, the RFLP and
PCR technology form the basis of forensic DNA typing. 17
1.2. DNA Polymorphisms
Even if the vast majority of our DNA (over 99.7%) is the same between individuals, there is a small fraction (~0.3%) that differs, making each and everyone of us unique individuals. Human identity testing utilizes the variation within our genome to generate an individual’s DNA profile.
DNA variation can be in the form of sequence polymorphisms or length polymorphisms. Sequence polymorphisms are manifested when one or more bases in the
DNA sequence for a particular locus are different. The most common of these are called single nucleotide polymorphisms. Length polymorphisms occur when the number of times a particular string of bases are repeated is different. Examples of length polymorphisms include variable number tandem repeat (VNTR) and short tandem repeat
(STR) markers.
In DNA typing, multiple markers or loci are examined. The more markers examined and compared, the greater the chances that two unrelated individuals will have different genotypes. The larger the numbers of alleles present for a particular DNA marker, the greater the number of possible genotypes that can result. In general, if there are n alleles, then there n homozygote genotypes and n (n-1)/2 heterozygous ones. Thus, a locus with 10 possible alleles would exhibit 10 + (10 x 9)/2 =55 genotypes. A
combination of 10 loci with 10 alleles in each locus would have over 2.5 x 1017 possible genotypes3.
18
1.3. Overview of Forensic DNA Typing Markers
Over the past 20 years several DNA markers have been developed3. These
markers differ in their discriminatory power and the speed at which the analysis can be
performed. However, with the advent of modern DNA technology, samples that usually take days to analyze can now be processed in a few hours. The techniques for DNA testing can be divided into two methods: RFLP analysis and PCR-based assays.
1.3.1. RFLP Analysis
RFLP analysis was the first technique adapted for forensic DNA analysis2,3. This technique involves the use of a restriction enzyme to cut out regions of DNA surrounding the repeat polymorphism. Since different individuals will have different distances from the sites of cleavage for the restriction enzyme, the length of the DNA fragments produced will be variable. The availability of different restriction enzymes to cut out restriction sites and the high variability in the number of polymorphic repeats gives this method its high discriminatory power2.
Single-locus and multi-locus RFLP probes have been developed. The use of multi-locus RFLP probes increases the variability between individuals but the method is time-consuming and labor-intensive. Also, the analysis using multi-locus RFLP probes is not amenable to automation which makes them unsuitable for processing a large number of samples. Another challenge encountered with multi-locus RFLP is the analysis of mixture samples. Thus, most laboratories resorted to using single-locus RFLP probes in a serial fashion3.
19
1.3.2. PCR-Based Assays
The polymerase chain reaction (PCR) technique is used to produce multiple copies of a small region of DNA. This process is often referred to as “molecular xeroxing”2.The PCR process consists of three main steps. First is the denaturation of the double stranded DNA template at high temperatures (~95 °C), followed by the annealing of the PCR primers at a lower temperature (~ 55 °C), and finally extension step at 72 °C.
The extension step is performed at a temperature optimal for the polymerase enzyme to make copies of the DNA template strand. The forward and reverse primers serve as boundaries and define the actual size of the amplified product.
DNA samples used for PCR analysis can be analyzed using several systems such as HLA DQα/HLA DQA1, Amplitype® PM, D1S80 system, STR systems, mitochondrial
DNA (mtDNA), and Y-chromosome systems, but not by RFLP analysis2. The DNA
fragment sizes generated by RFLP methods are too large to be amplified by the PCR
process.
The HLA DQα/HLA DQA1 is a dot blot method used to analyze a 242 base pair sequence variation within chromosome 6. This polymorphism is detected using molecular probes, which are synthetic fragments of DNA designed to be complementary to the different alleles of this locus. Because only one locus with limited variability is analyzed, the power of discrimination is not as good as the RFLP method. The chief advantage of
this method is the ability to analyze small samples and the speed of analysis2,3.
The Amplitype® PM polymarker system is an expanded version of the HLA
DQα/HLA DQA1 method. This system combines five markers at different loci to 20 increase the power of discrimination. A disadvantage associated with this system is the complexity of DNA analysis when more than one contributor to the sample is involved.
Since more than one probe is involved, small changes in typing conditions can cause variations in the intensity of the dot blot results which makes interpreting mixture samples difficult.
The D1S80 system is a length polymorphism that involves the analysis of a 16 base pair VNTR sequence. The number of repeats can vary from 16-41, producing DNA fragments in the range of hundreds of base pairs2,6. An advantage of this system is its superiority in handling mixtures and its ease of separation. However, because only one locus is being examined for length variation the power of discrimination is not that high.
Recently, this system has been replaced by STR markers. These markers have become the most popular method used for human identification. STRs are similar to the
D1S80 system except that the repeat units are shorter with less variation in the number of repeats. To date, several highly polymorphic loci in different chromosomes have been used for STR analysis which gives this method an excellent power of discrimination between individuals. Because these STR markers are short, they can be analyzed in multiplex reactions. This characteristic of STRs can produce highly discriminating results and reduce analysis time. In addition, the detection of multiplex STRs can be automated.
This capability provides great benefit to the forensic community because the demand for
DNA testing continuously increases.
Mitochondrial DNA (mtDNA) is useful in forensic cases when it is important to associate maternally related individuals or when there is not enough biological material 21 recovered from the crime scene. The high copy number of mtDNA present in the cell increases the probability of obtaining sufficient DNA from extremely old or degraded
DNA samples2,7. However, since mtDNA is only inherited from one’s mother, siblings
have the same mtDNA sequence. Thus, the profile obtained using mtDNA is not unique
for every individual1,2,7. In addition to PCR amplification, the use of mtDNA for human
identity testing also involves sequencing the non-coding hypervariable control region,
called the D-loop. The high mutation rate of the DNA sequence in this region makes it
attractive for individual identification2.
The use of Y-chromosome markers is starting to become a popular method to
trace male DNA. Y-chromosome markers are analyzed by amplifying short tandem
repeats or single nucleotide polymorphisms in the Y-chromosome. These markers have
been used to trace human evolution through male lineages7 and to identify the male component of a mixture in a sexual assault case9. Since the Y-chromosome is passed
down from father to son without any recombination, a number of polymorphic markers
are needed to increase the power of discrimination3. Within the past years, several Y- chromosome markers have been described and developed into multiplex systems10,11.
1.4. Biology of DNA
The basic unit of life is the cell which produces the raw materials, energy, and waste removal capabilities needed to sustain life. Different enzymes are required to maintain the functions of the cell1. Within the nucleus of the cell is deoxyribonucleic acid (DNA). It encodes the instructions for growth, development, and reproduction of an organism. Our DNA contains all the genetic information that determines our physical 22 features and attributes. The collection of all this information within an organism is referred to as its genome. Human beings possess a diploid genome, one that consists of two copies of each type of chromosome. The information encoded in our DNA is passed on from generation to generation with each half coming from each of our parents.
1.4.1. Basic Structure of DNA
Nucleic acids are made up chemical units consisting of three parts: a base, sugar, and a phosphate group. The base is responsible for the variation in nucleotide structure while the sugar and phosphate groups form the backbone structure of the DNA molecule3. DNA molecules are composed of four bases: adenine (A), thymine (T),
cytosine (C), and guanine (G). Adenine and thymine are called purine bases because they
have two-ring structures. Cytosine and guanine are pyrimidine bases because they have
single ring structures. The various combinations of these four bases are responsible for
the biological differences seen in every human being and all living organisms. These
nucleotides are linked together via phosphodiester bonds between the 5’-OH of one
pentose sugar and the 3’-OH of the adjacent sugar.
DNA exists as a double helix. It is composed of two strands that are linked
together through a process known as hybridization. The chains of the helix run in
opposite directions with reverse polarity. One strand runs in the 5’ to 3’ direction while
the other strand runs in the 3’ to 5’ direction. The strands are held together by hydrogen
bonding between complementary bases. Base pairing rules states that adenine can only
hybridize to thymine and cytosine can only hybridize to guanine. There are two hydrogen 23 bonds between A-T base pairs and three hydrogen bonds between G-C base pairs. Thus, more energy is needed to break G-C base pairs than A-T base pairs1,3.
1.4.2. Chromosomes, Genes, and DNA markers
DNA is packaged into structures called chromosomes. The human karyotype has
22 matched pairs of autosomal chromosomes and two sex chromosomes. Thus, a normal human cell contains 46 different chromosomes or 23 pairs of chromosomes. Males are designated XY because they have a single copy of the X chromosome and a single copy of the Y chromosome while females are designated XX because they have two copies of the X chromosome.
Chromosomes in somatic cells are in a diploid state, with two sets of chromosome per cell; gametes (sperm or egg) are in a haploid state, with one set of chromosomes1. It
is during fertilization when a sperm cell unites with an egg cell that the zygote becomes a
diploid again. Thus, each chromosome that makes up the chromosomal pair is derived
from each parent3.
DNA sequences that code for polypeptides are called genes. Eukaryotic genes consist of exons, which are the protein-coding portions and introns, which are intervening sequences. Most of our chromosomal material is made up of non-protein coding regions of DNA. Markers used for human identification are usually found in these non-coding regions either between genes or within genes (i.e. introns). Thus, these markers do not code for genetic variation3.
Polymorphic markers that are variable between individuals are found throughout
non-coding regions of the human genome. The location of a gene or a DNA marker in the 24 chromosome is referred to as a locus. Chromosome pairs that have the same size and contain the same genetic structure are described as homologous. Because one chromosome is inherited from an individual’s mother and the other from the individual’s father, the DNA sequence for each chromosome in the homologous pair may or may not be identical. Alternative forms of a gene are called alleles1. If two alleles at a particular
locus on a homologous chromosome are different they are termed heterozygous and, if
the alleles at a particular locus are identical, they are termed homozygous. This detectable
difference in the alleles of a particular locus between individuals is the fundamental basis
for human identity testing. Characterization of the alleles present in a genetic locus gives
the genotype of an individual. The combination of genotypes from multiple loci gives rise
to an individual’s DNA profile. Thus, the process of DNA typing and DNA profiling
involves the determination of the genotype present at specific locations along the DNA
molecule3.
1.4.3. Nomenclature for DNA markers
If a marker is part of a gene or falls within a gene, the gene name is used for
designation. For example, the TPOX marker is from the human thyroid peroxidase gene.
The STR marker TH01 is from the human tyrosine hydroxylase gene located on chromosome 11. The prefix HUM is sometimes added to the beginning of a locus name to indicate that it is from the human genome (i.e. HUMTH01, HUMTPOX)3.
DNA markers that fall outside of gene regions are designated by their chromosomal position. Some examples are the STR loci D5S818 and D16S539. In these cases, the ‘D’ stands for DNA. The next character refers to the chromosome number, 5 25 for chromosome 5 and 16 for chromosome 16. The ‘S’ means that the DNA is a single copy sequence. The final number indicates the order in which the marker was discovered and categorized for a particular chromosome. These numbers are used to give uniqueness to each identified DNA marker. Thus for D5S818, the final number tells us that it is the
818th locus described in chromosome 53. 26
Chapter 2. Introduction to Short Tandem Repeat Markers
2.1. Short Tandem Repeat Markers (STRs)
Repeated DNA sequences are found throughout the eukaryotic genome. These
repeated DNA sequences are designated by the length of the core repeat unit and the
number of contiguous repeat units or the overall length of the repeat region. Some long
repeats contain a hundred to a thousand base pairs in their repeat units3. These regions are
referred to as satellite DNA.
Repeat units having 10-100 base pairs are referred to as minisatellites or VNTRs
(variable number of tandem repeats). The D1S80 forensic DNA marker discussed above
is a minisatellite6. DNA sequences having 2-6 base pair repeat units are called microsatellites or STRs (short tandem repeats). The use of STRs for DNA profiling has become the most common method of human identification due to its highly polymorphic nature and ease of its genotyping7-14. STRs can easily be amplified using PCR without having problems with preferential amplification because alleles from heterozygotes would have similar sizes.
STR markers can be identified by searching DNA sequence databases for regions having six or more contiguous repeat units3. Primers complementary to the flanking regions are then designed and the repeat region is amplified for analysis. The length of the repeat unit can vary for STR sequences. Dinucleotide repeats have two bases in the repeat unit, trinucleotide bases have three units, tetranucleotide units have four, pentanucleotide bases have five, and so on. Common STR markers used today have at 27 least four bases in the repeat unit due to the fact that longer STR repeat units are less prone to produce slippage products during the PCR process.
Aside from differing in the length and number of repeat units, STRs also differ in their repeat patterns. Some STR markers contain simple repeats, wherein the repeat units have identical length and sequence. Some contain compound repeats, where the repeat units are made up of two or more adjacent simple repeats. Still others contain complex repeats, where the repeat units can be made up of several blocks of variable unit length as well as variable intervening sequences3. Some alleles that contain incomplete repeat units called microvariants can also be found within the STR locus. One of the most common microvariants is the allele 9.3 at the TH01 locus. This microvariant contains nine complete AATG tetranucleotide repeat units and one incomplete repeat of three nucleotides because the seventh copy of the AATG repeat is missing an adenine15.
2.1.1. Characteristics of STRs Used in Forensic DNA Typing
For human identification, DNA markers which are highly polymorphic are utilized. STRs are well-suited for PCR because of their small alleles. This narrow size range permits multiplexing in which several STR markers are combined to produce a series of amplicons that differ in size range in one amplification reaction. It also minimizes the problem of preferential amplification of smaller alleles that can be encountered with VNTRs. STR markers are also better suited for use in samples where the DNA template is degraded. Because the template becomes highly fragmented when the DNA sample is degraded, large alleles of minisatellites often fail to amplify. 28
STRs used in forensic DNA typing should have a high power of discrimination with observed heterozygosity of greater than 70%, low stutter characteristics, low mutation rate, exhibit robustness and reproducibility of results when multiplexed with
other markers, predicted allele length that falls in the range below 500 base pairs. These
markers should also be in different chromosomal locations to ensure that closely linked
loci are not chosen3. Care is also taken to avoid markers closely linked to genetic diseases.
2.1.2. Allelic Ladders
An allelic ladder is the reference standard used for each STR locus. It contains all the common alleles present in the human population for a particular STR marker16.
Allelic ladders are amplified with the same primers used for amplifying DNA samples.
They provide a comparison standard for analysis of unknown alleles. These ladders are
also used to adjust for mobility shifts and differences in sizing measurements between
instruments from different laboratories3.
Allelic ladders are created by combining PCR products from different samples.
PCR products from various samples that produce a complete set of all relevant alleles in
an STR locus can be separated using polyacrylamide gel electrophoresis (PAGE) and
compared to one another. Representative alleles for a given locus are then combined and
re-amplified17. Allelic ladders can be regenerated by diluting the original ladder 1:1,000-
1:1,000,000 parts with deionized water and then re-amplifying using the original PCR primers. PCR primers used to create allelic ladders should be the same primers used to amplify unknown samples so that the alleles in the ladder will accurately reflect the 29 number of allele repeats when genotyping3,17. Commercial manufacturers of STR kits provide allelic ladders for use in genotyping.
2.1.3. The 13 CODIS STR loci
A standardized set of DNA markers has been developed by the forensic DNA community to be used for human identification. Although several STR markers have been evaluated and used by different forensic laboratories, only 13 of these markers were chosen to be part of the national DNA database known as the CODIS (Combined DNA
Index System). This STR project began in April 1996 and ended in November 1997. In this project, 17 candidate STR loci were examined and 13 were chosen to be a part of the
CODIS national DNA database3. The 13 CODIS core STR loci include: TH01, CSF1PO,
TPOX, FGA, D21S11, D7S820, vWA, D18S51, D13S317, D5S818, D8S1179, D16S539,
and D3S135818,19. The three most polymorphic markers are FGA, D21S11, and D18S51
while TPOX shows the least variation between individuals3. The 13 CODIS STR loci can
be classified according to the kind of repeat motif they have. TPOX, CSF1PO, D5S818,
D13S317, and D16S539 are classified as simple repeats consisting of one repeat
sequence. TH01, D18S51, and D7S820 are classified as simple repeats with non-
consensus alleles. vWA, FGA, D3S1358, and D8S1179 are classified as compound
repeats with non-consensus alleles. Non-consensus alleles refer to the presence of
microvariants in the repeat motif. Lastly, D21S11 is classified as a complex repeat20.
Table 2-1 contains the information on the chromosomal location, the sequence of the repeat motif, the kind of repeat motif, and the allele range of the 13 CODIS loci. 30
Table 2-1. Summary information on the 13 CODIS core STR loci. The chromosomal location, repeat format, kind of repeat motif, and the allele range are shown. (Adapted from ref. 1)
Chromosomal Repeat Motif Allele STR Locus Kind of Repeat Motif Location ISFH Format Range
CSF1PO 5 TAGA Simple 6-16 TPOX 2 GAAT Simple 6-13 D5S818 5 AGAT Simple 7-16 D16S539 16 GATA Simple 5-15 D13S317 13 TATC Simple 5-15 TH01 11 TCAT simple, non-consensus 3-14 D7S820 7 GATA simple, non-consensus 6-15 D8S1179 8 [TCTA][TCTG] simple, non-consensus 8-19 FGA 4 CTTT compound, non-consensus 15-51.2 vWA 12 [TCTG][TCTA] compound, non-consensus 10-24 D18S51 18 AGAA compound, non-consensus 7-27 D3S1358 3 [TCTG][TCTA] compound, non-consensus 9-20 Complex D21S11 21 [TCTA][TCTG] Complex 24-38
*The allele range refers to the number of repeat units present in the alleles. 31
2.1.4. Commercial STR Kits
There are two major manufacturers of commercial STR kits used by the forensic community: Promega Corporation in Madison, WI and Perkin-Elmer Applied Biosystems in Foster City, CA. These two manufacturers have made several kits available for monoplex or multiplex PCR amplification. The amplification of several STR loci in a multiplex reaction offers several advantages21,22. First, it conserves the DNA sample. This is beneficial in cases where the quantity of DNA template recovered is insufficient to perform monoplex amplifications for each locus. Multiplexing also increases sample throughput and conserves reagents and consumables. In addition, with the development of multi-color fluorescence detection, STR loci with overlapping size ranges can be simultaneously amplified22. Thus, the number of STR loci co-amplified in a single reaction has increased from 3 or 4 to over 10 loci. To date, two of the most powerful commercial kits used are the PowerPlex® 16 system from Promega23 and the
AmpFlSTR® Identifiler™ kit from Applied Biosystems24. These kits can amplify 16 loci simultaneously. Table 2-2 provides information on the STR loci included in these two kits and their power of discrimination1,23
2.1.5. Additional STR loci
Although most of the kits contain the 13 core CODIS loci, there are still other
STR markers that have been evaluated and used by forensic laboratories3. Applied
Biosystems has included the D2S1338 and D19S433 in their AmpFlSTR® Identifiler™ kit24 while Promega has included two pentanucleotide repeat markers, Penta D and Penta
E, in the Geneprint® PowerPlex™ 2.126 and PowerPlex® 16 system23. Although these 32
Table 2-2. Summary information on the PowerPlex® 16 system and AmpFlSTR® Identifiler™ kit. The STR loci included for each kit are marked: (●) PowerPlex® 16 loci; (■) AmpFlSTR Identifiler loci.
AmpFlSTR® STR Loci PowerPlex® 16 Identifiler™
Amelogenin ● ■ TH01 ● ■ CSF1PO ● ■ TPOX ● ■ FGA ● ■ D21S11 ● ■ D7S820 ● ■ D5S818 ● ■ D8S1179 ● ■ D16S539 ● ■ vWA ● ■ D18S51 ● ■ D13S317 ● ■ D3S1358 ● ■ D2S1338 ■ D19S433 ■ Penta D ● Penta E ●
Power of Discrimination 1:1.8 x1017 1:2.1x1017 Manufacturer Promega Applied Biosystems 33 markers are not principally included in the development of the DNA CODIS database, data on these loci will grow as more samples are tested because of its inclusion in available commercial kits.
2.2. Issues with STR Markers
In the process of amplifying STR alleles, artifacts such as stutter products, dye blobs, and electric spikes can occur which can interfere with the clear interpretation and genotyping of results. These signals can give rise to additional peaks in addition to the true, major peaks, thus complicating the interpretation of genetic profiles.
2.2.1. Stutter Products
The PCR amplification of STR alleles often produces an additional PCR product one repeat unit smaller than the main product peak. These minor products are referred to as “stutter peaks”. Stutter peaks result from the slippage of the Taq polymerase enzyme during DNA replication27. Thus, for tetranucleotide repeat units, stutter products are 4 base pairs shorter than the main allele band. These peaks are usually less than 10% of the main peak28. It has also been found that the tendency for stutter product formation decreases with longer repeat units (i.e., pentanucleotide repeats < tetra < tri < dinucleotides). Also, the percentage of stutter increases with the number of repeat units.
The formation of stutter products could be directly related to the DNA polymerase processivity or how rapidly it copies the template strand. Stutter products smaller than the main allele peak are usually observed.
The slipped-strand mispairing model has been proposed to explain the mechanism of stutter product formation3,28. In this model, a region of the primer-template complex 34 becomes separated when the polymerase falls off during DNA synthesis. Upon re- annealing of the two strands, slippage of either the primer or template strand can occur such that one repeat forms a non-base paired loop. This results in a PCR product one repeat shorter than the main allele.
The presence of stutter products can complicate the interpretation of DNA profiles in cases in which more than one possible contributor to the sample exists.
Because stutter bands have the same size as actual allele bands, sometimes it is impossible to determine whether a faint band in a mixed sample is an allele from the minor contributor or the stutter product of the adjacent allele.
2.2.2. Non-Template Addition
The Taq polymerase enzyme used in PCR can catalyze the addition of an extra nucleotide to the 3’ end of the PCR product. Because the non-template addition is often adenine, sometimes it is referred to as ‘adenylation’29. This ‘plus A’ modification is
primer specific and results in a product that is one base pair longer than the target
sequence. Non-template nucleotide addition adjacent to the 3’ terminal C of the template
is favored29. The presence of partially adenylated products can result in inconsistent data interpretation. It is better to have all the PCR products uniform instead of having PCR products that are partially adenylated. In addition, partial adenylation can contribute to peak broadening if the system’s chromatographic resolution is poor. Thus, the preferential addition of the 3’ A nucleotide is carried out by adding a final incubation step at 60 °C or 72 °C after the temperature cycling steps in PCR3. A method called ‘pig 35 tailing’, which utilizes the addition of a GTTTCTT tail to the 5’ end of the reverse primer also gives PCR products that are nearly 100% adenylated29
2.2.3. Microvariants, Mutations, and Polymorphisms
Alleles that exhibit sequence variation in the form of insertions, deletions, or
nucleotide changes are occasionally encountered in the human population. These alleles
are referred to as microvariants because they are only slightly different from full repeat
alleles. These microvariants are sometimes called ‘off-ladder’ alleles because they do not
size correctly with the alleles present in the allelic ladder. A microvariant that gives a
different allele length and falls between the characterized alleles of a locus can be easily
determined. However, sometimes alleles with the same length but a different sequence
exist. In this case, the microvariant allele can only be determined by sequence analysis.
Sequence polymorphisms can occur in three locations relative to the primer
binding sites: within the repeat region, in the flanking region, or in the primer-binding
region3,30. If the polymorphism occurs within the repeat region or in the flanking region,
the amplification should not be affected. However, the size of the PCR product may vary
depending on the type of polymorphism (i.e. point mutation, insertion, deletion). If the
polymorphism occurs in the primer-binding region, the PCR process can be unsuccessful due to failure of the primer to anneal to the template. The closer the polymorphism is to the 3’ end of the primer, the higher the probability that allele dropout or a null allele will result31. 36
Chapter 3. DNA degradation
3.1. Process of degradation
The process of DNA degradation begins a few hours or days after the death of an
organism. Upon exposure to the environment, this degradation occurs due to bacterial, biochemical, and oxidative processes. DNA degradation begins with autolysis and putrefaction. Most of the degradation occurs during autolysis when nonbacterial enzymes
liberated from the lysosomes digest the DNA template32,33. Putrefaction is the process where anaerobic bacteria decompose proteins32. This process is often accompanied by gas
production which results in the foul odor of decaying bodies. DNA degradation occurs at
this time due to the presence of endonucleases. These enzymes decompose the DNA
template by shearing it into smaller fragments. In addition, exonucleases detach one
nucleotide after another from the terminal ends, thus gradually shortening the DNA
fragments32. Other chemical processes that affect DNA degradation over time include hydrolysis and oxidation.
The labile N-glycosyl bonds of deoxyribonucleotides are susceptible to hydrolysis
leading to the depurination and depyrimidination of bases and resulting in an apurinic or
apyrimidinic (AP) site34. The production of AP sites in DNA can lead to strand scission if not repaired immediately. As illustrated in Figure 3-1, hydrolytic cleavage of the N- glycosidic bond leads to the formation of an aldehyde (compound 1) rendering the 3’-
phosphate group susceptible to β-elimination (compound 2). Under alkaline conditions, this product undergoes cleavage of the 5’ phosphoester bond35. Deprived of the normal
DNA repair mechanisms, DNA samples recovered from the crime scene are 37
Figure 3-1. DNA strand scission due to hydrolysis. Hydrolysis at the C1 position of the deoxyribonucleotide results in the release of the base (i.e.guanine) and the formation of an AP site (1). The open chain aldehyde becomes susceptible to β-elimination that results in the cleavage of the 3’ phosphoester bond (2). Under alkaline conditions, cleavage of the 5’ phosphoester bond results (Adapted from ref.35). 38 spontaneously hydrolyzed. In fact, it has been estimated that every human cell generates
10,000 AP sites in a 24 hour cell generation period at 37 ºC35. Studies have shown this reaction occurs more rapidly in acidic media than in neutral media for all bases, and that the hydrolysis of pyrimidine bases are less affected by pH than those of purine bases36.
This mechanism explains the reason why pyrimidine bases, thymine and cytosine, are lost at 5% of the rate of purine bases34. However in living cells, the presence of AP endonucleases rapidly initiates an excision-repair process. This endonuclease cleaves the phosphodiester bond at the apurinic or apyrimidic site. The sugar phosphate residue is then removed by a separate phosphodiesterase followed by the filling-in of the gap by
DNA polymerase I and DNA ligase37. In the absence of this DNA repair mechanism, the
DNA backbone can spontaneously degrade into smaller fragments.
In addition to depurination and depyrimidation, DNA bases are also susceptible to hydrolytic deamination. The main targets for this reaction are cytosine and its homologue
5-methylcytosine. The deamination of cytosine and 5-methylcytosine yields uracil and thymine, respectively, resulting in a base transition unless corrected (Figure 3-2). In living cells, DNA glycosylases can repair deaminated bases by removing the altered base and creating an AP site which could then be repaired by the AP endonuclease excision
repair pathway37.
The oxidation of the DNA backbone due to active oxygen species such as
. . superoxide radicals (O2 ), hydrogen peroxide (H2O2), and hydroxyl radicals (OH ) can also cause endogenous damage to DNA. These oxygen species are produced as 39
Figure 3-2. Deamination of cytosine and 5-methylcytosine. The deamination of cytosine and 5-methylcytosine yields uracil and thymine, respectively. This reaction results in a transition mutation (Adapted from ref. 37).
40 by- products of normal aerobic metabolism37. Figure 3-3 shows a mechanism by which an oxidant attacks the sugar backbone of DNA. Strand breakage originates from the radical attack at the C4 carbon of the sugar moiety (Compound 1). The radical is stabilized by its proximity to an oxygen atom (Compound 2). The radical then reacts with the phosphoester group at the C3 position resulting in the elimination of phosphate group
(Compound 3). The radical cation formed can further react with water to form another C4 radical (Compound 4) which can now eliminate the phosphate group at the C5 position
(Compound 5)38.
These oxidants can also attack bases resulting in structural mutations. The major
mutagenic base produced by hydroxyl radicals is 8-oxo-7-hydroxydeoguanosine which
base pairs with adenine instead of cytosine resulting in a tranversion mutation (Figure 3-
4). This lesion is excised by a specific DNA glycosylase34.
The modification and loss of bases due to hydrolytic and oxidative damage and the absence of specific repair enzymes in dead cells can result in the loss of the expected
DNA fragment during PCR amplification33.
3.2. The Problem of Degraded DNA
Situations occur where DNA samples recovered are highly degraded. Mass fatality incidents such as commercial airline crashes and fire disasters often require the use of DNA typing to identify victims. However, the samples recovered in these situations are often far from pristine. For example, the most recent American Airlines 41
Figure 3-3. DNA strand breakage resulting from oxidant attack on the sugar moiety. Strand breakage originates from the radical attack at the C4 carbon of the sugar residue (1). This radical is stabilized by its proximity to the oxygen atom (2). Elimination of the phosphate group at the C3 position follows (3). The radical cation formed can further react with water to form another C4 radical (4) which can now eliminate the phosphate group at the C5 position (5). (Adapted from ref. 38)
42
Figure 3-4. Mispairing of 8-oxy-7,8-dihydroguanine and adenine. Because of the oxygen free radical-induced lesion, the formation of 8- OH-Gua base pairs with adenine resulting in a transversion mutation. (Adapted from ref. 39)
43 flight 587 that struck the World Trade Center and killed more than 2,700 victims last
September 11, 200140 and fire that struck the compound of the Branch Davidian religious
sect in Waco, Texas killing over 80 people in April 19, 19933. Most of the remains recovered were in a very poor state, fragmented and charred by the explosion and collapse of the building. Still other samples were exposed to water as the fires were being extinguished leading to potential water damage and excessive mold formation. In addition to these situations, samples recovered from military conflicts or missing person cases present other challenges due to the exposure of these materials to different environmental insults. In these situations, it is rare to recover samples with intact muscles or tissues. Most of the samples recovered are human skeletal remains. Thus, DNA profiling is mostly performed on these types of samples.
Skeletal remains are among the most challenging biological samples from which intact DNA can be obtained. This difficulty can be attributed to the complexity of extracting DNA from the bone matrix, to the presence of PCR inhibitors inherent in the bone sample such as collagen and calcium, and to the presence of inhibitors that have been commingled with the sample through environmental exposure40.
