The Kruppel Like Factors in Aging and Aging Associated

THE KRUPPEL LIKE FACTORS IN AGING AND AGING ASSOCIATED

PATHOLOGY

PAISHIUN NELSON HSIEH

Submitted in partial fulfillment of the requirements for the degree of Doctor of

Philosophy

Department of Pathology

CASE WESTERN RESERVE UNIVERSITY

May, 2018

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Paishiun Nelson Hsieh candidate for the Ph.D. degree *.

(signed) George R. Dubyak, Ph.D.

(chair of the committee)

Mukesh K. Jain, M.D.

Jeff Coller, M.D.

Goutham Narla, M.D., Ph.D.

Clive R. Hamlin, Ph.D.

03/29/2018

(date)

*We also certify that written approval has been obtained for any proprietary material contained therein.

CONTENTS

LIST OF TABLES 6

LIST OF FIGURES 7

ACKNOWLEDGEMENTS 10

ABSTRACT 12

CHAPTER 1: Introduction to aging 14

Evolutionary perspectives on aging ...... 14

General strategies for studying aging ...... 16

Determinants of longevity, or the “Hallmarks of Aging” ...... 19

Signaling pathways in aging ...... 28

Chronic diseases in aging and extension of healthspan ...... 31

The Kruppel like factors in aging and aging associated diseases ...... 33

Anti-aging interventions ...... 46

CHAPTER 2: Methods 48

CHAPTER 3: Longevity and healthy aging converge on a conserved

Kruppel-like Factor-autophagy pathway 61

Authors: ...... 61

Summary ...... 61

Introduction ...... 62

Results ...... 65

KLF requirement for lifespan extension in multiple pathways ...... 65

klf-3 overexpression enhances health and lifespan in C. elegans ...... 79

KLF-mediated lifespan extension is dependent on

regulation of autophagy ...... 87

Mammalian KLF4 regulates autophagy ...... 108

Endothelial restricted KLF4 overexpression delays vessel aging

and enhances autophagy ...... 116

Discussion ...... 126

CHAPTER 4: A complement protein mediates neuroprotection in a model of Parkinson’s disease via a gut-neuron axis 134

Authors ...... 134

Summary ...... 134

Introduction ...... 136

Results ...... 137

Overexpression of klf-3 delays neurodegeneration in a C. elegans

model of Parkinson’s Disease ...... 137

Intestinal specific overexpression of klf-3 delays

neurodegeneration ...... 143

Intestinal clec-186 is required for intestinal klf-3 mediated

neuroprotection ...... 147

Discussion ...... 155

CHAPTER 5: Conclusions and discussion 157

Conclusions ...... 157

Discussion ...... 158

Closing Thoughts ...... 159

REFERENCES 163

LIST OF TABLES Suppl. Table 3-1 Summary table of combinatorial lifespan analysis of 67 double KLF loss of function

Suppl. Table 3-2 Combinatorial lifespan analysis of C. elegans animals 69 with reduced klf-1, klf-2 or klf-3 levels

Suppl. Table 3-3 Lifespan analysis of C. elegans mutant animals with 76 reduced klf-1 levels

Suppl. Table 3-4 Lifespan analysis of C. elegans with klf-3 over-expression 81 (o/e)

Suppl. Table 3-5 In silico search identifies presence of KLF response 96 elements GA/GCCC within 1000 base pairs upstream and 200 base pairs downstream of start codon in autophagy genes

Suppl. Table 3-6 Lifespan analysis of C. elegans klf-3 and klf-1 o/e animals 107 with reduced beclin-1, lgg-3, atg-13 or atg-7 levels

Suppl. Table 3-7 KLF4 manipulation alters expression of a broad spectrum 115 of genes in the autophagy pathway.

LIST OF FIGURES Figure 1 Kruppel like factor regulation of aging 45

Suppl. Figure 3-1 Dual loss of function of the Kruppel-like factors reduces 70 C. elegans lifespan

Suppl. Figure 3-2 Single RNAi depletion of either klf-1 or klf-3 is specific and 72 does not alter expression of another klf, while mutant worms demonstrate compensatory induction of klfs

Figure 3-1 KLFs are required for long lifespan in multiple longevity 77 paradigms

Suppl. Figure 3-3 Double loss of function of klf-1 and klf-3 suppresses 78 enhanced longevity in multiple longevity paradigms

Figure 3-2 Klf-3 overexpression extends healthspan in C. elegans 82

Suppl. Figure 3-4 Overexpression of klf-3 does not strongly change total 85 number of hatched eggs laid.

Suppl. Figure 3-5 Overexpression of klf-3 does not significantly alter 86 pharyngeal pumping rates

Figure 3-3 KLF-mediated lifespan extension is dependent on 89 autophagy

Suppl. Figure 3-6 Both klf-1 and klf-3 are induced in eat-2 animals and by 91 inhibition of TOR at age Day 12

Suppl. Figure 3-7 Loss of DNA binding region abolishes klf-3 mediated 92 enhancement of autophagy gene expression

Suppl. Figure 3-8 Klf-3 mutants do not strongly suppress autophagy gene 93 expression, and concurrent RNAi inactivation of klf-1 in klf-3 mutants weakly reduces expression

Suppl. Figure 3-9 Klf-1 overexpression driven by ges-1 promoter 94

Suppl. Figure 3-10 Klf-1 overexpression driven by ges-1 promoter increases 95 autophagy gene expression

Suppl. Figure 3-11 Little to no autophagic-like vesicles presence in wild-type 100 and klf-3 RNAi klf-1 animals by TEM at Day 5 or Day 9 (post-fertile period)

Suppl. Figure 3-12 KLF-mediated lifespan extension is autophagy dependent 102

Suppl. Figure 3-13 Autophagy is decreased in daf-2 or eat-2 animals with 103 single or compound deficiency of klf-1 and klf-3

Figure 3-4 KLF regulation of autophagy is conserved in mammalian 109 cells

Figure 3-5 KLF4 regulates autophagy and ageing in vasculature and 118 decreases with age

Suppl. Figure 3-14 VO2max and KLF4 levels decrease with age in humans 120

Suppl. Figure 3-15 Structural wall components are unchanged in aged WT 122 versus aged ECK4TG mice

Suppl. Figure 3-16 KLF4 is induced in HUVECs by serum starvation and 124 rapamycin

Suppl. Figure 3-17 Flow-induced eNOS expression is autophagy dependent 125

Figure 4-1 Klf-3 delays neurodegeneration in a C. elegans model of 140 Parkinson’s Disease

Figure 4-2 Klf-3 alters dopaminergic neuron dependent functions 141

Figure 4-3 Klf-3 does not impact motor deficit in αSyn animals 142

Figure 4-4 Intestinal klf-3 delays dopaminergic neurodegeneration 144

Figure 4-5 Intestinal klf-3 overexpression does not extend lifespan 145

Figure 4-6 RNA-seq analysis of putative secreted genes in klf-3 o/e 146 animals

Figure 4-7 Intestinal klf-3 mediated dopaminergic neuroprotection 149 requires systemic clec-186

Figure 4-8 Intestinal klf-3 mediated dopaminergic neuroprotection 150 does not require systemic nlp-24

Figure 4-9 Whole animal RNAi depletion of clec-186 abrogates 151 intestinal klf-3 mediated dopaminergic neuroprotection

Figure 4-10 Scheme for generation of intestine and dopaminergic 152 neuron specific RNAi models

Figure 4-11 Intestinal klf-3 mediated dopaminergic neuroprotection 153 requires intestinal clec-186

Figure 4-12 Intestinal klf-3 mediated dopaminergic neuroprotection 154 does not require dopaminergic neuron clec-186

ACKNOWLEDGEMENTS

I have many people to thank who have contributed to my professional and personal growth. First, I want to acknowledge my thesis advisor, Mukesh Jain, for his mentorship and faith in me. From his example I learned how to conduct rigorous science, work collaboratively, and conduct myself with integrity. Many of my lab colleagues, senior and junior, have imparted valuable lessons to me.

Specifically, thanks go to Tony Prosdocimo, Yuan Lu, Xudong Liao, Lilei Zhang,

Lalitha Nayak, Rongli Zhang, and Guangjin Zhou, who have taught me everything I know about benchwork, scientific rigor, writing papers, grant preparation, the list could be endless. Panjamaporn, David, Liyan, Stephanie,

Neel, Sean, Kei, Mo, Yuyan, you are all amazing and your support during this time has been invaluable. I am glad to be able to count you all as friends.

Thanks also go to people outside the Jain lab who have been integral to any success I’ve had in my graduate studies. John Feng, whose lab I did the lion’s share of the worm work in, was a daily source of intellectual stimulation and his post-doc Yiyuan could not be driven away by my pestering questions no matter how hard I tried. Thanks also go to my collaborators John Kirwan, Ciaran Fealy

(in the Kirwan Lab), Maureen Peters, Aaron Proweller, Diana Ramirez-Bergeron,

Anna Borton (in the Ramirez-Bergeron lab), Anne Hamik, and Evgenii Boriushkin

(in the Hamik lab) for providing crucial reagents and scientific guidance. I also want to acknowledge the important scientific and professional mentorship

10 provided by the members of my thesis committee, Drs. George Dubyak, Jeff

Coller, Goutham Narla, and Clive Hamlin.

Additionally, thanks go to the Department of Pathology of CWRU, and the

Medical Scientist Training Program for their support of my time here.

Last but certainly not least, my friends and family deserve special mention for putting up with me during this long but rewarding process.

The Kruppel like Factors in Aging and Aging Associated Pathology

Abstract

PAISHIUN NELSON HSIEH

Aging is a progressive, global degeneration in cellular functions which occurs as homeostatic mechanisms become insufficient, leading to an age- related exponential increase in risk of mortality and age-associated disease.

Aging has characteristic features shared across phylogeny and is subject to biologic control. Here I describe a regulatory pathway which modulates lifespan and healthspan of the nematode Caenorhabditis elegans via enhancement of cellular proteostasis. Specifically, direct transcriptional control of macroautophagy by the family of Kruppel like factors (KLFs) alters nematode lifespan and age-associated phenotypes. Further, the KLFs are broadly required in at least four mechanistically distinct longevity pathways, suggesting that diverse upstream signaling converges on a KLF regulatory node to effect a common pro-longevity response. The KLF-autophagy pathway is conserved in mice vasculature to regulate endothelial autophagy and vascular aging. As the

KLFs are well accepted as mechanotransducers of laminar shear stress, we also suggest that KLFs mediate the effects of shear stress on endothelial autophagy.

Long-lived nematodes overexpressing a KLF also are protected from neurodegeneration in a model of Parkinson’s Disease, therefore experiencing an extension of time spent free of age-associated debility. Interestingly, only an intestinal KLF is required for this effect and these nematodes do not experience lifespan extension. A putative secreted c-type lectin (ortholog for mammalian complement protein COLEC11) mediates intestinal KLF neuroprotection, linking gut signals with neuronal proteostatic mechanisms.

Together, these observations outline a novel longevity pathway, in addition to known biologic mechanisms regulating aging, and define a role for the KLFs in determining organismal lifespan.

CHAPTER 1: INTRODUCTION TO AGING

Portions of this chapter have been published in Trends in Cell & Molecular

Biology 12:1-15; 20171,a

Evolutionary perspectives on aging

Human lifespan is limited, yet its potential extent and the mechanisms governing it remain mysterious. Further, aging organisms experience a progressive deterioration in cellular function of all kinds, such that coincident with an increase in risk of mortality comes a rise in age-associated debility and disease. How to understand these two related yet distinct phenomena is the overarching purpose of any aging study.

However, over the decades, substantial attention has also been paid to the question of why aging occurs at all, the primary domain of evolutionary theories of aging. These efforts may be useful to consider and at the very least provide some context for the following discussions. Therefore, a very brief overview is provided here, although they remain the subject of intense debate.

Evolutionary arguments propose several ideas. The earliest, by August

Weismann which has since fallen out of favor, placed emphasis on fitness of the group rather than individual fitness to argue that natural selection has evolved mechanisms to promote aging and predetermine the death of the old to spare resources for the young, a theory today known as Programmed Death.2 Although a This work is a derivative of Aging and the Krüppel-like factors, used with permission under an open access license.