Because the extraction method affects the quality and the quantity of the DNA recovered, different procedures have been tested to maximize the yield of DNA and eliminate PCR inhibitors. Cattaneo et al. assessed the efficiency of the silica-based, magnetic bead, and sodium acetate method in extracting DNA from 43 year old bone samples41. Results from this study showed that extracts prepared using the silica-based method followed by the magnetic bead method gave the highest yield of amplifiable 44
DNA. Although the sodium acetate method was better in maximizing yield, its extracts contained significant amounts of PCR inhibitors. Schmerer et al. reported an optimized organic extraction technique to improve the reproducibility of genotyping degraded DNA samples42. This optimized method involves increasing the time of EDTA incubation from
24 to 96 hours, using a constant temperature between 20-30ºC for EDTA incubation,
increasing the time of proteinase K incubation from 60 to 90 minutes, and using sodium
perchlorate instead of phenol as an extraction reagent. In addition to maximizing the yield
by using various DNA extraction methods, others have used increased cycle numbers to
increase sensitivity43.
However, all these different procedures fail to address a major problem with
degraded DNA which is the fragmentation of the template backbone. As discussed in the
first part of this chapter, the bacterial, biochemical, hydrolytic, and oxidative processes
that cause the DNA template to become highly fragmented reduce the probability of
finding an intact target sequence during the PCR. Although STR markers have been
successfully applied in the analysis of degraded DNA44-47, the success of STR amplification is still dictated by the average size of the template being amplified.
Commercial multiplex STR kits have amplicon sizes ranging from 100-450 base pairs23,48,49. When these kits are used to analyze degraded samples, a “decay curve” in
which the peak height is inversely proportional to the amplicon length is seen due to the
wide range of amplicon sizes in these kits (Figure 3-5). The larger sized amplicons in
these kits often have lower sensitivity and fall below the detection threshold. In these
situations partial genetic profiles with allele or locus dropout results. This limitation of 45 commercial STR kits in typing highly degraded samples generally require the use of mitochondrial DNA (mtDNA) sequence analysis to obtain usable data for genotyping7,50.
The chief advantage of using mtDNA typing over nuclear DNA typing is the high copy number of mtDNA present in cells and the small amplicon size of the mtDNA hypervariable region. These characteristics increase the sensitivity of typing mtDNA samples when the quantity of sample recovered from the crime scene is low and or in degraded condition50. However, the use of mtDNA also has its limitations. Because mtDNA exhibits maternal inheritance, it may become impossible to distinguish profiles between siblings and maternally related individuals. Technical and interpretational challenges can also be encountered due to the high mutation rate of mtDNA2. mtDNA from different tissues may show a mixture of types which means that at one base position two different bases can be found. This condition is known as heteroplasmy. The challenges associated with the analysis of samples from siblings and maternally related individuals and the possible presence of heteroplasmy limit the use of this technique when nuclear DNA analysis of degraded and low copy number samples fail.
A better approach to address the problem of DNA degradation encountered with current STR systems would be to redesign the primers to produce smaller PCR products.
Because the main problem associated with DNA degradation is the fragmentation of the
DNA template, primers which produce smaller PCR amplicons would increase the probability of obtaining a profile from shorter DNA fragments. In this way, mtDNA sequence analysis would not have to be performed and challenges associated with heteroplasmy and maternally related individuals will not be encountered. 46
Figure 3-5. Decay curve of degraded DNA. For degraded samples, an inverse relationship between the amplicon size and relative peak fluorescent intensity is seen. Larger amplicons have lower intensity and often fall below the detection threshold. Top panel: Positive control sample 9947A amplified with the PowerPlex® 16 system. Lower Panel: Bone sample under surface condition that has been exposed to the environment for 3 years.
47
Chapter 4. Primer Design
One of the key ingredients in a PCR reaction is the primer. A primer is a short
oligonucleotide sequence complementary to a region of DNA which provides an
initiation site for elongation of the polymerase enzyme. Target-specific PCR reactions
require a forward and reverse primer spanning the sequence of interest to hybridize to
opposing strands of the DNA template. In STR analysis, these locus-specific primer pairs
are designed to be complementary to the flanking regions of the repeat polymorphism.
Ideally, these primers should be able to generate high yields of PCR product using the lowest number of amplification cycles possible without forming non-specific products51.
4.1. Important Parameters to Consider When Designing Primers
The success of any PCR reaction entails careful primer design. Primer design is the first step in any PCR optimization process. There are a number of factors to consider when designing primers for a PCR reaction. Although ideal conditions are hardly met by all primers, it is necessary to consider these parameters to find the optimal primers for the reaction. Most primer design software automatically evaluates these parameters for the user.
Prior to designing the primers used for STR analysis, the reference DNA sequence for the region of interest should already be known. Reference sequences for the commonly used STR markers can be found at the STRBase website25. The reference sequence for the locus of interest is then imported into the primer design software and the user can then specify the criteria for primer selection (i.e. target amplicon length, GC content, etc.). 48
4.1.1. Primer Length
The length of the primer controls the specificity of binding. For example, there is a 1/4 chance of finding either one of the bases in a DNA sequence; a 1/16 chance of finding a dinucleotide sequence (e.g. AG, CT); a 1/256 chance of finding a tetranucleotide sequence. With this probability, the chance of finding a 20 base sequence is 1/420 or 1 in 1.1 x 1012. As the primer sequence becomes longer, there is a smaller likelihood of finding another sequence other than its target. The increased specificity of longer primers allows the use of lower annealing temperatures to improve the sensitivity of the PCR reaction. Because primer extension also depends on the rate of primer dissociation from the primer-template complex and the rate of elongation until the polymerase forms a stable primer-template complex, shorter primers tend to dissociate more rapidly than longer primers52. However, longer primers are also more likely to form secondary structures including hairpins, dimers, and self-complementarity. Usually primers with lengths of 17-25 nucleotides are in length51 and melting temperatures of 56-
63 °C range are chosen53. The length of the forward and reverse primers need not be the
same.
4.1.2. Melting Temperature (Tm)
The primer melting temperature (Tm) is defined as the temperature where 50% of the oligonucleotide is hybridized to its complementary strand. This property characterizes the stability of the DNA hybrid formed54. The melting temperature of both the forward and reverse primer pair should be similar so that optimal annealing temperatures are close55. The optimal temperature for annealing is the temperature at which maximum 49
PCR yield with minimum mispriming is achieved51. In cases where primers are multiplexed, the Tm of the primers in the set should all be similar. For example, if primer
X has a lower Tm than primer Y, possible mispriming of primer Y at the lower
temperature required for annealing of primer X may be observed. Because the Tm affects the optimal annealing temperature of the PCR reaction, amplifying primers with significant differences in Tm can lead to mispriming or poor reaction yields.
4.1.3. GC Content
Primers should have at least 40-60% GC content for more efficient binding55.
Because GC base pairs have three hydrogen bonds, primers with a higher GC content would have stronger attraction to the template. The GC content for the primers in a PCR reaction should also be similar. To compensate for the difference in GC content between primer pairs, the length of one primer can be lengthened or shortened51.
4.1.4. Priming Efficiency
When a primer binds to a DNA region other than its target sequence, false
priming occurs. False priming efficiency is determined by the stability of the primer.
Since the polymerase enzyme initiates DNA synthesis from the 3’ end of the primer, the
3’ end base pairing plays a more significant role in the formation of the primer-template
complex than the 5’ end of the primer56. If the primer has a stable 3’ end, it may bind to a site complementary to itself while the 5’ end is unbound53. This can lead to the production of additional bands. Ideally primers should have a stable 5’ end and an unstable 3’ end. It is better to use primers which have unstable 3’ ends because even if it binds to false priming sites, these primers will be too unstable to extend53. 50
The stable 5’ region is called the GC clamp. A strong GC clamp at the 5’ end of the primers allows efficient primer binding to the target site. Primers with a strong GC clamp are more stable and allow the use of lower annealing temperatures without the production of non-specific bands53.
4.1.5. Secondary Structures
The formation of secondary structures within the primers can reduce the
efficiency of primer binding to the target site. The stability of the secondary structure
formed is determined by the sequence of bases and the interaction of each base with its nearest-neighbor bases. To determine the stability of these structures, primer design programs measure the free energy of the hairpin loop formed using the thermodynamic library of the 10 Watson-Crick DNA nearest neighbor interactions calculated by
Breslauer et al53,57. The free energy of an oligonucleotide sequence is determined from
the enthalpies and entropies pre-calculated for each dinucleotide sequence57. If the free energy is greater than 0, the secondary structure is too unstable to interfere with the reaction. However, if the free energy is less than 0, the presence of the secondary structure could reduce the amplification efficiency of the reaction53.
One common type of secondary structure is the hairpin loop. This secondary
structure is formed when a primer folds back upon itself. These loops are held in place by
intramolecular hydrogen bonding and can occur with as few as 3 consecutive
homologous bases53. Another type of secondary structure commonly encountered are primer dimers which form when two primers bind together because a region of homology exists between them. This can lead to the production of primer dimer artifact bands and to 51 a reduction in the efficiency of the PCR reaction due to fewer substrates available to amplify the target template.
In addition to secondary structure formation, the binding of primers to regions other than their target sites can also reduce the number of primers available for amplification. If this false priming product formed has a similar size to the target product, extraneous bands that could interfere with the detection process may be observed. Primer homology to other primer binding sites may be checked using the basic local alignment search tool (BLAST) at the National Center for Biotechnology Information (NCBI) website58.
4.2. Multiplex STR Primer Design
Different primer pairs specific for multiple loci can be combined in a single PCR reaction for the analysis of multiple DNA regions. The use of multiplex PCR entails careful selection of primers according to the parameters discussed above. In contrast to
monoplex reactions where only one primer pair needs to be optimized, a multiplex
reaction necessitates that all primer pairs be well-matched. This condition means that all
primer pairs included in the multiplex reaction should have similar characteristics such as
melting temperature and GC content. They also should not form significant interactions
with other primers to form primer dimers, with its internal sequence to form hairpin
structures, and with other regions of the DNA template to cause false priming21,59.
As is the case with monoplex primer design, the complexity of multiplex primer design begins with the selection of the loci to be examined. Reference sequences obtained from STRBase25 or GenBank58 are then used to establish the allele number ranges for a 52 particular locus. To avoid overlap, amplicons for a particular locus within a single dye lane should at least be 10 base pairs apart59. This 10 base pair gap accommodates the potential existence of a new tetranucleotide allele. In designing primers for a multiplex reaction, it is very important that the melting temperatures are comparable so that these primers anneal at similar temperatures during the PCR reaction59. One of the challenges that may arise with multiplex PCR reactions is the greater chance of forming primer dimers because the chances of encountering another primer with similar homology are greater. Thus, all primers should be cross checked against each other to avoid the formation of these secondary structures. The final step in multiplex STR design is to have all the primers adjusted to their optimal concentration to achieve a balance in the amplification yields of all loci.
4.3. Miniplex Approach to the Problem of Degraded DNA
As mentioned in the previous chapter, one of the greatest challenges encountered in forensic situations is the analysis of degraded DNA samples. To facilitate the analysis
of these types of samples, a new set of primers were developed in which the primers were
positioned as close as possible to the ends of the repeat to reduce the amplified product
size. These reduced size primer sets were called “Miniplexes”60. The reduction in size of the Miniplex primers can be seen in Table 4-1. Several reports have been published regarding the validity of this approach for highly degraded samples. Primer pairs producing amplicons less than 110 base pairs for three STR loci: FES, TH01, and TPOX were used by Hellman et al. for typing DNA extracted from human telogen hairs61.
53
Table 4-1. Information on re-designed Miniplex primers. The reductions in size of the Miniplex primers compared to several commercial kits are shown. The GenBank reference sequences used for primer design are available at http://www.cstl.nist.gov/biotech/strbase/str_ref.htm (Adapted from ref. 60)
STR Locus GenBank Accession Product Size STR Kit Miniplex Size Size Reduction TH01 D00269 160-203 bp (Cofiler) 55-98 bp 105 bp CSF1PO X14720 280-320 bp (Cofiler) 89-129 bp 191 bp TPOX M68651 213-249 bp (Cofiler) 65-101 bp 148 bp FGA M64982 196-352 bp (ProPlus) 125-352 bp 71 bp D21S11 AP000433 186-244 bp (ProPlus) 153-211 bp 33 bp D7S820 AC004818 253-293 bp (ProPlus) 136-176 bp 117 bp D5S818 AC008512 134-170 bp (ProPlus) 81-117 bp 53 bp D8S1179 AF216671 123-171 bp (ProPlus) 86-134 bp 37 bp D16S539 AC024591 233-273 bp (Cofiler) 81-121 bp 152 bp vWA M25858 152-212 bp (ProPlus) 88-148 bp 64 bp D18S51 AP001534 264-344 bp (ProPlus) 113-193 bp 151 bp D13S317 AL353628 193-237 bp (ProPlus) 88-132 bp 105 bp Penta D AP001752 376-449 bp (PP16) 94-167 bp 282 bp Penta E AP027004 379-474 bp (PP16) 80-175 bp 299 bp D2S1338 AC010136 288-340 bp (SGM Plus) 90-142 bp 198 bp D3S1358 NT_005997 97-145 bp (ProPlus) 72-120 bp 25 bp
54
Because of the degradation of nuclear DNA in keratinized cells of the hair shaft and the telogen hair root, primers producing short amplicons yielded better success rates in typing these samples. Ricci et al. demonstrated an increase in success rate of typing degraded DNA samples using a new primer pair for the D12S391 STR locus. In this study, amplified fragment sizes were decreased from 205 base pairs to 125 base pairs62.
Reductions in primer pairs for TH01, D10S2325, DYS319, DYS1963, and CSF1PO64 have also been reported. Because these short primers only require short fragments of intact DNA, the chances of obtaining usable profiles with degraded DNA increases.
4.4. Miniplex Primer Design
The Miniplex primers were developed by Dr. John Butler of the National Institute of Standards and Technology for use with matrix-assisted laser desorption ionization time
-of-flight mass spectrometry (MALDI-TOF) using the web-based Primer3 program65.
The primers were designed based on the reference sequences shown in Table 4-1. In designing these primers, the product size was made as small as possible around the STR repeat region. MiniSTR primers were designed for the 13 CODIS STR loci (TH01,
CSF1PO, TPOX, FGA, D21S11, D7S820, D5S818, D8S1179, D16S539, vWA, D18S51,
D13S317, D3S1358) plus 3 non-CODIS loci (D2S1338, Penta D, Penta E) 60,66. Table 4-2 lists the sequences of these primer pairs. Using a standard annealing temperature of
55 °C, the calculated melting temperature of each primer was targeted to be between the ranges of 57 °C- 63 °C58. Although some primers such as CSF1PO and D16S539 have melting temperatures below the 57 °C design criteria, these primers had been
55
Table 4-2. Miniplex primer sequences. Primer melting temperatures (Tm) are calculated from the Primer 3 program using default values. PCR products with a 5’ tail on the reverse primer will be 7 base pairs longer than the values listed in Table 4-1. The 5’ tail was added to prevent having partial adenylated products. A negative number indicates that the end of the primer is in the repeat region. (Adapted from ref.60)
STR Distance from Locus Miniplex Primer Sequence (5' to 3') Tm (ºC) 5' Tail Added Repeat (bp) TH01 F 6FAM-CCTGTTCCTCCCTTATTTCCC 61.0 0 R GGGAACACAGACTCCATGGTG 62.8 GTTTCTT 1 CSF1PO F VIC-ACAGTAACTGCCTTCATAGATAG 52.4 14 R GTGTCAGACCCTGTTCTAAGTA 53.6 6 TPOX F NED-CTTAGGGAACCCTCACTGAATG 60.0 -4 R GTCCTTGTCAGCGTTTATTTGC 61.0 GTTTCTT 5 FGA F 6FAM-AAATAAAATTAGGCATATTTACAAGC 55.9 3 R GCTGAGTGATTTGTCTGTAATTG 56.6 23 D21S11 F VIC-ATTCCCCAAGTGAATTGC 55.8 2 R GGTAGATAGACTGGATAGATAGACGA 56.5 0 D7S820 F NED-GAACACTTGTCATAGTTTAGAACGAAC 58.9 4 R TCATTGACAGAATTGCACCA 58.6 GTTTCTT 65 D5S818 F 6FAM-GGGTGATTTTCCTCTTTGGT 58.0 4 R AACATTTGTATCTTTATCTGTATCCTTATTTAT 58.3 -5 D8S1179 F VIC-TTTGTATTTCATGTGTACATTCGTATC 58.5 -4 R ACCTATCCTGTAGATTATTTTCACTGTG 59.4 5 D16S539 F NED-ATACAGACAGACAGACAGGTG 52.5 0 R GCATGTATCTATCATCCATCTCT 55.0 16 vWA F 6FAM-AATAATCAGTATGTGACTTGGATTGA 58.1 0 R ATAGGATGGATGGATAGATGGA 57.3 0 D18S51 F VIC-TGAGTGACAAATTGAGACCTT 54.8 5 R GTCTTACAATAACAGTTGCTACTATT 52.7 33 D13S317 F NED-TCTGACCCATCTAACGCCTA 58.3 19 R CAGACAGAAAGATAGATAGATGATTGA 57.4 GTTTCTT 2 Penta D F 6FAM-GAGCAAGACACCATCTCAAGAA 59.5 11 R GAAATTTTACATTTATGTTTATGATTCTCT 57.3 19 Penta E F VIC-GGCGACTGAGCAAGACTC 57.1 6 R GGTTATTAATTGAGAAAACTCCTTACA 57.6 4 D2S1338 F NED-TGGAAACAGAAATGGCTTGG 61.0 3 R GATTGCAGGAGGGAAGGAAG 61.1 3 D3S1358 F NED-CAGAGCAAGACCCTGTCTCAT 59.5 -1 R TCAACAGAGGCTTGCATGTAT 58.4 -1 56 shown to work well when used in previous studies with time-of-flight mass spectrometry67.
In designing these primers, every attempt was made to keep the PCR product size at a minimum. However, flanking regions of some of the STR markers contained polymorphic nucleotides, partial repeats, mononucleotide repeat stretches, insertions or
deletions that could interfere with primer binding. Thus, not all primers could be placed
within a few nucleotides of the STR repeat region60.
For example, FGA has a partial repeat and mononucleotide stretch of “TTTC
TTCC TTTC TTTTTT” immediately downstream of the core STR repeat. It would be irrational to place the reverse primer within this region because of the low GC content and the existence of possible sequence variations. Thus, the reverse FGA-primer was placed outside of this mononucleotide repeat stretch and the 3’ end was located 23 nucleotides away from the core STR repeat60. This inability to move the FGA reverse
primer closer to the repeat region limits the amplicon size to 125 base pairs. The D7S820
locus has primers which are located the farthest from the STR repeat region than any
other miniSTR as seen in Table 4-2. In this locus, a polymorphic stretch of T’s can be
found 13 nucleotides downstream of the core GATA repeat60. For this reason, the
D7S820 reverse primer had to be placed outside of this poly-T stretch to avoid primer binding site problems and to avoid the allele dropouts encountered with some alleles.
These problems have been reported with some 8 and 10 alleles60,67.
The existence of polymorphisms in the flanking STR regions that have caused null alleles in the past were also taken into consideration. Null alleles result when the 57
STR repeat region fails to be amplified because of improper primer binding. For example, a polymorphic nucleotide 55 bases downstream of the D8S1179 STR repeat causes allele dropout with the AmpFlSTR Profiler Plus kit in some Asian samples68. The
Miniplex D8S1179 reverse primer was placed internal to this polymorphic sequence and thus will not be affected. Likewise, a polymorphic nucleotide 55 bases upstream of the vWA repeat region has also been reported69. Because this polymorphism is outside the
Miniplex vWA forward primer binding region, it will not affect the efficiency of primer
binding.
As was mentioned above, Miniplex primers were designed for the 13 CODIS STR
loci. However, there is minimal size reduction with the D5S818, D3S1358, D21S11, and
D8S1179 relative to available commercial kits. Although the D19S433 and amelogenin
loci have been included in some commercial kits, new primers for these STRs were not
designed because the amplicon sizes in commercial kits are already small. In addition to
the size reduction, the Miniplex primers can also be used to check for the existence of
possible primer binding site mutations that can cause allele drop out in some samples
because the primer sequences are different from commercial kits.
For amplicons that were not fully adenylated during the PCR process, a 7-base
sequence of GTTTCTT was added to the 5’ end of the reverse primer (Table 4-2). As
discussed in the previous chapter the addition of this 5’ tail facilitates the addition of a non-templated 3’ terminal adenine nucleotide by Taq polymerase29.
58
4.5. Multiplexing Miniplex Primers
A set of five Miniplexes with 3 STR loci per set has been designed (Table 4-3).
To keep the amplified product size as small as possible, only one locus was amplified in each dye lane. This property of the Miniplex primer sets is in contrast to commercial multiplex kits where four or five loci are combined in a single dye lane by adjusting the amplicon size to avoid overlap. Since these Miniplex primer sets were designed to aid in the analysis of degraded DNA samples, it is important that the amplicon size be as small as possible. This size reduction can only be accomplished by amplification of one locus for each dye lane. The primers were labeled with 6-FAM (blue), VIC (green), and NED
(yellow). The last dye lane is used for the internal standard (i.e. ROX). Moreover, because it was not possible to reduce the PCR products of the Miniplex 3 STR loci below
140 base pairs, it was combined with Miniplex 1 to create a six-loci set called “Big
Mini”. The alleles for the different loci in the same dye lane are more than 20 base pairs apart so they can be easily distinguished from one another60. However, a disadvantage of this Miniplex approach when compared to commercial multiplex STR assays is that four to five reactions are required to type all the core loci, and there may not be enough DNA template available when using samples that are degraded or present at low copy number. 59
Table 4-3. STR loci combination in Miniplexes. Big Mini is a combination of Miniplex 1 and Miniplex 3.
6FAM VIC NED
Miniplex 2 D5S818 D8S1179 D16S539
Miniplex 4 vWA D18S51 D13S317
Miniplex 5 Penta D Penta E D2S1338
Miniplex 1 TH01 CSF1PO TPOX
Big Mini Miniplex 3 FGA D21S11 D7S820
60
Chapter 5. Materials, Methods, and Technology
5.1. DNA Extraction
5.1.1. DNA Extraction using Silica-Based Spin Columns
DNA samples from blood, buccal swabs, and tissue specimens were extracted
using the QIAamp® Kit (Qiagen Inc., Valencia, CA)70. Degraded DNA samples run on agarose gel were extracted using the QIAquick® Gel Extraction Kit (Qiagen Inc.,
Valencia, CA)71. These kits utilize a silica-gel membrane to bind the DNA template.
Buffers and reagents provided in the kit are optimized to ensure proper DNA binding to the membrane while contaminants and impurities are washed away. DNA samples adsorb to the silica membrane in the presence of high salt concentrations and low pH (≤ 7.5).
Elution of DNA from the membrane is achieved under basic conditions and low salt concentrations. The DNA template is eluted with the elution buffer provided in the kit.
The step by step protocol for this method can be found in Appendix I.
5.1.2. Phenol Chloroform Isoamyl Alcohol (PCIA) Method of DNA extraction
The phenol-chloroform method72,73 of DNA extraction was used to extract DNA
from blood stains and other matrices (i.e. shoe, hammer, leaf, etc.). This method utilizes
the difference in the solubility of nucleic acids and proteins. The addition of phenol helps
remove proteins and lipids leaving the nucleic acids in the aqueous layer. The use of another solvent, chloroform, improves protein removal by further denaturing these compounds and removing residual phenol from the aqueous layer72. Isoamyl alcohol is added to help reduce foaming of chloroform. The pH of the PCIA is important because higher pH’s and salt concentrations help strip the DNA molecules from histone 61 proteins74. The PCIA method of DNA extraction is hazardous and can have severe toxic effects. Because of its toxicity, this method was only utilized when large intact fragments of DNA were required or when the concentration of DNA was low. The step by step protocol for this method can be found in Appendix I.
5.1.3. DNA Extraction from FTA™ Paper
FTA™ paper is a cellulose-based paper that contains an adsorbed proprietary solution to protect DNA molecules from nuclease degradation and preserve the paper from bacterial growth. This paper was developed by Lee Burgoyne at Flinders University in Australia during the 1980’s1. Forensic samples such as blood, saliva, swabs, etc. spotted on FTA paper is stable at room temperature for more than 11 years75. Using
FTA™ paper to store DNA samples involves adding the sample to the FTA™ card (i.e. a spot of blood or a swab of saliva) and allowing the stain to dry. The chemicals in the FTA card lyse the cells and the DNA is immobilized on the matrix of the paper1. The DNA template can then be extracted using the standard FTA extraction protocol75 or the heat elution method of Morton et al76. The step by step protocol for these two methods can be
found in Appendix I.
5.2. DNA Quantification
5.2.1. Quantiblot® Human DNA Quantitation Kit,
This method of DNA quantification is based on the hybridization of a 40 nucleotide long biotinylated probe to the sample DNA immobilized on a nylon membrane. This probe is complementary to the human alpha satellite locus D17Z1, which has been estimated to be present in 500-1,000 copies per chromosome 1777,78. The 62 binding of streptavidin-horseradish peroxidase enzyme to the bound probe allows for chemiluminescent detection using luminol based reagents. The horseradish peroxidase enzyme oxidizes luminol to produce a chemiluminescent product, 3-aminophthalate79.
This product is detected using a standard autoradiography film and the signal intensity on the film is a function of DNA quantity. A disadvantage of this method is that it is time- consuming and labor intensive. It takes 1.5 hours to perform and requires the analyst to manually perform all the steps. Also, this method has a poor detection limit of 150 pg of
DNA.
The use of membrane bound DNA assays such as the QuantiBlot® system
(Applied Biosystems, Foster City, CA) have been shown to be sensitive to DNA
degradation. Reports have shown that QuantiBlot® readings can underestimate the actual
DNA content of the sample if degradation is present because some samples that gave low or negative quantitation readings were still successfully typed80. This underestimation could be due to the poor binding of fragmented genomic DNA in degraded forensic samples. Although the target sequence for quantitation is only 171 base pairs long80, the presence of these highly fragmented DNA templates can reduce the binding efficiency of intact DNA templates to the membrane. The step by step protocol for this method can be found in Appendix I.
5.2.2. Alu- Based Real Time PCR Method of DNA Quantification
This method of DNA quantitation employs the use of a real-time PCR instrument in conjunction with Alu-based primers81. Alu sequences are conserved sequences ~280 base pairs in length containing a cleavage site for the restriction enzyme Alu I82. These 63 sequences are highly repetitive and primate-specific regions found in 500,000 –
1,000,000 copies in the human genome. This represents 6 to 13 % of the haploid genome.
Because these sequences are present in many copies in primates, they are an excellent target or marker for human DNA81. The Alu primers were designed from plasmid pPD39 of the Ya5 Alu subfamily because the sequence of this plasmid is concordant with the human specific Alu subfamily sequence81,83. The primers were also designed to work with shorter amplicons (124 base pairs) and have the following sequences: forward 5’-
GTCAGGAGATCGAGACCATCCC-3’ and reverse 5’-
CCACTACGCCCGGCTAATTT-3’.
The Corbett Research Rotor-Gene R3G3000 cycler84 was used for the amplification of Alu- based primers and Sybr Green I was used for quantitation. This
instrument monitors the accumulation of PCR product with each cycle in real time. The
final readout for each sample is given as the concentration threshold (Ct), which is
defined as the point where the amplification curve crosses a set fluorescence value81. The
Ct is inversely proportional to DNA concentration which means that samples with a
higher DNA concentration will need fewer amplification cycles to cross the fluorescence
threshold.
In comparison to the slot blot method of DNA quantitation, real-time assays have
better specificity, sensitivity, and dynamic range. This method is not labor intensive and
uses only 2 µL of sample. It can reliably quantitate human DNA in the range of 16 ng – 1
pg81. In addition to this, studies have shown that this method is better for the quantification of degraded DNA samples because small fragments can fail to bind in the 64 slot blot membrane. Also, the presence of inhibitors in the PCR mixture is evident. The amplification curve will be altered and will never reach a plateau if inhibitory substances are present81. However, an inherent disadvantage of using the real-time PCR method to
quantify DNA samples is that only the amplifiable DNA template in the sample and not
the total DNA content is quantified. A detailed description of the procedure can be found
in Appendix I.
5.3. DNA Amplification
The polymerase chain reaction process (PCR) was used to replicate a region of
DNA to make many copies of a particular sequence. A typical PCR reaction consist of
the reaction buffer, deoxynucleotide triphosphates (dNTPs), forward and reverse primers,
MgCl2, Taq polymerase, and the template. Water is then added to the reaction mix to
achieve the desired volume of reaction. PCR reaction volumes commonly used are
between 20-50 µL. The optimization of the PCR conditions will be discussed in the subsequent chapters.
For these studies, the standard conditions and reaction components used for amplification consist of: Miniplex primers, 1X GeneAmp® PCR buffer (50mM KCl,
10mM Tris-HCl, pH 8.3; 1.5mM MgCl2 and 0.001% (w/v) gelatin), 200 µM of each dNTP, and 1-2 U/ 25 µL AmpliTaq Gold® DNA polymerase (Applied Biosystems, Foster
City, CA). The thermal cycling parameters are 95 ºC for 10 minutes (hot-start), 28-33 cycles at 94 ºC for 1 minute (denature), 55 ºC for 1 minute (anneal), and 72ºC for 1
minute (extend), followed by a final incubation of 60 ºC for 45 minutes (final extension)
and 25 ºC forever. 65
The protocols for amplifying DNA samples using the commercial kits, CTTv®
and PowerPlex® 16 from Promega can be found in the manufacturer’s technical manual85,86.
5.4. Detection and Data Analysis
The Miniplex sets use a four dye system of 6-FAM, VIC, NED and ROX
(Applied Biosystems, Foster City, CA). Amplicons were analyzed using the ABI
PRISM® 310 Genetic analyzer. The ABI 310 is a single capillary instrument capable of
simultaneous multicolor detection. This instrument uses a multiline argon-ion laser,
adjustable to 10 mW, which excites multiple fluorophores at 488 and 514 nm.
Fluorescence emission is recorded on a charge-coupled device (CCD) camera, which
simultaneously detects all wavelengths from 525 to 680 nm87.
The ABI 310 collects data in real-time as the sample passes through the detector
window. Figure 5-1 shows a block diagram of the ABI 310 detection system88. The light from the argon-ion laser passes through the laser filter, which removes low-intensity sidebands and other broadband spontaneous emission. The light is then focused by the diverging lens onto a dichroic mirror. The dichroic mirror is used to separate the excitation and emission light paths. The beam then passes through a microscope objective to the sample. The emitted light is then reflected by the dichroic mirror onto a re-imaging lens after it passes through a long-pass filter. The long-pass filter prevents the light from the argon-ion laser from interfering with the detection of the dye signals. Fluorescent light is then directed onto a spectrograph where a diffraction grating disperses the light by
wavelength and focuses the resulting spectrum onto a CCD array. The data collection 66 software in the 310 defines certain areas on the CCD array for the collection of fluorescent emission from dye labels used. These areas are called virtual filters. The ABI
310 instrument has different virtual filters set in the system depending on the dye combination used. The dye combination of the Miniplex primers are only compatible with virtual filter sets D or F. Virtual filter set F was the default filter used for the
Miniplex primer sets.
Although the dyes used are selected to have widely spaced emission maximums to minimize overlap of their spectral profiles, spectral overlap still occurs. Thus, color separation has to be performed by the analysis software prior to data analysis. Color deconvolution is performed using a matrix file in the analysis software. Matrix corrections are accomplished by running matrix standard samples. These are standard sets of fragments labeled with each individual dye. The software then analyzes the data from each dye and creates a matrix file to reflect the spectral overlap between dyes3. The software also subtracts out the emission from other dyes that interferes with a particular
dye’s fluoresecence. Figure 5-2 shows an example matrix file from the ABI Prism 310
generated using the four dye system used for the Miniplexes. The values in the table
represent the amount of spectral overlap observed for each dye. For example, the values
in the B (blue) column represent the amount of overlap of the other dyes into the FAM
spectra. In this example, the green dye (G), VIC, makes up 87% (0.8686) of the blue
signal. Matrix file values vary between each instrument and under different run
conditions on the same instrument. Thus, new matrix files should be created for an
instrument each time run conditions are changed. 67
Figure 5-1. Block diagram of the ABI PRISM 310 Genetic Analyzer. Light from the argon-ion laser is used to excite fluorophores as they pass through the capillary detector window. The resulting emission is then focused by the dichroic mirror on to the spectrograph. A long-pass filter is used to prevent the light from the argon-ion laser in interfering with the dye signals. A grating is used to disperse the emitted light onto the CCD array. (Adapted from ref. 88)
68
After color separation, STR fragments represented by peaks in capillary electropherograms are sized relative to an internal size standard that is mixed with the
DNA sample. The internal size standard is labeled with a different dye to distinguish it from the fragments of unknown size. The size standard used is the GeneScan® ROX 500
size standard (Applied Biosystems, Foster City, CA) which contains 16 fragments with
sizes of 35, 50, 75, 100, 139,150, 160, 200, 250, 300, 340, 350, 400, 450, 490 and 500
base pairs. This size standard is labeled with a rhodamine dye. Samples were prepared by
adding 1 µL PCR product to 12 µL Hi-Di™ formamide (Applied Biosystems, Foster
City, CA) containing 0.50 µL GeneScan® ROX 500 internal lane standard. Samples were
injected into a 43 cm x 50 µm capillary (Polymicro Technologies, Phoenix, AZ) for 5 s at
15 kV in POP™4 (Applied Biosystems, Foster City, CA) and separated with a field strength of 349 V/cm for 18 minutes with a run temperature of 60 ºC. Data was collected by the ABI data collection software version 2.0 under the GeneScan run module GS
POP4-F (virtual filter set F) and processed in GeneScan® software version 3.1. Allele designations were made using the Genotyper® 2.5 software program.
The most common algorithm used for sizing STR fragments is the local Southern method89. Fragment sizes are determined based on a reciprocal relationship between fragment length and mobility. This method uses the two peaks on both sides of the unknown fragment to determine the best-fit line value. This sizing method works well if the DNA fragments fall within the size standard range. However, for fragments that are smaller and larger than the internal sizing standard, the unknown fragment size cannot accurately be determined. Peaks that are also near the edge of the sizing region cannot be 69 sized accurately because two standards peaks on either side of the unknown fragment have to be present. This problem is encountered when using the Miniplex primer sets because of the short amplicon sizes (50-280 base pairs). The 35 base pair size standard fragment is not defined due to the presence of primer dimers in this region. An alternative method is to use the global Southern method in which the unknown fragments are fitted into a best-fit line through all available points. This method is similar to a least- squares method in that all points in the standard are equally weighted. An advantage of the global Southern method compared to the local Southern method is that it is less sensitive to migration shifts of fragments that may occur due to slight temperature
changes90. 70
Figure 5-2. Example of a matrix file from the ABI Prism 310 instrument generated using the four dye system used for the Miniplex primer sets. The letters B, G, Y, and R represent the dye colors blue (FAM), green (VIC), yellow (NED), and red (ROX), respectively. These matrix files should have values of 1.0 on the diagonal from top left to bottom right. The other values in the table represent the amount of spectral overlap resulting from the other dye’s fluorescence emission.
71
Chapter 6. Degradation Study
The Miniplex STR primer sets with shorter amplicon sizes were developed to
improve the amplification efficiency of degraded DNA samples. To test this hypothesis,
results of amplification using Miniplex primer sets 2, 4, and Big Mini were compared to a
commercially available multiplex kit on enzymatically degraded DNA91.
The effects of degradation were studied using whole blood samples that had been extracted using the QIAamp® Blood Maxi Kit (Qiagen, Inc., Valencia, CA). Degraded
DNA was prepared by enzymatically digesting 2.5 µg of the extracted DNA with 0.01 units/µL DNase I (Fermentas, Inc., Hanover, MD) for time periods of 2, 5, 10, 20, and 30 minutes. The degraded DNA was separated by gel electrophoresis using 2% agarose
(Sigma-Aldrich, St. Louis, MO) in 1X Tris-borate EDTA (TBE) buffer and stained with ethidium bromide for detection. 10 µL of the 10 mg/mL ethidium bromide stock solution was added per 50 mL of 1X TBE buffer. DNA from different regions of the gel corresponding to different fragment sizes (< 126, 179-222, 222-350, 350-460, 460-517,
676-1198, and >1198 base pairs) based on the pGEM® DNA marker from Promega were
extracted using the QIAquick® Gel Extraction Kit (Qiagen, Inc., Valencia, CA) (Figure 6-
1). The pGEM® DNA marker consists of 15 DNA fragments ranging from 36- 2,645 base pairs. These DNA fragments were prepared by digesting double-stranded pGEM®-3
Vector DNA with each of Hinf I, Rsa I and Sin I restriction enzyme. These fragments then serve as a sizing standard for samples run on adjacent lanes of the agarose gel. The extracted fragments from the gel were then requantitated. All blood DNA extracts used in
72
Figure 6-1. DNA degraded with DNase I over different time periods. pGEM® DNA marker (Promega Corporation, Madison, WI) was used as ladder (L). DNA from different regions of the gel corresponding to fragment sizes of <126, 179-222, 222-350, 350-460, 460-517, 676-1198, and >1198 base pairs were excised from the gel and amplified with the Miniplex primer sets and the commercial kit, PowerPlex® 16. 73 this study were quantified using the Quantiblot® Human DNA Quantitation Kit (Applied
Biosystems, Foster City, CA).
The fragments with different lengths that were excised from the gel were amplified with the Miniplex 2, Miniplex 4, and Big Mini set and compared to amplifications with the PowerPlex® 16 system from Promega (Figure 6-2). For all the
samples tested in the degradation study, the genotypes obtained from the Miniplex sets
were the same as the genotypes obtained for the larger amplicons in the commercial kit.
When examining the results obtained with the commercial multiplex kit, PowerPlex® 16, with amplicon sizes ranging from 100-480 base pairs, the PCR product yield for the larger sized loci began to decrease as template DNA fragment sizes became smaller. For example, Penta D and Penta E amplicons with allele sizes in the range of 368-472 bp began to lose intensity when the average template size dropped to ~350-460 base pairs.
D18S51 (284-358 bp), CSF1PO (317-354 bp), and FGA (320-444 bp) started to drop out at DNA template sizes of ~222-350 base pairs, and lastly D16S539 (262-302 bp) and
TPOX (261-289 bp) dropped out at DNA template sizes ~179-222 base pairs. Below 126 base pairs only the smaller sized loci of the PowerPlex® 16 kit (i.e. TH01, D5S818, and vWA) were detectable. The loss of peak intensity as the amplicon sizes became larger was clearly evident for the PowerPlex® 16 system, and this behavior would be expected
for any commercial kit that contains large amplicon sizes (i.e. AmpFlSTR™ Identifiler and SGM Plus™). On the other hand, the Miniplex primer sets were capable of producing complete profiles for all tested samples even at template fragment sizes below 222 base pairs. However, it should be noted that allele drop out can occur for the longest alleles of 74 the FGA locus. The physical limitation of commercial kits to amplify alleles that are larger than the available intact DNA template may be less apparent in certain forensic situations as degraded DNA will contain a mixture of fragments of different lengths, however, these results clearly define the effect of template size on amplification efficiency. While in some circumstances it may be possible to increase template concentration to reduce allele dropout with commercial kits, this is not always an option with forensic samples because the DNA template recovery can be very low.
The effect of cycle number on the amplification efficiency of DNA fragments were studied for fragment sizes of ~222-350 base pairs and ~350-460 base pairs. These fragments were tested at 28, 30, and 33 amplification cycles with the Big Mini primer set
(Figure 6-3). It was observed that an increase in cycle number increases the average peak height, with the smaller loci (i.e. TH01, CSF1PO, TPOX) being most affected. For DNA templates in excess of 1 ng, the effect of cycle number is not that apparent. 75
Figure 6-2A. Amplifications of different fragment sizes with Miniplex 2 and PowerPlex® 16 system Different DNA fragment sizes were excised from agarose and amplified with Miniplex 2: D5S818, D8S1179, and D16S539 (left) and the PowerPlex® 16 system (right). DNA concentrations of 1 ng/25 µL were used to compare Miniplex 2 with the PowerPlex® 16. The Miniplexes were amplified at 30 cycles, while 32 cycles were used for PowerPlex® 16. The two bars correspond to the two alleles for the locus. A 95% confidence interval was used to calculate the error bars.
76
Figure 6-2B. Amplifications of different fragment sizes with Miniplex 4 and PowerPlex® 16 system Different DNA fragment sizes were excised from agarose and amplified with Miniplex 4: vWA, D18S51, and D13S317 (left) and the PowerPlex® 16 system (right). DNA concentrations of 1 ng/25 µL were used to compare Miniplex 4 with the PowerPlex® 16. The Miniplexes were amplified at 30 cycles, while 32 cycles were used for PowerPlex® 16. The two bars correspond to the two alleles for the locus. A 95% confidence interval was used to calculate the error bars.
77
Figure 6-2C. Amplifications of different fragment sizes with Big Mini and PowerPlex® 16 system Different DNA fragment sizes were excised from agarose and amplified with Big Mini: TH01, CSF1PO, and TPOX (left) and the PowerPlex® 16 system (right). DNA concentrations of 2 ng/25 µL were used to compare Big Mini with the PowerPlex® 16. The Miniplexes were amplified at 30 cycles, while 32 cycles were used for PowerPlex® 16. The two bars correspond to the two alleles for the locus. The samples used were homozygotes for the TH01 and TPOX loci. A 95% confidence interval was used to calculate the error bars.
78
Figure 6-2C (continued). Amplifications of different fragment sizes with Big Mini and PowerPlex® 16 system Different DNA fragment sizes were excised from agarose and amplified with Big Mini: FGA, D21S11, and D7S820 (left) and the PowerPlex® 16 system (right). DNA concentrations of 2 ng/25 µL were used to compare Big Mini with the PowerPlex® 16. The Miniplexes were amplified at 30 cycles, while 32 cycles were used for PowerPlex® 16. The two bars correspond to the two alleles for the locus. A 95% confidence interval was used to calculate the error bars.
79
Figure 6-3. Effect of cycle number on the amplification efficiency of DNA fragments. 2 ng/25 µL of ~350–460 and ~222–350 base pair fragments amplified with Big Mini at 28 (Panel A), 30 (Panel B) and 33 (Panel C) cycles. Increasing the cycle number increases the average peak height with the smaller sized loci, TH01, CSF1PO, and TPOX being most affected. However, smaller cycle numbers generally give better peak balance. 80
Chapter 7. Concordance Studies
Although all known polymorphisms have been taken into account in the design of
the Miniplex primers, primer binding related problems may occur. Since microsatellites
and their adjacent regions have mutation rates higher than other genomic regions92, only comparison studies can verify the presence of previously undetected polymorphisms. If the polymorphism covers several nucleotides or is close to the 3’ end of the primer, the allele may not be amplified at all and a null allele or allele drop out results31. However, if the polymorphism is close to the 5’ end of the primer or consists of just a single nucleotide far from the 3’ end, only small reductions in amplification efficiency will be observed. A concordance study of 532 DNA samples was performed to check for the existence of allele dropout or low sensitivity of one allele in standard typing kits. At the same time, potential point mutations in the Miniplex primer binding region or insertion/deletions between commercial primers and Miniplex primers were investigated93.
Anonymous liquid blood samples with self-identified ethnicities were purchased
from Interstate Blood Bank (Memphis,TN) and Millenium Biotech, Inc. (Ft. Lauderdale,
FL) and extracted, quantified, and typed with the commercial kit AmpFlSTR™ Identifiler
(Applied Biosystems, Foster City, CA) at the NIST. These samples were of African
American (n=212), Caucasian (n=208), Hispanic (n=110), and Asian (n=2) origin. A total
of 12 STR loci were compared between the single amplification AmpFlSTR™ Identifiler kit and three separate Miniplex sets: Big Mini (TH01, CSF1PO, TPOX, FGA, D21S11, and D7S820), Miniplex 2 (D5S818, D8S1179, and D16S539), and Miniplex 4 (vWA, 81
D18S51, and D13S317). For the Big Mini assay, 5 µL volumes with 2 ng of input DNA and 28 PCR cycles were used while Miniplex 2 and Miniplex 4 utilized 5-µL volumes, 2 ng of DNA template, and 26 PCR cycles.
Out of the 532 samples, full concordance was observed in 99.8 % (6,369 out of
6,384) of all STR allele calls compared. The 15 differences listed in (Table 7-1) encompass the three loci D13S317 (n=5), D5S818 (n=1), and vWA (n=9). The other 9
STR loci, CSF1PO, FGA, TH01, TPOX, D7S820, D8S1179, D16S539, D18S51, and
D21S11, were fully concordant for all samples examined in this study. Discrepancies between Identifiler kit and Miniplex assay primer sets were confirmed by re- amplification of the samples and further testing using the PowerPlex® 16 kit (Promega
Corporation, Madison, WI) following manufacturer protocols85.
Among these 15 discrepant samples, 8 samples representative of each locus were chosen to be sequenced (Table 7-2). DNA sequencing was performed at the NIST using the primer sequences shown in Table 7-3. These primer sequences bind outside the
MiniSTR and commercial kit primer binding sites. Briefly, the mutant samples were amplified and quantified using the Agilent 2100 Bioanalyzer in conjunction with the
DNA 1000 LabChip® kit prior to running in a 32 cm, 0.4 mm thick polyacrylamide gel made up of 10% acrylamide and 3% bis:acrylamide crosslinker. The gel was imaged and the desired allele bands were excised, quantified, and re-amplified. ExoSAP-IT™ was added to the sample for purification prior to cycle sequencing. The exonuclease chews up the extra primers while the SAP (shrimp alkaline phosphatase) digests the unincorporated dNTPs. Cycle sequencing was then performed using the BigDye™ Terminator v 3.0 82
Table 7-1. Summary of 15 discordant STR profiling results observed in this study between commercial kits and our Miniplex assays. Shown are 12 different African American (AA) and 3 Hispanic (H) samples. PowerPlex® 16 (PP16) results all agree with the Identifiler™ results for these 15 samples.
Locus Origin Miniplex Identifiler PP16 Likely Cause 1 D13S317 AA 11,13 10,13 10,13 deletion outside of allele 11 2 D13S317 H 14,14 8,14 8,14 allele 8 primer binding site mutation 3 D13S317 AA 10,11 9,11 9,11 deletion outside of allele 10 4 D13S317 H 10,11 9,11 9,11 deletion outside of allele 10 5 D13S317 H 10,14 9,14 9,14 deletion outside of allele 10 6 D5S818 AA 11,11 11,12 11,12 allele 12 primer binding site mutation 7 vWA AA 16,16 12,16 12,16 allele 12 primer binding site mutation 8 vWA AA 18,18 13,18 13,18 allele 13 primer binding site mutation 9 vWA AA 15,15 14,15 14,15 allele 14 primer binding site mutation 10 vWA AA 15,15 14,15 14,15 allele 14 primer binding site mutation 11 vWA AA 17,17 14,17 14,17 allele 14 primer binding site mutation 12 vWA AA 17,17 14,17 14,17 allele 14 primer binding site mutation 13 vWA AA 19,19 14,19 14,19 allele 14 primer binding site mutation 14 vWA AA 19,19 14,19 14,19 allele 14 primer binding site mutation 15 vWA AA 19,19 14,19 14,19 allele 14 primer binding site mutation 83
Table 7-2. Eight representative samples from discrepant loci chosen for DNA sequencing. D13S1317 (n=4), D5S818 (n=1), vWA (n=3).
Allele Approximate Sample Locus Miniplex Identifiler PP16 Cut out & Sequence Spread Product Size 1 ZT79305 (AA) D13S317 11,13 10,13 10,13 Allele 10 (smaller) 12 bp 342 bp 2 Y22 (H) D13S317 14,14 8,14 8,14 Allele 8 (smaller) 24 bp 334 bp 3 GT37864 (H) D13S317 10,11 9,11 9,11 Allele 10 (smaller) 8 bp 342 bp 4 ZT80656 (H) D13S317 10,14 9,14 9,14 Allele 10 (smaller) 20 bp 342 bp 5 MT95371 (AA) D5S818 11,11 11,12 11,12 Allele 12 (larger) 4 bp 257 bp 6 PT83871 (AA) vWA 16,16 12,16 12,16 Allele 12 (smaller) 16 bp 257 bp 7 PT84216 (AA) vWA 18,18 13,18 13,18 Allele 13 (smaller) 20 bp 261 bp 8 MT95095 (AA) vWA 19,19 14,19 14,19 Allele 14 (smaller) 20 bp 265 bp
*AA- African American; H- Hispanic **Allele spread gives the total number of bases between the two alleles.
84
Table 7-3. Primer sequences used for sequencing discrepant alleles. The primer binding site for these primer pairs are outside the MiniSTR and commercial kit primer binding sites.
Product Reference Primer Sequence (5'-to-3') Tm ºC Length Size Allele D13S317-F AATATTGGGATGGGTTGCTG 59.7 20 346 bp 11 D13S317-R CAGATAACAGTCTGAAAGTACAAGTGG 59.7 27 D5S818-F TTCTAATTAAAGTGGTGTCCCAGA 59.1 24 253 bp 11 D5S818-R TCTCAGAGGAATGCTTTAGTGC 58.7 22 vWA-F TCCCACCTTCCAGAAGAAGA 59.8 20 281 bp 18 vWA-R AGATACAAAGGATAGATAGAGACAGGA 57.4 27
*Primer melting temperature as determined by Primer 3 web-based PCR primer design software. **Reference allele refers to the number of repeats in the reference sequence used.
85 sequencing kit from Applied Biosystems. The primers used for sequencing were identical to those used for amplification.
When placing primers close to the repeat region, problems in genotyping can arise if an insertion or deletion occurs in the flanking regions of the STR marker but outside of the Miniplex primer binding site. In these cases, it is possible to have full amplification with commercial primers and Miniplex primers but a different allele-call results. The
Miniplex reverse primer for D13S317 is located between the repeat region and a four- base pair TGTC deletion in the D13S317 flanking region94, whereas commercial STR
primers are located outside of this deletion sequence. Thus, in samples where this
deletion sequence is present, full amplification with both kits is possible but an allele-
call with a four-base pair difference results.
DNA sequencing of the D13S317 discrepant samples revealed the presence of the
TGTC deletion 24 bases downstream of the core TATC repeat (Figure 7-1). This deletion is responsible for the allele shifts with the Miniplex primer sets60,94. One Hispanic sample revealed a TATC deletion 12 bases downstream of the core D13S317 STR repeat.
The TATC deletion falls within the D13-reverse miniSTR primer binding region causing allele dropout for this sample (Figure 7-1). The vWA allele dropouts with miniSTR primers were caused by an eight-base pair CCATCCAT deletion 10 bases downstream of the core vWA repeat (Figure 7-2) which falls within the vWA reverse MiniSTR primer binding site. Despite the fact that the reverse primer of PowerPlex kits fall within this
region, primer binding site problems are not encountered because the adjacent sequence,
CCATCTAT, only differs from the deleted CCATCCAT sequence by one base pair 86
Figure 7-1. Four base TGTC and TATC deletion at the D13S317 locus. The TGTC deletion is found 24 bases downstream of the core TATC repeat. The TGTC deletion is responsible for the allele shifts observed with the D13S317 Miniplex primer60,94. The TATC deletion is found 12 bases downstream of the core D13S317 STR repeat. The TATC deletion falls within the D13-reverse miniSTR primer binding region causing allele dropout for the Hispanic sample. 87
Figure 7-2. Eight base pair CCATCCAT deletion in the vWA locus. The deletion is found 10 bases downstream of the core vWA repeat and falls within the vWA-reverse MiniSTR primer binding site.
88
Figure 7-3. A closer look at the eight base pair deletion in the vWA locus. Primer binding site problems are not encountered with the PowerPlex® 16 primers because the adjacent sequence, CCATCTAT, only differs from the deleted CCATCCAT sequence by one base pair (C-T). This deletion, however, causes the commercial kit to miscount the actual number of alleles.
89
(C-T) (Figure 7-3). This eight- base pair deletion causes commercial kits to miscount the actual number of alleles. For example, a sample actually having 14 core repeats will be typed as a 12 because of this eight- base pair deletion. The mutation in the vWA miniSTR reverse primer binding region could possibly be the same mutation that was previously reported by Lazaruk et al95. This C-to-T transition was observed in a sufficient number of African Americans samples to cause Applied Biosystems to add a degenerate primer for vWA in their AmpFlSTR kits95. DNA sequencing of the two D5S818 alleles of the African American sample confirmed the presence of two polymorphic nucleotides that affects the D5S818 miniSTR forward primer binding (Figure 7-4). These polymorphisms were reported at an International Society for Forensic Genetics (ISFG) meeting poster in Munster, Germany in August 200196. These polymorphic nucleotides are also responsible for the heterozygote peak height imbalance observed for some samples60. Interestingly, sequencing results for one of the D5S818 alleles showed a four- base pair AGAG deletion immediately adjacent to the core STR repeat. This deletion impacts the D5S818 reverse Miniplex primer which led to the allele dropout of the
African American sample. The forward and reverse D5S818 miniSTR primers have now been moved farther away from the repeat to avoid these polymorphisms (Figure 7-5). The primer sequences for the new D5S818 miniSTR primers are forward 5’-
GGGTGATTTTCCTCTTTGGT-3’ and reverse 5’-
AACATTTGTATCTTTATCTGTATCCTTATTTAT-3’.
The dataset for this study is available at http://www.cstl.nist.gov/biotech/strbase/NISTpop.htm.
90
Figure 7-4. Original D5S818 Miniplex primers. The presence of two polymorphic nucleotides affects the D5S818 miniSTR forward primers. These polymorphic nucleotides are also responsible for the heterozygote peak height imbalance observed for some samples58. (Courtesy of Dr. John Butler, NIST)
Figure 7-5.New D5S818 Miniplex primers. The forward and reverse D5S818 miniSTR primers were moved farther away from the repeat to avoid the polymorphisms. (Courtesy of Dr. John Butler, NIST) 91
Chapter 8. PCR Inhibition
The presence of source contaminants commingled with the DNA template
presents another challenge in forensic human identification. The effects of these
compounds on the PCR reaction can vary from attenuation to complete inhibition of the
amplification reaction. PCR inhibitors can be endogenous or exogenous to the reaction97.
Endogenous contaminants usually originate from insufficiently purified DNA template.
This happens when the inhibitor is co-extracted with the target DNA during the extraction or purification step. Other endogenous sources include the sample tubes and reaction components such as the reaction buffer and the Taq polymerase enzyme.
Different batches, brands, and suppliers of PCR tubes and Taq polymerase have been reported to manifest some inhibitory effects on the PCR reaction98-100. On the other hand
exogenous contaminants arise due to improperly controlled hygienic or laboratory
conditions. Some examples of exogenous contaminants that can inhibit the PCR reaction
include glove powder101, pollen102, bacteria, and dust97.
Since the presence of these inhibitors can affect the amplification efficiency of any primer set, inhibition studies were performed with the Miniplex primer sets to test the robustness of these primers. The effect of amplicon size on the degree of PCR inhibition was also investigated by amplifying samples spiked with different inhibitor concentrations with the Miniplex primer sets (size range: 55-280 base pairs) and a commercial kit, CTTv® (size range: 130-330 base pairs), from Promega.
8.1. Types of PCR Inhibitors
For this study, inhibitors already present in the sample itself were examined.
These inhibitors can commingle with the DNA sample upon exposure to different 92
environmental conditions or can co-extract with the DNA sample from a particular matrix. Some of the more common PCR inhibitors include components of body fluids and tissues (e.g. hematin, urea, bile, collagen, melanin, and heparin), food constituents
(e.g. glycogen, fats, Ca2+), and environmental compounds (e.g. humic acids, Maillard products, fulvic acids, and heavy metals)97. Although a wide range of PCR inhibitors have been reported, six common PCR inhibitors known to affect forensic samples were chosen for these studies: 1) hematin, the main oxygen carrier in blood103, 2) indigo, the
most common dye from denim that is a common location of semen DNA following
sexual assault 104, 3) melanin, a pigment present in skin and hair 105-107, 4) humic acid or
Maillard products which are the polyphenolic compounds ubiquitously found in soil and water samples97,108, 5) collagen, a connective protein making up 90% of the organic
fraction of bones 109, and 6) calcium, which is another component in bone samples110.
8.2. Mechanisms of PCR Inhibition
The exact mechanisms of PCR inhibition have not yet been fully elucidated.
However, the manner in which these inhibitors affect the PCR reaction can be grouped into three categories: failure of cell lysis, nucleic acid degradation or capture, and DNA polymerase inhibition97. The inhibitor can act in one or more of these three mechanisms.
One cause of PCR inhibition is the failure of cell lysis. Inadequate cell lysis due to improper conditions or enzyme inactivation can result in a failure to extract the target
DNA and will prevent PCR amplification. Some proteolytic enzymes and denaturants may degrade lytic enzymes. For example, phenolic compounds from the sample or from the extraction step can inhibit the reaction by denaturing lytic enzymes and producing a concomitant failure to expose the DNA template97. 93
When the DNA template is degraded due to oxidative and biochemical processes, amplification of larger sized fragments becomes a challenge. Commercial kits which have large target amplicons often fail to give typable results when the DNA sample is degraded. The sequestration of the DNA template due to the presence of inhibitory compounds can also prevent amplification. These compounds bind to the DNA template, restricting access of the polymerase. Ahokas and Erkkila have reported that polyamines such as spermine and spermidine can interfere with the PCR reaction by preventing the polymerase from accessing the DNA template97,111. Young et al. mentioned that certain biological molecules may be denatured by binding of phenolic or quinonic groups of humic compounds. These phenolic groups can bond to amides or oxidize to form a quinone which binds to DNA or proteins112. In other studies, humic acids have also been found to prevent DNA-DNA hybridization97.
The most common mechanism proposed for PCR inhibitors is the inhibition of the
DNA polymerase enzyme. Phenolic compounds and urea can cause inhibition by denaturing the polymerase97,113. Inhibition can also occur due to blockage of the active
site of the polymerase. For example, Yoshii et al. reported that Taq DNA polymerase
combines with two molecules of melanin to form an inactivated complex 107. Similarly,
Eckhart et al. reported that melanin binds reversibly to the DNA polymerase enzyme thus affecting its processivity106. Another mechanism for inhibition is the competition of other divalent ions for the magnesium binding site of the enzyme. Bickley et al. reported that calcium ions compete with magnesium ions in interacting with the polymerase enzyme.
Because magnesium is an essential cofactor for the polymerase enzyme, the presence of these divalent cations can lead to a decrease in the efficiency of the PCR reaction. 94
8.3. Common Methods for Removal of PCR Inhibitors
Several methods have been developed and tested for the efficient removal of PCR inhibitors. The most common methods employed include the use of spin column filters, magnetic beads, sodium hydroxide (NaOH) as denaturant, additives such as bovine serum albumin (BSA), and low-melting temperature (LMT) agarose. However, none of these methods provide a universal solution for all kinds of PCR inhibitors. In addition, some of these methods involve additional purification steps which reduces the yield of DNA obtained. In choosing a method to relieve PCR inhibition, it is important that the method remove as many inhibitors as possible and at the same time maximize the yield of DNA
template. A brief description of each method will be discussed in the next few sections.
8.3.1. Spin Column Filters
Different spin filters such as the Microcon® or Centricon® columns and
QIAQuick® or QIAamp® columns have been used to concentrate and purify DNA extracts. The Microcon® and Centricon® columns use a regenerated cellulose membrane to isolate the DNA template from the matrix and concentrate it114. The QIAquick® and
QIAamp® columns use a silica membrane to bind the DNA template70,71. The buffers, pH, and salt conditions for this system are optimized to ensure proper binding of DNA to the silica membrane while other proteins and contaminants which can inhibit PCR are not retained. Purified DNA is then eluted with an elution buffer or water. However, these methods can result in a significant loss in the amount of DNA template and thus cannot be used when the quantity of DNA recovered from the crime scene is low. Silica-based spin columns have been applied for the removal of PCR inhibitors from bone samples115.
However, this method seemed to be insufficient for the removal of some PCR inhibitors. 95
Studies had been conducted in which bone samples subjected to different environmental conditions were purified and concentrated using QIAamp® silica-based spin columns
following decalcification with EDTA and some samples still exhibited PCR inhibition116.
As an alternative, Lin et al. have used a Bio-Gel P-60 minicolumn developed by Yoshii,
Tamura, Taniguchi, Akiyama, and Ishiyama for removing eumelanin from unpurified
DNA solution107,117. Bio-Gel P60 is made up of polyacrylamide crosslinked with N’N’
bis-acrylamide and when equilibrated with 10 mM sodium acetate buffer at pH 4.2 can
selectively adsorb indol, a component of eumelanin while allowing the DNA to pass
through107. However, this column also failed to relieve PCR inhibition in some hair samples117.