14 his theory is no longer commonly referenced, Weismann proved prescient in his prediction of a mechanism of programmed cell death, or what he termed “clock”, which might limit the number of somatic cell divisions and therefore determine organismal lifespan; in the 1960s Hayflick discovered a limited capacity of cultured human cells to divide, the well-known “Hayflick limit”.3,4 Contemporary proposals focus on the declining selective pressure which occurs as individuals age, coupled with inevitable mutational burden. Late acting mutations with deleterious impacts on fitness cannot be removed and passively permeate throughout a population, resulting in an accumulation of mutations which preferentially act in older individuals and presumably lead to the evolution of aging phenotypes. This is known as the mutation accumulation model.5 Another modern theory, the antagonistic pleiotropy model, agrees with this line of reasoning, but further posits that some early genes may in fact provide fitness advantages and therefore reproductive benefit, but be detrimental in late life and are therefore actively retained while the converse (loss of genes with late benefit and early life cost) would be true as well.6 These ideas are elaborated upon in the related theory of disposable soma, whereby energy used for reproduction is siphoned away from somatic maintenance, and a roughly inverse relationship occurs between fecundity and longevity.7 Indeed, the discovery that genetic inactivation of the Notch ortholog glp-1 in the roundworm Caenorhabditis elegans renders them both sterile (glp-1 is required for germline stem cell proliferation) and long-lived initially lent strength to the idea of “costs of reproduction”.8,9

Additionally, genes which provide fitness advantage early in life which are later

15 detrimental may be harmful through both inactivation as well as through increased, deregulated activity, perhaps in compensation for some other age- related decay; this last concept is described by the hyperfunction theory.10

However, the simple inverse relationship of fecundity and longevity has been complicated by the observation that the germline of worms, specifically germline stem cells, directly signals to the soma to modulate longevity and therefore this signal itself, rather than energetic considerations, may be responsible for lifespan changes in the nematode.8,11 Fascinatingly, though this relationship is not ironclad, it is quite widespread; for example, Drosophila melanogaster fruit flies prevented from mating live longer lives.12,13 This may extend even to humans, as in a historical data set of British aristocratic families, female longevity correlated positively with age at first childbirth and negatively with parity, though it should be noted that confounding variables in human studies of longevity (advances in medicine, socioeconomic status) are notoriously difficult to account for and subsequent studies of other human cohorts have been inconsistent, identifying both positive and negative relationships of fertility with longevity.14 In part due to the difficulty of human studies, the field of aging, while historically descriptive, has expanded dramatically with the development of well-characterized experimental models allowing for unprecedented dissection of molecular and cellular characteristics of aging.

General strategies for studying aging

Strategies to study human aging are varied. Correlational studies in long- lived humans (e.g. supercentenarians) and monogenic disorders of premature aging (human progeroid syndromes) are two popular methods for investigating aging. Although too numerous to list here, large-scale sequencing efforts, genome-wide association studies, and quantitative trait locus mapping have been applied to compare centenarians/supercentenarians with controls to reveal novel insights, including the identification of longevity variants in the gene APOE (as well as others which are less well validated), the association of metabolic dysfunction with aging, and the characterization of exceptionally long lived people as a distinct phenotype from healthy individuals with normal lifespan.15-20

Several efforts have catalogued the results of these studies.21-23 Hutchinson-

Gilford progeria syndrome and Werner syndrome, diseases of so-called

“accelerated aging”, have in particular received attention (mutations in lamin A/C and Werner syndrome ATP-dependent helicase respectively), as they have implicated DNA damage and repair, cellular senescence and even mesenchymal stem cell function in aging.24 Culture of human cells and the study of cellular senescence in vitro has proven fruitful as well.25

Empirical features of aging on a population level have also been extensively documented and mathematically modeled; perhaps the best example of this is the exponential increase in risk of mortality, known as the Gompertz law. Other theoretical models from diverse fields have been utilized to explain longevity; notably, the reliability theory (originally used to understand lifespan of complex mechanical systems) proposes to produce a detailed and accurate

17 mathematical description of all the variables involved in aging and their respective relationships. Indeed, it posits that aging is simply a natural decay function of any complex, imperfect, yet highly redundant system and that redundancy is a key feature in explaining exponential increase in mortality.26

In recent decades, the field has benefited from the development of a diverse range of experimental animal models, many non-mammalian, which are genetically tractable and, importantly, have manageable lifespans. As human longevity experiments remain extraordinarily impractical, these models allow for the design of experiments providing evidence of causality, i.e. experiments which demand the measurement of lifespan after an intervention. Further, comparative analyses between similar animals with dramatic differences in lifespan have been useful in identifying longevity associated genes. The more experimentally tractable models include the budding yeast Saccharmoyces cerevisiae, the nematode Caenorhabditis elegans, the fruit fly Drosophila melanogaster, zebrafish Danio rerio, and more recently the African turquoise killifish,

Nothobranchius furzeri, along with the mouse and the rhesus macaque.27 Many aging phenotypes are shared broadly across phylogeny and in these models, although species specific differences exist. For example, S. cerevisiae are unicellular and exhibit yeast-specific aging in the age-associated accumulation of extrachromosomal ribosomal DNA.28 Generally however, invertebrate models of aging, especially yeast, worms, and flies, have allowed scientists to bring to bear powerful genetic approaches using genome-wide forward and reverse genetic screens to identify hundreds of aging genes involved in mechanisms and

18 pathways broadly conserved from yeast to human. In C. elegans, the use of genome-wide RNA interference libraries to target genes which modulate lifespan is today commonplace.29 Vertebrate models such as the killifish, mouse, and monkey offer the obvious advantage of more closely mimicking human aging, although with a commensurate increase in cost and time. Of note, the existence of an experimental toolkit and therefore manipulability of many of these models offers great advantages; however, several models do not have these characteristics, yet are rightfully the focus of special scientific attention due to other unique features. The naked mole-rat, Heterocephalus glaber, can live beyond 30 years, experiences negligible senescence (little age-associated alteration in fertility, low life-long cancer rate, unchanged basal metabolic rate, preserved vasoreactivity), and their risk of mortality, albeit based on limited data, does not increase with age.30,31 The Brandt’s bat, Myotis brandtii, is another such long-lived rodent with a maximum lifespan of over 40 years. Further, it exhibits the most extreme body mass/lifespan ratio known in mammals, as it weighs only

4-8 grams in adulthood; sequencing efforts have identified mutations in the growth hormone receptor/insulin-like growth factor 1 pathway.32

Coupled with studies in humans, these efforts have yielded a deeper understanding of the cellular and molecular basis of aging leading to the modern convergence on a set of features some have termed the “hallmarks of aging”.

Determinants of longevity, or the “Hallmarks of Aging”

Aging is a progressive and global decline in cellular and physiologic function, accompanied by an exponential increase in age-specific hazard of mortality and disease. It is composed of both stochastic (e.g. environmental) and deterministic (e.g. genetic) components.

Aging organisms share common molecular and cellular features; over time and across phylogeny, they display characteristic changes in mitochondrial health, resistance to oxidative stress, genomic maintenance, enhanced low- grade sterile inflammation, epigenetic modifications, proteostasis, susceptibility to development of senescence, and metabolic pathways. 33 Importantly, alterations in any of these processes modify the rate of aging, either accelerating or delaying it. Each of these is discussed in brief below with supporting evidence in experimental models referenced. Although each process is mentioned separately, they are intimately associated with each other and therefore modulation of one almost certainly impacts several simultaneously.

The role of mitochondria in aging has been proposed for decades, primarily through the mitochondrial free radical theory of aging.34 This theory postulates that the necessary result of aerobic metabolism is the release of highly reactive oxygen species (ROS) by mitochondria. Over time ROS can cause oxidative damage to diverse types of molecules in the cell leading to age- related dysfunction. In recent years, this view has fallen out of favor and increasing attention has been drawn to other roles of mitochondria in aging, including ROS localized in the mitochondria, the role of mtDNA mutations, and the important influence of mitochondria in conserved nutrient sensing pathways

20 known to influence longevity.35 Because of the central role of mitochondria in cellular homeostasis and metabolism, mitochondrial function and its decline are implicated in the pathogenesis of nearly every age-related disease.

Mitochondrial function and biogenesis declines with age, and mitochondria accumulate mutations in their DNA (mtDNA) in rats as well as humans.36,37

Enhancement of mitochondrial biogenesis or disposal can alter longevity in model organisms; caloric restriction and exercise both improve healthspan and lifespan through enhanced activity of PGC-1α.38,39 Enhanced activation of the mitochondrial kinase PINK1 and the cytosolic E3 ligase Parkin, which transduce mitochondrial damage signals to activate mitophagy, or Nix (BNIP3L), a

PINK1/Parkin-independent mitophagic pathway, extends lifespan in worms and flies.40,41 Another mitochondrial stress response pathway, the mitochondrial unfolded protein response (UPRmt) has also been implicated in longevity, as worms which have only a modest impairment of mitochondrial function via knockdown of a subunit of cytochrome C oxidase counterintuitively do not experience premature aging, but instead long life which requires elevated activity of the UPRmt.42 The UPRmt exerts many of its downstream effects through activating transcription factor associated with stress-1 (ATFS-1), which regulates a large set of genes involved in aging which promote longevity which are currently still being elucidated. Interestingly, ATFS-1 can translocate between the mitochondria and the nucleus, mediating direct mitochondrial-nuclear communication, suggesting that altered communication between the cell and mitochondria during aging may drive some aging phenotypes. Mitochondrial

21 metabolism and generation of ROS have been linked to cellular senescence; the role of p53 in senescence and tumor suppression may be in part occurring through the repression of the mitochondrial malic enzyme ME2 which converts malate to pyruvate, thereby allowing p53 to directly control cellular proliferation.43

Finally, mitochondria have an established role in influencing chronic inflammation as well; mtDNA activate the NLRP3 inflammasome, and reductions in NLRP3 activity are linked to enhanced healthspan.44

Mutations in mtDNA can play a role in determining lifespan, though this remains controversial; mice with a proof-reading-deficient version of the mitochondrial DNA polymerase g (D257A missense mutation in catalytic subunit) experience a higher frequency of somatic mtDNA mutations associated with shortened lifespan and premature kyphosis, osteoporosis, alopecia, and heart defects.45,46 However, more recent sequencing of mitochondrial DNA from these mice has found that the mutations induced by defective mitochondrial DNA polymerase g do not accumulate canonical mtDNA deletions associated with aging (e.g. a 4977bp deletion between two 13bp direct repeats at 13447-13459 and 8470-8482 containing seven polypeptide components of the mitochondrial respiratory chain and five tRNA genes for mitochondrial protein synthesis), and therefore cast doubt on the relevance of these mice to physiologic aging.47

Further, mutation of mitochondrial helicase Twinkle induces mtDNA deletions in mice; however, these mice have a normal lifespan.48

Telomere attrition over time contributes to cellular senescence and organismal aging. Telomeres are complexes at the terminal ends of DNA

22 strands, which allow the cell to distinguish them from free ends generated upon a

DNA double strand break and avoid initiating DNA repair mechanisms.49,50 They consist of telomere specific G-rich tandem repeats (in humans TTAGGG) in physical association with multiple DNA binding proteins. Due to the inability of

DNA polymerase to replicate to the very ends of DNA strands, telomeres are replicated via activity of telomerase, which utilizes an RNA template to repetitively add the telomeric sequence to the ends of genomic DNA. This enzyme is active in embryonic stem cells and many types of cancer, but not in somatic cells.51,52 Therefore, cells with low expression of telomerase over a period of time eventually may experience telomere shortening, which can contribute to organismal aging through complex mechanisms including cellular senescence, direct activation of apoptosis or defects in stem cell renewal.53

Although the role of telomere attrition and cellular senescence in organismal aging has been unclear, as many studies on the subject have been largely correlative, recent investigations have provided much stronger evidence for a causal role for telomere shortening and cellular senescence in promoting aging.

Constitutive expression of telomerase reverse transcriptase in mice resistant to cancer (overexpressing p53, p16 and p19ARF), to overcome the tendency of telomerase overexpression to be oncogenic, extended median lifespan.54

Further, adenoviral delivery of telomerase reverse transcriptase in aged mice similarly extended lifespan and elongated telomeres.55 A small molecular activator of telomerase can also elongate telomeres and improves glucose tolerance, osteoporosis and skin health in aged female mice; however, it does

23 not extend lifespan.56 Finally, the removal of p16(Ink4a) positive cells, a marker for senescent cells, systemically and in a life-long manner extends healthspan and lifespan in mice.57 The precise tissue specific contribution of various senescent cells and the mechanisms by which they contribute to organismal aging remain to be unraveled.