8.3.2. Magnetic Beads
Magnetic bead particles such as Dynabeads and the DNA IQ™ system have also been used for isolation of DNA. These particles are made up of crosslinked polymers with magnetic material. The surfaces of Dynabead particles have been modified with a charged resin to isolate DNA118. The DNA IQ™ system uses silica-coated magnetic beads to separate the DNA template from other cellular debris119. The DNA-magnetic bead complex can then be isolated free of contaminants using a magnet. However, a previous study comparing the magnetic bead method to the silica-based method has shown that using the latter gives a higher recovery of inhibitor free DNA extracts41. Also,
if the magnetic-bead complex is not washed properly, contaminating inhibitors could
seep into the final DNA extract119. In addition, these magnetic bead particles only capture
a constant amount of DNA (i.e.100 ng/µL for the DNA IQ™ system) which can decrease
the yield of human DNA as the ratio of bacterial DNA to human DNA increases in 96
situations where the sample recovered has been exposed to a variety of environmental insults80.
8.3.3. Sodium Hydroxide (NaOH) Studies
Some PCR inhibitors are thought to act by intercalating between dsDNA. The use
of NaOH as a denaturant to reduce the affinity of these inhibitors for DNA has been
studied120. Under alkaline conditions, the DNA molecule is single stranded. Thus, these inhibitors would have lesser affinity for the ssDNA template permitting their dilution or removal. Although the use of NaOH as a purification method can remove PCR inhibitors, this method cannot be used when the quantity of DNA is limited because the treatment results in an approximate 50% loss in the amount of DNA120. In addition, hydrostatic shearing of the ssDNA and imperfect renaturation of the DNA strand after neutralization may add to the degradation of the template. This poses a problem in forensic cases because samples recovered in compromised cases are often both degraded and have low template amounts.
8.3.4. Bovine Serum Albumin (BSA)
The use of BSA as an additive to relieve PCR inhibition has been reported in several papers. For example, BSA has been used to relieve PCR inhibition by heme103.
The ligand binding properties of the albumin protein is responsible for the binding of the heme compound to a hydrophobic D-shaped cavity in subdomain IB of the protein121.
BSA has also been reported to relieve PCR inhibition by melanin 105, humic acids, fulvic acids, tannic acids, or other extracts from feces, freshwater, or marine water108. Most of the inhibitory substances relieved by BSA contain phenolic groups. These groups bind to proteins by forming hydrogen bonds with peptide oxygens108. 97
When using BSA to relieve PCR inhibition, it is important that the BSA is not acetylated. Acetylated BSA that is treated with acetic anhydride to inactivate nucleases,
inhibit the PCR reaction instead of relieving it108. This finding was verified when acetylated BSA from Sigma was utilized in the quantification of bone samples using real- time PCR. Inhibition was only relieved when non-acetylated BSA was substituted for the acetylated form. The acetyl groups from the acetylated BSA protein can transfer to the polymerase during high temperature reactions (80 ºC) thereby inactivating it122.
8.3.5. Low-Melting Temperature (LMT) Agarose
LMT agarose has been used to purify DNA templates naturally contaminated with polysacharrides and humic acids122. This method for PCR inhibitor removal takes
advantage of the difference in size and shape between the DNA template and the PCR
inhibitors. Basically, samples with inhibitors are mixed with LMT agarose at 70 oC. The agarose is then cooled to form a solid mass. The solid block is washed with buffer and then with ultra pure water to cause PCR inhibitors to diffuse outside of the solid agarose while the DNA template remains embedded within. LMT agarose embedded DNA preparations can be used directly for PCR reaction. Also, because low melting point agaroses have a melting temperature ≤ 65ºC, it is possible to remelt the agarose without affecting the DNA double helix.
To date, the use of spin column filters, magnetic beads, and NaOH purification methods are not capable of completely relieving the sample from all PCR inhibitors and at the same time provide maximum DNA yield. The use of BSA to relieve PCR inhibition offers an advantage since additional purification and clean-up steps that can reduce DNA 98
yield are not necessary. Similarly, the use of LMT agarose can offer an efficient and reproducible alternative to provide clean and high quality DNA template for PCR with the additional advantage of being inexpensive and just requiring a few number of steps.
8.4. PCR Inhibitor Preparation
Hematin, indigo, melanin, and humic acid were obtained from VWR
International, West Chester, PA. Collagen type I and calcium phosphate were obtained from Sigma-Aldrich, St. Louis, MO. Stock solutions of hematin (MW: 633.5 g/mol) and calcium (MW: 136.06 g/mol) in 100 mM concentration were prepared in 0.1 N NaOH and 0.1 N HCl, respectively. A 100 mM stock solution of indigo (MW: 262.27 g/mol) was prepared by dissolving the indigo powder in 0.2% Triton X-100 in H2O. Stock
solutions of melanin and collagen in 1 mg/mL concentration were prepared in 0.5 N
ammonium hydroxide and 0.1 N acetic acid, respectively. Lastly, 1 mg/mL humic acid
was prepared in H2O. Subsequent dilutions were performed with H2O.
8.5. Inhibition Studies with Miniplex Primers
In this study amplifications between the Miniplex primer sets, which produce amplicons in the size range of 55-280 base pairs, and the commercial kit, CTTv
GenePrint™ Fluorescent STR system (CSF1PO, TH01, TPOX, vWA, 130-330 bp) from
Promega were used to examine the effect of PCR amplicon size with respect to the
concentration of inhibitors. These two primer kits were amplified with varying
concentrations of PCR inhibitors. In addition, the threshold inhibitory concentrations of
hematin, indigo, melanin, humic acid, collagen, and calcium were determined for the
Miniplex primer sets. Lastly, two methods to relieve PCR inhibition were tested. The first
method utilized the addition of BSA to the PCR mixture because this is the easier 99
alternative to relieve inhibition without having to deal with additional clean up steps and possible DNA losses. The second method involved a purification step using LMT agarose to recover clean and high quality DNA template directly from agarose embedded DNA preparations. Because the LMT method has only been used to clean up humic acids and polysaccharides, this study will aim to extend the application of this method to relieve more PCR inhibitors.
8.5.1. Threshold Inhibitor Concentration
The threshold inhibitor concentration is defined as the lowest concentration of inhibitor that removes the signal from at least one locus from three replicate measurements. It is only at that point when one locus fails to amplify that the possible presence of PCR inhibition will be detected by an analyst. The threshold inhibitor concentration for hematin, indigo, melanin, humic acid, collagen, and calcium was determined for the Miniplex 2, Miniplex 4, and Big Mini multiplex set (Figure 8-1). With
250 pg of DNA template, Miniplex 2 and Miniplex 4 are inhibited by hematin at 0.76
µM; melanin at 0.20 ng/ µL; humic acid at 0.60 ng/µL; indigo at 320 µM and 300 µM, respectively; collagen at 32 ng/µL and 24 ng/µL, respectively; and calcium at 1100 µM and 800 µM, respectively. With 500 pg of DNA template, Big Mini is inhibited by hematin at 1 µM; indigo at 280 µM; melanin at 0.16 ng/µL; humic acid at 0.50 ng/µL; collagen at 24 ng/µL; and calcium at 1100 µM. The results are summarized in Table 8-1.
Amplifications with different inhibitor concentrations using Promega’s CTTv
GenePrint™ Fluorescent STR system were performed to test whether the size of the amplified product would affect the degree of PCR inhibition (Figure 8-2). Since the
amplicon sizes for this commercial kit are larger compared to the PCR products of the 100
Miniplexes (100-330 bp versus 55-280 bp), it was anticipated that the degree of PCR inhibition may be affected by the amplicon size. If PCR inhibitors affect the processivity of the polymerase enzyme, then smaller amplicons would have a greater chance of being completely amplified before the polymerase enzyme falls off. Unlike the results with degraded DNA, no correlation between the amplicon length and the degree of PCR inhibition was observed.
Samples were also amplified using twice the primer concentrations to see if the threshold inhibitor concentration can be increased. In these experiments, an increase in the primer concentration failed to yield amplification products and thus, did not relieve
PCR inhibition. However, the degree of PCR inhibition appeared to be sequence dependent since some loci were preferentially reduced compared to others (Figure 8-1).
For the inhibitors hematin, indigo, melanin, and humic acid, the D16S539 (81-121 bp) and vWA (88-148 bp) loci in Miniplex 2 and Miniplex 4, respectively, were usually the last ones to be affected by PCR inhibition. In the Big Mini set, the FGA (125-281 bp),
CSF1PO (89-129 bp), D21S11 (153-211 bp), and D7S820 (136-176 bp) loci were inhibited well before TH01 (55-98 bp) and TPOX (65-101 bp). This pattern was also observed in another experiment when the annealing temperature was increased from 55ºC to 58ºC, 60ºC, and 65ºC. In this study, TH01, TPOX, and D7S820 failed to amplify at an annealing temperature of 65ºC while the other loci of the Big Mini set failed to amplify at
an annealing temperature of 60ºC. For the CTTv GenePrint™ Fluorescent STR system, it
was observed that the TPOX locus (224-252 bp) followed by the CSF1PO locus (295-327
bp) becomes inhibited before the TH01 (179-203 bp) and vWA (139-167 bp) loci.
Differential amplification of loci independent of amplicon size has also been observed in 101
validation studies with the AmpFlSTR Blue Kit as the concentration of the inhibitor hematin was increased49. Therefore, it was hypothesized that the effects of these four
inhibitors on a particular locus can vary depending on the strength of primer binding or
on the ternary interaction of Taq polymerase-primer-DNA template at that locus. These
findings could be attributed to the higher calculated melting temperatures (Tm) for the
TH01 (61.0ºC and 62.8 ºC for the forward and reverse primer, respectively) and TPOX
(60.0 ºC and 61.0 ºC for the forward and reverse primer, respectively) primers compared to the other primer pairs in the Big Mini set (see Table 4-2). Because primer extension is kinetically governed by the rate of primer dissociation and the rate of primer elongation52, sequences which have stronger primer binding may tend to form the DNA-primer- polymerase complex faster, and thus reduce the affinity of the inhibitor for the polymerase enzyme.
For collagen and calcium, the different loci do not become inhibited in the same order as the other inhibitors studied. These two inhibitors must have a different mechanism of inhibition compared to the other four inhibitors.
8.5.2. Relief of Inhibition by the Addition of BSA to the Miniplex PCR mixture
In this study, the effect of adding 1 µg of non-acetylated BSA to 25 µL of the
Miniplex 2, Miniplex 4, and Big Mini PCR mixture containing the tested PCR inhibitors was examined (Figure 8-3). Based on these results, the addition of 1 µg BSA to 25 µL of the Miniplex PCR mixture was sufficient to relieve PCR inhibition by hematin (1 µM), indigo (320 µM), melanin (0.20 ng/ µL), and humic acid (0.60 ng/ µL). Because melanin 102
Hematin: Mini 2 and Mini 4
1.2
0 1 0.8 0.6 D5S818 0.4 D8S1179 0.2 Ratio I/I D16S539 0 vWA 0.00 0.24 0.50 0.76 1.00 D18S51 D13S317 Inhibitor Concentration (µM)
Hematin: Big Mini 1.4
0 1.2 1 0.8 0.6 TH01 0.4 CSF1PO Ratio I/I Ratio 0.2 0 TPOX FGA 0.00 0.24 0.50 0.76 1.00 D21S11 Inhibitor Concentration (µM) D7S820
Figure 8-1A. The effect of increasing hematin concentration on the electropherogram signal intensity of Miniplex 2, Miniplex 4, and Big Mini loci. DNA samples were spiked with different concentrations of hematin ranging from 0-1 µM. I/I0 is the ratio of signal with inhibitor in the sample to the signal without inhibitor in the sample. DNA concentrations are 250 pg/25 µL for Miniplex 2 and 4 and 500 pg/25 µL for Big Mini. All amplifications were performed at 33 cycles. (n=3)
103
Indigo: Mini 2 and Mini 4
1.2 1 0 D5S818 0.8 0.6 D8S1179 0.4 D16S539
Ratio I/I Ratio 0.2 vWA 0 D18S51 0 200 280 300 320 D13S317 Inhibitor Concentration (µM)
Indigo: Big Mini
1.2 1 0 0.8 0.6 TH01 0.4 CSF1PO TPOX Ratio I/I 0.2 0 FGA 0 200 280 300 320 340 D21S11 D7S820 Inhibitor Concentration (mM)
Figure 8-1B. The effect of increasing indigo concentration on the electropherogram signal intensity of Miniplex 2, Miniplex 4, and Big Mini loci. DNA samples were spiked with different concentrations of indigo ranging from 0-340 µM. I/I0 is the ratio of signal with inhibitor in the sample to the signal without inhibitor in the sample. DNA concentrations are 250 pg/25 µL for Miniplex 2 and 4 and 500 pg/25 µL for Big Mini. All amplifications were performed at 33 cycles. (n=3)
104
Melanin: Mini 2 and Mini 4
2.5
0 2 D5S818 1.5 D8S1179 1 D16S539 vWA 0.5 Ratio I/I D18S51 0 D13S317 0.0 1.5 2.0 4.0 5.0
Inhibitor Concentration (ng /25 µl)
Melanin: Big Mini
1.2
0 1 TH01 0.8 CSF1PO 0.6 0.4 TPOX FGA
Ratio I/I Ratio 0.2 0 D21S11 0.0 1.5 2.0 4.0 5.0 6.0 D7S820 Inhibitor Concentration (ng /25 µl)
Figure 8-1C. The effect of increasing melanin concentration on the electropherogram signal intensity of Miniplex 2, Miniplex 4, and Big Mini loci. DNA samples were spiked with different concentrations of melanin ranging from 0-6 ng/25 µL. I/I0 is the ratio of signal with inhibitor in the sample to the signal without inhibitor in the sample. DNA concentrations are 250 pg/25 µL for Miniplex 2 and 4 and 500 pg/25 µL for Big Mini. All amplifications were performed at 33 cycles. (n=3)
105
Humic Acid: Mini 2 and Mini 4
2 0 1.5 D5S818
1 D8S1179 D16S539 0.5 vWA Ratio I/I 0 D18S51 0.0 2.5 5.0 10.0 12.5 15.0 D13S317 Inhibitor Concentration (ng /25 µl)
Humic Acid: Big Mini
1.5 0 TH01 1.0 CSF1PO
0.5 TPOX FGA Ratio I/I 0.0 D21S11 0.0 2.5 5.0 10.0 12.5 15.0 D7S820 Inhibitor Concentration (ng /25 µl)
Figure 8-1D. The effect of increasing humic acid concentration on the electropherogram signal intensity of Miniplex 2, Miniplex 4, and Big Mini loci. DNA samples were spiked with different concentrations of humic acid ranging from 0-15 ng/25 µL. I/I0 is the ratio of signal with inhibitor in the sample to the signal without inhibitor in the sample. DNA concentrations are 250 pg/25 µL for Miniplex 2 and 4 and 500 pg/25 µL for Big Mini. All amplifications were performed at 33 cycles. (n=3)
106
Collagen: Mini 2 and Mini 4
1.2 D5S818 0 1 D8S1179 0.8 0.6 D16S539 0.4 vWA 0.2 Ratio I/I D18S51 0 D13S317 0 200 500 600 800 1000
Inhibitor Concentration (ng /25 µl)
Collagen: Big Mini
1.2 0 1 0.8 TH01 0.6 CSF1PO 0.4 TPOX 0.2 Ratio I/I FGA 0 0 500 600 800 1000 D21S11 D7S820 Inhibitor Concentration (ng /25 µl)
Figure 8-1E. The effect of increasing collagen concentration on the electropherogram signal intensity of Miniplex 2, Miniplex 4, and Big Mini loci. DNA samples were spiked with different concentrations of collagen ranging from 0-1000 ng/25 µL. I/I0 is the ratio of signal with inhibitor in the sample to the signal without inhibitor in the sample. DNA concentrations are 250 pg/25 µL for Miniplex 2 and 4 and 500 pg/25 µL for Big Mini. All amplifications were performed at 33 cycles. (n=3)
107
Calcium: Mini 2 and Mini 4
1.5 0 D5S818 1 D8S1179 0.5 D16S539 vWA Ratio I/I 0 D18S51 0 500 800 900 1000 1100 D13S317 Inhibitor Concentration (µM)
Calcium: Big Mini
2 0 1.5 TH01 CSF1PO 1 TPOX 0.5 FGA Ratio I/I 0 D21S11 0 500 800 900 1000 1100 D7S820 Inhibitor Concentration (µM)
Figure 8-1F. The effect of increasing calcium concentration on the electropherogram signal intensity of Miniplex 2, Miniplex 4, and Big Mini loci. DNA samples were spiked with different concentrations of calcium ranging from 0-1100 µM . I/I0 is the ratio of signal with inhibitor in the sample to the signal without inhibitor in the sample. DNA concentrations are 250 pg/25 µL for Miniplex 2 and 4 and 500 pg/25 µL for Big Mini. All amplifications were performed at 33 cycles. (n=3)
108
Table 8-1. Threshold inhibitory concentrations of hematin, indigo, melanin, humic acid, collagen, and calcium amplified with the Miniplex 2, Miniplex 4, and Big Mini multiplex sets. All amplifications were performed at 33 cycles in 25 µL reaction volume (n=3).
Big Mini Mini 2 Mini 4 INHIBITOR (500 pg) (250 pg) (250 pg)
Hematin 1 µM 0.76 µM 0.76 µM (0.48 ng/µL) (0.48 ng/µL) (0.48n g/µL) Indigo 280 µM 320 µM 300 µM (73 ng/µL) (84 ng/µL) (78 ng/µL) Melanin 0.16 ng/µL 0.20 ng/µL 0.20 ng/µL
Humic Acid 0.50 ng/µL 0.60 ng/µL 0.60 ng/µL
Collagen 24 ng/µL 32 ng/µL 24 ng/µL
Calcium 1100 µM 1100 µM 800 µM (150 ng/µL) (150 ng/µL) (109 ng/µL) 109
A
TPOX FGA D7S820 vWA TH01 0 µM D21S11 TPOX CSF1PO TH01 CSF1PO 0 µM
.50 µM 0.5 µM
1.0 µM 1.0 µM
B TPOX D7S820 vWA TH01 CSF1PO TH01 CSF1PO FGA D21S11 TPOX 0 µM 0 µM
200 µM 200 µM RFU 280 µM 280 µM
300 µM 300 µM
C
vWA TPOX CSF1PO 0 ng TH01 0 ng
CSF1PO TH01 TPOX D7S820FGA D21S11 2 ng 2 ng
4 ng 4 ng
5 ng 5 ng
Size in base pairs Figure 8-2A. Comparison of amplifications using the Big Mini multiplex set and the CTTv system. (A) Amplifications with different hematin concentrations ranging from 0- 1 µM. (B) Amplifications with different indigo concentrations ranging from 0-300 µM. (C) Amplifications with amounts of melanin ranging from 0-5 ng per 25 µL reaction volume. All amplifications were performed with 500 pg/25 µL of DNA at 33 cycles. 110
D
D7S820 CSF1PO TH01 CSF1PO vWA TH01 TPOX 0 ng 0 ng FGA D21S11 TPOX
5 ng 5 ng
10 ng 10 ng
15 ng 15 ng
E
vWA TH01 0 ng 0 ng TPOX CSF1PO
TH01 TPOX CSF1PO FGA D21S11 200 ng D7S820 200 ng
500 ng 500 ng RFU RFU
600 ng 600 ng
F
CSF1PO0 µM D7S820 vWA TH01 TH01 TPOX FGA D21S11 TPOX0 µM CSF1PO
500 µM 500 µM
800 µM 800 µM
1000 µM 1000 µM
Size in base pairs
Figure 8-2 (continued). Comparison of amplifications using the Big Mini multiplex set and the CTTv system. (D) Amplifications with different amounts of humic acid ranging from 0-15 ng per 25 µL reaction volume. (E) Amplifications with different amounts of collagen ranging from 0-600 ng per 25 µL reaction volume. (F) Amplifications with different calcium concentrations ranging from 0-1000 µM. All amplifications were performed with 500 pg/25 µL of DNA at 33 cycles. 111
and humic acid compounds are phenolic substances, it was anticipated that BSA would be able to relieve its inhibition. Likewise, the indigo molecule can form a phenol-like compound by tautomerization (personal communication, Dr. Jared Butcher, Ohio
University). Relief of inhibition by hematin could be due to the ligand binding properties of the albumin protein121. However, BSA does not relieve PCR inhibition by collagen and calcium. It was found that the addition of BSA precipitates the collagen in the sample after PCR amplification. Analysis of the PCR product after removal of the precipitate failed to yield results. The failure of BSA to relieve PCR inhibition by collagen could be due to the fact that the size of the collagen protein (MW: ~285 kDa) is larger than the size of the BSA protein (MW: ~66 kDa).
The addition of different BSA concentrations ranging from 0-2.5 µg to 25 µL of the Big Mini PCR mixture containing at least twice the minimum inhibitory concentration of inhibitor was also tested. Results indicated that at 1 µg/ 25 µL, BSA was able to relieve PCR inhibition by hematin (2 µM), indigo (640 µM), melanin (0.32 ng/µL), and humic acid (1.2 ng/µL) (Figure 8-4). BSA failed to relieve inhibition at twice the minimum inhibitory concentration of collagen (48 ng/µL) and calcium (2200 µM).
Instead, the formation of a white precipitate was again observed after PCR amplification of the collagen spiked samples. These samples were centrifuged and the supernatant was analyzed but amplified products were not observed.
Even if additional purification steps are performed following DNA extraction, there is still a possibility that traces of PCR inhibitors are present. Thus, the addition of
BSA as constitutional part of the PCR mixture can help relieve the effects of certain 112
Figure 8-3. Effect of adding 1 µg/25 µL BSA to the Miniplex 2, Miniplex 4, and Big Mini reaction mixture containing the different inhibitors. Panel A: Positive control sample without inhibitor, Panel B: Sample spiked with 1 µM of hematin, Panel C; Sample spiked with 320 µM of indigo, Panel D: Sample spiked with 0.20 ng/µL of melanin, Panel E; Sample spiked with 0.60 ng/µL of humic acid, Panel F: 32 ng/µL of collagen, and Panel G: 1100 µM of calcium.
113
Figure 8-4. Effect of adding different amounts of BSA to the Big Mini reaction mixture. Different BSA concentrations ranging from 0-2.5 µg per 25 µL were added to the Big Mini multiplex PCR reaction mixture and amplified at 33 cycles. (A) 2 µM hematin, (B) 640 µM indigo, (C) 0.32 ng/µL melanin, and (D) 1.2 ng/ µL humic acid.
114 inhibitors by their sequestration. The addition of 1 µg/25 µL concentration of BSA was optimal for Miniplexes under these PCR conditions. Judging from these data, increasing the concentrations of BSA above 1 µg/25 µL does not have a great effect on results. A decrease in the yield of some loci could be seen as the BSA concentration was increased. Similar results have been reported by Lin et al. They have reported that too large an amount of BSA in the PCR mixture can adversely inhibit the PCR reaction114.
Therefore, it is the responsibility of the analyst to find the minimum amount of BSA necessary to relieve PCR inhibition under their PCR conditions.
8.5.3. Use of LMT Agarose for PCR Inhibitor Removal
In this study, the LMT agarose method (see Appendix I) was used to clean up
DNA samples containing either hematin (4 µM), indigo (1.28 mM), melanin (1.6 ng/ µL), humic acid (5 ng/ µL), collagen (540 ng/ µL), or calcium (4.4 mM). Samples were then amplified with the Big Mini primer set (Figure 8-5). These results indicate that using
LMT agarose to purify DNA samples is an effective way of removing PCR inhibitors.
However, this method requires an additional step prior to amplification of the samples and losses in the amount DNA template can occur during the purification step.
To optimize the procedure, four different agaroses from Promega and Cambrex
were tested. A series of experiments were performed quantifying positive control DNA
extracts from blood (Figure 8-6) and degraded DNA extracts from bone (Figure 8-7)
prior to LMT clean-up and after LMT clean-up. When used to clean-up positive control
DNA extracts from blood, the LMT agarose from Promega and the SeaPlaque® agarose from Cambrex resulted in an average DNA loss of 20% while the SeaPlaque® GTG® 115
Figure 8-5. Low-melting temperature (LMT) agarose clean-up of PCR inhibitors. LMT agarose used was from Promega Corporation. A: 4 µM hematin; B: 1.28 mM indigo; C: 1.6 ng/µL melanin; D: 5 ng/µL humic acid; E: 540 ng/µL collagen; and 4.4 mM calcium. Top panel: before LMT agarose cleaning. Bottom Panel: after LMT agarose cleaning. Samples were amplified with the Big Mini multiplex set. 116 and NuSieve ® GTG® agarose from Cambrex resulted in an average DNA loss between
40-50%. However, when used to clean-up degraded DNA extracts from bone, the LMT
agarose from Promega and the NuSieve ® GTG® agarose from Cambrex gave the best recoveries with 20- 50% DNA loss compared to the SeaPlaque® agaroses which gave
losses greater than 60%. Because the LMT agarose from Promega and the NuSieve ®
GTG® agarose from Cambrex were specially designed to be used for the recovery of
DNA fragments below 1000 base pairs, it was anticipated that these two agaroses would be more efficient in cleaning-up extracts from degraded DNA samples. This characteristic of Promega’s LMT agarose and Cambrex’s NuSieve ® GTG® agarose was confirmed by our results.
Analysis of variance (ANOVA) calculations between these different types of agaroses were performed to determine if there was any significant difference in their efficiency of DNA recovery. Using an alpha value of 0.05, an F-value of 6.71 (critical F:
2.97; P-value: 1.68 x 10-3) and 3.26 (critical F: 3.07; P-value 4.18 x 10-2) was obtained when used to clean- up positive control DNA from blood (Table 8-2) and degraded DNA from bone (Table 8-3), respectively. These results point out that the type of low melting temperature agarose used can have an effect on the amount of DNA recovered. For both types of DNA, the LMT agarose from Promega (catalog number: V3841) gave the lowest percentage of DNA loss.
Furthermore, in using the LMT agarose method, the pipetting precision of the analyst is very crucial to achieve consistency. To maximize recovery, it is essential that all of the supernatant is carefully removed while leaving the solidified agarose with DNA 117 template in the tube. A cooling step at 4 °C was added to ensure that the agarose is solidified. Cooling also helps distinguish the two phases present since the buffers and water have the same color as the agarose. 118
Figure 8-6. Comparison of DNA loss for four different types of agaroses using positive control DNA extracts from blood. The % DNA loss for each type of agarose is shown with Promega’s LMP agarose and Cambrex’s SeaPlaque® agarose giving better DNA recovery when used to clean-up non-degraded DNA samples.
Table 8-2. ANOVA results for the different types of agaroses used to clean-up positive control DNA extracts from blood. ANOVA calculations showed a significant difference in DNA recovery between the different types of agaroses when used to clean- up positive control DNA extracts from blood (α:0.05).
ANOVA Source of Variation SS df MS F P-value F crit Between Groups (type of agarose) 0.51 3.00 0.17 6.70 0.00 2.98 Within Groups 0.67 26.00 0.03
Total 1.18 29.00
119
Figure 8-7. Comparison of DNA loss for four different types of agaroses using degraded DNA extracts from bone. The % DNA loss for each type of agarose is shown with Promega’s LMP agarose and Cambrex’s NuSieve® GTG® agarose giving better DNA recovery when used to degraded DNA samples.
Table 8-3. ANOVA results for the different types of agaroses used to clean-up degraded DNA extracts from bone. ANOVA calculations showed a significant difference in DNA recovery between the different types of agaroses when used to clean- up degraded DNA extracts from bone (α:0.05).
ANOVA Source of Variation SS df MS F P-value F crit Between Groups (type of agarose) 0.88 3 0.29 3.26 0.04 3.07 Within Groups 1.88 21 0.09
Total 2.76 24
120
Chapter 9. Validation Studies
The developmental validation of newly designed methods for DNA analysis is an
integral process used by the scientific community prior to the adoption of the method by
any other laboratory. Developmental validation studies of the Miniplex primer sets in
accordance to the Technical Working Group on DNA Analysis Methods (TWGDAM)
guidelines to evaluate the performance of the Miniplex primer sets have been performed.
These validation studies are conducted to determine the limitations of the method and to
examine the different parameters that will affect the ability of the Miniplex primers in
acquiring reliable results from forensic samples obtained under a variety of conditions.
These studies will also demonstrate the robustness of the Miniplex primer sets in typing
compromised forensic samples.
In subsequent sections, validation studies on Miniplex primer sets 2, 4, and Big
Mini will be presented. Validation studies on Miniplex 5 have not been performed
because non-specific binding problems have been encountered with the Penta E locus at
low DNA template concentrations (Figure 9-1). This non-specific binding observed with
the Penta E primers could be attributed to the potential binding of the redesigned forward
and reverse Penta E primers to compatible sequences in the human genome. Examples of
this binding were uncovered using the BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and BLAT (http://genome.ucsc.edu) search.
Several factors such as the reaction conditions, the quality and the quantity of the
DNA template, and the analysis conditions can have variable effects on the outcome of results from PCR-based STR assays. In this study, several factors that can potentially 121
Figure 9-1. Non-specific binding observed at the Penta E locus of Miniplex 5. This non-specific binding could be attributed to the binding of both the re-designed forward and reverse Penta E primers to other sequences in the human genome.
122
affect the genotyping results obtained from amplifications with Miniplex 2, Miniplex 4, and Big Mini were evaluated.
The Miniplex primer sets were designed for the analysis of degraded and compromised samples. In these situations, low quantities of DNA template are usually recovered. Thus, most of the studies conducted with the Miniplexes were performed with
100 pg of DNA template per 25 µL of reaction volume (4 pg/µL) and 33 amplification
cycles. This capability of the Miniplex primer sets to amplify low copy number DNA
template would make it a useful alternative when commercial STR typing kits fail to
generate profiles for these compromised samples due to DNA degradation and low
template quantity.
9.1. Standard Specimens and Reproducibility
Standard specimen studies (n=3) were conducted to ensure that fresh body fluid
samples obtained from the same donor and stored in a controlled manner will produce the
same genotype result. Similarly, reproducibility studies ensure that stain and liquid
specimen samples would yield the same genotype. For this study, fresh (no EDTA) blood
was spotted on an unbleached white cotton cloth and an FTA card. EDTA is used as an
anti-coagulant and helps preserve the blood sample. Saliva was also collected from the
same individuals and applied to an FTA indicator card. These three specimens were
amplified with Miniplex 2, Miniplex 4, and Big Mini and consistent genotypes were
obtained for all.
Genotype consistency was also tested between samples that had been stored for a
year and samples that have been freshly obtained. In this study, EDTA treated blood
samples were spotted on unbleached white cotton cloth and on FTA cards and stored at 123
room temperature for one year. Fresh saliva from the same individuals was then obtained and applied to FTA indicator cards a few days before the aged blood samples were amplified to compare the genotype results of fresh samples to those that had been stored for one year. In both cases, all three Miniplex primer sets gave consistent genotypes.
Stability studies were conducted between fresh samples and samples that had been stored for two years. In this study, EDTA treated blood was spotted on an unbleached white cotton cloth. Some of the stains were extracted, amplified, and typed prior to storage at room temperature for two years. After two years, the remaining stains
were again extracted, amplified, and typed. In both cases, all three Miniplex primer sets
gave consistent genotypes.
For these studies, three different extraction methods were used. The phenol/
chloroform method was used for blood stains, DNAzol method was used for blood
spotted FTA cards, and the standard FTA extraction protocol for saliva specimens. These
different extraction methods did not affect the genotype results obtained. Procedures for
these methods can be found in Appendix I.
9.2. Sensitivity Studies
In some situations, the DNA template recovered from the crime scene is not only
degraded but the concentration of the DNA template recovered is also low. It was
anticipated that shortening the PCR amplicon size would improve the amplification
efficiency of samples where the DNA template is degraded and present in low copy
numbers. In these situations, the probability of finding short intact DNA fragments
amongst the few cells available would be higher than the probability of finding long
DNA fragments. Most manufacturers of STR multiplex kits have set the lower limit of 124
sensitivity at 250 pg of DNA23,43. These multiplex kits usually have their optimum efficiency when 1 ng of DNA is amplified124,125. Because the Miniplex primer sets are utilized for the analysis of highly degraded samples where only low concentrations of intact template may be present, the limits of sensitivity for Miniplex 2, Miniplex 4, and
Big Mini was explored.
Samples with DNA concentrations ranging from 31 pg to 500 pg in 25 µL reaction volumes were amplified. These concentrations are below the range recommended for commercial sets. Correct genotypes were obtained at concentrations as low as 31 pg/25 µL for majority of the samples tested with Miniplex 2 and Miniplex 4.
However at this concentration, there was one sample that showed allele dropout for
Miniplex 2 (n=12) and six samples that showed allele dropout for Miniplex 4 (n=20). At
63 pg/25 µL, one sample for Miniplex 2 and four samples for Miniplex 4 showed allele
dropout. At 125 pg/ 25 µL, no allele drop out was observed for Miniplex 2 and Miniplex
4. For the Big Mini multiplex, allele dropout was evident for most of the loci tested at 31
pg/ 25 µL. At 63 pg/ 25 µL, 50% of the samples (n=14) still showed allele dropout for the
CSF1PO, D21S11 and D7S820 loci. At 125 pg/25 µL, two samples still showed allele
dropout for the Big Mini set. Based on these results, template concentrations of 125 pg/25
µL work well with Miniplex 2 (Figure 9-2) and Miniplex 4 (Figure 9-3). At this
concentration, the average peak heights for Miniplex 2 and Miniplex 4 are 2400 and 1200
RFU, respectively. These are well above the detection threshold of 150 RFU set for these
primer sets. Below 150 RFU it becomes difficult to distinguish a peak from the baseline
noise. Currently, template concentrations of 100 pg/25 µL are used for these two primer
sets. 125
As for the Big Mini set, our preliminary studies showed that template concentrations greater than 250 pg/25 µL (Figure 9-4) are needed to avoid allele dropout and get satisfactory signal intensity. However in later work, the primer concentrations of
the Big Mini multiplex set were optimized to permit amplification of 100 pg/25 µL of
DNA template. This corresponds to approximately 30 copies of DNA template, or 15
cells55.
Two-factor ANOVA calculations of average peak heights between DNA
concentrations and between loci for each of these three Miniplex primer sets showed that
there is a significant difference between loci and between DNA concentrations for
Miniplex 4 and Big Mini (Table 9-1). For Miniplex 2, ANOVA calculations revealed that
there was no significant difference between the loci of this set. These results show that all
loci of the Miniplex 2 set have similar amplification efficiencies for all concentrations
tested. On the other hand, the loci of the Miniplex 4 and Big Mini set have different
amplification efficiencies for each concentration. The effect of interaction between loci and concentration is not significant for Miniplex 2 and Miniplex 4. However, interaction effects between loci and concentration are significant for the Big Mini set. The effect of interaction between loci and concentration for the Big Mini set confirms that the amount of DNA amplified affects the amplification efficiency of each Big Mini locus.
It is also important to note that sensitivity of any system is a function of cycle number, injection time, and concentration of sample injected. Thus, it is the responsibility 126
5000
4000 D5S818 3000 D8S1179 D16S539 2000
1000 Average Peak Height(RFU) 0 31.3 62.5 125.0 250.0 500.0 Template Concentration (pg/25µl reaction volume)
Figure 9-2. Sensitivity studies for Miniplex 2. The change in fluorescence signal intensity as a function of template concentration is shown for D5S818, D8S1179, and D16S539. Primer concentrations used were 0.4 µM, 0.4 µM, and 0.2 µM for D5S818, D8S1179, and D16S539, respectively. All samples were amplified at 33 cycles. No allele dropout and good signal intensities (2500 RFU) were achieved at template concentrations greater than 125 pg/25µL. Template concentrations of 100 pg/25µL are currently used with this primer set (n=12).
127
4500
4000
3500
3000
2500 vWA D18S51 2000 D13S317 1500
1000
Average Peak Height (RFU) 500
0 31.3 62.5 125.0 250.0 500.0 Template concentration (pg/25 µL reaction volume)
Figure 9-3. Sensitivity studies for Miniplex 4. The change in fluorescence signal intensity as a function of template concentration is shown for vWA, D18S51, and D13S317. Primer concentrations used were 0.40 µM, 0.40, and 0.56 µM for vWA, D18S51, and D13S317, respectively. No allele dropout and good signal intensities (1200 RFU) were achieved at template concentrations greater than 125 pg/25µL. Template concentrations of 100 pg/25µL are currently used with this primer set. (n=20) 128
2500
2000 TH01 CSF1PO 1500 TPOX FGA 1000 D21S11 D7s820 500 Average Peak Height (RFU)
0 31.3 62.5 125.0 250.0 500.0 Template Concentration (pg/25 µL reaction volume)
Figure 9-4. Sensitivity studies for Big Mini. The change in fluorescence signal intensity as a function of template concentration is shown for TH01, CSF1PO, TPOX, FGA, D21S11, and D7S820. Primer concentrations used were 0.20 µM for TH01, TPOX, FGA, 0.30 µM D21S11, D7S820, and 0.12 µM CSF1PO. All samples were amplified at 33 cycles. Template concentrations greater than 250 pg/25µL are needed to avoid allele dropout and achieve good signal intensity. (n=14) The primer concentrations for this set were optimized in a later work to work well with 100 pg/25 µL of template.
129
Table 9-1. Two factor ANOVA of average peak heights for Miniplex 2, Miniplex 4, and Big Mini. (α: 0.05)
Miniplex 2 ANOVA: Average Peak Height (two-factor) Source of Variation F P-value F crit Loci 1.47 0.23 3.04 Concentration 34.49 0.00 2.41 Interaction 0.35 0.95 1.98
Miniplex 4 ANOVA: Average Peak Height (two-factor) Source of Variation F P-value F crit Loci 5.72 0.00 3.02 Concentration 47.56 0.00 2.40 Interaction 1.16 0.32 1.97
Big Mini ANOVA: Average Peak Height (two-factor) Source of Variation F P-value F crit Loci 34.95 0.00 2.24 Concentration 44.16 0.00 2.39 Interaction 6.92 0.00 1.60 130
of the analyst to develop validated procedures when sensitivity is an issue. For example,
the number of cycles can be increased to achieve higher amounts of DNA template; the
injection time can be increased from 5 seconds to 8 seconds in order to introduce more
DNA molecules into the capillary; similarly, the concentration of the sample injected can
be increased by adding 2 µL instead of 1 µL of the amplified sample to 12 µL of the
ROX-formamide mixture prior to sample injection. All these can be manipulated by an analyst to increase sensitivity. The profile quality should not be sacrificed for sensitivity
(i.e. production of extra bands when using higher cycle numbers or overloading the CCD camera when large amounts of DNA are injected)
9.3. Peak Balance Studies
When the amount of template added to the PCR reaction is extremely low, the amplification of heterozygote alleles may be imbalanced due to stochastic effects. One allele can be preferentially amplified over the other due to unequal sampling of heterozygote alleles during the early stages of the PCR reaction126. Because an important requirement for accurate genotyping is to produce balanced allele peaks, the heterozygous peak balance ratio at five DNA concentrations (500, 250, 125, 63, 31 pg per
25 µL) was calculated. Only samples that were heterozygous for a particular locus were included in the calculations. The peak balance ratio was calculated by dividing the peak height of the smaller peak by the peak height of the larger peak. For samples with complete dropout of one allele, a zero peak balance ratio was assigned. Good intraloci and interloci balance (≥ 0.6 ratio) were obtained at a concentration 125 pg/25 µL for
Miniplex 2 (Figure 9-5) and Miniplex 4 (Figure 9-6). At 100 pg/25 µL of template, which is the default concentration used, peak balance ratio for the Miniplex 2 and Miniplex 4 set 131
5000
4000
3000 D5S818 D8S1179 2000 D16S539
1000
Average Peak Height (RFU) 0 31.3 62.5 125.0 250.0 500.0 Template Concentration (pg/25µl reaction volume)
Figure 9-5. Peak balance ratio for Miniplex 2. The average peak balance ratio for D5S818, D8S1179, and D16S539 is plotted as a function of template concentration. Primer concentrations used were 0.40 µM, 0.40 µM, and 0.20 µM for D5S818, D8S1179, and D16S539, respectively. All samples were amplified at 33 cycles. Template concentrations greater than 125 pg/25µL gave good peak balance ratios for this set at these conditions. At the 100 pg/25 µL of template currently used, the peak balance ratio is still above the 0.6 criterion. (n=12) 132
1
0.8
0.6 vWA D18S51 D13S317 0.4
0.2 Average Peak Ratio Peak Balance Average
0 31.3 62.5 125.0 250.0 500.0 Template concentration (pg/25µL reaction volume)
Figure 9-6. Peak balance ratio for Miniplex 4. The average peak balance ratio for vWA, D18S51, and D13S317 is plotted as a function of template concentration. Primer concentration used was 0.40 µM vWA, 0.40 µM D18S51, and 0.56 µM D13S317. All samples were amplified at 33 cycles. Template concentrations greater than 125 pg/25µL gave good peak balance ratios for this set at these conditions. At the 100 pg/25 µL of template currently used, the peak balance ratio is still above the 0.6 criterion. (n=20)
133
1
0.8 TH01
CSF1PO 0.6 TPOX 0.4 FGA
0.2 D21S11 Average Peak Balance Ratio 0 D7S820 31.3 62.5 125.0 250.0 500.0 Template Concentration (pg/25 µL reaction volume)
Figure 9-7. Peak balance ratio for Big Mini. The average peak balance ratio for TH01, CSF1PO, TPOX, FGA, D21S11, and D7S820 is plotted as a function of template concentration. Primer concentrations used were 0.2 µM for TH01, TPOX, FGA, 0.3 µM D21S11, D7S820, and 0.12 µM CSF1PO. All samples were amplified at 33 cycles. Template concentrations greater than 250 pg/25µL gave good peak balance ratios for this set at these conditions. The primer concentrations for this set were optimized in a later work to work well with 100 pg/25 µL of template. (n=14)
134
are still above the 0.6 ratio criterion. For the Big Mini set, poor peak balance for CSF1PO and D21S11 (0.21 and 0.41, respectively) were observed at these concentrations of template using old primer ratios (Figure 9-7). This problem was resolved by varying the primer concentrations for the problematic loci of this set using a factorial design approach.
Two factor ANOVA calculations of peak balance ratio between loci and between concentrations for Miniplex 2, Miniplex 4, and Big Mini revealed no significant difference between loci and between concentrations for Miniplex 2 and no significant difference between loci for Miniplex 4 at each concentration tested (Table 9-2). However, for Big Mini, there is a significant difference in peak balance ratios between concentration and between loci. These results show that the loci of the Miniplex 2 set have similar peak balance ratios between and within all concentrations tested. Interaction effects between loci and concentration are only significant for Big Mini which reveals that the concentration of DNA in the PCR mixture affects the peak balance between all
Big Mini loci. These findings were further confirmed by performing two single-factor
ANOVA calculations between DNA concentrations and between loci for the Big Mini set
(Table 9-3). The results of these calculations revealed a significant difference for all Big
Mini loci between concentrations. Interestingly, single factor ANOVA calculations between loci revealed a significant difference only for concentrations between 31, 63, and
125 pg/25 µL of DNA template. At higher DNA concentrations of 250 pg/25 µL and 500 pg/25 µL, there is no significant difference in the peak balance ratio between the six loci.
These findings confirm that template concentrations greater than 250 pg/25 µL are
135
Table 9-2. Two factor ANOVA of average peak balance ratio for Miniplex 2, Miniplex 4, and Big Mini. (α: 0.05)
Miniplex 2 ANOVA: Average Peak Balance Ratio (two-factor) Source of Variation F P-value F crit Loci 0.11 0.90 3.12 Concentration 1.81 0.15 2.73 Interaction 0.24 0.96 2.23
Miniplex 4 ANOVA: Average Peak Balance Ratio (two-factor) Source of Variation F P-value F crit Loci 0.27 0.76 3.02 Concentration 7.72 0.00 2.40 Interaction 0.81 0.59 1.97
Big Mini ANOVA: Average Peak Balance Ratio (two-factor) Source of Variation F P-value F crit Loci 5.12 0.00 2.27 Concentration 12.04 0.00 2.66 Interaction 2.23 0.01 1.73 136
Table 9-3. Single factor ANOVA for average peak balance ratio between concentrations and between loci for Big Mini. (α:0.05)
Big Mini ANOVA: Average Peak Balance Ratio (single factor) Variation between concentrations Loci F P-value F crit TH01 3.46 0.02 2.64 CSF1PO 13.57 0.00 2.61 TPOX 3.58 0.01 2.61 FGA 5.42 0.00 2.58 D21S11 21.13 0.00 2.54 D7S820 25.25 0.00 2.58
Big Mini ANOVA: Average Peak Balance Ratio (single factor) Variation between loci DNA template concentration ( pg in 25µL) F P-value F crit 31.3 3.90 0.00 2.39 62.5 3.36 0.01 2.39 125.0 2.99 0.02 2.39 250.0 1.63 0.17 2.39 500.0 0.88 0.50 2.39
137
needed to achieve good peak balance ratio when old primer concentrations are used
(Figure 9-7).
Although these Miniplex primer sets can efficiently amplify 100 pg/25 µL of
DNA template, the possibility of observing stochastic effects with some samples is not ruled out. When analyzing degraded and low copy number DNA samples, an analyst should be familiar with the various profile morphologies that may be expected47.
Stochastic amplification of heterozygous alleles may occur resulting in peak imbalance or allele drop out for these samples. Because the resulting peak heights may vary depending on the performance differences between capillary electrophoresis instruments, it becomes
necessary for each laboratory to assess where their stochastic threshold is when peak
imbalances start to occur.
9.4. Primer Concentration
Changing the primer concentration of one locus can affect the average peak height
and average peak balance ratio between loci. The difference in the DNA sequence for
each locus is also responsible for the variation in the efficiency of primer binding. Thus,
it becomes necessary to adjust the primer concentrations to obtain the optimum signal
intensity and balanced peak heights for each multiplex set. The initial primer
concentrations of 0.40 µM D5S818, 0.40 µM D8S1179, and 0.20 µM D16S539 for the
Miniplex 2 set and 0.40 µM vWA, 0.40 µM D18S51, and 0.56 µM D13S317 for the
Miniplex 4 set efficiently amplified DNA samples at 100 pg/25 µL. These two Miniplex
sets were not further optimized. For the Big Mini set, the initial primer concentrations of
0.20 µM TH01, TPOX, FGA, 0.30 µM D21S11, D7S820 and 0.12 µM CSF1PO used 138
gave poor sensitivity and poor peak balance for some loci at 100 pg/25 µL of DNA concentration as seen from the results of the previous section.
The sensitivity and peak balance ratio of the problematic loci (FGA, CSF1PO, and D21S11) in Big Mini was improved by varying the primer concentrations. A factorial design was used to find the optimum region of primer concentration.
Initially three loci, CSF1PO, D21S11, and D7S820, were examined while keeping the other three loci, TH01, TPOX, and FGA at fixed primer concentrations of 0.16 µM, 0.20
µM and 0.30 µM respectively. A 23 factorial design was used (Table 9-4). Based on the
results of the factorial design, best results were achieved at primer concentrations of 0.20
µM CSF1PO, 0.3 µM D21S11, and 0.35 µM D7S820. After the initial factorial design
test, primer concentrations were further optimized by examining different primer
concentrations around the optimum region. Optimal results for the Big Mini set was
achieved at 0.16 µM TH01, 0.16 µM CSF1PO, 0.20 µM TPOX, 0.24 µM FGA, 0.24 µM
D21S11, and 0.32 µM D7S820 of primer concentration (Figure 9-8). The positive
control K562 sample has a small FGA allele that was only visible at this primer ratio.
These primer concentrations also work well for amplification of samples with higher
quantities of DNA template. Table 9-5 shows the optimal primer concentration for each
Miniplex locus at 33 amplification cycles.
9.5. Cycle Number Study
One way to increase the sensitivity of any method is to raise the number of PCR
amplification cycles. Usually multiplex amplifications are carried out using 28-30 PCR
cycles43. The improvement in sensitivity obtained by using higher cycle numbers (i.e. >
28 cycles) allows for a wider range of evidence types to be analyzed. DNA profiles have 139
Table 9-4. 23 factorial design for optimization of CSF1PO, D21S11, and D7S820 loci in Big Mini. TH01, TPOX, and FGA at a fixed primer concentration of 0.16 µM, 0.20 µM and 0.30 µM respectively. (S.D. standard deviation; C.I. confidence interval; α:0.05)
Run CSF1PO D21S11 D7S820 Average S.D. C.I. Average S.D. C.I. Peak Height Peak Ratio µM µM µM
1 (+) 0.24 (+) 0.40 (+) 0.45 3500 1500 1200 0.78 0.098 0.078
2 (-) 0.20 (+) 0.40 (+) 0.45 3500 1800 1500 0.75 0.081 0.065
3 (+) 0.24 (-) 0.30 (+) 0.45 3600 1500 1200 0.78 0.063 0.050
4 (-) 0.20 (-) 0.30 (+) 0.45 3700 1500 1200 0.74 0.15 0.12
5 (+) 0.24 (+) 0.40 (-) 0.35 3000 800 700 0.77 0.045 0.036
6 (-) 0.20 (+) 0.40 (-) 0.35 3100 1200 1000 0.76 0.076 0.061
7 (+) 0.24 (-) 0.30 (-) 0.35 3500 1500 1200 0.75 0.061 0.049
8 (-) 0.20 (-) 0.30 (-) 0.35 4400 1400 1100 0.87 0.086 0.069
140
Figure 9-8. Big Mini primer titration. Combinations of different primer concentrations were tested around the optimum region for amplification of 100 pg/25 µL of positive control K562 DNA at 33 cycles. Optimal primer concentrations for this set are 0.16 µM TH01, 0.16 µM CSF1PO, 0.20 µM TPOX, 0.24 µM FGA, 0.24 µM D21S11, and 0.32 µM D7S820. The small allele of the FGA locus was only evident at this primer ratio.
141
Table 9-5. Optimal primer concentrations for each Miniplex locus when using 33 cycles for amplification.
Miniplex Locus Primer Concentration
D5S818 0.40 µM
D8S1179 0.40µM
D16S539 0.20 µM
vWA 0.40 µM
D18S51 0.40 µM
D13S317 0.56 µM
TH01 0.16 µM
CSF1PO 0.16 µM
TPOX 0.20 µM
FGA 0.24 µM
D21S11 0.24 µM
D7S820 0.32 µM
142
been obtained from buccal cells using the second generation multiplex (SGM) with 34 cycles127. Epithelial cells obtained after strangulation have been analyzed using 30-31
cycles of PCR128,129. Fingerprints from tool grips have been analyzed using 28-40 cycles130. Hair shafts without the root have also been analyzed using 35-43 cycles131. In
addition, forensic anthropologists have routinely used increased PCR cycle numbers to obtain profiles from ancient DNA. Gill et al. have used 38-43 PCR cycles to analyze
STRs from 70- year- old bone samples from the Romanov family132. Other authors have reported using 50 and 60 PCR cycles to analyze STRs from thousand years old bone samples33,42. Samples with less than 100 pg of DNA template have been routinely analyzed with both SGM and AmpFlSTR® SGM Plus™ using 34 cycles133.
To test the effect of cycle number on the sensitivity of the Miniplex primer sets,
100- 500 pg per 25 µL of DNA template were amplified at 28, 30, 33, and 36 cycles
(n=3). Miniplex 2 and Miniplex 4 gave good signal intensities (≥ 1000 RFU) and good peak balance ratio with 30 and 33 cycles (Figure 9-9). At 28 cycles, amplification products were observed but the signal intensity was quite low. For the Big Mini set, successful amplification of all the loci was only achieved at 33 cycles. At 28 cycles, only the FGA, D21S11, and D7S820 loci amplified with 100 pg/25 µL of DNA template. The smaller sized loci, TH01, CSF1PO, and TPOX were only successfully amplified at 500 pg/25 µL at 28 cycles. At 30 cycles, the smaller sized loci of the Big Mini set successfully amplified with 250 pg/25 µL of template. At 36 cycles, all Miniplex loci were over-amplified and problems with non-specific amplification were encountered
Although increasing the cycle number can increase signal intensity, lower cycle numbers can achieve better peak balance23,91. For DNA templates in excess of 250 pg/25 143
µL, lower cycle numbers can be used (i.e. 30 cycles for Big Mini and 28 cycles for
Miniplex 2 and Miniplex 4). However, in situations where only low copy amounts of
DNA template are available, it becomes indispensable to use a higher cycle number.
Using 33 cycles for amplifying DNA samples with 100 pg/25 µL of template is recommended. Using this cycle number with the Miniplex primer sets achieves the best balance between sensitivity and profile quality.
9.6. Reaction Volume Study
Decreasing the reaction volume of the PCR reaction is used as a means to save the cost of reagents. It also saves the amount of DNA template added to the PCR reaction.
The use of smaller reaction volumes can be beneficial for amplifications using the
Miniplex primer sets because three different sets of amplifications have to be performed for each sample to obtain profiles for 12 loci. This could pose a limitation when the amount of DNA template recovered from the crime scene is limited. Thus, reducing the reaction volume of the sample is an effective way to reduce the amount of DNA template used for amplification.
In this study, the effect of varying the reaction volume on amplification efficiency was tested. Reaction volumes of 5, 10, 12.5, 25, and 50 µL were tested with final DNA concentrations of 100, 250, 500, and 1000 pg/25 µL (4, 10, 20, and 40 pg/µL) using 33 cycles (n=3). The final template concentration was kept constant to avoid overloading the
CCD camera of the instrument. Signal intensities for all reaction volumes remained the same. Allele dropout with 100 pg/25 µL of DNA template using 5 µL of reaction volume 144
Figure 9-9. Cycle number study for Miniplex 2 and Miniplex 4. Amplifications of 100 pg/25 µL of DNA with Miniplex 2 and Miniplex 4 at different cycle numbers. Panel A: 28 cycles, Panel B: 30 cycles, Panel C: 33 cycles, and Panel D: 36 cycles. 1 µL of amplified sample was added to 12 µL formamide. Injection time used was 5 seconds at 15 kV. (Courtesy of Kerry Opel, Ohio University)
145
Figure 9-10. Miniplex 2 reaction volume study. 100 pg/25 µL of DNA template amplified at 33 cycles with Miniplex 2. The reaction volume for each panel is as follows: Panel A: 5 µL, Panel B: 10 µL, Panel C: 12.5 µL, Panel D: 25 µL, and Panel E: 50 µL. Allele dropout for D5S818 was observed when 5 µL of reaction volume at this concentration. (Courtesy of Kerry Opel, Ohio University)
146 was observed for Miniplex 2 (Figure 9-10) and no amplification products were observed at this concentration and volume for the Big Mini set. All other volumes and concentrations tested produced consistent profiles. For the Big Mini set, best results were obtained at 25 µL reaction volume for 100 pg/25 µL DNA concentration. When the amount of DNA template at 25 µL reaction volume is in excess of 250 pg/25 µL, excessive amplification resulted when using 33 cycles (i.e. saturation of CCD camera).
9.7. Magnesium Titration
Magnesium ions act as a cofactor for the Taq polymerase enzyme. The concentration of this ion in the reaction can affect primer annealing, product specificity, strand dissociation temperatures of both template and products, formation of primer- dimer artifacts, and polymerase activity and fidelity110. The effect of different magnesium concentrations on the efficiency of the PCR reaction was examined. Ten samples plus two DNA standards (9947A and 9948) were amplified with different magnesium concentrations. Magnesium titrations of 1.0, 1.5, 2.0, 2.5, and 3.0 mM were tested with these three Miniplex sets at 33 cycles with 100 pg/25 µL of DNA template. Results for the magnesium titration of the Big Mini set is shown on Figure 9-11. The GeneAmp®
PCR buffer II without magnesium was used and the specified amount of magnesium was then titrated. Based on these results, allele dropout was a problem at 1 mM magnesium
concentration. Magnesium concentrations of 1.5 – 2.0 mM were found to be optimal. At
higher magnesium concentrations (2.5 -3.0 mM), problems with non-specific binding
start to become apparent. These results indicate that the availability of magnesium ions is essential for optimal polymerase activity. Although increases in magnesium
147
Figure 9-11. Magnesium titrations for the Big Mini multiplex set. 100 pg/25 µL of DNA template amplified at 33 cycles titrated with varying magnesium concentrations. Final magnesium concentration in each reaction is as follows: Panel A: 1.0 mM Mg, Panel B: 1.5 mM Mg, Panel C: 2.0 mM Mg, Panel D: 2.5 mM Mg, and Panel E: 3.0 mM Mg. (Courtesy of Kerry Opel, Ohio University)
148
concentration do not greatly affect PCR yield, a decrease in the amount of magnesium
can cause adverse effects on the yield of the reaction.
9.8. Variation in Annealing Temperature
The annealing temperature during the PCR can affect the specificity, yield, and
balance of the amplified loci. Lower annealing temperatures can increase yield while
higher annealing temperatures increase specificity. In this study, the effect of different annealing temperatures on the efficiency of PCR amplification was examined. Annealing temperatures of 50, 55, 58, 60, 65 ºC were tested at 33 cycles with 100 pg/25 µL of DNA template (Figure 9-12). At an annealing temperature of 50 ºC, allele dropout was not observed and no additional artifacts were seen. Locus and allele dropout started to occur at the annealing temperature of 58 ºC for D5S818 of the Miniplex 2 set. At 60 ºC,
CSF1PO, D21S11, and FGA of the Big Mini set began to drop out. And at 65 ºC, all loci failed to amplify. For these primer sets, an annealing temperature of 55 ºC is recommended.
9.9. AmpliTaq Gold® Polymerase Titration
The amount of DNA polymerase added to each reaction affects the yield of PCR
products. Therefore, the effect of varying the Taq polymerase concentration on the
amplification efficiency of the reaction was studied. Titrations of AmpliTaq Gold DNA
polymerase from 1-5 Units/25 µL were tested with 100 pg/25 µL of DNA template for
Miniplex 2 (Figure 9-13), Miniplex 4, and Big Mini (n=3). Based from these results, 1 U of enzyme per 25 µL is enough to successfully amplify 100 pg/25 µL of DNA at 33
cycles. However, better peak balance was achieved at 2 U of enzyme. Higher 149
Figure 9-12. Effect of the variation in annealing temperature for Miniplex 2, Miniplex 4 and Big Mini. 100 pg/25 µL of DNA template amplified at 33 cycles using different annealing temperatures. The D5S818 began to dropout at 58ºC followed by CSF1PO, FGA, and D21S11 at 60ºC. At 65ºC, no amplifications are seen for all loci. 150
Figure 9-13. Miniplex 2 titration of AmpliTaq Gold® DNA polymerase. 100 pg/25 µL of DNA template was amplified at 33 cycles and titrated with varying enzyme concentrations. Enzyme concentration per 25 µL is as follows: Panel A: 1 Unit, Panel B: 2 Units, Panel C: 3 Units, Panel D: 4 Units, and Panel 5 Units. (Courtesy of Kerry Opel, Ohio University)
151 concentrations of enzyme do not seem to have much of an effect on the yield of PCR products. A default enzyme concentration of 2 U/25 µL is currently used.
9.10. Environmental Studies
DNA samples recovered from forensic situations have usually been exposed to a
variety of conditions. Environmental conditions have actually more influence on DNA
preservation than does time. Depending on which condition the samples are exposed to,
the template can fail to amplify due to DNA degradation or PCR inhibition. In the
previous chapter, the effects of DNA degradation on the amplification efficiency of the
Miniplex primer sets were assessed. In the next chapter, the results of the Miniplex
primer sets on bone samples that have been exposed to a variety of environmental insults
will be discussed. However, for validation purposes, DNA degradation was simulated to
make the conditions more controlled.
Five to six drops of fresh blood without EDTA was spotted on an unbleached
white cotton cloth. Thirty-six swatches were made and allowed to air dry at room
temperature overnight. Five spots were then extracted the following day using the
phenol/chloroform method to serve as the control sample. The swatches were then stored
at -20ºC, 4ºC, room temperature, and 50ºC for periods of 3, 7, 14, 28, 56, and 84 days.
One set of swatches were exposed to randomly fluctuating temperatures for the same
periods of time. Another set of swatches were exposed to a UV plant “gro” light for 8
hours a day to simulate sunlight and were also sampled under the same time periods as
mentioned above. No allele drop out was observed for any of the samples tested.