Chronic, systemic inflammation in the absence of infection, also termed inflammaging, is a hallmark of aging. It is characterized by elevated levels of interleukin 6 (IL-6), IL-1β, and tumor necrosis factor-α (TNF). Inflammaging is also mediated by transcriptional regulators such as nuclear factor kappa-light- chain-enhancer of activated B cells (NF-κB), as blockade of NF-κB activity removes markers of aging and extends mouse lifespan and healthspan.58-60

Several factors contribute in a complex fashion to inflammaging, including responses to endogenous damage associated molecular patterns (advanced glycation end-products, free radical modified proteins, etc.), mitochondrial activation of the Nlrp3 inflammasome, cellular senescence and secretion of proinflammatory cytokines (the senescence associated secretory phenotype), and alterations in coagulation pathways and immunity.25,61-68 Chronic inflammation has been linked to the acceleration of age-related diseases such as type 2 diabetes, atherosclerosis, and degenerative arthritis.69,70 As mentioned above, reduced Nlrp3 signaling can extend lifespan. Recently, inflammaging has been localized, in part, to the hypothalamus, wherein mice with hypothalamic specific delivery of dominant negative IκBα experienced extended lifespan and improved health including collagen cross-linking and bone mass.59 In fact, further

24 studies by the same group have shown that the hypothalamus may be uniquely critical in controlling systemic aging, as mid-life implantation of healthy hypothalamic stem/progenitor cells can extend lifespan partially via restored secretion of exosomal miRNAs.71

Epigenetic changes, or regulated alterations in gene expression independent of changes in DNA sequence (e.g. DNA methylation, post- translational modification of histones), function as a layer of regulation in nearly every aspect of biology. The importance of these changes in the aging process has recently been recognized. Particular changes in single epigenetic marks and broader changes to the epigenetic landscape have been identified as being highly associated with aging72, and manipulation of these marks or the enzymes responsible can modulate lifespan in model organisms like C. elegans.73-77 The reversal of these changes through cellular reprogramming approaches modulates health and lifespan. With the identification of four transcription factors,

Yamanaka factors (Oct3/4, Sox2, Klf4, c-Myc), capable of returning cells to a pluripotent state, many have recognized that this reprogramming process necessarily removes chromatin marks, including those associated with age.78,79

This has led to efforts to delay aging by intervening at the level of epigenetic regulation, while avoiding the tendency of in vivo dedifferentiation to cause formation of teratomas or other tumors.80-82

Homeostasis of the proteome, or proteostasis, is crucial to the health of the organism and requires constant surveillance by the cell. The cell achieves proteostasis via mechanisms including control of translational efficiency,

25 autophagy (primarily for the degradation of protein aggregates), proteasome- mediated degradation (degradation of misfolded proteins), and molecular chaperones (assisting in protein folding).83 An aging associated decline in a functioning proteome results in the accumulation of misfolded proteins, which contribute to a wide array of pathology, neurodegeneration (Alzheimer’s,

Parkinson’s, Huntington’s diseases) being particularly well-recognized.84 An extensive body of evidence links proteostatic mechanisms such as autophagy to longevity, reviewed elsewhere85; for example, mid-life rapamycin treatment to inhibit mTORC1 signaling extends lifespan in mice.86 Additionally, it is intuitive that enhanced function of molecular chaperones and improved protein folding will induce less proteotoxic stress. For example, heat shock factor 1, a transcriptional regulator of several molecular chaperones in response to heat stress, together with daf-16/FOXO in worms modulates lifespan via enhancing folding of protein aggregates.87 Misfolded proteins in the endoplasmic reticulum activate an unfolded protein response (UPRER) mediated by IRE1, PERK and ATF6 which upregulate molecular chaperones and reduce protein translation, presumably to lower the burden of protein folding in the ER. The role of the UPRER in aging has been confirmed through the observation that expression of a constitutively active

XBP-1, an effector downstream of IRE1 which is spliced into an active form, in worms extends lifespan in a cell-nonautonomous fashion.88

Finally, stem cell health and function contribute to organismal aging. Stem cells experience a decrease in regenerative capacity with age, as well as dysregulation of self-renewal mechanisms, potentially leading to depletion of the

26 stem cell pool or skewed lineage commitment. This has several consequences including a reduced immune response (immunosenescence) as circulating immune cells are not replenished89, an increased susceptibility to development of cancers, a reduction in osteogenic capability leading to osteoporosis and poor fracture healing90, and reduced muscle response to injury, among others91,92. The topic of stem cells and aging is an immensely complex one with unique discussions for stem cell niches in different tissues. Even further complicating their role, stem cells also exert systemic effects through the release of circulating factors; in elegant parabiosis experiments, these factors have been shown to improve neurogenesis and cognitive function in aged mice and to restore lifespan

93,94 in murine progeroid models.

Altogether, these cellular changes likely contribute to tissue dysfunction over time, leading to features of organismal aging which may be clinically observable, such as impairments in hearing and vision, glucose intolerance, decline in bone density and exercise capacity, deterioration of cognitive function, alterations in blood pressure and sympathetic activity, decreased immune function, changes in renal and pulmonary function, as well as a dramatic rise in age-associated pathology, notably cardiovascular and neurodegenerative diseases95-97. Evidence also exists to suggest that aging does not occur at the same rate across tissues (using DNA methylation prediction methods)98, and is non-cell autonomous, as systemic inflammation and circulating factors can affect aging in every organ in the body99,100.

Signaling pathways in aging

Conserved genes in model organisms modulate lifespan. Many of these genes have roles in classic nutrient sensing pathways. For example, insulin/insulin-like signaling (IIS), the target of rapamycin (TOR) pathway, AMP- activated protein kinase (AMPK), sirtuins, and pain receptor-mediated neuropeptide signaling have all been implicated as modifiers of the aging process, as the activity of these pathways has been shown to alter lifespan and health of organisms across phylogeny101-108.

The insulin/IGF-1 signaling (IIS) pathway was the first implicated in longevity, as age-1 (phosphatidylinositol 3-kinase, PI3K) and daf-2 (ortholog for

IIS receptor) mutant worms lived significantly longer than wild-type worms.109,110

This finding has been robustly corroborated in other experimental models inactivating various components of the pathway, a testament to its degree of conservation; Drosophila with mutant InR (insulin receptor) or chico (insulin receptor substrate) experience lifespan extension and mice with deficient IIS, either by white adipose specific insulin receptor loss, heterozygous loss of IGF-1 receptor, inactivation of the IIS responsive isoform of PI3K, increased gene dosage of Pten, and Akt1 haploinsufficiency are long lived as well.111-117 Further, many mouse models with exceptional longevity display reduced growth hormone and IGF-1 such as the dwarf Ames (Prop-1-/-), Snell (Pit-1-/-) and Little (GhrhR-/-

).118,119 Finally, several genetic polymorphisms in this pathway have been found

28 to be enriched in centenarians (IGF1R, IGF1, GHR, FOXO3A).120-122 In C. elegans, longevity of daf-2 mutants is entirely dependent on dephosphorylation and nuclear translocation of daf-16, a downstream FoxO transcription factor which regulates genes involved in stress resistance, fat metabolism, and immunity. 123,124

In response to nutrient status, the TOR pathway regulates cellular growth processes including protein translation, autophagy, stress-response genes, and ribosome biogenesis. In eukaryotes, two distinct TOR containing multimeric complexes (TORC1 and TORC2) partition growth required functions, with

TORC1 being the most well understood and linked to aging as it is the only complex sensitive to rapamycin inhibition. TORC1 phosphorylates ribosomal protein S6 kinase 1 (S6K1) and eukaryotic translation initiation factor 4E-binding protein (4E-BP) to control translation initiation, integrating TOR signaling with

AMPK and IIS, and autophagy.

Just as with IIS, a large body of evidence supports the role of TOR signaling in longevity, notably that even initiation of rapamycin treatment late in life in mice can extend both health and lifespan; these observations are consistent with lifespan experiments in several model organisms.86,125-127 Indeed, manipulation of the downstream effectors of TOR signaling S6K1 and 4E-BP also modulates longevity.

AMPK activation is another link between nutrient sensing and longevity. In addition to enhancing mitochondrial biogenesis, function and oxidation, effects mediated largely through PGC1-α,128 AMPK’s effects on lifespan are also

29 mediated through the cAMP-responsive element binding protein (CREB) signaling pathway and cAMP-regulated transcriptional coactivators

(CRTCs).129,130 AMPK extends lifespan in C. elegans and Drosophila and is required for lifespan extension by caloric restriction.131,132 Further, the effect of metformin on male mouse lifespan seems to be through activation of AMPK.133

The role of sirtuins in mitochondrial health and biogenesis is well- accepted, but their link to longevity remains unclear. The sirtuins are a highly conserved family of NAD-dependent deacetylases, with several studies in worms and flies demonstrating that increased activity of Sir2 extended lifespan; however, these studies were not replicable, and in one case found to be due to confounding effects from genetic background.134 Nevertheless, sirtuins have been shown in many experiments to be required for dietary restriction mediated lifespan extension, and overexpression of Sirt6 in male mice, but not female, extended lifespan in a modest manner.135,136 Additionally, a brain specific Sirt1 transgenic mouse demonstrated significant lifespan extension and delayed aging phenotypes.137 Sirtuins exert their effects on longevity through a variety of mechanisms, including regulation of PGC-1α and FOXO1 to affect mitochondrial health and oxidation38,138 as well as the mitochondrial unfolded protein response.139

Recent evidence also points to a role for pain sensation pathways in aging. Knockout of the transient receptor potential cation channel subfamily V member 1 (TRPV1) which detects high temperatures and painful stimuli in mice

30 extends lifespan through CRTC1/CREB signaling.140 While fascinating, this observation requires further investigation.

Interestingly, transcription factors often mediate the effects of longevity pathways (IIS, TOR, AMPK, etc.). Although upstream stimuli such as nutrient status or circulating hormones are diverse and the subsequent activation of signal transduction pathways is enormously complex, relatively few factors summate upstream inputs to effect cellular responses. These include (some are mentioned above) but are obviously not limited to FoxO, PGC-1α, HIF-1, heat shock factor 1, TFEB, SKN-1, and CREB. The transcriptional networks and regulatory architecture of longevity is not well understood; therefore, how these factors interact with each other, what controls their activity and their specificity for relevant gene targets remain unknown, as well as the potential existence of nodal regulatory points in the regulation of aging.

Chronic diseases in aging and extension of healthspan

Longevity is often, although not always, coupled to the prolongation of time spent free of age-associated disease. Indeed, in centenarians and supercentenarians, morbidity becomes compressed into the final decade of life such that 30% of centenarians have onset of their first age-associated disease after age 100 years while this cohort rises to an astonishing 69% for supercentenarians.141 Predicted by Fries in 1980, this “compression of morbidity” was taken also to imply that maximum human lifespan was limited to approximately 110 years.142 In light of recent findings, this view seems less likely;

31 however, as the mechanisms governing aging are elucidated, it is also becoming clear that extending healthspan is an equal, if not even more important, goal to lifespan extension. In fact, the potential to intervene in several diseases (which share aging as their primary risk factor) simultaneously by acting upon underlying aging processes is a major driver of aging investigations. However, the observation that healthspan and lifespan extension can be uncoupled even in model organisms suggests there are nuances to the biological regulation of lifespan vs healthspan that are currently not well understood.143,144 Indeed, merging basic knowledge of aging with chronic disease research remains nontrivial.

A broad spectrum of chronic diseases is recognized as aging-related.

These include, but are not limited to, cancer, diseases of the cardiovasculature

(e.g. heart failure, stroke, hypertension), neurodegenerative diseases (e.g.

Alzheimer’s, Parkinson’s), osteoporosis, and diseases of metabolic dysfunction

(e.g. diabetes). Their incidence rises with age, and manipulation of biological determinants of aging alters their progression.95 For example, caloric restriction, still the most robust intervention known to extend lifespan, improved glucose homeostasis, prevented diabetes, reduced body fat, reduced sarcopenia, cancer rates, cardiovascular disease, and preserved brain gray matter volume in aging rhesus monkeys.145,146

Below, we examine several hallmarks of aging in the context of aging- related diseases, in particular focusing on the role of a family of transcription

32 factors, the Kruppel like factors, recently introduced as novel regulators of longevity in addition to the aging pathways already described.

The Kruppel like factors in aging and aging associated diseases

The Krüppel-like factors (KLFs) are a family of transcriptional regulators with a C-terminal DNA-binding domain containing three C2H2-type zinc fingers recognizing a 5’-C(A/T)CCC-3’ sequence as well as other GC-rich sequences.

While this domain is well-conserved across the family, the N-terminal regions are much less so, allowing diverse protein-protein interactions as well as transactivation or repression. There are at least 18 mammalian KLFs with roles in nearly every major organ system regulating an array of cellular functions.147

Recently, using the model organism C. elegans, two of the three nematode KLFs have been shown to be regulators of lifespan148,149, providing the first evidence linking the KLFs to longevity and directing attention towards the question of whether functions controlled by mammalian KLFs might have similar effects on mammalian age-related health and longevity. While formal analyses of the KLFs and their influence on mammalian lifespan have yet to be performed, the KLFs regulate many of the above discussed molecular and cellular features of aging and have been implicated in mammalian diseases of aging (Fig. 1).

Telomere attrition

KLF4 is a direct transcriptional regulator of the telomerase reverse transcriptase (TERT)150. In human cells, the Tert promoter contains a KLF4 binding site near its transcriptional start site, and overexpression or knockdown

33 of KLF4 correspondingly altered mRNA transcript levels of Tert150. In embryonic stem cells and cancer cells, KLF4 interacts with β-catenin and poly(ADP-ribose) polymerase 1 to control Tert expression.151,152 In T cells, KLF2 has also been shown to repress Tert expression; this repression is relieved upon T-cell activation153.