152
9.11. Matrix Studies
The substrates on which forensic samples are in contact with can affect the quality of the DNA template. The substrate can enhance DNA degradation or possibly can contain PCR inhibitors that can be co-extracted with the DNA template. For instance, pigments and dyes which inhibit the PCR reaction can be co-extracted from denim and leather49,104.
For this study, DNA from fresh blood stains were deposited on a variety of
substrates and extracted using the phenol/chloroform method. The following substrates
were used: white cotton (control), white paper, blue denim, black leather shoe, rusted
wrench, clean metal hammer, rubber hammer, leaf, and pine wood. The stains were
allowed to dry for one week at room temperature prior to extraction. After eight weeks of
storage at room temperature, the stains were sampled again.
Based on the results of this study, no significant decreases in signal intensity for
all extracts except those from white paper after 8 weeks of storage at room temperature
were observed. The decrease in the signal intensity of amplicons from white paper after
eight weeks of storage in room temperature could be attributed to the presence of bleach.
9.12. Mixture Studies
Many casework samples contain DNA from more than one contributor. Thus, the capability of STR multiplex sets to distinguish between major and minor components of the sample becomes important. In situations where contributors share common alleles, the genotypes may not easily be decipherable. The analysis of peak ratios becomes an important tool to determine the amount of DNA originating from the major or minor contributor. For this study, mixtures of DNA samples in defined ratios were examined 153 while keeping the template concentration constant at 100 pg/25 µL. Pairs of DNA samples were mixed in the following ratio: 1:19, 1:9, 1:4, 1:3, 1:2, and 1:1 (Figure 9-14).
The average peak heights of the minor and major alleles were used to calculate the ratio
of the minor to major component for each locus. The average peak height ratio was
calculated as the intensity of the minor allele divided by the intensity of the major allele
in relative fluorescence units (RFU). For each locus, only samples which are both
homozygotes and both heterozygotes with alleles at least eight base pairs apart were used.
Because of the possible existence of stutter peaks, alleles that are four base pairs apart
can complicate mixture analysis. The presence of these artifacts in the amplification
process makes it impossible to distinguish if the peak is a stutter artifact or an actual
allele from the minor component of the sample.
Results from this study show that at a 1:19 ratio the minor components of the
D5S818, vWA, D18S51, D13S317, CSF1PO, and FGA loci start to become detectable.
When the minor component is present at 10% (1:9 ratio) of the total quantity of DNA
template, all Miniplex loci are detectable. Results for all loci also show that the relative
peak height ratio for the minor component increases as the proportion of minor
components increase in the sample. For the vWA, CSF1PO, and FGA loci, the ratio of
the minor component alleles to the major component alleles quantitatively reflected the
ratio of input DNA. For the D5S818 loci, the ratio of the minor components below a 1:1
ratio was greater than expected. For the D8S1179, D16S539, and D13S317 loci, the ratio
of minor to major component quantitatively reflected the ratio of input DNA when the
mixture ratio was at least 1:4. The D18S51 and TPOX loci quantitatively reflects the ratio
of input DNA except at the mixture ratio of 1:3 and 1:2, respectively, in which the 154 resulting peak ratio was greater than expected. For the TH01, D21S11, and D7S820 loci, a mixture ratio of 1:9 gave peak ratios that are lower than the expected 10%. TH01 gave peak ratios higher than expected for a 1:4 and 1:3 mixture ratio; D21S11 gave peak ratios higher than expected for a 1:4, 1:3, and 1:2 mixture ratio; and D7S820 gave peak ratios higher than expected for a 1:2 mixture ratio. These mixture studies indicate that it is possible to distinguish a mixture depending on the ratio of genomic DNA and combination of alleles present despite the low concentration of 100 pg/25 µL of input
DNA template.
9.13. Stutter Peaks
The PCR amplification of STR alleles often produces stutter products. Stutter peaks are usually four base pairs smaller than the main product peak. The presence of stutter products can complicate mixture analysis. Because these products usually have the same size as allele bands, it can be difficult to identify a peak as an allele from a minor contributor or as a stutter product. Each STR locus in these three Miniplexes was evaluated for stutter. Stutter was determined only for alleles that differed by at least eight base pairs. Stutter percentage was calculated by dividing the peak height of the stutter peak by the peak height of its corresponding allele multiplied by 100 (Figure 9-15).
Stutter percentages from off-scale peaks were excluded because the height of the actual allele is underestimated and this causes the stutter percentage to be artificially high.
Based from the results, the TH01 and TPOX loci were found to have the lowest stutter percentage. Average stutter also increases as the alleles for a particular locus becomes larger (Figure 9-16). 155
Figure 9-14. Mixture study of the Miniplex primer sets. Two DNA samples were mixed at different ratios while keeping the template concentration constant at 100 pg/25 µL. At a 1:19 ratio, the minor components of the D5S818 loci, vWA, D18S51, D13S317, CSF1PO, and FGA start to become detectable. All Miniplex loci are detectable when the minor component is present at a 1:9 ratio. 156
10 9 8 7 6 5 4 3 2
Average % Stutter 1 0
) 3) ) ) 9) 20) 76 61) 3 42) 36) 33 = = = n= = n = = = =21) (n ( (n (n=50)(n=63 (n 17 A ( 9 A 51 G OX 17 S S3 F P 1 S539 3 TH01 (n T 6 vW D21S11 (n D7S820D5S818 (n (n D18 D1 CSF1PO (n=19) D8S D1 Locus (sample size)
Figure 9-15. Average stutter calculated for each locus of the Miniplex 2, Miniplex 4, and Big Mini multiplex set. The sample size (n) indicates the number of samples used to calculate stutter for each locus. A 95% confidence interval was used to calculate the error bars.
157
Figure 9-16A. Stutter percentage for the alleles of the Miniplex 2 and Miniplex 4 loci. Average stutter increases for the larger alleles of a locus.
158
Figure 9-16B. Stutter percentage for the alleles of the Big Mini loci. Average stutter increases for the larger alleles of a locus.
159
9.14. Non-Human Studies
To ensure that the Miniplex primer sets demonstrate specificity for humans, a variety of animal and bacterial species were examined. DNA from chimpanzee, dog, cat, pig, mouse, rat, chicken, E. coli, S. aureus, E. faecalis, and P. aeruginosa were amplified
with the Miniplex 2, Miniplex 4, and Big Mini primer set. Amplifications for all loci
were seen with the chimpanzee sample at 1 ng/25 µL of template. At 250 pg/25 µL of
DNA from the chimpanzee, amplification was not seen with the Big Mini loci. Other
STR systems have also reported amplification products for this primate23,134. Peaks were seen at D16S539 and D13S317 when the mouse sample was amplified with Miniplex 2 and Miniplex 4 at high DNA concentrations (Figure 9-17). The amplification products from the mouse sample at the D16S539 locus of Miniplex 2 were larger than the allele size range for this locus. However, non-specific binding was observed at a DNA concentration of 10 ng/25 µL for the D13S317 locus in Miniplex 4. At 1 ng/25 µL, an amplification product that resembles allele 9 of the D13S317 locus was still visible. No amplifications for all loci were seen with the other samples.
9.15. Preferential and Differential Amplification
Differential amplification is defined as the difference in the amplification efficiency between loci in the multiplex set while preferential amplification is defined as the difference in amplification efficiency between alleles of the same locus. Differential amplification for the Miniplex primer sets has been observed when analyzing degraded
DNA samples. In these situations, a decay curve is seen where the larger sized loci loose peak intensity as allele size increases91. This effect was also seen when amplifying bone 160
Figure 9-17. Mouse DNA sample amplified with Miniplex 2 and Miniplex 4. Amplification products from Miniplex 2 are larger than the allele size range for the D16S539 locus. Non-specific binding was observed at D13S317 locus of Miniplex 4 at high DNA concentrations. At 1 ng/ 25 µL of DNA, an amplification product that resembles allele 9 of the D13S317 locus was still visible. 161 samples obtained from different environmental conditions. Profiles for the larger sized loci of the Big Mini set (FGA, D21S11, and D7S820) could not be obtained due to severe
DNA degradation. In the case of PCR inhibition, a different mechanism for differential amplification was observed. The decrease in peak intensity pattern was not the same as that seen with degraded DNA. With inhibited samples, no correlation was seen between the amplicon size and the degree of PCR inhibition. This observation could be due to stronger primer binding for some loci as this phenomena was also observed when the annealing temperature was increased. Problems of preferential amplification due to stochastic fluctuations are common when amplifying low copy number DNA. When the concentration of DNA template amplified is below 100 pg/25 µL, peak imbalance is observed for most of the Miniplex loci. Preferential amplification due to significant differences in base pair size was not observed since most of the Miniplex loci have small size ranges. However, in situations where the sample is degraded and has large differences in allele size, preferential amplification of the smaller allele can be observed.
9.16. Problems with Dye Blobs
Problems with residual dye molecules or “dye blobs” are often encountered when the PCR product size is less than 150 base pairs. These residual dye molecules usually result from improper attachment of the dye molecule during the oligonucleotide synthesis process60. These free dye molecules give rise to peaks that are wider and less intense than true alleles. An analyst can usually distinguish between a true allele and a dye blob artifact by morphology of the peak. They can also be recognized because these dye blobs can migrate through the capillary slightly differently depending on the electrophoretic 162 conditions60. However, when the DNA sample is degraded and lower amounts are tested,
the intensity ratio of the residual dye blob to the amplicon may increase because there is
less amplification occurring. These situations may affect data interpretation. Figure 9-18
shows the results from a Big Mini amplification. The dye blobs appear in each of the
three different dye lanes. Dye blobs can be removed by using a Gel Filtration Cartridge
spin column from Edge Biosystems (Gaithersburg, MD), which adds an extra step and
more cost to the genotyping process. The procedure can be found in Appendix I.
The presence of residual dye molecules does not always interfere with the genotyping process and usually an additional clean-up step using the column can be omitted. However, when the dye blob impacts the true alleles of the sample such as the large blob at the D21S11 locus that interferes with allele 34, using the spin column may be necessary for correct genotype interpretation. These dye blob artifacts often affect Big
Mini amplifications and are usually not a problem with Miniplex 2 and Miniplex 4 amplifications.
9.17. Sizing Precision of GeneScan-500 ROX Size Standard
The sizing precision obtained using an internal lane standard is important for accurate genotyping. In addition, the presence of microvariant off-ladder alleles must be distinguished from true alleles. In this study, the sizing precision of the GS-500 ROX size standard was evaluated by comparing the sizing of alleles from 12 injections of the Big
Mini ladder. Allele sizing was performed with GeneScan® Software using the Global
Southern method of sizing. Because the alleles in the Miniplex primer sets are small, problems are encountered when the default Local Southern sizing method is used58. For 163
Figure 9-18. Dye blob artifacts encountered in Big Mini amplifications. These residual dye molecules are usually wider and less intense than the true alleles. However, sometimes they can interfere with correct genotype interpretation when it impacts the true alleles of the sample.
164 this study, the average allele size was plotted against the standard deviation for each allele. All alleles below 200 base pairs gave standard deviations of less than 0.1 base
pairs. Increased deviation was observed for the larger alleles (> 250 base pairs) of the
FGA locus (SD >0.1 bases) (Figure 9-19). The results confirm the precision of the GS-
500 ROX size standard in the sizing of possible off-ladder microvariants.
These validation studies have demonstrated the reliability, reproducibility, and
robustness of the Miniplex primer sets in analyzing DNA template concentrations as low
as 100 pg/25 µL using 33 amplification cycles. These studies also indicate that these
primer sets are accurate and reliable in genotyping DNA isolated from different matrices
and DNA exposed to different environmental conditions.
The sensitivity, peak balance, stutter, and mixture studies provided an experience
for the laboratory to assess samples when allele drop outs, heterozygote peak imbalances,
and low sensitivity of amplicons occur. These studies will provide a useful tool to avoid
problems in profile interpretation when complex forensic samples are analyzed.
As mentioned earlier, variations in signal intensity may be observed because of
the performance differences of different capillary electrophoresis instruments. However, when a laboratory is able to establish its own interpretation criteria, such as signal intensity threshold, acceptable peak balance ratio, stutter percentage, etc., these Miniplex primer sets can provide a powerful investigative tool for the analysis of degraded and compromised forensic samples. 165
0.25
0.2 FL 0.15 VIC NED 0.1 (bases)
0.05 Standard Deviation Standard 0 0 50 100 150 200 250 300 Size in Base Pairs
Figure 9-19. Sizing precision of GeneScan-500 ROX size standard. The average fragment size of each allele in the Big Mini ladder was plotted against the standard deviation obtained from 12 ladder injections.
166
Chapter 10. Application of Miniplex Primer Sets to Real Samples
The samples used in the DNA profiling of convicted offenders consist of blood or
saliva. These samples generate full profiles with the available commercial kits. However,
in situations in which the samples have been exposed to several environmental insults
prior to recovery, problems with DNA degradation and PCR inhibition are often
encountered. In these cases, human skeletal remains can be utilized to obtain the DNA
profiles when other samples fail. Sometimes soft tissue samples can be recovered but
these are usually lost through bacterial lysis and scavenger activity135. For these studies the Miniplex primer sets were applied in the DNA profiling of human skeletal remains.
DNA in compact bone is located in the osteocytes, which are present in 20,000- 26,000 copies per cubic millimeter of calcified bone matrix135. Thus bone tissue samples should contain sufficient amounts of DNA for analysis.
10.1. Effect of Environmental Factors on DNA Preservation
Degradation of human DNA is a natural process resulting from the exposure of the sample to different environmental insults. Some factors that may affect the rate of physical, chemical, and biochemical degradation of the DNA template include temperature, light, humidity, pH, soil composition, and degree of microbial infestation33,136.
DNA template is preserved at lower temperatures since the rate of chemical
reactions is slower and the degree of microbial infestation is reduced. Arid conditions
also favor DNA preservation. Under dry conditions hydrolytic and oxidative damage of
bases is reduced33. The degree of humidity positively correlates with the presence of organic substances in the soil. Humidity allows hard tissue samples to be penetrated by 167
organic substances such as humic and fulvic acids from the soil33. The presence of these organic substances can inhibit the PCR amplifications leading to lower genotyping success rates108. For DNA preservation, the pH of the soil should be neutral or slightly
alkaline. Under low pH conditions, the bioapatite in bones or teeth is degraded to brushite
which is soluble in acid media leading to decomposition of the sample137. The presence of microorganisms in the soil sample can also prevent DNA preservation. These microorganisms and their metabolites can destroy the DNA template completely33.
Although the factors leading to the preservation of the DNA template have been enumerated, the interplay of these different forces is usually unknown. Favorable conditions can slow down some physical and chemical processes to a certain extent.
However, reactions such as the oxidation of bases continue to occur over time33.
As the natural process of DNA degradation occurs, the amount and quality of template available for amplification is also affected. When the average DNA fragment length is reduced to sizes smaller than 300 base pairs, loss of genetic information due to the unavailability of intact DNA templates and failure of commonly used STR typing kits to generate profiles for the larger sized loci may occur136.
10.2. DNA profiling of Human Skeletal Remains
10.2.1. Sample Collection and Preparation
One tibia bone sample and twenty-four femur bone samples from twenty-five individuals were obtained from the Forensic Anthropology Center (FAC) at the
University of Tennessee in Knoxville. The materials sampled were part of the William
Bass Donated Skeleton Collection of remains that had been processed at the facility and
curated. The general outdoor environmental condition at the facility was an average 168
temperature of 16 °C and high humidity for the duration of the exposure. Burials were in clay soil at a depth of 60-120 cm. Prior to accession into the collection, the remains had been subjected to different environmental conditions, cleaned, and heated without chemicals (50 °C -60 °C) for 6-12 hours, and analyzed by the researchers at the facility.
The samples were stored at room temperature prior to sampling.
Six additional femur bone samples were obtained from the Franklin County
Coroner’s Office (FCCO) in Columbus, Ohio. These samples were donated to the Ohio
University Department of Anthropology and stored at 4 °C prior to cleaning and sampling.
Bone samples were first sanded, then brushed with 5% bleach solution and immediately rinsed with distilled water and with 95% ethanol. Bone powder was
1 5 generated by Black and Decker cordless drilling into the bone using drill bits ( /4”, /16”,
3 and /8”) designed for woodwork. The samples were collected on weighing paper and
stored frozen in 15 mL polypropylene tubes (VWR, West Chester, PA). Some samples
from the FCCO required minor soft tissue removal before sampling, and this was done
using sterile forceps and scalpel blades. The identification numbers and conditions for the bone samples obtained from the FAC in Tennessee and the Franklin County Coroner’s
Office are given in Tables 10-1 and 10-2, respectively.
10.2.2. DNA Quantification
The samples were quantified using real time PCR with the use of non-acetylated
BSA because a previous study with acetylated BSA failed. BSA is used as an additive to
PCR reactions because it is known to reverse inhibition108,114. Nine (36%) samples from 169
Table 10-1. Sample information and conditions of bone samples from the Forensic Anthropology Center, University of Tennessee, Knoxville. Also shown are the number of loci that gave profiles.
Sample Number Bone Condition Time Out Miniplex Loci Powerplex Loci D2003.5.1 femur surface, clothed 11 months 12 of 12 10 of 16 D2003.5.2 femur buried 35 months 10 of 12 5 of 16 D2003.5.3 femur buried 36 months 11 of 12 3 of 16 D2003.5.5 femur semi-buried/cleaned unknown 12 of 12 7 of 16 D2003.5.6 femur surface 3 years 12 of 12 16 of 16 D2003.5.7 tibia surface 3 years 12 of 12 16 of 16 D2003.5.8 femur surface 3 years 11 of 12 7 of 16 D2003.5.14 femur surface/preservative 12-18 months 4 of 12 2 of 16 D2003.5.15 femur surface 12-18 months 12 of 12 11 of 16 D2003.5.16 femur surface 12-18 months 12 of 12 15 of 16 D2003.5.17 femur buried 12-18 months 12 of 12 12 of 16 D2003.5.18 femur buried 12-18 months 9 of 12 2 of 16 D2003.5.19 femur buried in compost 12-18 months 12 of 12 16 of 16 D2003.5.20 femur surface 12-18 months 11 of 12 12 of 16 D2003.5.21 femur buried/preservative 12-18 months 11 of 12 2 of 16 D2003.5.22 femur surface/clothing 12-18 months 11 of 12 9 of 16 D2003.5.23 femur surface/clothing 12-18 months 12 of 12 6 of 16 D2003.5.24 femur surface/clothing 12-18 months 12 of 12 9 of 16 D2003.5.25 femur surface 12-18 months 11 of 12 3 of 16 D2003.5.26 femur surface/sun 12-18 months 11 of 12 12 of 16 D2003.5.27 femur surface/sun 12-18 months 12 of 12 7 of 16 D2003.5.28 femur surface 12-18 months 12 of 12 10 of 16 D2003.5.29 femur surface 12-18 months 9 of 12 8 of 16 D2003.5.30 femur surface 12-18 months 12 of 12 15 of 16 D2003.5.31 femur surface 12-18 months 7 of 12 4 of 16
170
Table 10-2. Sample information and condition of bone samples from the Franklin County Coroner’s Office, Columbus, Ohio. Also shown are the number of loci that gave profiles.
Sample Number Bone Condition Years in Storage Miniplex Loci Powerplex Loci D2003.6.1 Femur cold storage 5 12 of 12 7 of 16 D2003.6.2 Femur cold storage 11 12 of 12 16 of 16 D2003.6.3 Femur cold storage 6 12 of 12 9 of 16 D2003.6.4 Femur cold storage 14 12 of 12 10 of16 D2003.6.5 Femur cold storage 5 12 of 12 16 of 16 D2003.6.6 Femur cold storage 10 12 of 12 13 of 16 171 the FAC and one sample from the FCCO yielded low amounts of DNA template (less than 10 pg/µL). The conditions of these samples included burials (n = 2), semi-burial
(n = 1), burial with preservative (n = 1), surface (n = 3), surface with clothing (n = 1), surface with preservative (n = 1), and cold storage (n = 1). Unfortunately, the number of samples was not sufficient to make any inference about the rate of DNA degradation at different conditions.
10.2.3. Test for PCR Inhibition
Samples containing 250 pg of DNA were amplified with Miniplex 2, Miniplex 4 and Big Mini, and samples with 500 pg of DNA were amplified with the PowerPlex® 16
multiplex in a total reaction volume of 12.5 µL using 33 amplification cycles. The bone samples were first amplified using Miniplex 2 without adding BSA to test for presence of
PCR inhibitors. Among the 25 bone samples from the FAC, only 9 (36%) samples were successfully amplified. The 16 (64%) samples that failed to amplify were the same samples that failed to yield results in the real-time PCR system when acetylated BSA was used. The conditions of the 16 samples that failed to amplify without BSA were: burials
(n = 2), burial with preservative (n = 1), semi-burial (n = 1), surface (n = 7), surface with clothing (n = 4), and surface with preservative (n = 1). These samples probably contained one or more of the PCR inhibitors that are known to be present in the soil (i.e. Ca2+ and humic acid) and the human body (i.e. melanin and collagen). All 6 samples from the
FCCO were successfully amplified with Miniplex 2 even without added BSA.
The bone samples were then re-amplified with 0.5 µg BSA added to the Miniplex
2 primer mixture. Amplifications with Miniplex 4, Big Mini, and PowerPlex® 16 primers 172 were also performed with BSA in the PCR mixture. Despite the fact that the PowerPlex®
16 reaction buffer already contains 1.6 mg/mL of BSA, 0.5 µg BSA was still added to
12.5 µL of the PCR mixture because it was observed that adding this amount of BSA improved amplification results. There were 4 samples (Sample #’s 5.14, 5.18, 5.21, 5.25) that failed to amplify due to the extremely low amount of DNA template available (1-5 pg/µL). These samples were concentrated approximately 10 times using the Microcon
YM-100 filters and amplified again. However, only partial profiles were obtained. The addition of 0.5 µg of BSA to 12.5 µL of the PCR mixture was sufficient to reverse the
PCR inhibition of the 16 samples that failed to amplify without BSA. PCR products were observed for all bone samples amplified with the Miniplex sets and the PowerPlex® 16 system. However, some samples only generated partial genetic profiles due to DNA degradation.
10.2.4. Test for DNA Degradation
The Miniplex primers were designed to make the amplified product size as short as possible because the chances of obtaining long amplicons are lower if the DNA template is degraded. Although most of the bone samples were able to produce full profiles for Miniplex 2 (81-134 bp), Miniplex 4 (88-193 bp), and the smaller loci of Big
Mini (55-129 bp) after the addition of 0.5 µg of BSA, ten of the samples yielded a partial
genetic profile for the larger loci of the Big Mini primer set (125-281 bp). Only three
samples yielded a full profile for the PowerPlex® 16 system (100-480 bp). With the signal intensity threshold set at 150 RFU, 13 out of the 25 samples from the FAC and 6 out of the 6 samples from the Franklin County Coroner’s Office yielded complete 173 profiles for all Miniplex loci. The conditions of the 13 samples that yielded complete profiles with the Miniplex primer sets were surface: 3 years (n = 2); surface: 12-18 months (n = 4); surface with clothing: 11 months (n=1); surface with clothing: 12-18 months (n=2); surface under sunlight: 12-18 months (n=1); burial: 12-18 months (n = 1); burial in compost: 12-18 months (n = 1); and semi-burial: unknown (n=1). Table 10-3 summarizes these results.
Among the samples from the FAC that yielded partial genetic profiles, ten samples failed to amplify at the larger 3 loci (FGA, D21S11, and D7S820) of the multiplex set. These 3 loci have a larger range of amplicon sizes compared to all other
Miniplex loci. This suggests that DNA degradation has occurred with these bone samples91. Although there were samples that yielded partial genetic profiles for the smaller sized CSF1PO loci of the Big Mini set, Miniplex 2, and Miniplex 4, these could be attributed to the extremely low amount of DNA template available even after concentration with the Microcon® filters. The amplification efficiency per locus relative to amplicon length is shown in Figure 10-1.
Amplification with the PowerPlex® 16 system further confirmed that degradation has occurred with these bone samples. Most of the samples yielded complete profiles for the D3S1358, TH01, D5S818, Amelogenin, and vWA loci (Figure 10-1). These loci have the smallest amplicon sizes in this multiplex kit. A sharp decrease in signal intensity and 174
Table 10-3. Summary of profiling results grouped by sample source. The percentage of samples that gave full and partial profiles for each multiplex set is shown.
Samples from the Forensic Anthropology Center Samples Full Primer Set tested Profile Partial Profile Miniplex 2 25 23 (92%) 2 (8%) Miniplex 4 25 22 (88%) 3 (12%) Big Mini 25 13 (52%) 12 (48%) Miniplex 1 22 (88%) 3 (12%) Miniplex 3 15 (60%) 10 (40%) PowerPlex 16 25 3 (12%) 22 (88%)
Samples from the Franklin County Coroner's Office Samples Full Primer Set tested Profile Partial Profile Miniplex 2 6 6 (100%) 0 Miniplex 4 6 6 (100%) 0 Big Mini 6 6 (100%) 0 Miniplex 1 6 (100%) 0 Miniplex 3 6 (100%) 0 ® PowerPlex 16 6 2 (33%) 4 (67%) 175
Figure 10-1. Amplicon size ranges of the PowerPlex 16 system and Miniplex primer sets showing percentages of amplification success per locus. A sharp decrease in the percentage of loci that yielded profiles can be seen with the larger amplicons of the PowerPlex® 16 system. The Miniplex primer sets gave higher success rates in amplifying degraded DNA samples due to the smaller PCR product size. (n = 31)
176 loss of larger size alleles was observed with the PowerPlex® 16 amplifications (Figure
10-1). The 3 samples (Sample #’s 5.6, 5.7, 5.19) from the FAC that yielded complete profiles with the PowerPlex® 16 system also yielded complete profiles with all the
Miniplex sets. There were also 5 samples amplified with the Big Mini set that indicated the possibility of allele drop out in one or two loci. This observation means that
one of the peaks is below the 150 RFU threshold. Because reference profiles for these
samples are not available, it was impossible to ascertain if the samples were actually
homozygotes or heterozygotes for that locus. As for the samples amplified with the
PowerPlex® 16 system, 50% had allele drop out at one or more of the larger sized loci.
The alleles that dropped out are the larger sized alleles of these loci. The Big Mini and
PowerPlex® 16 data suggest that the degradation of template fragments predominantly
occurs around 200 base pairs and is not kit-dependent.
Because of the low number of samples analyzed, an explicit conclusion as to
which conditions enhance or diminish the rate of degradation could not be made since
DNA degradation is a process that depends on a multitude of environmental conditions.
Although the conditions to which the samples were subjected to were controlled to some
extent, the interplay of different environmental factors could still vary from one sample to another. However, it was observed that the samples kept in cold storage for 5-14 years from the FCCO were less prone to degradation and PCR inhibition when compared to the samples from the FAC in Tennessee. The lack of knowledge of the conditions prior to refrigeration prevents formulation of a correlation between the environmental condition and degree of degradation for these samples. It is anticipated that given better control of 177 experimental conditions, a relationship between the environmental condition and the rate of DNA degradation may be more evident.
10.3. Case Report
Two bone samples from which complete profiles from standard kits were unavailable were re-tested with the Miniplex primer sets. The first sample was from a human body that decomposed at high temperatures in a closed environment for more than a month. The second bone sample was from a set of remains that was discovered near a stream and was believed to have been in water at some point. Complete profiles for all loci in Miniplex 2, Miniplex 4 and Big Mini were obtained for both samples at concentrations of 60 pg/25 µL (Figure 10-2). Higher concentrations were not tested due to the low amount of DNA available. Amplifications of the first bone sample with the
commercial multiplex kit resulted in a partial genetic profile (Figure 10-2). For the
second bone sample, the results from the commercial kit were inconclusive because the
peak height for the larger sized amplicons was below our detection threshold of 150
RFU. In contrast, the Miniplex sets were able to give typable results for these larger sized
amplicons. 178
Figure 10-2. Bone sample with 60 pg/25 µL of DNA amplified with Miniplex 2 and Miniplex 4 at 33 cycles. Bone sample was from a human body that decomposed at high temperatures in a closed environment for more than a month. The Miniplex 2 and Miniplex 4 sets were able to give typable results at this concentration. 179
Figure 10-2 (continued). Bone sample with 60 pg/25 µL of DNA amplified with Big Mini and PowerPlex® 16 at 33 cycles. Typing by PowerPlex® 16 resulted in a partial genetic profile at this template concentration. The Big Mini set was able to give typable results at this concentration. Off-ladder (OL) allele is a current spike. 180
Conclusions
The redesigned STR primer sets, Miniplex 2, Miniplex 4, and Big Mini, in which amplicon size is kept at a minimum, provide an effective tool for the analysis of degraded
DNA samples. The use of primers generating shorter amplicon sizes improves genotyping success when the target DNA is highly fragmented due to degradation. When amplifications with enzymatically degraded DNA were compared to commercial kits, the improvement in amplification efficiency of the smaller sized fragments was clearly evident. The Miniplex primer sets were also able to give more complete profiles for the bone samples that had been exposed to different environmental conditions from the FAC in Tennessee and FCCO in Ohio. This improvement was further confirmed by using the
Miniplex primer sets to generate complete profiles for actual casework samples that yielded partial genetic profiles using commercial kits.
Comparison studies in over 532 samples with different origin have verified that these primer sets can provide results that are 97% concordant with commercial STR kits.
A new four base pair TATC deletion 24 bases downstream of the core D13S317 repeat and an eight base pair CCATCCAT deletion 10 bases downstream of the core vWA repeat have been found in these studies. Because no primer set is immune to the existence of polymorphisms, the difference in primer sequences between the Miniplex sets and commercial STR sets can serve as a way to check for the presence of possible primer binding site mutations and insertions or deletions in the flanking sequences.
The preliminary findings on PCR inhibitors show that the strength of primer- template binding affects the degree of PCR inhibition. These findings that the sequence 181 of primers affects the degree of PCR inhibition can serve as a cautionary measure in the design of primers for future purposes. These studies further confirmed that the use of
BSA as an additive to the PCR reaction mixture provides a convenient way for relieving the common PCR inhibitors: hematin, indigo, melanin and humic acid. Because traces of these inhibitors could still be present after rigorous extraction and purification procedures of the DNA template, the addition of BSA as a regular component of the Miniplex PCR mixture can help save time and effort when amplifying real casework samples.
The application of LMT agarose prior to PCR amplification of samples has also been extended to clean-up more PCR inhibitors. However, this method entails the use of an additional step prior to PCR and can only be used for samples where sufficient amounts of DNA template are available. Studies have also verified that the kind of LMT agarose can affect the amount of template recovery.
The robustness, reliability, and reproducibility of Miniplex sets 2, 4, and Big Mini have been demonstrated for the analysis of low copy number samples. DNA template concentrations as low as 100 pg/25µL can be successfully amplified with high sensitivity and good peak balance ratio using 33 cycles. The validation studies have provided an experience for the laboratory to assess problems that may arise in the interpretation of data for complex forensic samples
In summary, these Miniplex primer sets can provide an alternative to standard
STR typing kits when allele drop out and low sensitivity of large amplicons becomes a problem due to DNA degradation, PCR inhibition, or primer binding site mutations. 182
Future Work
While the validation processes of these markers have been started, further tests are needed to examine their application to non-routine forensic samples such as hair, fingernail scrapings, and other low copy number DNA sources. Because the Miniplex primer sets have been shown to work well with degraded and low copy number samples, it is anticipated that using these primer sets for these samples would improve genotyping success rates.
Different DNA samples will also need to be sent to the various laboratories and be typed with these Miniplex primer sets and their commercial sets to verify consistency.
This study will give a chance to assess the reproducibility of the Miniplex primer sets between different laboratories. Non-probative evidence samples should also be tested with these kits to further demonstrate the capability of the Miniplex primer sets in handling real case work samples.
A population study on more Asian samples will need to be conducted because this population was missed in the initial concordance study. This concordance study will
provide a means to check for the possible presence of primer binding site mutations and
insertions or deletions in the Asian population.
An important issue that has surfaced from the above studies is that while the
amplification and quantitation results show that the DNA sample is degraded, a reliable
way to assess the status of the samples prior to amplification should performed. One
possibility is to perform real time PCR to check DNA concentrations at specific sizes.
Primers that produce amplicons of different sizes for the same locus can be used to 183 determine the amount of large and small fragments in degraded DNA samples. With this technique the quality of the recovered DNA template could be assessed, even at low copy number. These primers can be used to determine the quantity at each range of fragment size and the overall amount of degraded DNA in the sample.
A technique known as template reconstruction can also be applied by amplifying badly fragmented template in the absence of primers138. The fragments would anneal to each other and the sticky ends are extended by the polymerase. This technique will allow fragmented DNA templates to be reconnected and repaired. A second amplification is can then be performed with the Miniplex primers.
In addition, more bone samples under better controlled environmental conditions need to be studied to establish a stronger correlation between the quality and quantity of
DNA recovered to the environmental condition. Samples under various controlled environmental conditions for set periods of time will be compared with control samples stored in a freezer. The conditions to be studied will include placement on open ground, placement under shade, burial in soil, and in water. Yield gels, microfluidic capillary electrophoresis and real-time PCR with template size specific PCR primers can be used to assess the quality and quantity of the template.
Lastly, other analytical techniques to better characterize DNA extracts and further
understand the mechanism of PCR inhibition have to be explored. It is important to detect
and quantify PCR inhibitors present in actual environmental samples. To perform this
task, a variety of analytical techniques can be used to characterize extracted DNA
samples. Ion chromatography can be used to examine small inhibiting calcium ions 184 present in bone samples139, capillary electrophoresis for the detection of organic acids, humic acids and hydrophilic proteins140, and electrospray mass spectrometry for the further investigation of biopolymers and humic substances in the DNA extracts141.
Kinetic analysis of PCR inhibitors may also be useful to characterize the mechanism of inhibition. The results obtained from these studies will provide a better understanding of the processes behind PCR inhibition and to allow the forensic community to develop better tools for their removal. 185
References:
1. Kirby, L.T. DNA Fingerprinting; Stockton Press: New York, NY, 1990.
2. Inman, K.; Rudin, N. An Introduction to Forensic DNA Analysis; CRC Press LLC: Boca Raton, FL, 1997.
3. Butler, J.M. Forensic DNA Typing; Academic Press: San Diego, CA, 2001.
4. Budowle, B. History and future of DNA typing. Proceedings from the 11th International Symposium on Human Identification; 2000 Oct 8-13; Biloxi, MS.
5. Mullis, K; Faloona, Fred A. Specific Synthesis of DNA in Vitro via a Polymerase- Catalyzed Chain Reaction. In Methods in Enzymology; Wu, R., Ed. Academic Press: San Diego, CA, 1987; pp.335-350.
6. Kasai, K.; Nakamura, Y.; White, R. Amplification of a Variable Number of Tandem Repeats (VNTR) Locus (pMCT118) by the Polymerase Chain Reaction (PCR) and Its Application to Forensic Science. J. Forensic Sci. 1990, 35, 1196- 1200.
7. Wilson, M.R.; DiZinno, J.A.; Polansky, D.; Repogle, J.; Budowle, B. Validation of mitochondrial DNA sequencing for forensic casework analysis. Int. J. Legal Med. 1995, 108, 68-74.
8. Jobling, M.A.; Tyler-Smith, C. Fathers and sons: the Y chromosome and human evolution. Trends Genet. 1995, 11, 449-456.
9. Kayser, M.; Caglia, A.; Corach, D.; Fretwell, N.; Gehrig, C.; Graziosi, G.; Heidorn, F.; Herrman, S.; Herzog, B.; Hidding, M.; Honda, K.; Jobling, M.; Krawczak, M.; Leim, K.; Meuser, S.; Meyer, E.; Oesterreich, W.; Pandya, A.; Parson, G.; Penacino, G.; Perez-Lezaun, A.; Piccinini, A.; Prinz, M.; Schmitt, C.; Roewer, L. Evaluation of Y-chromosomal STRs: a multicenter study. Int. J. Legal Med. 1997, 110, 125-129.
10. Sinha, S.K.; Budowle, B.; Arcot, S.S. Richey, S.L.; Chakraborty, R.; Jones, M.D.; Wojtkiewicz, P.W.; Schoenbauer, D.A.; Gross, A.M.; Sinha, S.K., Shewale, J.G. Development and validation of a multiplexed Y-chromosome STR genotyping system, Y-Plex™ 6, for forensic casework. J. Forensic Sci. 2003, 48, 93-103.
11. Butler, J.M.; Schoske, R.; Vallone, P.M.; Kline, M.C.; Redd, A.J.; Hammer, M.F. A novel multiplex for simultaneous amplification of 20 Y chromosome STR markers. Forensic Sci. Int. 2002, 129, 10-24.
186
12. Lygo, J.E.; Johnson, P.E.; Holdaway, D.J.; Woodroffe, S.; Whitaker, J.P.; Clayton, T.M.; Kimpton, C.P.; Gill, P. The validation of short tandem repeat (STR) loci for use in forensic casework. Int. J. Leg. Med. 1994, 107, 77-89.
13. Edwards, A.; Civitello, A.; Hammond, H.A.; Caskey, C.T. DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am. J. Hum. Genet. 1991, 49, 746-56.
14. Hammond, H.A.; Jin, L.; Zhong, Y.; Caskey, C.T.; Chakraborty, R. Evaluation of 13 short tandem repeat loci for use in personal identification applications. Am. J. Hum. Genet. 1994, 55, 175-89.
15. Puers, C.; Hammond, H.A.; Jin, L.; Caskey, C.T.; Schumm, J.W. Identification of repeat sequence heterogeneity at the polymorphic short tandem repeat locus HUMTH01[AATG]n and reassignment of alleles in population analysis by using a locus-specific allelic ladder. Am. J. Hum. Genet. 1993, 53, 953-958.
16. Sajantila, A.; Puomilahti, S.; Johnsson, V.; Ehnholm, C. Amplification of reproducible allele markers for amplified fragment length polymorphism analysis. Biotechniques 1992, 12, 16-21.
17. Baechtel, F.S.; Smerick, J.B.; Presley, K.W.; Budowle. B. Multigenerational amplification of a reference ladder for alleles at locus D1S80. J. Forensic Sci. 1993, 38, 1176-82.
18. Bacher, B.; Helms, C.; Donis-Keller, H.; Hennes, L.; Nassif, N.; Schumm, J.W. Chromosome localization of CODIS loci and new pentanucleotide repeat loci. In Progress in Forensic Genetics 8; Sensabaugh, G.F.; Lincoln, P.J.; Olaisen, B., Eds.; Proceedings of the 18th International ISFH Congress; Elsevier: SanFrancisco, CA, 1999; pp 33-36.
19. Chakraborty, R.; Stivers, D.N.; Su, B.; Zhong, Y.; Budowle B. The utility of short tandem repeat loci beyond human identification: implications for development of new DNA typing systems. Electrophoresis 1999, 20, 1682-1696.
20. Urquhart, A.; Kimpton, C.P; Downes, T.J.; Gill, P. Variation in short tandem repeat sequences--a survey of twelve microsatellite loci for use as forensic identification markers. Int. J. Legal Med. 1994, 107, 13-20.
21. Wallin, J.M.; Holt, C.L.; Lazaruk, K.D.; Nguyen, T.H.; Walsh, P.S. Constructing universal multiplex PCR systems for comparative genotyping. J. Forensic Sci. 2002, 47, 52-65.
187
22. Oldroyd, N.; Urquhart, A.J.; Kimpton, C.P.; Millican, E.S.; Watson, S.K.; Downes, T.; Gill, P.D. A highly discriminating octoplex short tandem repeat polymerase chain reaction system suitable for human individual identification. Electrophoresis 1995, 16, 334-337.
23. Krenke, B.E.; Tereba, A.; Anderson, S.J.; Buel, E.; Culhane, S.; Finis, C.J.; Tomsey, C.S.; Zachetti, J.M.; Masibay, A.; Rabbach, D.R.; Amiott, E.A.; Sprecher, C.J. Validation of a 16-locus fluorescent multiplex system. J. Forensic Sci. 2002, 47, 773-785.
24. Collins, P.; Roby, R; Hennessy, L.; Leibelt, C.; Shadravan, F.; Bozzini, L.; Reeder, D. Validation of the AmpFlSTR™ Identifiler PCR amplification kit. Proceedings from the 11th International Symposium on Human Identification, Biloxi, MS, Oct 8-13, 2000. www.promega.com/geneticidproc/ussymp11proc/content/collins.pdf
25. STRBase Home Page. http://www.cstl.nist.gov/biotech/strbase (accessed March 2004)
26. Levedakou, E.N.; Freeman, D.A.; Budzynski, M.J.; Early, B.E.; Damaso, R.C.; Pollard, A.M.; Townley, A.J.; Gombos, J.L.; Lewis, J.L.; Kist, F.G.; Hockensmith, M.E.; et al. Characterization and validation studies of PowerPlex™ 2.1, a nine- locus short tandem repeat (STR) multiplex system and Penta D monoplex. J. Forensic Sci. 2002, 47, 1-16.
27. Bacher, J.; Schumm, J.W. Development of highly polymorphic pentanucleotide tandem repeat loci with low stutter. Profiles in DNA, 1998, 3-6.
28. Walsh, S.P.; Fildes, N.J.; Reynolds, R. Sequence analysis and characterization of stutter products at the tetranucleotide repeat locus vWA. Nucleic Acids Res. 1996, 24, 2807-2812.
29. Brownstein, M.J.; Carpten,J.D.; Smith, J.R. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques 1996, 20, 1004-1010.
30. Clayton, T.M.; Hill, S.M.; Denton, L.A.; Watson, S.K.; Urquhart, A.J. Primer binding site mutations affecting the typing of STR loci contained within the AmpFlSTR® SGM Plus kit™. Forensic Sci. Int. 2004, 139, 255-259.
31. Newton, C.R.; Graham, A.; Heptinstall, L.E.; Powell, S.J.; Summers, C.; Kalsheker, N.; Smith, J.C.; Markham, A.F. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res. 1989, 17, 2503-2516.
188
32. Bar, W.; Kratzer, A.; MAchler, M.; Schmid, W. PosTmortem stability of DNA. Forensic Sci. Int. 1988, 39, 59-70.
33. Burger, J.; Hummel, S.; Herrman, B.; Henke, W. DNA preservation: A microsatellite-DNA study on ancient skeletal remains. Electrophoresis 1999, 20, 1722-1728.
34. Lindahl, T. Instability and decay of the primary structure of DNA. Nature 1993, 362, 709-715.
35. Shepard, T.L.; Ordoukhanian, P.; Joyce, G.F. A DNA enzyme with N-glycosylase activity. Biochemistry 2000, 97, 7802-7807.
36. Lindahl, T.; Karlstrom, O. Heat-induced depyrimidination of deoxyribonucleic acid in neutral solution. Biochemistry 1973, 12, 5151-5154.
37. Griffiths, A.J.F.; Gelbart, W.M.; Lewontin, R.C.; Miller, J.H. Gene Mutation: Origins and Repair Processes. Modern Genetic Analysis, 2nd Edition; W.H. Freeman: New York, NY 2002; Chapter 10.
38. Sonntag, C. V. Polynucleotides and DNA. The Chemical Basis of Radiation Biology, Taylor & Francis, Inc. Philadelphia, PA 1987; Chapter 9.
39. Lindahl, T. The Croonian lecture, 1996: Endogenous damage to DNA. Phil. Trans. R. Soc. Lond. B 1996, 351, 1529-1538.
40. Holland, M.M; Cave, C.A.; Holland, C.A.; Bille, T.W. Development of a quality, high throughput DNA analysis procedure for skeletal samples to assist with the identification of victims from the world trade center attacks. Croat. Med. J. 2003, 44, 264-272.
41. Cattaneo, C.; Craig, O.E.; James, N.T.; Sokol, R.J. Comparison of three DNA extraction methods on bone and blood stains up to 43 years old and amplification of three different gene sequences. J. Forensic Sci. 1997, 42, 1126-1135.
42. Schmerer, W.M.; Hummel, S.; Herrmann, B. Optimized DNA extraction to improve reproducibility of short tandem repeat genotyping with highly degraded DNA as target. Electrophoresis 1999, 20, 1712-1716.
43. Gill, P. Application of low copy number DNA profiling. Croat. Med. J. 2001, 42, 229-232.
44. Hummel, S.; Schultes, T.; Bramanti, B.; Herrmann, B. Ancient DNA profiling by megaplex amplifications. Electrophoresis, 1999, 20, 1717-1721. 189
45. Alonso, A.; Andelinovic, S.; Martin, P.; Sutlovic, D.; Erceg, I.; Huffine, E.; de Simon, L.; Albarran, C.; Definis-Gojanovic, M.; Fernandez-Rodriguez, A.; Garcia, P.; Drmic, I.; Rezic, B.; Kuret, S.; Sancho, P.; Primorac, D. DNA typing from skeletal remains: evaluation of multiplex and megaplex STR systems on DNA isolated from bone and teeth samples. Croat. Med. J. 2001, 42, 260-266.
46. Takahashi, M.; Kato, Y.; Mukoyama, H.; Kanaya, H.; Kamiyama, S. Evaluation of five polymorphic microsatellite markers for typing DNA from decomposed human tissues - correlation between the size of the alleles and that of the template DNA. Forensic Sci. Int. 1997, 90, 1-9.
47. Whitaker, J.P.; Clayton, T.M.; Urquhart, A.J.; Millican, E.S.; Downes, T.J.; Kimpton, C.P.; Gill, P. Short tandem repeat typing of bodies from a mass disaster: high success rate and characteristic amplifications patterns in highly degraded samples. BioTechniques 1995, 18, 670-677.
48. Cotton, E.A.; Allsop, R.F.; Guest, J.L.; Frazier, R.R.; Koumi, P.; Callow, I.P.; Seager, A.; Sparkes, R.L. Validation of the AmpFlSTR® SGM Plus™ system for use in forensic casework. Forensic Sci. Int. 2000, 112, 151-161.
49. Wallin, J.M.; Buoncristiani, M.R.; Lazaruk, K.D.; Fildes, N.; Holt, C.L.; Walsh, P.S. TWGDAM validation of the AmpFlSTR™ Blue PCR amplification kit for forensic casework analysis. J. Forensic Sci. 1998, 43, 854-870.
50. Wilson, M.R.; Polansky, D.; Butler, J.; DiZinno, J.A.; Repogle, J.; Budowle, B. Extraction, amplification, and sequencing of mitovhondrial DNA from human hair shafts. BioTechniques 1995, 18, 662-669.
51. Robertson, J.M.; Walsh-Weller, J. An introduction to PCR primer design and optimization of amplification reactions. In Forensic DNA Profiling Protocols; Lincoln, P.J.; Thomson, J. Eds.; Humana Press Inc.: Totowa, NJ, 1998; Vol. 48, pp 193-208.
52. Wu, D.Y.; Ugozzolli, L.; Pal, B.K.; Qian, J.; Wallace, R.B. The effect of temperature and oligonucleotide primer length on the specificity and efficiency of amplification by the polymerase chain reaction. DNA Cell Biol. 1991, 10, 233-238.
53. Biosoft International. Primer Premier 5.0 Manual. Palo Alto, CA, 2000.
54. http://www.gensetoligos.com/Tech_Info/tech_info_melt_frame.html (accessed June 2004)
55. Promega Corporation. DNA Analysis Notebook. Part #BR129. Madison, WI, 2003. 190
56. Rychlik, W. Priming efficiency in PCR. BioTechniques 1995, 18, 84-89.
57. Breslauer, K.J.; Frank, R.; Blocker, H.; Marky, L.A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. 1986, 83, 3746-3750.
58. http://www.ncbi.nlm.nih.gov (accessed June 2004)
59. Schoske, R.; Vallone, P.M.; Ruitberg, C.M.; Butler, J.M. Multiplex PCR design strategy used for the simultaneous amplification of 10 Y chromosome short tandem repeat (STR) loci. Anal. Bioanal. Chem. 2003, 375, 333-343.
60. Butler, J.M.; Shen, Y.; McCord, B.R. The development of reduced size STR amplicons as tools for analysis of degraded DNA. J. Forensic Sci. 2003, 48, 1-11.
61. Hellman, A.; Rohleder, U.; Schmitter, H.; Wittig, M. STR typing of human telogen hairs- a new approach. Int. J. Legal Med. 2001, 114, 269-273.
62. Ricci, U.; Giovannucci Uzielli, M.L.; Klintschar, M. Modified primers for D12S391 and a modified silver staining technique. Int. J. Legal Med. 1999, 112, 342-344.
63. Wiegand, P.; Kleiber, M. Less is more- length reduction of STR amplicons using redesigned primers. Int. J. Legal Med. 2001, 114, 285-287.
64. Yoshida, K.; Sekiguchi, K.; Kasai, K.; Sato, H.; Seta, S.; Sensabaugh, G.F. Evaluation of new primers for CSF1PO. Int. J. Legal Med. 1997, 110, 36-38.
65. Rozen, S.; Skaletsky, H.J. Primer3 (primer 3_www.cgi v 0.2); 1998. http://www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi
66. Butler, J.M.; Li, J.; Monforte, J.A.; Becker, C.H. inventors. Genetrace Systems, Inc., assignee. DNA typing by mass spectrometry with polymorphic DNA repeat markers. US patent 6,090,558. July 18, 2000.
67. Butler, J.M.; Becker, C.H. Improved analysis of DNA short tandem repeats with time-of-flight mass spectrometry. Report No.:NCJ 188292. National Institute of Justice: Washington (DC), 2001.
68. Han, G.R.; Song, E.S.; Hwang, J.J. Non-amplification of an allele of the D8S1179 locus due to a point mutation. Int. J. Legal Med. 2001, 115, 45-47.
191
69. Alves, C.; Amorin, A.; Gusmao, L.; Pereira, L. VWA STR genotyping: further inconsistencies between Perkin-Elmer and Promega kits. Int. J. Legal Med. 2001, 115, 97-99.
70. Qiagen Inc. QIAamp DNA Mini Kit and QIAamp DNA Blood Mini Kit Handbook. Valencia, CA, 2001.
71. Qiagen Inc. QIAquick Spin Handbook. Valencia, CA, 2001.
72. Sambrook J, Fritch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, 1989.
73. Mitochondrial DNA Sequencing Protocol; Federal Bureau of Investigation: Quantico, VA, 1998.
74. Kirby, K.S. A new method for the isolation of deoxyribonucleic acids; evidence on the nature of bonds between deoxyribonucleic acid and protein. Biochem J. 1957, 66, 495-504.
75. WhaTman Bioscience Inc. FTA® Protocols. Princeton, NJ, 2002.
76. Morton, K.A.; Loockerman, D.; Buckner, R.M.; Chavana, A. A simple heat elution of human genomic DNA from FTA™- treated paper using water. Presented at the 11th International Symposium on Human Identification, Biloxi, MS, 2001.
77. Walsh, P.S.; Varlaro, J.; Reynolds, R. A rapid chemiluminescent method for quantitation of human DNA. Nucleic Acids Res. 1994, 20, 5061-5065.
78. Roche Molecular Systems. Quantiblot® Human DNA Quantitation Kit. Package Insert. Part No. N808-0114; Foster City, CA, 2000, Applied Biosystems.
79. http://www.stjohnassociates.com/literature/lumi-tec_flyer.pdf (accessed April 2004)
80. Prinz, M.; Caragine, T.; Kamnick, C.; Cheswick, D.; Shaler, R. Challenges posed when processing compromised samples. Proceedings from the 13th International Symposium on Human Identification, Phoenix, AZ, Oct 7-10, 2002.
81. Nicklas, J.A.; Buel, E. Development of an Alu-based, real-time PCR method for quantitation of human DNA in forensic samples. J. Forensic Sci. 2003, 48, 936- 944.
82. Mighell, A.J.; Markham, A.F.; Robinson, P.A. Alu Sequences. FEBS Lett. 1997, 417, 1-5. 192
83. Batzer, M.A.; Alegria-HarTman, M.; Deininger, P.L. A consensus Alu repeat probe for physical mapping. Genet. Anal. Tech. Appl. 1994, 11, 34-38.
84. Corbett Research Inc. Rotor-Gene 3000 Real-Time Amplification Operator’s Manual version 4.6. Hayward, CA.
85. Promega Corporation. GenePrint® PowerPlex™ 16 System Technical Manual, Part # TMD012 (4/00). Madison, WI 2000,www.promega.com/tbs/TMD012/TMD012.html.
86. Promega Corporation. GenePrint® Fluorescent STR Systems Technical Manual, Part # TMD0006 (11/99). Madison, WI 2000, www.promega.com/tbs/TMD006/TMD006.html.
87. Wenz, H.M.; Robertson, J.M., Menchen, S.; Oaks, F., Demorest, D.M.; Scheibler, D.; Rosenblum, B.B.; Wike, C.; Gilbert, D.A.; Efcavitch, J.W. High-precision genotyping by denaturing capillary electrophoresis. Genome Res. 1998, 8, 69-80.
88. Watts, D. Genotyping STR Loci using an automated DNA Sequencer. In Forensic DNA Profiling Protocols; Lincoln, P.J.; Thomson, J. Eds.; Humana Press Inc.: Totowa, NJ, 1998; Vol. 48, pp 193-208.
89. Southern, E.M. Measurement of DNA length by gel electrophoresis. Anal. Biochem. 1979, 100, 319-323.
90. Hartzell, B.; Muncy, K., McCord, B. Response of short tandem repeat systems to temperature and sizing methods. Forensic Sci. Int. 2003, 133, 228-234.
91. Chung, D.T.; Drabek, J.; Opel, K.L.; Butler, J.M.; McCord, B.M. A study on the effects of degradation and template concentration on the amplification efficiency of the STR Miniplex primer sets. J. Forensic Sci. 2004, 49, 733-740.
92. Bennett, P. Demystified…Microsatellites. J. Clin. Pathol. 2000, 53, 177-183.
93. Drabek, J.; Chung, D.T.; Butler, J.M.; McCord, B.R. Concordance Study Between Miniplex Assays and a Commercial STR Typing Kit. J. Forensic Sci. 2004, 49, 859-860.
94. Boutrand, L.; Egyed, B.; Furedi, S.; Mommers, N.; Mertens, G.; Vandenberghe, A. Variations in primer sequences are the origin of allele drop out at loci D13S317 and CD4. Int. J. Legal Med. 2001, 114, 295-297.
193
95. Lazaruk,K.; Wallin, J.; Holt, C.; Nguyen, T.; Walsh, P.S. Sequence variation in humans and other primates at six short tandem repeat loci used in forensic identity testing. Forensic Sci. Int. 2001, 119, 1-10.
96. Alves, C.; Gusmao, L.; Pereira, L.; Amorim, A. Multiplex STR genotyping: comparison study, population data and new sequence information. Poster P24 at 19th International Congress of the International Society for Forensic Genetics, Munster, Germany, August 2001.
97. Wilson, I.G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 1997, 63, 3741-3751.
98. Chen, Z.; Swisshelm, K.; Sager, R. A cautionary note on reaction tubes for differential display and cDNA amplification in thermal cycling. Biotechniques 1994, 16, 1002-1006.
99. Hughes, M.S.; Beck, L.A.; Skuce, R.A. Identification and elimination of DNA sequences in Taq DNA polymerase. J. Clin. Microbiol. 1994, 32, 2007-2008.
100. Tyler, K.D.; Wang, G.; Tyler, S.D.; Johnson, A.W. Factors affecting reliability and reproducibility of amplification-based DNA fingerprinting of representative bacterial pathogens. J. Clin. Microbiol. 1997, 35, 339-346.
101. De Lomas, J.G.; Sunzeri, F.J.; Busch, M.P. False-negative results by polymerase chain reaction due to contamination by glove powder. Transfusion 1992, 32, 83-85.
102. St. Pierre, B.S.; Neustock, P.; Schramm, U.; Wilhelm, D.; Kirchner, H.; Bein, G. Seasonal breakdown of polymerase chain reaction. Lancet 1994, 343, 673.
103. Akane, A.; Matsubara, K.; Nakamura, H.; Takahashi, S.; Kimura, K. Identification of a heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J. Forensic Sci. 1994, 34(2), 362-372.
104. Larkin, A., Harbison, S.A. An improved method for STR analysis of bloodstained denim. Int. J. Legal. Med. 1999, 112:388-390.
105. Giambernardi, T.A.; Rodeck, U.; Klebe, R.J. Bovine serum albumin reverses inhibition of RT-PCR by melanin. Biotechniques 1998, 25, 564-566.
106. Eckhart, L.; Bach, J.; Ban, J.; Tschachler, E. Melanin binds reversibly to thermostable DNA polymerase and inhibits its activity. Biochem. Biophys. Res. Commun. 2000, 271,726-730.
194
107. Yoshii, T.; Tamura, K.; Taniguchi, T.; Akiyama, K.; Ishiyama, I.. Water-soluble eumelanin as a PCR-inhibitor and a simple method for its removal. Nippon Hoigaku Zasshi 1993, 47(4):323-329.
108. Kreader, C.A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 1996, 62, 1102-1106.
109. Scholz, M., Giddings, I.; Pusch, C.M. A polymerase chain reaction inhibitor of ancient hard and soft tissue DNA extracts is determined as human collagen type I. Anal. Biochem. 1998, 259, 283-286.
110. Bickley, J.; Short, J.K.; D. McDowell, G.; Parkes, H.C. Polymerase chain reaction (PCR) detection of Listeria monocytogenes in diluted milk and reversal of PCR inhibiton caused by calcium ions. Lett. Appl. Microbiol. 1996, 22, 153-158.
111. Ahokas, H.; Erkkila, M.J. Interference of PCR amplification by polyamines, spermine and spermidine. PCR Methods Appl. 1993, 3, 65-68.
112. Young, C.; Burghoff, R.L.; Kein, L.G.; Minak-Bernero, V.; Lute, J.R.; Hinton, S.M. Polyvinylpyrrolidone-agarose gel electrophoresis purification of polymerase chain reaction-amplifiable DNA from soils. Appl. Environ. Microbiol. 1993, 59, 1972-1974.
113. Saulnier, P.; Andremont, A. Detection of genes in feces by booster polymerase chain reaction. J. Clin. Microbiol. 1992, 30, 2080-2083.
114. Millipore Website. http://www.millipore.com (accessed June 2004)
115. Yang, D.Y.; Eng, B.; Dudar, J.C.; Saunders, S.R.; Waye, J.S. Removal of PCR inhibitors using silica-based spin columns: application to ancient bones. Can. Soc. Forens. Sci. 1997, 30, 1-5.
116. Chung, D.T.; Opel, K.L.; Drabek, J.; Tatarek, N. E.; Jantz, L.M.; McCord, B.R. The application of the Miniplex primer sets in the analysis of degraded DNA from human skeletal remains. Am. J. Phy. Anthropol. Submitted
117. Lin, Z.; Kondo, T.; Minamino, T.; Ohtsuji, M.; Nishigami, J.; Takayasu, T.; Sun, R.; Oshima, T. Sex determination by polymerase chain reaction on mummies discovered at Taklamakan desert in 1912. Forensic Sci. Int. 1995, 75, 197-205.
118. Dynabeads Website http://www.dynabeads.com (accessed June 2004)
195
119. Greenspoon, S.; Ban, J. Robotic extraction of mock sexual assault samples using Biomek® 2000 and the DNA IQ™ system. Profiles in DNA 2002, 5, 3-5.
120. Bourke, M.T.; Scherczinger, C.A.; Ladd, C.; Lee, H.C. NaOH treaTment to neutralize inhibitors of Taq polymerase. J. Forensic Sci. 1999, 44, 1046-1050.
121. Zunszain, P.A.; Ghuman, J.; Komatsu, T.; Tsuchida, E.; Curry, S. Crystal structural analysis of human serum albumin complexed with hemin and fatty acid. BMC Struct. Biol. 2003, 3, 6-14.
122. Shutler, G.G.; Copp, T.L.; Chau, J. Studies of PCR inhibition. American Academy of Forensic Sciences; 2004 Feb. 16-20; Dallas, TX.
123. Moreira, D. Efficient removal of PCR inhibitors using agarose-embedded DNA preparations. Nucleic Acids Res. 1998, 26, 3309-3310.
124. Sparkes, R.; Kimpton, C.; Watson, S.; Oldroyd, N.; Clayton, T.; Barnett, L.; Arnold, J.; Thompson, C.; Hale, R.; Chapman, J.; Urquhart, A.; Gill, P. The validation of a 7-locus multiplex STR test for use in forensic casework (I) Mixtures, ageing, degradation and species studies. 1996, 109, 186-194.