Genomic stability

In addition to regulation of TERT, KLFs have roles in maintaining genomic stability. KLF4 is crucial for p53 mediated cell arrest154, and it differentially regulates the expression of several cell cycle checkpoint proteins, including the cyclin dependent kinase inhibitor 1A (CDKN1A), cyclin B1, and cyclin D1 in response to DNA damage155-157. Further, Klf4 null mouse embryonic fibroblasts exhibit centrosome amplification, numerous chromosomal aberrations, and aneuploidy, which can be rescued upon re-introduction of Klf4, and KLF4 is protective against γ-irradiation induced damage via inhibition of cyclin E158-160.

KLF5 suppresses expression of the CDK inhibitor p27 and therefore promotes cell proliferation and oncogenesis in a triple negative breast cancer cell line161,162.

Conversely, KLF6 positively regulates CDKN1A to inhibit cell proliferation in prostate cancer163. In a human endometrial epithelial cell line, KLF9 has been shown to upregulate CDKN1A164. KLF14 also has roles in protecting the genome, as its deletion in a mouse leads to centrosome amplification and aneuploidy while promoting spontaneous tumorigenesis through its regulation of polo-like kinase 4165.

Cancer

Genomic instability and telomere shortening, which are integral to the aging process, have long been implicated in cancer166,167. Cancer is gaining increasing recognition as an age-associated disease; the incidence of cancer rises dramatically after sexual maturity168. Indeed, KLF regulation of these processes is reflected in the abundant literature surrounding roles for the KLFs in tumorigenesis or tumor suppression, although direct mechanistic links are still being established. Numerous members of the family have complex roles in cancers; these roles have been elegantly reviewed in detail169. In particular, several KLFs (KLF4, KLF5, KLF6, KLF10, KLF13) exert their influence on cancer by targeting genes involved in regulating the cell cycle and therefore cell proliferation169. For example, KLF4 functions mainly as a tumor suppressor. In colorectal cancer, elevated activity of von Hippel-Lindau (pVHL) protein degrades

KLF4 and reduces expression of its target gene p21, leading to escape from cell cycle arrest, while expression of a mutant KLF4 lacking pVHL ubiquitylation sites greatly reduces colony formation in vitro in a colorectal cancer line170. KLF4 transcript levels are low in multiple types of tumors, and KLF4 is anti-proliferative in cervical carcinomas, pancreatic cancer, bladder cancer, gastric cancer, and lung cancer 171-179. However, reflective of its complex role in cancer, KLF4 has been reported to be overexpressed in breast cancer and squamous-cell oropharyngeal cancers180,181, and in specific contexts such as genetic p21 inactivation or ectopic expression of mutant RASv12, KLF4 induces expression of p21 and represses p53182. Splice variants of KLF4 can also be oncogenic. KLF4α

35 is upregulated in pancreatic cancer cell lines and increased KLF4α expression enhances in vivo tumor formation183.

KLF regulation of inflammation

The Krüppel-like factors are expressed in various cells of the innate and adaptive immune system. Several KLFs have pro- or anti-inflammatory functions in myeloid cells, including KLF1, KLF2, KLF3, KLF4, KLF5, KLF6 and KLF10184-

187. In particular, KLF2, KLF4, and KLF6 have established roles in macrophage inflammatory gene expression. KLF2 is a negative regulator of monocyte activation and inhibits the activity of NF-κB and activator protein 1188. As a result, mice with myeloid-restricted loss of KLF2 have higher plasma levels of IL-1β and

TNFα189. In vivo, KLF4 modulates macrophage polarization, cooperating with

STAT6 to induce expression of arginase-1, the mannose receptor, and resistin- like α, while loss-of-function of KLF4 enhances expression of TNF-α, COX-2,

MCP-1, and RANTES190. KLF6 loss in vitro and in vivo strongly reduces the induction of pro-inflammatory genes by LPS such as IL-1α, IL-1-β, and TNF-

α191,192.

Dendritic cells (DC) function both as antigen-presenting cells to facilitate T cell education and activation and as major producers of cytokines and chemokines. Recent studies have identified KLF2 and KLF4 as mediators of DC functions. KLF4 is expressed in DCs; its depletion impairs development of pre- classical DC progenitors in the bone marrow, and its presence is required for maintenance of CD11chi DCs in the spleen193,194. KLF4 in DCs influences adaptive immunity, as it has been shown to be required for type 2 helper T cell

36 responses to pathogens such as Schistosoma mansoni194. Importantly, KLF4 in

DCs contributes to systemic inflammation via production of IL-6 and may drive differentiation of inflammatory DC subtypes195,196.

Arthritis, atherosclerosis, metabolic disease

The functional consequences of KLF regulation of inflammation are most well known in the contexts of arthritis, atherosclerosis, and metabolic disease; the incidence of these diseases increases with age. KLF2 regulation of monocyte activation has functional consequences as methylated-BSA and IL-1β induced arthritis is exacerbated in KLF2 hemizygous mice197. Additionally, KLF2 deletion in the myeloid compartment exacerbates atherosclerosis in an LDLR null mouse model198. In an ApoE null model of atherosclerosis, loss of myeloid KLF4 also increases atherosclerotic lesion burden199. Macrophage KLF4 also has roles in metabolic syndrome; KLF4 levels in macrophages isolated from human adipose tissue is correlated with adiponectin and obesity190. In these same patients, KLF4 levels in visceral fat were found to be lower than in subcutaneous fat190. In mouse models, KLF4 deficient macrophages have a higher glucose intake, and mice with myeloid specific deletion of KLF4 gain more weight on high-fat diet as well as developing insulin resistance190. Further, myeloid KLF4 deficiency delays wound healing due to increased iNOS and TNF-α while not affecting cell migration190. Finally, DCs with loss of KLF2 express higher levels of CD40 and

CD86, and mice with DC specific deletion of KLF2 (Itgaxcre-cre mice) in a model of atherosclerosis develop larger atherosclerotic lesions, but without an increase in macrophage content within the lesions200.

Autophagy and molecular chaperones

In C. elegans, increased activity of either klf-1 or klf-3 not only extends nematode lifespan but also delays the appearance of age-associated phenotypes such as a decline in locomotory speed149. This lifespan extension is mediated through KLF regulation of autophagy, and this function is conserved by mammalian KLF4. KLF4 directly regulates genes involved in the autophagy molecular machinery across multiple steps in the pathway, and this broad transcriptional regulation of autophagy by KLF4 occurs in the cardiovasculature149,201. In mouse embryonic fibroblasts and a multiple myeloma cancer model, loss of KLF4 leads to reduced autophagy202-204. In endothelial cells, KLF2 and KLF4 have also recently been shown to regulate autophagy, potentially in response to laminar shear stress149,205. In the liver, KLF6 has also been shown to be a positive regulator of autophagy related genes Atg7 and

Becn1206.

Several KLFs regulate the expression of molecular chaperones. In BALB/c

3T3 cells, KLF6 binds to a cis-acting element in the first intron of the collagen specific Hsp47 gene to regulate its expression207. Recently, KLF4 has also been shown through gain and loss-of-function studies to affect expression of heat shock proteins 84 and 86 (the two versions of heat shock protein 90) and heat shock cognate 70 in C2C12 and RAW264.7 cells and is upregulated by heat shock transcription factor 1 in response to heat stress208-210. Finally, during epidermal keratinocyte differentiation, the unfolded protein response is strongly activated simultaneously with increases in Klf4 mRNA transcript levels and

38 treatment with ER stress-inducing reagents such as tunicamycin upregulates

Klf4211.

Vascular aging and heart failure

Proteostasis is linked to numerous aging-associated diseases84. KLF regulation of autophagy has been linked to vascular aging, as a transgenic mouse overexpressing KLF4 in an endothelial cell specific manner experiences delayed endothelial senescence and improved vascular reactivity with age149.

Importantly, the maintenance of vascular reactivity with age was abolished with blockade of autophagy by chloroquine149. Additionally, KLF4 is a broad regulator of autophagy related genes in cardiomyocytes, and in a model of heart failure, loss of KLF4 exacerbated cardiac dysfunction201. The contribution of the endothelium to organismal aging is an important question which is recently attracting attention. With aging, an increasing number of endothelial cells undergo senescence and secrete soluble, usually pro-inflammatory factors (IL-1,

IL-6 and IL-8) which contribute to low-grade systemic inflammaging and the development of age-associated cardiovascular disease212. KLF2 and KLF4 have well-known functions in the endothelium as anti-inflammatory, antiadhesive, and antioxidant factors, and overexpression of KLF4 in the endothelium is protective against atherothrombosis. Whether these functions are dependent on KLF regulation of autophagy remains to be seen213-216.

Stem cells in intestine, skin, breast, and muscle

The KLFs regulate stem cell renewal in a variety of tissues. In the intestinal crypt, proliferating stem cells express KLF5, which controls stem cell maintenance and proliferation217. In addition, KLF5 regulates epithelial differentiation and migration expression in part through regulation of genes including Ki-67, cyclin B, cyclin-dependent kinase 1 and cyclin D1217. As a result, intestine-specific loss of KLF5 leads to neonatal lethality due to impaired epithelial barrier function218-221. KLF4 is expressed in the differentiated compartment of the intestinal epithelium and serves to arrest growth and maintain those cells in a terminally differentiated state217. Additionally, both KLF5 and KLF4 are implicated in the development of intestinal cancers179,182,222-225. In the skin, KLF4 also contributes to epithelial barrier integrity226 and is expressed in hair follicle bulge stem cells. Its loss has been shown to inhibit cutaneous wound healing, suggesting a role in maintaining stem cell numbers in this niche227, and lowered expression of KLF4 has been correlated with incidence of squamous cell carcinoma and basal cell carcinoma228. KLF4 expression is also elevated in mammary gland stem cells229 and hematopoietic stem cells230. In muscle, KLF5 is induced after injury in differentiating myoblasts, and satellite cell-specific loss of KLF5 impairs muscle regeneration231.

Hematopoiesis

A number of KLFs are major regulators of aspects of hematopoiesis. KLF1 is restricted to erythroid cells and promotes erythropoiesis while inhibiting megakaryopoiesis232,233. KLF2 is also expressed in erythroid cells and KLF1 and

KLF2 promote erythropoiesis through regulating embryonic β-like globin gene

40 expression234,235. In thymocytes, KLF4 represses CDKN1b/p27Kip1 to decrease thymocyte proliferation236. Loss of KLF6 in mouse embryonic stem cells reduces their capacity to differentiate into hematopoietic and vascular cells, although the mechanism remains unclear237. KLF7 is expressed in hematopoietic progenitors, and overexpression of KLF7 suppressed myeloid progenitor cell growth while sparing T cells238. Finally, in human bone marrow stromal cells, overexpression of KLF2 increased cell proliferation and upregulation of Oct4, Nanog and

Rex1239.

Embryonic stem cells

In mouse embryonic stem cells, KLF2, KLF4, and KLF5 are recognized to be involved in maintaining a pluripotent state, and they form an internal regulatory circuit by binding to promoter regions of Oct4, Sox2, and Nanog, which then bind to promoters of the KLFs240,241. Oct4 regulates KLF2, while the leukemia inhibitory factor/Stat3 pathway regulates KLF4 expression. Expression of KLF2 or KLF4 in postimplantation embryo-derived, epiblast-derived stem cells restores naïve pluripotency242. KLF4 itself has well known roles in embryonic stem cell differentiation and self-renewal243,244. Recently, acetylation status of

KLF5 has been shown to suppress expression of genes related to differentiation and enhances the ability of KLF5 to maintain pluripotency in mouse embryonic stem cells245. Interestingly, expression profiling of mouse embryonic stem cells undergoing differentiation identifies expression changes in nearly all the members of the KLF family, an observation which may be explained by

41 competition by each KLF for occupancy of the same promoter regions in genes determining self-renewal246.

Nerve regeneration

An intriguing role for the KLFs in regulating axon growth of central nervous system neurons has been described247. KLF6 and KLF7 promote neurite growth, while nine KLFs (KLF1, KLF2, KLF4, KLF5, KLF9, KLF13, KLF14, KLF15, and

KLF16) suppress it248,249. Schwann cells overexpressing KLF7 grafted into mice improve sciatic nerve regeneration and enhance myelination after nerve injury250 and overexpression of KLF7 engineered to be transcriptionally active promote regenerative axon growth in cortical slice cultures after axon injury251. Further investigation into KLF regulation of stem cell renewal in the context of aging will improve efforts to delay the effects of aging on stem cell maintenance.

Mitochondrial health

Krüppel-like factors have a critical role in the maintenance of mitochondrial health and function. Within the kidney, mitochondrial health has been linked to several glomerular pathologies, including congenital human nephrotic syndrome, collapsing focal segmental glomerular sclerosis, and adriamycin-induced nephropathy252-255. Podocyte-specific loss of KLF6 leads to the appearance of dysmorphic mitochondria and reduced expression of genes involved in mitochondrial replication, such as Nrf1, Polrmt, and Tfam as well as other genes involved in mitochondrial function256. Further, these mice were more susceptible to adriamycin-induced injury to the kidney. In humans with focal segmental

42 glomerular sclerosis, KLF6 expression is lower256. In the heart, loss of KLF15 leads to formation of megamitochondria, suggestive of a defect in cellular control of mitochondrial fission257. Additionally, cardiomyocyte KLF4 regulates mitochondrial biogenesis, dynamics, and energetics in part via synergistic interaction with estrogen-related receptor α and PPARγ coactivator 1 α201. Mice with early (E9.5) cardiac-specific deletion of KLF4 demonstrated 50% mortality two weeks after birth and surviving mice displayed reduced mitochondrial volume density, increased fragmentation, and a 30% decrease in mitochondrial genomic

DNA content201. These mice also had severely reduced cardiac contractile function, presumably due to the requirement of mitochondrial biogenesis for cardiac adaptation to postnatal developmental conditions201. In mice with KLF4 deletion after birth, KLF4 deficiency resulted in an inability to adapt to pressure overload induced by transaortic constriction, and mice aged to 9 months exhibited reductions in cardiac contractile function compared to control mice201.

Epigenetics and cellular reprogramming

The reversal of age-associated changes in the epigenetic landscape presumes a causal role for these marks, and therefore several efforts have been made to utilize cellular reprogramming technologies (e.g. Yamanaka factors) to induce cells to return to a so-called younger state. In this respect, KLF4 is perhaps the most well-known of the KLFs and has been used in many reprogramming approaches. As with Oct4 and Sox2 (but not c-Myc), Klf4 acts as a pioneer factor, accessing target sites in areas of DNaseI-resistant, unmodified,

“silent” chromatin to activate transcription258. Indeed, short-term, cyclic systemic

43 expression of Oct4, Sox2, c-Myc and Klf4 restores epigenetic markers of aging such as levels of H3K9me3 and H4K20me3 while improving age-associated tissue decline and extending lifespan in a murine progeria model259.

Fig. 1. Kruppel like factor regulation of aging.

Anti-aging interventions

As mentioned above, methods of restricting nutrient entry (caloric or dietary restriction) remain the most robust lifespan extending interventions known to date. Further, recent studies have suggested that macronutrient composition, in particular low-protein and high-carbohydrate diets or selective amino acid restrictive diets (e.g. methionine) are sufficient to mimic the effects of caloric restriction, thereby providing a more feasible regimen for clinical translation as well as scientific insights into the effects of caloric restriction on aging.260,261 An interesting example is tryptophan restriction, which extends lifespan and delays cancer and other aging phenotypes like hair loss in rats, and was correlated with low brain serotonin levels.262,263 Fasting regimens as well, can provide longevity benefits; a four day diet mimicking fasting in mice extended lifespan, promoted hippocampal neurogenesis, and rejuvenated progenitor stem cell populations.264

A central challenge of aging research is how to leverage current understanding of the underlying mechanisms of the aging process to produce an intervention which can prolong health and lifespan in humans. Pharmacologic approaches have yielded results in this area, including IIS inhibition (e.g. metformin), dietary regimens (e.g. periodic fasting), rapamycin or other mTOR pathway inhibitors, AMPK activators, sirtuin activators, and even inhibitors of

Ras-Erk-ETS signaling (e.g. trametinib)265,266. In this respect, the KLFs may represent attractive targets. Many of the agents identified thus far correspondingly induce or suppress KLF expression depending on their effects,

46 such as metformin267, fasting268, rapamycin269, the AMPK activator AICAR (5- amino-1-β-D-ribofuranosyl-imidazole-4-carboxamide)270, and the sirtuin activator resveratrol271, and importantly, the KLFs have been shown to be broadly required for lifespan extension mediated through many of these targeted pathways, as will be discussed below.149

CHAPTER 2: METHODS Portions of this chapter are published in Nature Communications 8(1):914; Oct

2017149,b

Strains, maintenance and preparation N2 Bristol was used as the wild-type strain. The following mutant strains were used from Caenorhabditis Genetics

Center (CGC, University of Minnesota, Minneapolis, MN, USA): klf-1(tm731), klf-

2(ok1043), klf-3(ok1975), daf-2 (e1370), eat-2(ad1116), clec-186, nlp-24, nhx-

2p::rde-1, dopaminergic neuron specific RNAi nematode. For GFP::LGG-1 puncta visualization, adIs2122 Ex [lgg-1p::GFP::lgg-1 + rol-6(su1006)] was used.

Worms were maintained and prepared by standard methods that included culture on nematode growth medium (NGM) plates and age synchronization.272 The pre- fertile period of adulthood was identified as t = 0. All strains were out-crossed at least 3 times with N2 nematodes.

Generation of transgenic and mutant C. elegans lines Transgenic worms over-expressing klf-3 or klf-3 zinc finger mutant were generated as described.273

Specifically, klf-3 genomic DNA was under the control of putative native promoter

(~2.5kb upstream of start codon) or ges-1 and selective markers such as

Discosoma sp. red fluorescent protein (DsRed) or GFP were under the control of the promoter of myo-3 or myo-2. For intestinal restricted nematodes overexpressing klf-3, klf-3 genomic DNA was under the control of a ~3kb region upstream of ges-1, and assembled by Gibson assembly and sequenced. For nematodes overexpressing mutant klf-3, a 258 nucleotide C-terminal deletion b This work is a derivative of A conserved KLF-autophagy pathway modulates nematode lifespan and mammalian age-associated vascular dysfunction by the authors listed, under a Creative Commons CC BY license.

48 which included the entire zinc-finger containing region was generated using the

QuikChange II Site-Directed Mutagenesis Kit. Double mutant daf-2;klf-3 and eat-

2;klf-3 were generated by crossing hermaphrodite daf-2 or eat-2 animals to klf-3 males and genotyped by PCR or by placing worms at 25ºC at which daf-2 mutants enter the dauer stage. Primer sequences used were 5’ gcaaaagaggatgggaatca 3’ (forward primer outside of deleted region), 5’ gtaggtggtctagtaccact 3’ (forward primer within deleted region), 5’ aaagcaaaaatgacatcgcc 3’ (reverse primer) for klf-3 and 5’ ctctagagttggctaaccttc

3’, 5’ gaacgcttgcaaattcgctgc 3’ for eat-2. Promoter of dat-1 was cloned and linked to αSyn or DsRed and integrated by UV/TMP with 4x backcross.274

RNA-interference (RNAi) clones The identities of all RNAi clones were verified by sequencing the inserts using the M13-forward primer. All clones were from

Julie Ahringer's RNAi library. HT115 bacteria transformed with RNAi vectors expressing dsRNA of the genes of interest were grown at 37 °C in LB with 10

μg/ml tetracycline and 50 μg/ml carbenicillin, and then seeded onto NGM- carbenicillin plates.

Dietary restriction treatments Solid agar dietary restriction (sDR) in C. elegans, a particular form of food restriction requiring the action of AMPK, was performed.275 Briefly, adult worms were transferred every 2 days onto freshly seeded plates at 108cfu/mL at day 5 of adulthood and lifespan measured.

100μg/mL carbenicillin and 50μg/mL kanamycin was applied to bacteria prior to seeding on plates to arrest growth. For cell culture experiments, starvation was accomplished via replacement of media with DPBS for the 1 hour before harvest.

Rapamycin treatments Rapamycin (LC laboratories) treatment in C. elegans was carried out by dissolving rapamycin in DMSO to 50mg/mL and adding to agar plates to 100uM concentration.276 Control plates contained equal concentration of DMSO only. Rapamycin treatment in cell culture was performed by dissolving rapamycin in DMSO and adding to cell culture media to 20ug/mL.

Cells were incubated for 24 hours before harvest.

Lifespan analysis Lifespan assays were carried out at 20°C as described.87,109

Animals were grown at 20 °C on NGM plates for at least two generations before the experiments were initiated. RNAi treatments were carried out by adding synchronized eggs to plates containing bacteria with an empty vector (L4440) and then transferring the larva to plates seeded with the RNAi bacteria 3 days later (L4/Young Adult). Nematodes were moved to plates with fresh RNAi bacteria every 2 days until reproduction was completed and then moved to new plates every 5–7 days for the rest of the life span analysis. Viability of the nematodes was scored every 2–3 days. In all experiments, the pre-fertile period of adulthood was used as t = 0 for life span analysis. 60-180 animals per strain per assay were used and valid animal number varied from approximately 40 to

170. Mean life is defined as the day in adulthood where 50% of the population have died. In all cases, the log-rank (Mantel-Cox) test was used to test the hypothesis that the survival functions among groups were equal.

Autofluorescence quantification Experiments were performed with a TCS SP2 confocal microscope (Leica Microsystems, Bannockburn, IL, USA) as described.277 Wavelengths used were 420-440 nm (λem).

Reproduction analysis Reproduction was analyzed as described with modification.278 Progeny was counted every 12 hours instead of daily.

Pharyngeal pumping Synchronized worms were placed on plates in the presence of OP50, left overnight, and the number of pumps (as determined by number of backward grinder movements in the terminal bulb) was counted for

15-30 seconds (or the length of time for 60 grinder movements), then converted to pumps per minute. At least 10 animals per group were measured and averaged.

Transmission electron microscopy Whole animals were fixed by sequential immersion in triple aldehyde-DMSO, ferrocyanide-reduced osmium tetroxide, and acidified uranyl acetate; dehydrated in ascending concentrations of ethanol; passed through propylene oxide; and embedded in Poly/Bed resin (Polysciences

Inc., 21844-1). Thin sections were sequentially stained with acidified uranyl acetate, followed by a modification of Sato’s triple lead stain, and examined with a JEOL 1200EX electron microscope.279 All EM images were independently analyzed by an EM expert from the Electron Microscopy Facility, Case Western

Reserve University, and autophagic vesicles were identified as described by

Zhang et al.280

GFP-LGG-1 puncta quantification Autophagy was assessed using a

GFP::LGG-1 translational reporter characterized previously.281 GFP-positive puncta were counted in 30-150 total hypodermal seam cells in 10-20 animals, averaged, and analyzed by two-tailed Student t-test.

Quantification of Locomotion Activity

Locomotion behavior was assayed on NGM plates every other day throughout life span using an automated worm-tracking system (Worm Tracker) described previously.282,283 The Worm Tracker consists of a stereomicroscope (Zeiss Stemi

2000C) mounted with a digital camera (Cohu 7800) and a digital motion system

(Parker Automation) that follows worm movement. A customer-developed software package was used to control the system. Worm images were recorded at 2 Hz for 2 min, and the mean centroid speed of each worm was quantified and displayed in real time. The entire process was recorded by an automated worm- tracking system. The vision data were compressed and stored as a commonly used multimedia file format (AVI), and first 30 seconds discarded. P values were generated by two-way ANOVA with the Tukey post hoc using Sigmaplot 12 software.

Basal slowing responses Animals with and without food were counted and measured as previously described.274,284

EC isolation. Cardiac microvascular endothelial cells were isolated from the heart tissue of mice using a standard technique as previously described with a minor modification.285 Briefly, the hearts were washed in cold PBS, minced with blades, digested in PBS containing 1%BSA, collagenase type I, 1mM CaCl2, and

1 mM MgCl2 at 37oC for 45 minutes. ECs were purified by using Dynal bead- conjugated anti-PECAM antibody (BD Biosciences, San Jose, CA, USA). ECs were pooled from 6 mice (2 mice per isolation for biological triplicate), and immediately harvested for fresh RNA.

RNA extraction and qPCR C. elegans samples were homogenized in TRIzol reagent (Life Technologies, 15596-026) with a TissueLyser (Qiagen) or subjected to at least three freeze-thaw cycles. Cell samples were directly dissolved in

TRIzol reagent. Total RNA was extracted, treated with DNase I (Life

Technologies, 18068015), purified using the High-Pure RNA isolation kit (Roche,

11828665001) or Aurum Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad, 732-

6830), and reverse transcribed to complementary DNA using the iScript Reverse

Transcription Kit (Bio-Rad, 170-8841). For single worm RNA-seq, RNA was isolated by the method described by Snell et al. quality assessed on

Bioanalyzer.286 qPCR was performed with either the TaqMan method (Roche

Universal ProbeLibrary System) or the SYBR green method on a ViiA 7 Real-

Time PCR System (Applied Biosystems). Relative expression was calculated using the ΔΔCt method with normalization to mammalian GAPDH or C. elegans act-1. Primers from the RT² Profiler PCR Array Mouse Autophagy (Qiagen) were used.