125. Sparkes, R.; Kimpton, C.; Gilbard, S.; Carne, P.; Andersen, J.; Oldroyd, N.; Thomas, D.; Urquhart, A.; Gill, P. The validation of a 7-locus multiplex STR test for use in forensic casework (II) Artefacts, casework studies and success rates. 1996, 109, 195-204.
126. Walsh, S.P.; Erlich, H.A.; Higuchi, R. Preferential PCR amplification of alleles: mechanisms and solutions. PCR Meth. Appl. 1992, 1, 241-250.
127. Findlay, I.; Frazier, R.; Taylor, A.; Urquart A. Single cell DNA fingerprinting for forensic applications. Nature 1997, 389, 555-556.
128. Wiegand, P.; Kleiber, M. DNA typing of epithelial cells after strangulation. Int. J. Legal Med. 1997, 110, 181-183.
129. Wiegand, P.; Trubner, K.; Kleiber, M. STR typing of biological stains on strangulation tools. Progress in Forensic Genetics 2000, 8, 508-513.
130. Van Hoofstat, D.; Deforce, D.; Brochez, V.; De Pauw, I.; Janssens K.; Mestdagh, M. et al. DNA typing of fingerprints and skin debris: sensitivity of capillary electrophoresis in forensic applications using multiplex PCR. In: Promega Corporation. Proceedings from the 2nd European Symposium of Human Identification, 1998, Innsbruck, Austria, p. 131-137.
196
131. Barbaro, A.; Falcone, G.; Barbaro, A. DNA typing from hair shaft. Progress in Forensic Genetics 2000, 8, 523-525.
132. Gill, P.; Ivanov, P.L.; Kimpton, C.; Piercy, R.; Benson, N.; Tully, G.; et al. Identification of the remains of the Romanov family by DNA analysis. Nat. Genet. 1994, 6, 130-135.
133. Gill, P.; Whitaker, J.; Flaxman, C.; Brown, N.; Buckleton, J. An investigation of the rigor of interpretation rules for STRs derived from less than 100 pg of DNA. Forensic Sci. Int. 2000, 112, 17-40.
134. Micka, K.A.; Amiott, E.A.; Hockenberry, T.L.; Sprecher, C.J.; Lins, A.M.; Rabbach, D.R. et al. TWGDAM validation of a nine-locus and a four-locus fluorescent STR multiplex system. J. Forensic Sci. 1999, 44, 1243-1257.
135. Hochmeister, M.N.; Budowle, B.; Borer, U.V.; Eggman, U.; Comey, C.T.; Dirnhofer, R. Typing of deoxyribonucleic acid (DNA) extracted from compact bone and human remains. J. Forensic Sci. 1991, 36, 1649-1661.
136. Schneider, P.M.; Bender, K.; Mayr, W.R.; Parson, W.; Hoste, B.; Decorte, R.; et al. STR analysis of artificially degraded DNA- results of a collaborative European exercise. Forensic Sci. Int. 2004, 139, 123-134.
137. Herrmann, B.; Newesely, H. Long term decomposition of bones 1. Mineral phase. Anthropol. Anz. 1982, 40, 19-31.
138. Golenberg, E.M,; Bickel, A.; Weihs, P. Effect of Highly Fragmented DNA on PCR. Nucleic Acids Res. 1996, 24, 5026-5033.
139. Hall, K. E.; McCord, B. R. The Analysis of Mono- and Divalent Cations Present in Explosive Residues using Ion Chromatography with Conductivity Detection. J. Forensic Sci. 1993, 38(4), 928-934.
140. Pacheco, M.; Havel, J. Capillary zone electrophoresis of humic substances from the American continent. Electrophoresis 2002, 23, 268-277.
141. Beck, J. L.; Colgrave, M.L.; Ralph, S.F.; Sheil, M.M. Electrospray ionization mass spectrometry of oligonucleotide complexes with drugs, metals, and proteins. Mass Spectrom. Rev. 2001, 20, 61-87
197
Appendix I
Protocols
I.A. DNA Extraction
I.A.1. DNA Extraction using the QIAamp® Blood Maxi Kit70
Notes: For isolation of genomic DNA from 10 mL (5 mL) of whole blood. • Samples should be equilibrated to room temperature (15–25 °C) before starting. • Prepare a 70 °C water bath • Prepare buffers and reagents from the kit beforehand • If a precipitate has formed in Buffer AL, redissolve by incubating at 56 °C.
1. Pipet 500 µL QIAGEN Protease into the bottom of a 50 mL centrifuge tube. Use the same amount of QIAGEN protease for volumes less than 10 mL.
2. Add 10 mL blood and mix briefly. Add PBS for sample volumes less than 5 mL.
3. Add 12 mL of Buffer AL and mix thoroughly by vortexing 3 times, for 5 seconds each time. Reduce the amount of Buffer AL proportionately for sample volumes less than 10 mL. Mix sample thoroughly to ensure adequate lysis.
4. Incubate at 70 °C for at least 10 minutes. Longer incubation times will not adversely affect yield.
5. Add 10 mL of ethanol (96–100%) to the sample and mix again by vortexing. Reduce the amount of ethanol proportionately for sample volumes less than 10 mL.
6. Carefully apply the solution from step 5 onto the QIAamp Maxi column placed in a 50 mL centrifugation tube provided in the kit. This step is performed twice to accommodate all the solution. Avoid spilling and do not moisten the rim of the QIAamp Maxi column. Close the cap and centrifuge at 1850 x g (3000 RPM) for 3 minutes. Discard filtrate prior to adding remainder of the solution.
7. Remove the QIAamp Maxi column, discard the filtrate, and place the QIAamp Maxi column back into the 50 mL centrifugation tube. Wipe off any spillage from the column opening. 8. Carefully, without moistening the rim, add 5 mL Buffer AW1 to the QIAamp Maxi column. Close the cap and centrifuge at 4500 x g (5000 RPM) for 1 198
minute. Do not alter the volume of Buffer AW2 if the initial sample volume was less than 10 mL.
9. Carefully, without moistening the rim, add 5 mL of Buffer AW2 to the QIAamp Maxi column. Close the cap and centrifuge at 4500 x g (5000 RPM) for 15 minutes. Do not alter the volume of Buffer AW2 if the initial sample volume was less than 10 mL.
10. Discard the 50 mL centrifugation tube containing the filtrate, and place the QIAamp Maxi column in a clean 50 mL centrifugation tube provided in the kit.
11. Add 1 mL of Buffer AE, or distilled water, equilibrated to room temperature (15–25 °C). Pipet directly onto the membrane of the QIAamp Maxi column and close the cap. Reduce the amount of Buffer AE proportionately for initial sample volumes less than 10 mL.
12. Incubate at room temperature for 5 min and centrifuge at 4500 x g (5000 RPM) for 5 minutes. • To obtain highly concentrated DNA proceed to step 13. To obtain maximum DNA yield proceed to step 14.
13. For maximum concentration: Reload the 1 mL of eluate containing the DNA onto the membrane of the QIAamp Maxi column. Close the cap and incubate at room temperature for 5 minutes. Centrifuge at 4500 x g (5000 RPM) for 5 minutes.
14. For maximum yield: Pipet 1 mL of fresh Buffer AE or distilled water, equilibrated to room temperature, onto the membrane of the QIAamp Maxi column. Incubate at room temperature for 5 min and centrifuge at 4500 x g (5000 RPM) for 5 minutes. If the initial sample volume was less than 10 mL, pipet the appropriate amount of fresh Buffer AE or distilled water, onto the membrane of the QIAamp Maxi column.
199
I.A.2 DNA Extraction from Agarose Gel using the QIAquick® Gel Extraction Kit71
Notes: • The yellow color of Buffer QG indicates a pH ≤7.5. • Add ethanol (96–100%) to Buffer PE before use. • Isopropanol (100%) and a heating block or water bath at 50 °C are required. • All centrifugation steps are carried out at 13,000 RPM (~17,900 x g) in a conventional table-top microcentrifuge. • 3 M sodium acetate, pH 5.0, may be necessary.
1. Excise the DNA fragment from the agarose gel with a clean, sharp scalpel. Minimize the size of the gel slice by removing extra agarose.
2. Weigh the gel slice in a colorless tube. Add 3 volumes of Buffer QG to 1 volume of gel (100 mg ~ 100 µL). Add 300 µL of Buffer QG to each 100 mg of gel. For >2% agarose gels, add 6 volumes of Buffer QG.
3. Incubate at 50 °C for 10 minutes or until the gel slice has completely dissolved. Vortexing the tube every 2–3 minutes during the incubation helps dissolve the agarose gel slice.
4. After the gel slice has dissolved completely, check that the color of the mixture is yellow (similar to Buffer QG without dissolved agarose). • If the color of the mixture is orange or violet, add 10 µL of 3 M sodium acetate, pH 5.0, and mix. The color of the mixture will turn to yellow.
5. Add 1 gel volume of isopropanol to the sample and mix. Add 100 µL isopropanol for every 100 mg of agarose gel.
6. Place a QIAquick spin column in a provided 2 mL collection tube.
7. Apply the sample to the QIAquick column, and centrifuge for 1 minute to bind the DNA. For sample volumes of more than 800 µL, simply load and spin again.
8. Discard flow-through and place QIAquick column back in the same collection tube.
9. To wash, add 0.75 mL of Buffer PE to QIAquick column and centrifuge for 1 minute.
10. Discard the flow-through and centrifuge the QIAquick column for an additional 1 minute at 13,000 RPM (~17,900 x g).
200
11. Place QIAquick column into a clean 1.5 mL microcentrifuge tube.
12. To elute DNA, add 50 µL of Buffer EB (10 mM Tris·Cl, pH 8.5) or H2O to the center of the QIAquick membrane and centrifuge the column for 1 minute. Alternatively, for increased DNA concentration, add 30 µL of elution buffer to the center of the QIAquick membrane, let the column stand for 1 minute and then centrifuge for 1 minute. 201
I.A.3 DNA Extraction using Phenol/ Chloroform Method72,73
1. Prepare a reagent blank for each extraction procedure by adding 300 µL of stain extraction buffer (SEB, See Appendix II) and 2 µL (20 mg/ mL) Proteinase K to a 2 mL microcentrifuge tube.
2. Cut a small portion of the stain or cotton swab tip and place into a sterile 2 mL microcentrifuge tube.
3. Add 300 µL of SEB and 2 µL of Proteinase K to the samples. Vortex and spin in a microcentrifuge.
4. Incubate tubes for 2 -24 hours at 56 ºC. Briefly spin the tubes in a microcentrifuge to force condensate into the bottom of the tubes.
5. Transfer the cutting into a spin filter basket (Promega Corp., Madison, WI). Place the filter insert into the same tube containing the stain extract. Centrifuge at high speed for 5 minutes. Remove and discard the filter with cutting.
6. Add 300 µL phenol:chloroform:isoamyl alcohol (PCIA 25:24:1) to the extract and reagent blank.
7. Vortex the tubes to attain milky emulsion then spin in a microcentrifuge for 3 minutes at 10,000 x g.
8. Assemble and label a Microcon™ 100 (Millipore Corp., Billerica, MA) for each sample. Prepare the Microcon™ 100 concentrators by adding 100 µL of ddH2O to the filter side (top) of each concentrator.
9. Carefully remove the aqueous phase (supernatant ~300 µL) of PCIA from each sample and transfer to the appropriate concentrator. Note: Avoid drawing any of the organic layer into the pipet tip.
10. Spin the Microcon™ 100 concentrators for 5 minutes at 3,000 x g. Additional spin time may be needed to filter out the entire volume.
11. Discard the filtrate and return the filtrate cups to the concentrators.
12. Add 400 µL of ddH2O to the filter side (top) of each concentrator.
13. Spin again at 3,000 x g and discard the filtrate cups.
14. Add 60 µL of ddH2O to the filter side (top) of each concentrator and place a retentate cup on the top of each concentrator. 202
15. Briefly vortex the Microcon™ 100 concentrators with the retentate cups pointing upward.
16. Invert each concentrator with its retentate cup and spin in a micrcentrifuge at 10,000 x g for 3 minutes.
17. Discard the concentrators. Cap the retentate cups.
18. Store the DNA samples at 4ºC until ready for use. 203
I.A.4 DNA Extraction from Bone Samples
Note: Store DNA extract at 4 ºC or -20 ºC until ready for use.
1. Cleaning
a. Rinse bone samples in distilled water.
b. Briefly rinse with 5% bleach.
c. Rinse thoroughly with distilled water.
d. Use sand paper to scrape of the outer part of the bone sample.
e. Rinse with absolute ethanol.
f. Allow to dry.
g. Drill bone sample with Black and Decker driller and collect bone powder.
2. Decalcification
a. Place 0.1 g ground bone powder into extraction tube (2 mL tube). Place RB (reagent blank) swab into a separate extraction tube.
b. Add 1.6 mL EDTA (0.5 M, pH 8.0) to each tube. Close tubes carefully and seal top with parafilm.
c. Vortex gently to suspend bone powder.
d. Incubate tubes with agitation for 16 hours at room temperature.
e. Centrifuge tubes to pellet bone powder (spin 45 seconds – 1 minute, 8000 RPM).
f. Remove EDTA supernatant.
g. Wash RB and bone powder by adding 1 mL of distilled water to the tube.
h. Close lid, mix by inverting and flicking tube to completely resuspend bone powder in water.
i. Centrifuge to pellet bone powder and remove supernatant. 204
j. Repeat wash step (step 7-9) two more times for a total of 3 washes.
3. Extraction
a. Add 300 µL of Stain extraction buffer (SEB, See Appendix II) and 2 µL (20 mg/ mL) Proteinase K.
b. Incubate bone powder in SEB for 8 hours at 56 ºC with agitation.
4. Purification
a. Centrifuge tubes briefly to pellet the condensation. Spin the ease basket with the RB.
b. Add 300 µL buffer AL to each sample (extract or RB). The solution may appear very viscous.
c. Mix by vortexing.
d. Incubate tubes for 10 minutes at 70 ºC.
e. Centrifuge briefly to pellet condensation.
f. Add 400 µL to the tube. Vortex to mix. Centrifuge briefly.
g. Carefully transfer 500 µL of the mixture (including any precipitate) directly to a QiaAmp® spin column. Avoid touching the pipet tip to lip of column and do not let pipet tip touch the filter in the column.
h. Centrifuge column for 1 minute (8000 RPM). Discard flow through and return spin column to the collection tube.
i. Transfer remaining 500 µL of the mixture (including any precipitate) directly to the QiaAmp® spin column. Avoid touching the pipet tip to lip of column and do not let pipet tip touch the filter in the column.
j. Centrifuge column for 1 minute (8000 RPM). Transfer spin column to a new collection tube.
k. Add 500 µL buffer AW1 directly to QiaAmp® spin column. Centrifuge column for 1 minute (8000 RPM). Transfer spin column to a new collection tube.
205 l. Add 500 µL buffer AW2 directly to QiaAmp® spin column. Centrifuge column for 3 minutes (14000 RPM).
m. Transfer spin column to a new collection tube for elution of DNA.
n. Add 60 µL buffer AE.
o. Incubate at room temperature for 5 minutes. Centrifuge column for 1 minute (8000 RPM) to collect DNA extract. 206
I.A.5 DNA Extraction from FTA™ Paper using the Standard FTA™ Method75
1. Clean puncher with 70% ethanol (methanol or isopropanol).
2. Label tubes.
3. Punch a 1.2 mm disc using the small puncher. Place disc in PCR amplification tube.
4. Add 200 µL of FTA purification reagent (Whatman Bioscience, Princeton, NJ) to each tube.
5. Incubate for 5 minutes at room temperature with moderate manual mixing.
6. Remove and discard all the FTA purification reagent using a pipette.
7. Repeat steps 4-6 once for a total of two washes with FTA Purification reagent.
8. Add 200 µL of TE buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0).
9. Incubate for 5 minutes at room temperature.
10. Remove and discard all spent TE buffer with a pipette.
11. Repeat steps 8-10 once for a total of two washes with TE buffer.
12. Allow punch to dry at room temperature for about an hour or at 56 ºC for 10 minutes before performing PCR.
13. Add disc to PCR reaction.
207
I.A.6 DNA Extraction from FTA™ Paper using DNAzol Method76
Note: Preheat water bath at 100 ºC
1. Put the FTA paper punch in a spin basket and insert into 1.5 mL microcentrifuge tube.
2. Add 200 µL of FTA purification buffer (WhaTman Bioscience, Clifton, NJ).
3. Incubate at room temperature for 5 minutes. Centrifuge for 30 seconds.
4. Discard eluate in the microcentrifuge tube.
5. Repeat steps 2-4 twice.
6. Add 200 µL DNAzol (Gibco-BRL, Rockville, MD)
7. Incubate at room temperature for 5 minutes. Centrifuge for 30 seconds.
8. Discard eluate in the microcentrifuge tube.
9. Add 200 µL TE buffer to spin basket with FTA punch and centrifuge for 30 seconds.
10. Remove eluate in microcentrifuge tube.
11. Repeat step 9 once.
12. Transfer the filter basket into a new microcentrifuge tube.
13. Add 200 µL of nuclease free water.
14. Heat microcentrifuge tubes in a 100 ºC water bath for 15 minutes.
Note: Ensure that the level of boiling water completely covers the level of fluid in the spin basket. Too low temperature will reduce DNA yield.
15. Centrifuge tubes at 6,000 RCF for 5 minutes. 208
I.B. DNA Quantification
I.B.1. DNA Quantification using the Perkin-Elmer Quantiblot® Human DNA Quantification Kit78
Note: The composition of buffers and solutions are given in Appendix III. Prepare serial dilutions of DNA standards starting with 120 µL of DNA standard and store at 2 ºC to 8 ºC.
1. Prepare an 11.0 cm X 7.9 cm Biodyne B membrane and warm the hybridization and wash solutions to 50 oC.
a. Cut a small notch in the upper right corner of the membrane to ensure proper orientation.
b. Place membrane in a hybridization tray (Applied Biosytems, Foster City, CA) containing 50 mL of pre-wetting solution for 1-30 minutes.
2. Prepare DNA standards
a. Add 150 µL of spotting solution into each tube labeled for each standard A-G and two calibrator standards.
b. Vortex each standard and add 5 µL to the corresponding labeled tube.
3. Prepare samples to be quantified
a. Add 150 µL of spotting solution into each tube labeled for each sample.
b. Add 5 µL of the DNA extract into each sample tube with spotting solution.
4. Apply DNA standards and samples to the membrane using a vacuum manifold
a. Remove membrane from the pre-wetting solution and place it on the slot blot gasket.
b. Place the top plate of the slot blot apparatus on top of the membrane.
c. Turn on the vacuum source.
d. Turn off the sample vacuum and turn on the clamp vacuum on the slot blot apparatus.
209
e. Push down the top plate to ensure the formation of a tight seal.
f. Pipet each sample (155 µL) into the appropriate well of the slot blot apparatus.
g. Slowly turn on the sample vacuum. Leave the sample vacuum on until all of the samples have been drawn through the membrane. Uniform blue bands should be observed.
h. Turn off the sample vacuum, clamp vacuum, and vacuum source.
i. Proceed immediately to the hybridization step. Do not let the membrane dry out.
5. DNA hybridization
a. Pre-hybridization: Transfer the membrane to a hybridization tray with 100 mL of pre-warmed hybridization solution. Add 5 mL of 30% H2O2. Place lid on tray and rotate at 50oC for 15 minutes. Pour off solution.
b. Hybridization: Add 30 mL of hybridization solution to the hybridization tray containing the membrane. Tilt the tray to one side and add 20 µL of the D17Z1 probe. Place lid on tray and rotate at 50 oC for 20 minutes. Pour off solution.
c. Rinse membrane briefly in 100 mL of pre-warmed wash solution for several seconds and pour off solution.
d. Add 30 mL of wash solution. Tilt tray to one side and add 90 µL of Enzyme Conjugate: HRP-SA. Rotate at 50 oC for 10 minutes. Pour off solution.
e. Rinse the membrane thoroughly for 1 minute in 100 mL of pre-warmed wash solution. Pour off solution.
f. Wash the membrane with 100 mL of wash solution. Rotate at 50 oC for 15 minutes. Pour off solution.
g. Rinse the membrane briefly in 100 mL of citrate buffer. Pour off solution.
6. Sample detection
a. Cut a piece of benchkote to approximately 12 x16 cm. 210 b. To 5 mL of ECL reagent 2, add 5 mL of ECL reagent 1 (Amersham Biosciences, Piscataway, NJ). Do not prepare the mixture more than 5 minutes before use. c. Add the ECL mixture to the membrane and shake exactly for 1 minute. d. Put the membrane DNA-side up on the benchkote and cover with saran wrap. Press out all the bubbles. e. In a darkroom expose a piece of Kodak XAR5 film (Kodak, Rochester, NY) to the membrane for 2-24 hours. f. Develop the film.
i. Incubate with Kodak GBX developer for 90 seconds.
ii. Rinse in water for a few seconds.
iii. Incubate in Kodak GBX fixer for 90 seconds.
iv. Hang to dry. 211
I.B.2 Alu-Based Real-Time PCR Method of DNA Quantification81,84
Note: Use flat top 0.2 mL tubes to work with 20 µL volumes. To ensure uniform thermal transfer, completely fill all spaces in the rotor with tubes. Always prepare fresh serial dilutions of the DNA standard.
Preparation of 0.5 % working solution of SYBR Green I (Molecular Probes, Eugene, OR)
• Take 1 µL of 10,000X concentrated Sybr Green I and add 199 µL of DMSO. Prepare aliquots for future use.
1. Prepare serial dilution of DNA standard.
2. Prepare DNA samples to be quantified.
3. Prepare 36 flat-top tubes, label them on the cap.
4. Prepare and vortex Alu Mix:
5. Pipet 19 µL of Alu Mix into labeled PCR microtubes.
6. Add 1 µL of standard or DNA sample to each tube. Vortex and mix.
7. Turn on PC and turn on the Rotor Gene instrument.
8. Clean accessible optics with cotton Q-tip and ethanol.
9. Place tubes on the appropriate wells of the carousel and place ring on top. Align carousel in the chamber. Screw in the cap with the red dot on top. Close cover.
10. Set Alu program parameters and fill in information.
11. Edit profile (if needed)
Denature 95 °C 10 minutes Denature 96 °C 10 seconds Cycles 45 Cycling 95 °C 15 s, 55 °C 20 s, 72 °C 20 s acquiring to cycling on Sybr Green Melt: Ramp from 72 °C to 99 °C 212
Rising by 1 °C each step Wait for 45 seconds on first step, then Wait for 5 seconds for each step afterwards Acquire to Melt A on Sybr
12. Calibrate: check “Perform Calibration Before 1st acquisition”.
13. Start run, go to correct folder to name an experiment with “Alu-date”.
14. During run, fill the sample table: distinguish between DNA samples, no template control (NTC), and standards. Fill in the given concentrations in the “given concentration” column for standards and sample names for other sample tubes.
15. When experiment is completed, click Analysis-Quantitation-Show. New windows will appear and a box in the middle – click Cancel.
16. Fill:
Slope Correct ON Eliminate cycles before 5 Threshold default (0.03) When the box comes up, click OK.
17. The standard curve, fluorescence threshold cycle (Ct) and concentrations of samples will be calculated. The standard curve should have an efficiency and r value close to 1.00. You can choose to exclude those standard samples that cause give errors.
18. If raw data is good but not quantitated, click on the “quantitave settings” and decrease the threshold to 2% (1%).
19. Click “reports” in the upper left of the Quantitation window – Full Report - Send to Word and save.
20. Click Analysis-Melt.
21. Check if melting curve has two peaks (first is smaller). 213
I.C. Edge Biosystems DTR Spin Column Procedure for Dye Blob removal
1. Rehydrate the gel by pipetting 100 µl of PCR H2O to the center of packed column.
2. Centrifuge cartridge for 2 minutes at 750 x g (3500 RPM)
3. Transfer the cartridge to a clean microtube provided in the kit and add sample to the gel in the center of packed column.
4. Close the cap, centrifuge for 2 minutes at 750 x g.
5. Retain eluate. If the sample loss is greater than 4 µL, repeat centrifugation. 214
I.D. Low-Melting Temperature Agarose Method
Note: The analyst should be careful and consistent when pipetting the supernatant (wash buffer or water) out. Composition: 1.6% low melting temperature agarose in water
1. Switch the water bath on and set to 70 °C.
2. Thaw the 1.6% LMT agarose in the screw cap tube in the water bath (use the Styrofoam floating device). Wipe tube dry before opening.
3. Aliquot 1 volume (10 µL) of LMT agarose into the bottom of a 0.6 mL micrcentrifuge tube. 4. Add 1 volume (5 µL) of DNA with inhibitors. Close tubes.
5. Using the floating device, transfer the tubes to the 70 °C water bath until contents are dissolved (1 minute).
6. Wipe tubes dry.
7. Vortex and spin briefly.
8. Put the sample tubes in the freezer for 5 minutes to solidify.
9. Add 300 µL of TET buffer (Tris-Cl 10 mM, EDTA 1 mM pH 8, 0.1% Triton X- 100).
10. Close tubes and place in a sandwich bag. Incubate at room temperature and shake overnight.
11. Spin at 1400 RPM for 1 minute and allow to cool at 4 ºC for 5 minutes. Pipet supernatant out. Do not try to discard all supernatant (sediment should be atleast 15 µL).
12. Add 300 µL of PCR H2O.
13. Incubate at room temperature with agitation for 1 hour.
14. Spin at 1400 RPM for 1 minute and allow to cool at 4 ºC for 5 minutes. Pipet most of supernatant out.
15. Store at 4 °C. Put to 70 °C water bath and mix it before using for PCR. You can pipet four samples before gel starts to solidify again. 215
I.E. Microcon Concentration114
1. Insert the blue Microcon sample reservoir into the vial, white part first. Consult company manual for different colors/different cutoffs.
2. Pipette sample into the sample reservoir (500 µL maximum) without touching the membrane. Seal with attached cap.
3. Centrifuge cartridge for 12 minutes at 500 x g (~3000 RPM).
RCF 4. For reference: RPM = , radius is in millimeters. 1.118 *106 * radius 5. Separate vial from reservoir, place reservoir upside down in a new vial.
6. Spin for 3 minutes at 1000 x g (~4250 RPM).
7. Retain eluate.
216
Appendix II Composition of Buffers and Solutions
Citrate Buffer 0.1 M Sodium Pre-Wetting Solution 0.4 N NaOH, Citrate, pH 5.0 (1L) 25 mM EDTA (500 mL)
18.4 g trisodium citrate dihydrate 40 mL 5N NaOH . (Na3C6H5O7 2H2O) 25 mL 0.5 M EDTA 6 g citric acid monohydrate . (C6H8O7 H2O) Add NaOH and EDTA to 435 mL of DI H2O. Dissolve trisodium citrate dehydrate in 800 mL DI H2O. Adjust to pH 5.0 20% w/v SDS (1L) by adding citric acid monohydrate. Adjust final volume to 1 liter. 200 g SDS
EDTA 0.5 M (1L) Dissolve SDS in 800 mL DI H2O. Warm to dissolve solids and adjust 186.1 g disodium ethylenediamine- volume to 1 L. tetraacetic acid dihydrate . (NA2EDTA 2H2O) SEB (Stain extraction buffer) 10 ~20 g NaOH pellets mM Tris pH 8.0, 100 mM NaCl, 39 mM DTT, 10 mM EDTA, 2% SDS disodium ethylenediamine- (1L) tetraacetic acid dihydrate . (NA2EDTA 2H2O) in 800 mL DI 5.84 g NaCl H2O and adjust to pH 8.0 with 10 mL 1 M Tris NaOH. 20 mL 0.5 M EDTA 100 mL 20% (w/v) SDS Hybridization Solution (5X SSPE, 0.5 % w/v SDS (1L) To make 1L stock solution, dissolve NaCl in 500 mL sterile DI 250 mL 20X SSPE H2O. Add Tris, EDTA, 20% SDS. 25 mL 20% w/v SDS Titrate to pH 8.0 with HCl. Bring final volume to 1L with DI H2O. Add SSPE and SDS to 725 mL of Store at room temperature. DI H2O. *Supplement with DTT before use. To 100 mL of above solution, add 601.4 mg DTT and stir until dissolved. Store at room temperature. The complete solution is good for no more than two weeks. 217
Spotting Solution 0.4 N NaOH, 25 TBE 10X buffer mM EDTA, 0.00008% Bromothymol Blue (75 mL) 107.8 g Tris base . 7.44 g EDTA (Na2EDTA H2O) 6 mL 5N NaOH ~55.0 g boric acid 3.75 mL 0.5 mM EDTA 150 µL 0.04% Bromothymol Blue Dissolve Tris base and EDTA in 800 (included in kit) mL ddH2O. Slowly add boric acid and monitor the pH until the desired Add NaOH, EDTA, and pH of 8.3 is obtained. Bring volume Bromothymol Blue to 65 mL of DI to 1L with ddH2O. H2O and mix. TE buffer 10 mM Tris-HCl, 0.1 mM 20X SSPE Buffer 3.6 M NaCl, 200 EDTA, pH 8.0 (1L) . mM (NaH2PO4 H2O), 20 mM EDTA, pH 7.4 (1L) 10 mL of 1 M Tris-HCl, pH 8.0 0.2 mL of 0.5 M EDTA 7.4 g disodium ethylenediamine- tetraacetic acid dihydrate Add Tris-HCl to 990 mL DI H2O . (NA2EDTA 2H2O) and mix thoroughly. 210 g sodium chloride (NaCl) 27.6 sodium phosphate monobasic Tris-HCl (1 M), pH 8.0 (1L) . (NaH2PO4 H2O) 121.1 g Tris base Dissolve disodium ethylenediamine- ~ 45 mL of concentrated HCl tetraacetic acid dihydrate . (NA2EDTA 2H2O) in 800 mL DI Dissolve Tris base in 800 mL DI H2O and adjust to pH 8.0 with H2O and adjust to pH 8.0 by adding NaOH. Add sodium chloride (NaCl) HCl. Adjust final volume to 1 liter and sodium phosphate monobasic with DI H2O. . (NaH2PO4 H2O) and adjust pH to 7.4 with NaOH. Adjust final volume to 1 Wash Solution (1.5X SSPE, 0.5% liter with DI H2O. w/v SDS (2L)
150 mL 20X SSPE 50 mL 20% w/v SDS
Add SSPE and SDS to 1,800 mL of DI H2O.