Western Blot analysis Protein from cultured cells or tissues was extracted using

RIPA buffer (Sigma-Aldrich, R0278) supplemented with proteinase and phosphatase inhibitor cocktails (Roche, 4693132001 and 4906845001). LC3B

(Cell Signaling, 3868) was used for LC3-I lipidation assays. KLF4 (Santa Cruz

(H180) SC-20691), eNOS (BDBiosciences, 610297) were used for other Western analyses. Bio-Rad Quantity One software was used for quantitation of LC3-

II/LC3-I ratios.

Whole transcriptome sequencing RNA was sent to the Center for Advanced

Technology at the University of California San Francisco for analysis.

Cell Culture and Viral Infection HUVECs (Lonza) and HEK293 cells (ATCC

CRL-1573) were cultured as described previously.216 All lines were authenticated by respective sources and tested for mycoplasma. Expression plasmid (KLF4) and adenoviral KLF4, have been described previously.216 Efficacy of infection was assessed by qPCR of total cellular RNA isolated from the respective cell source. The adenovirus overexpresses human KLF4 (Ad-K4). Effects on gene expression in all overexpression experiments were assessed 2 days after virus infection. Appropriate empty viral constructs were used as controls. Knockdown of KLF4 was achieved using Dharmacon On-Target siRNA plus (J-005089-09,

9314; K4−/−) and appropriate non-targeting siRNA control (D-001810-01-05;

NS). Effects on gene expression were assessed 2 days after transfection. Atg7 knockdown was achieved using si-Atg7 (Thermo Fisher, 135754).

Chromatin Immunoprecipitation MEFs (2 × 107) were fixed with 1% formaldehyde, and chromatin was extracted and sonicated using a BioRuptor

(Diagnode), performed in triplicate. The sonicated chromatin was immunoprecipitated with 2 to 5 μg of anti-KLF4 antibodies (Santa Cruz, sc-

20691) bound to Protein A/G beads (EMD Millipore, 16-663), followed by extensive washing and elution. Chromatin was then reverse cross-linked, followed by purification of genomic DNA. Target and nontarget regions were amplified by qPCR in both the precipitated and input samples. A locus upstream of GATA6 was used as a nontarget control.

Chloroquine treatment Mice were injected once daily (30mg/kg i.p.) with chloroquine (Sigma) in saline for 8 days. Mice were assessed by echocardiography at baseline prior to initiation of chloroquine treatment, and same mice were assessed again after treatment.

Acetylcholine infusion CADcre (N=6) and ECK4KO (N=9) mice, male, 5-7 months old after bone-marrow transplantation for 8 weeks were used for this experiment. Mice were anesthetized with Avertin (0.25 mg/g, i.p.) and restricted on a temperature controlled small animal table to maintain physiological body temperature during experiment, a jugular vein catheter was used for continuous acetylcholine infusion. Echocardiography was performed using a Vevo 770 High-

Resolution Imaging System equipped with an RMV-707B 30-MHz probe

(VisualSonics). M-mode sampling was used through the upper abdominal aorta long axis, images were recorded under baseline and then after continuous acetylcholine infusion (2 μg/kg/min, 10 μL/min, Sigma-Aldrich, St Louis, Mo) for the indicated time intervals. The abdominal inner diameter at end-systolic and end-diastolic were analyzed through abdominal aorta M-mode image.

Microscopy A Leica TC1 SP2 confocal microscope was used for all neurodegeneration imaging. For DsRed, spectra were λex = 543nm and λem = 580–

630nm. For GFP, spectra were λex = 488nm and λem = 510–530nm. Living worms were immobilized with 30mM sodium azide on 5% agarose pads for in vivo imaging. Counting of dopaminergic neurons was performed manually according to its position, fluorescent intensity, and dendrite location.274 Images were

55 captured using a Leica TCS SP2 confocal microscope software and processed with National Instruments Vision Assistant 7.1.

Immunostaining and histologic and morphometric analysis Perfusion-fixed aortas were embedded in paraffin and cut into 7-μm-thick sections. Images were of whole aorta were taken at 100x magnification and at 400x magnification.

Medial thickness, lumen diameter and area were quantified using Image-Pro Plus software (Media Cybernetics). Trichrome staining of tissue was performed using the Gomori’s Trichrome Stain kit (Thermo Scientific) according to the manufacturer’s instructions. Collagen deposition was quantified using Image-Pro

Plus software by recognizing area stained blue versus total area of interest

(intermuscular area/total area *100). For each vessel, nine-ten images at 400x magnification were quantified. Elastin staining of aortic sections was performed on perfusion-fixed aortic cross sections using Elastin Stain kit (Sigma) according to the manufacturer’s instructions. An elastin break was defined as a distinct discontinuity in a singular concentric lamellar ring of elastin. The total number of elastin breaks in a whole vessel cross section was counted as a single data point. The aortic sections being compared were from the same aortic level for each mouse. Measurements were performed by two independent and blinded observers. Vessel diameter was quantified from elastin-stained circular aortic sections. We calculated lumen diameter as the mean distance between internal elastic laminae on diametrically opposite sides of the vessel ring. α-smooth muscle actin staining was performed using α-smooth muscle actin Cy3 (C6198) antibody from Sigma-Aldrich and 4′,6-diamidino-2-phenylindole (DAPI)

56 counterstaining. 10μm thick cryosections were received from the Cleveland Clinic

Histology Core. Muscle was encased in tragacanth gum and flash frozen in liquid nitrogen cooled isopentane. Samples were stored at -80oC until analysis.

Samples fixed in 10% neutral buffered formalin were blocked with 5% normal goat serum and 2% BSA before incubation with primary antibodies for KLF4

(Santa Cruz, SC20691) and CD31 (BD Pharmingen, 550389) diluted 1:100 in blocking buffer overnight at 4°C. 1:100 dilution was chosen after CD31 titration to avoid saturation conditions. Secondary Alexa fluor-488 goat anti-rabbit (life technologies, A11008), and -594 goat anti-mouse (Invitrogen, A11032) diluted

1:200 in blocking buffer were incubated for 2 hours at room temperature.

Following treatment with TrueBlack Lipofuscin Autofluorescence Quencher

(Biotium, 23007), slides were mounted with mounting medium for fluorescence with DAPI (vector H-1200). 3 complete sections were evaluated for each subject.

Images covering the entire area of each section were collected and analyzed by a blinded researcher. Images were captured with Leica DMI 6000 B and analyzed using image J. Endothelial area was defined by CD31 positivity. KLF4 levels in those regions was then assessed by fluorescent intensity and normalized to CD31 intensity; we did not find CD31 intensity to vary significantly between different biopsies.

In vitro hemodynamic flow model To generate fluid shear stress, a cone and plate viscometer were used as described previously.287 Briefly, the cone was placed into the 60-mm dish which contains a confluent monolayer of endothelial cells in culture media. Cells were either exposed to laminar flow (shear stress of

17 dyne/cm2) or maintained under static condition for 24 hour at 37oc in a 5%

CO2 incubator. After siRNA knockdown of Atg7, protein was isolated after 24 hours of flow, at which time a steady-state flow-dependent phenotype emerges.

Mouse models All animal studies were carried out with permission, and in accordance with, animal care guidelines from the Institutional Animal Care Use

Committee (IACUC) at Case Western Reserve University.EC-Klf4–/– mice were generated by mating floxed Klf4 mice (gift from K. Kaestner, University of

Pennsylvania, Philadelphia, Pennsylvania, USA) with VE-cadherin–driven Cre mice backcrossed into the C57BL/6 background (B6.Cg-Tg [Cdh5-cre] 7Mlia/J;

The Jackson Laboratory). Endothelial restricted KLF4 transgenic mice were generated in our laboratory using the human KLF4 coding sequence under control of the VE-cadherin promoter (gift from K. Walsh, Boston University,

Boston, Massachusetts, USA). All mice are on a C57BL/6J background. Mice were housed in a temperature- and humidity-controlled specific pathogen–free facility with a 12-hour-light/dark cycle and ad libitum access to water and standard laboratory rodent chow.

Vascular distensibility and echocardiography Mice were anesthetized with

Avertin (0.25 mg/g i.p.), and transthoracic echocardiography was performed using a Vevo 770 High-Resolution Imaging System equipped with an RMV-707B

30-MHz probe (VisualSonics). Standard M-mode sampling was used at the ascending aorta, and artery diameter at systole and diastole determined using the system software. Distensibility was calculated using the following formula:

58 distensibility = (systolic diameter-diastolic diameter)/diastolic diameter X 100%.

Control (C57BL/6J) at 3 and 10-14 months old and EC-KLF4 Tg male mice at 3 and 10-12 months old were used for vessel compliance analysis by echocardiogram of ascending aorta. Experiments were performed in a nonblinded fashion.

Participants Ten sedentary subjects (5 old, 50-70 yr vs. 5 young 20-40 yr) were included in this cross-sectional study. Subjects were non-smoking, weight stable

(< 2 kg in previous 6 mo), and free of chronic disease (i.e. renal, hepatic, thyroid, cardiovascular). Subjects had not participated in any regular exercise (< 30 min of aerobic activity > 2d/wk) for at least 6 months prior to providing the muscle biopsy sample, and all subjects reported similar activity levels via a physical activity questionnaire. All participants were verbally briefed about the study and signed informed consent documents approved by the Institutional Review Board.

Each participant performed an incremental-graded treadmill exercise test to determine maximal oxygen consumption (VO2max). Speed was set between 2 and 5 miles/hr, and the incline of the treadmill increased 2-3% every 2 min until volitional fatigue. Inspired air volumes were measured from pressure changes detected by a bidirectional digital volume sensor (Triple V) pneumotach, and concentrations of O2 (electrochemical detection) and CO2 (thermal conductivity detection) were measured using a Jaeger OxyCon Pro/Delta System (Version

4.6, Hoechberg, Germany). At least two of the following criteria were required for a maximum test: plateau in VO2, heart rate (HR) within 10 beats/min of age- predicted maximum, and/or a respiratory exchange ratio >1.1.

Muscle Biopsy Study participants reported to the Clinical Research Unit after an overnight fast and rested for 1 hour. Skeletal muscle biopsies were obtained from the vastus lateralis using a Bergstrom needle as previously described.288 The muscle was flash frozen and stored in liquid nitrogen until processing.

Statistics Statistical significance was analyzed using SigmaPlot software. One- tailed unpaired Student’s t-tests, one-way or two-way ANOVA and Mantel-Cox log-rank tests, were used for their appropriate applications as indicated in the figure legends. For mouse studies, data passed normality test, and power necessary for effect size based on previous experiments. Student T-test was used for difference between individual groups and log-rank tests for lifespan studies. In all figures, error bars represent standard error of mean (SEM).

CHAPTER 3: LONGEVITY AND HEALTHY AGING CONVERGE ON A CONSERVED KRUPPEL-LIKE FACTOR-AUTOPHAGY PATHWAY

Authors: Paishiun N. Hsieh, Guangjin Zhou, Yiyuan Yuan, Rongli Zhang,

Domenick A. Prosdocimo, Panjamaporn Sangwung, Anna H. Borton,

Evgenii Boriushkin, Anne Hamik, Hisashi Fujioka, Ciaran E. Fealy, John P.

Kirwan, Maureen Peters, Yuan Lu, Xudong Liao, Diana Ramírez-Bergeron,

Zhaoyang Feng & Mukesh K. Jain

Portions of this chapter are published in Nature Communications 8(1):914; Oct

2017149,c

Summary

Loss of protein and organelle quality control secondary to reduced autophagy is a hallmark of aging. However, the physiologic and molecular regulation of autophagy in long-lived organisms remains incompletely understood. In this chapter we present evidence that the Kruppel-like family of transcription factors are important regulators of autophagy and healthspan in C. elegans, with conserved effects on aging in mammals, namely the modulation of mammalian vascular age-associated phenotypes. KLF deficiency attenuates autophagy and lifespan extension across mechanistically distinct longevity nematode models. Conversely, KLF overexpression extends nematode lifespan in an autophagy-dependent manner. Furthermore, we show the mammalian vascular factor KLF4 has a conserved role in augmenting autophagy and improving c This work is a derivative of A conserved KLF-autophagy pathway modulates nematode lifespan and mammalian age-associated vascular dysfunction by the authors listed, under a Creative Commons CC BY license.

61 vessel function in aged mice. KLF4 expression also decreases with age in human vascular endothelium. Thus, the KLFs constitute a transcriptional regulatory point for the modulation of autophagy and longevity in metazoans with conserved effects in the murine vasculature and potential implications for mammalian aging.

Introduction

The maintenance of cellular and organismal homeostasis determines the progress of aging. On a cellular level, homeostasis is maintained, in part, through macroautophagy (hereafter referred to as autophagy), a conserved mechanism by which a cell achieves multiple goals, including clearance of misfolded proteins and organelle turnover with subsequent recycling of degraded constituents. As cells age, their ability to perform these functions declines. This likely leads to an unsustainable accumulation of protein aggregates, which ultimately present an obstacle to cellular survival.289-291

Indeed, studies of the distinct signaling networks in C. elegans that modulate lifespan have provided evidence of a central role for autophagy in many known longevity paradigms. These pathways include the highly conserved mechanistic target of rapamycin (mTOR), insulin/IGF-1 like (IIS), and 5′ AMP- activated protein kinase (AMPK) pathways. Notably, the inhibition of autophagy in any model of longevity mediated through the mTOR, IIS, or AMPK nutrient sensing pathways strongly suppresses lifespan.85,292 In mammals, global defects in autophagy are lethal postnatally, while tissue-restricted deficiencies produce age-associated pathologic features, including accumulation of

62 inclusion bodies containing ubiquitinylated proteins, deformed mitochondria,

ER stress, and appearance of lipofuscin positive vesicles.85 These local defects in autophagy usually result in organ-specific dysfunction, likely due to the diverse functional roles of autophagy; tissue-restricted autophagy defects have been investigated in some tissues (hepatocytes, neurons, skeletal and cardiac muscle, immune cells).85

Regulation of autophagy by conserved signaling pathways is primarily understood at post-translational levels; relatively few transcriptional regulators that operate broadly downstream of nutrient sensing pathways to regulate autophagy have been identified.293 How autophagy is transcriptionally regulated under diverse upstream stimuli therefore remains unclear. Pha-

4/FoxA is required for lifespan extension in the C. elegans eat-2 mutant model of dietary restriction and regulates autophagy, but is dispensable in other models such as IIS signaling-deficient nematodes or other modes of dietary restriction.294-296 A recently identified TFEB ortholog, HLH-30, has been shown to attenuate lifespan across multiple C. elegans longevity models and to regulate autophagy; it remains to be seen whether TFEB has any direct influence on mammalian aging.293 In mammals, substantial work has been performed on the transcriptional regulation of autophagy. Among others, β- catenin, C/EBPβ, FOXO1/3, GATA1, HIF1, NF- κB, p53, and SREBP2 have been reported to be regulators of autophagy, primarily through direct transcriptional activation of autophagy genes.297 Additionally, TFEB, an activator, and ZKSCAN3, a repressor, have been reported to bind directly to

63 promoter regions of target lysosomal and autophagy genes to regulate autophagosome and lysosome biogenesis in an organized pattern of control known as the coordinated lysosomal expression and regulation (CLEAR) network.298,299 Their roles in the connection between autophagy and mammalian aging largely remain to be explored, although variants of FOXO3A in humans have been linked to longevity in seven cohorts globally.108

The Kruppel-like transcription factors (KLFs) are a subfamily of zinc finger transcriptional regulators with highly characterized roles in proliferation, survival, metabolism, and response to stress. While 18 exist in mammals, in C. elegans 3 klf encoding genes (klf-1, klf-2 and klf-3) have been identified with roles in fat metabolism, cell survival, and muscle attachment.300,301 We and others have provided evidence that mammalian Kruppel-like factors such as

KLF4 may have a role in the regulation of autophagy. Using an in vitro model of multiple myeloma, Riz et al.202 showed that KLF4 regulated SQSTM1 and contributed to carfilzomib resistance. Liu et al.204 found that mouse embryonic fibroblasts (MEFs) lacking Klf4 exhibited impaired autophagy, increased apoptosis, and increased DNA damage, at least partially due to enhanced mTOR signaling. Finally, studies from our laboratory have reported that KLF4 regulation of mitophagy in cardiomyocytes is critical for mitochondrial homeostasis and the cardiac response to stress occurring with pressure overload. Cardiac KLF4 is required for the optimal function of an estrogen- related receptor/PPARγ coactivator 1 module to bind to metabolic and mitochondrial targets201. A recent link to lifespan has been established by

Carrano et al.148 whereby modulation of nematode lifespan via the HECT ubiquitin E3 ligase wwp-1 is dependent on klf-1 monoubiquitylation. However, whether KLFs are required for normal lifespan and the mechanistic basis by which they affect lifespan in C. elegans remain unknown, as does the existence of an ortholog with effects on mammalian aging.

Here we demonstrate that the KLFs are conserved regulators of autophagy and are necessary and sufficient for lifespan extension in separate longevity paradigms. We find that C. elegans klf-1 and klf-3 are broadly required across mechanistically distinct longevity paradigms. Further, from the known mammalian KLFs, we identify KLF4 as a direct transcriptional regulator of autophagy. Finally, while KLF4 has profound pleiotropic effects in multiple cell types, it functions to regulate autophagy in vascular endothelial cells and modulate blood vessel aging.

Results

KLF requirement for lifespan extension in multiple pathways

To assess the influence of KLFs on lifespan and determine which KLFs may be involved, we first performed single and combinatorial loss-of-function analysis of the three known C. elegans KLFs. Genetic loss of single klf genes achieved by either RNA interference (RNAi) by feeding during adulthood or knockout models showed little to no modulatory effect on lifespan (Supplementary

Tables 3-1 and 3-2). Combinatorial deficiency achieved by knockdown of one klf in the background of a second klf mutant nematode revealed that

65 knockdown of klf-2 in both a klf-1(tm731) mutant and klf-3(ok1975) mutant did not affect lifespan, while the converse, single knockdowns of klf-1 or klf-3 in a klf-2(ok1043) mutant, reduced mean lifespan significantly, a result which may reflect the differential response of an organism to acute vs. chronic loss of a klf gene (Supplementary Fig. 3-1B, C, E, F; Supplementary Tables 3-1 and 3-2).

However, double loss of klf-1 and klf-3 in any combination displayed a robust reduction in lifespan compared to wild-type nematodes (Supplementary Fig. 3-

1A, D). Together, our findings demonstrate that klf-1 and klf-3 are required for normal lifespan in C. elegans.

RNAi started Vector klf-1( RNAi klf-2 RNAi klf-3 RNAi in adulthood Control RNAi

N2 klf-1(tm731) NA klf-2(ok1043) NA klf-3(ok1975) NA

RNAi started Vector klf-1 RNAi klf-2 RNAi klf-3 RNAi from hatching Control RNAi

N2 Lethal klf-1(tm731) NA Lethal klf-2(ok1043) NA Lethal klf-3(ok1975) NA

Supplementary Table 3-1. Summary table of combinatorial lifespan analysis of double KLF loss of function. Complete data in Supplementary table 3-2. Each single arrow represents approximately 10% loss of lifespan. Horizontal bars represent nonsignificant difference. NA = not attempted.

Strains RNAi Avg Number 25% 50% 75% % P- treatments lifespan of (Days) (Days) (Days) chan value ± s.e.m. animals ge vs (Days) contro l

N2 OP50 18.586 ± 65/90 23 18 14 0.781 Vector 18.608 ± 79/86 23 18 14 control 0.661 klf-1 16.322 ± 68/90 20 14 12 -12 0.017 0.630 15.988 ± 81/90 18 14 12 -14 0.004 0.590 klf-2 17.934 ± 68/90 23 16 14 -4 0.388 0.588 19.638 ± 77/90 23 20 16 +6 0.443 0.629 klf-3 17.927 ± 48/90 23 16 14 -4 0.540 0.819 klf-1 OP50 19.869 ± 81/90 24 21 14 +7 0.528 (tm731) 0.608 Vector 19.869 ± 81/90 24 21 14 control 0.608 klf-2 20.432 ± 82/90 26 21 16 +3 0.490 0.571 klf-3 (from lethal birth) (from 17.336 ± 65/90 21 16 14 -13 0.002 adult) 0.608 klf- OP50 19.250 ± 56/90 24 19 16 +4 0.893 2(ok104 0.586 3) Vector 19.236 ± 56/90 24 19 16 control 0.588

19.161 ± 57/90 22 22 19 0.470 klf-1 (from 15.661 ± 40/90 19 16 13 -18 <0.00 birth) 0.585 1 (from 15.149 ± 56/90 17 14 12 -20 <0.00 adult) 0.617 1 klf-3 (from Lethal birth) (from 17.593 ± 74/90 21 17 16 -9 0.012 adult) 0.424 klf- OP50 19.829 ± 57/90 26 19 16 +7 0.478 3(ok197 0.714 6) Vector 19.829 ± 57/90 26 19 16 control 0.714 18.466 ± 55/90 22 22 16 0.642 klf-1(from 13.681 ± 38/90 16 13 10 -26 <0.00 birth) 0.567 1 (from 15.876 ± 55/90 19 16 14 -20 <0.00 adult) 0.618 1 klf-2 (from 19.000 ± 60/90 22 19 19 +3 0.362 birth) 0.364 (from 19.344 ± 56/90 24 19 14 -2 0.420 adult) 0.715

Supplementary Table 3-2. Combinatorial lifespan analysis of C. elegans animals with reduced klf-1, klf-2 or klf-3 levels. Results of lifespan analysis of wild-type (WT, N2) and mutant animals (klf-1, klf-2 and klf-3). Animals were raised and incubated at 20ºC and fed control bacteria or bacteria expressing dsRNA against klf-1, klf-2 or klf-3 beginning at adulthood. The klf-1(tm731) mutant contains a 343-bp intronic deletion with no obvious abnormalities, likely hypomorphic. The klf-2(ok1043) mutant contains an estimated 1500-bp deletion. The klf-3(ok1975) loss-of-function mutant contains a 1658-bp deletion spanning the 3’ end of exon 2 through the 5’ end of exon 3. Data show the average lifespan, number of events, day at which 25, 50 or 75% of animals remained alive, % change, and p value vs control calculated by Mantel-Cox log-rank test.

Supplementary Figure 3-1. Dual loss of function of the Kruppel-like factors reduces C. elegans lifespan. (A-F) Lifespan analysis of single KLF mutant worms fed RNAi bacteria targeting a second KLF gene or RNAi bacteria containing empy vector. Bolded genes represent the mutant strain. Klf-3 mutants are represented with a triangle, klf-2 with a circle, and klf-1 with a square. P- value<0.05 by Mantel-Cox log-rank tests compared to control RNAi bacteria. See also Supplementary Tables 3-1 and 3-2.

Interestingly, we observed that RNAi feeding targeting klf-3 from hatching was lethal but klf-3(ok1975) mutants were viable. Therefore, we hypothesized that klf-3(ok1975) mutants had compensated for klf-3 loss by induction of klf-1. To address this, we measured transcript levels of klf-1 in worms with single knockdown or knockout of klf-3 and vice versa. Klf-1 transcript levels were non-significantly different in klf-3 knockdown worms compared to wild-type, but were upregulated 1.4-fold in klf-3(ok1975) mutants. Klf-3 transcript levels were also not significantly changed in klf-1 knockdown worms compared to wild type, but were increased 3.5-fold in klf-1(tm731) mutants, providing evidence of compensatory induction of KLF family members in mutant worms but not in

RNAi-treated animals. Given the relatively modest upregulation of klf-1 transcript levels however, it remains unclear whether compensatory induction can be the sole explanation for the apparent lethality of klf-3 knockdown begun from hatching, or whether other mechanisms may be operative (Supplementary

Fig. 3-2; Supplementary Table 3-2).

Supplementary Figure 3-2. Single RNAi depletion of either klf-1 or klf-3 is specific and does not alter expression of another klf, while mutant worms demonstrate compensatory induction of klfs. klf-1 and klf-2 transcript levels are nonsignificantly changed by RNAi bacteria feeding targeting klf-3, and klf-2 and klf-3 transcript levels are nonsignificantly changed by RNAi bacteria feeding targeting klf-1. Klf-1 transcript levels are higher in klf-3(ok1075) mutants while klf- 3 is strongly induced in klf-1(tm731) mutants. N=3 biological replicates. * represents P-value<0.05, n.s. represents not significant (P-value <0.1) by Students T-test.

We next investigated the potential role of klf-1 and klf-3 in mediating lifespan extension in known nutrient sensing longevity pathways. We performed klf-

1/klf-3 double loss-of-function experiments in mechanistically separate models of lifespan extension utilizing RNAi against klf-1 on a klf-3(ok1975) mutant background. Strikingly, loss of function of both klf-1 and klf-3 abolished lifespan extension in the eat-2(ad1116) and food dilution on solid agar (sDR) models of dietary restriction as well as in the daf-2(e1370) and rapamycin treated worms, (Fig. 3-1a–d; Supplementary Table 3-3) Loss of both klf-1 and klf-3 genes was not significantly different from single loss in eat-2(ad1116) and animals undergoing sDR, but was additive in daf-2(e1370) animals and animals treated with rapamycin, suggesting partial redundancy in klf-1 and klf-

3 gene targets (Supplementary Fig. 3-3). The previous finding that single klf depletions in wild-type animals did not significantly affect lifespan further points to a specific effect of klf-1 and klf-3 on lifespan. Collectively, these results provide evidence for the broad requirement of klf-1 and klf-3 transcriptional regulation in lifespan extension mediated through AMPK, TOR, and IIS signaling.

Strains/Regi RNAi Avg lifespan Numbe 25% 50% 75% % P-value men treatments ± s.e.m. r of (Days (Days (Days cha vs (Days) animal ) ) ) nge control s

N2 Vector 21.594±0.51 69/90 24 20 20 Rapamycin Control 7 23.253±0.74 79/90 27 23 17 1 24.407±0.63 81/90 28 26 21 7 klf-1 19.424±0.46 66/90 22 18 18 -10 0.0070 3 19.355±0.58 62/90 21 19 17 -16 <0.001 8 18.290±0.53 69/90 21 18 14 -25 <0.001 3 klf-3 Vector 19.571±0.47 56/90 22 20 18 -9 0.0076 Rapamycin Control 7 20.534±0.68 58/90 23 19 17 -11 0.0140 0 18.729±0.66 48/90 21 18 16 -23 <0.001 0 klf-1 17.969±0.49 65/90 20 18 16 -17 <0.001 3 17.552±0.42 67/90 19 17 17 -25 <0.001 3 18.268±0.43 71/90 21 18 16 -25 <0.001 9

N2 solid Vector 27.081±1.38 74/90 34 26 15 agar dietary Control 3 restriction (sDR) 27.043±0.98 70/90 32 28 22 0

33.368±0.87 68/90 38 34 30 6 klf-1 20.652±1.07 69/90 26 20 13 -24 0.0020 4 22.020 ± 50/90 26 22 18 -18 0.0013 0.906 23.116 ± 69/90 28 24 18 -31 <0.001 0.961 klf-3 sDR Vector 22.197±1.25 66/90 30 20 13 -18 0.0595 Control 26.143±1.31 49/90 34 26 20 -3 0.964 8 26.949±1.45 39/90 36 26 22 -19 0.0022 7 klf-1 21.485±1.03 66/90 28 20 15 -21 0.0060 0 26.667±1.04 51/90 32 26 22 -1 0.992 8 24.861±1.00 36/90 28 26 22 -25 <0.001 5 eat-2 Vector 27.508 61/90 34 28 22 Control ±0.985 25.648±1.06 54/90 31 25 19 2 23.702±0.83 57/90 28 24 18 8 eat-2 klf-1 20.551±0.62 69/90 24 22 18 -19 <0.001 1 16.920±0.70 50/90 21 17 13 -34 <0.001 2 16.821±0.71 56/90 18 16 11 -29 <0.001 0 eat-2;klf-3 Vector 19.130±0.93 46/90 24 18 14 -30 <0.001 Control 6 20.770±0.83 61/90 25 21 17 -20 <0.001 2

19.875±1.17 24/90 22 18 16 -16 0.0458 5 klf-1 8.435±0.677 23/90 8 8 6 -70 <0.001 14.975±0.64 81/170 19 13 11 -42 <0.001 8 18.821 ± 39/90 26 18 13 -20 0.0085 1.104 daf-2 Vector 56.083±1.24 121/15 66 56 48 Control 4 0 50.101±1.58 79/90 62 52 40 4 klf-1 33.043±2.65 23/150 42 32 22 -41 <0.001 2 21.5±1.23 36/90 26 20 16 -57 <0.001 daf-2;klf-3 Vector 41.849±1.35 93/150 52 46 32 -25 <0.001 Control 9 34.364±3.33 11/90 44 38 20 -31 <0.001 4 klf-1 23.075±0.75 67/150 26 22 20 -59 <0.001 9 17.143±0.95 35/90 20 16 14 -66 <0.001 7

Supplementary Table 3-3: Lifespan analysis of C. elegans mutant animals with reduced klf-1 levels. Results of lifespan analysis of wild-type (WT, N2) and klf-3 mutant animals. Animals were raised and incubated at 20ºC and fed control bacteria or bacteria expressing dsRNA against klf-1 beginning at adulthood. Data show the average lifespan, number of events, day at which 25, 50 or 75% of animals remained alive, % change, and p value vs control calculated by Mantel- Cox log-rank test.

Fig. 3-1. KLFs are required for long lifespan in multiple longevity paradigms. Lifespan analysis of animals subjected to solid agar dietary restriction at 108 cfu/mL OP50 (sDR) (A), 100uM rapamycin (Rapa) (B), eat- 2(ad1116) animals (C), and daf-2(e1370) animals (D) after double loss-of- function of klf-1 and klf-3. Animals were crossed into klf-3(ok1975) mutant to achieve klf-3 loss-of-function, and RNAi feeding targeting klf-1 was used to achieve klf-1 loss-of-function starting from day 1 of adulthood. sDR and rapamycin treatments were initiated from day 1 of adulthood to avoid developmental alterations. All lines were raised and maintained on OP50 at 20oC. Strain is represented in bold. P-value<0.05 by Mantel-Cox log-rank tests. Data is reproduced in Supplementary Figure 3-3 with inclusion of klf-1 loss-of- function groups. See also Supplementary Table 3-3 for details of lifespan analyses and replicate experiments.

Supplementary Figure 3-3. Double loss of function of klf-1 and klf-3 suppresses enhanced longevity in multiple longevity paradigms. Representative traces are shown here, with full lifespan data in Supplementary Table 3-3. Lifespan extension of eat-2(ad1116) animals (A), animals subjected to solid agar dietary restriction at 108 cfu/mL (sDR) (B), 100uM rapamycin (C), and daf-2(e1370) animals (D) is strongly suppressed after double loss of function of klf-1 and klf-3. klf-3(ok1975) mutants have mildly suppressed lifespan in eat- 2(ad1116), sDR, daf-2(e1370) and rapamycin treated animals. RNAi against klf-1 in rapamycin treated animals had the same lifespan as klf-3 mutants, but more strongly suppressed lifespan in eat-2(ad1116), sDR, and daf-2(e1370) animals. In eat-2(ad1116) and sDR animals, RNAi against klf-1 had similar effects as RNAi against klf-1 in a klf-3 mutant background, while in rapamycin treated and daf-2(e1370) animals, double loss of function of klf-1 and klf-3 had the strongest suppressive effect on lifespan. See also Supplementary Table 3-3 for full details on numbers and replicates.

78 klf-3 overexpression enhances health and lifespan in C. elegans

To demonstrate that klf-1 and klf-3 are not only required but also are sufficient for lifespan extension, we performed gain-of-function analyses. We generated transgenic worms overexpressing klf-3 (klf-3 o/e) driven by a 2.5 kb region upstream of the transcription start site and found that lifespan was extended significantly (Fig. 3-2a, b; Supplementary Table 3-4). As reported by Carrano et al.,148 overexpression of klf-1 more modestly extended lifespan, and only when driven by the intestine specific ges-1 promoter (klf-1 o/e worm). We therefore focused efforts on the more long-lived klf-3 o/e animals.

Overexpression of klf-3 with a deletion of the zinc finger DNA-binding region abolished lifespan extension, which may suggest that the klf-3-mediated effect on longevity requires direct transcriptional regulation of gene targets (Fig. 3-2c, d; Supplementary Table 3-4).

Strains Avg lifespan ± s.e.m. Number 25% 50% 75% % P-value (ng of (Days) of animals (Days) (Days) (Days) chan vs plasmid ge control injected)

N2 *17.683 ± 0.381 69/90 20 20 15 #17.096 ± 0.423 78/90 20 20 15

†17.107 ± 0.368 74/90 20 20 15

‡21.079 ± 0.409 64/90 26 23 18

∆14.946 ± 0.505 49/60 17 15 13 º19.563 ± 0.395 131/180 22 20 16 ǂ19.739 ± 0.636 33/90 22 20 18 ϕ21.128 ± 0.413 148/166 24 22 18 ε14.568±0.433 44/60 17 15 12 ζ14.370±0.399 54/60 17 13 12 θ13.159±0.409 44/60 15 13 11 κ17.452 ± 0.266 146/171 20 17 15 λ10.859 ± 0.313 149/160 13 9 8 klf-3 o/e *Line #1 16.578 ± 79/90 20 16 14 -6 0.162 10ng 0.372 #Line #2 16.345 ± 64/90 20 16 14 -4 0.268 0.396

†Line #3 16.532 ± 69/90 20 16 14 -3 0.744 0.414 klf-3 o/e ‡Line #1 22.673 ± 51/90 26 23 18 +8 0.007 50ng 0.857

∆Line #1 16.333 ± 51/60 19 17 15 +9 0.050 0.473 º Line #2 21.760 ± 99/180 26 22 16 +11 <0.001 0.661 ǂLine #2 26.390 ± 17/60 31 27 21 +34 <0.001 1.774

Mutant ϕ Line #1 20.456 ± 171/183 24 22 18 -3 0.056 klf-3 o/e

50ng 0.320 εLine #2 13.956 ± 45/60 17 13 12 -4 0.250 0.384 ζLine #2 13.233 ± 30/60 15 13 11 -8 0.130 0.556 θLine #2 13.479 ± 48/60 15 12 12 +2 0.633 0.367

Supplementary Table 3-4: Lifespan analysis of C. elegans with klf-3 overexpression (o/e). Results of lifespan analysis of wild-type (WT, N2) and klf-3 overexpressing animals. Animals were raised and incubated at 20ºC and fed OP50 E. coli. Data show the average lifespan, number of events, day at which 25, 50 or 75% of animals remained alive, % change, and p value vs control calculated by Mantel-Cox log-rank test. Symbols represent experimental and control groups used to calculate p-values.

Fig. 3-2. Klf-3 overexpression extends healthspan in C. elegans. (A) klf-3 transcript levels in day 1 wild-type and klf-3 o/e animals overexpressing klf-3 driven by putative endogenous promoter as determined by qPCR. Animals were fed OP50 and maintained at 20oC. Significance determined by Student’s T-test, *p-value <0.05. N=3 biological replicates. (B) Lifespan analysis of klf-3 o/e animals compared to wild-type maintained at 20oC on OP50. P-value<0.05 by Mantel-Cox log-rank tests. See also Supplementary Table 3-4 for details of lifespan analyses and replicate experiments. (C) Mutant klf-3 transcript levels in day 1 animals overexpressing mutated klf-3 driven by putative endogenous promoter as determined by qPCR. Animals were fed OP50 and maintained at 20oC. Mutant klf-3 was created using a 258 nucleotide C-terminal deletion which included the entire zinc-finger containing region. Significance determined by Student’s T-test, p-value <0.05. N=3 biological replicates. (D) Lifespan analysis of klf-3 mutant overexpressing nematodes grown and maintained at 20oC on OP50. P-value<0.05 by Mantel-Cox log-rank tests. See also Supplementary

Table 3-4 for details of lifespan analyses and replicate experiments. (E) Appearance of age-related pigments in klf-3 o/e worms compared to wild-type and daf-2 mutants compared to wild-type as measured by autofluorescence at wavelength 420-440 (N=10 per group). Data collected from the same wild-type animals are displayed in both panels. Animals were fed OP50 and maintained at 20oC. Prior to imaging worms were anesthetized by sodium azide solution. Student’s T-test, *p-value <0.05. (F) Reproductive analysis as measured by viable egg-laying by klf-3 o/e and wild-type animals (N=10 per group). Worms were transferred every 12 hours and viable eggs were counted. Student’s T-test, *p-value <0.05. (G) Age-related decay in locomotory speed in klf-3 o/e worms compared to wild-type worms and daf-2 mutants (N=10 per group). Worms were picked onto fresh NGM plate without OP50 and scored for 2 minutes before being returned to plate. Otherwise, animals were fed OP50 and maintained at 20oC. * represents P-value<0.05 after two-way analysis of variance followed by the Tukey post hoc test. All error bars represent standard error of the mean (SEM).

In common with other manipulations found to extend lifespan in nematodes, overexpression of klf-3 not only extended lifespan, but delayed nematode specific aging characteristics. The appearance of age-associated pigments in the nematode intestine was delayed in klf-3 o/e worms compared to wild type with daf-2(e1370) mutants used as positive control, and klf-3 o/e worms had an extended reproductive period with 50% laying viable eggs at 6 days compared to 5.7 in wild type with no significant change in total number of hatched eggs

(Fig. 3-2e, f; Supplementary Fig. 3-4). Additionally, the rate of age-related decline in motor activity, as measured by locomotion speed, was reduced in klf-3 o/e worms (Fig. 3-2g), although not as strongly as in daf-2(e1370) mutants. There was no significant difference in pharyngeal pumping rates between wild-type and klf-3 o/e worms, arguing against a mechanical defect in pumping leading to restricted food intake being responsible for the observed changes (Supplementary Fig. 3-5). Together, our gain-of-function and loss-of- function analyses, as well as previous analysis by Carrano et al.148 utilizing intestinal klf-1 gain-of-function nematodes, suggest that klf-1 and klf-3 in C. elegans are required and sufficient for health and longevity.

Supplementary Figure 3-4. Overexpression of klf-3 does not strongly change total number of hatched eggs laid. Average number of viable eggs laid over the entire life of the N2 animals (281.5±14.2, N=15) compared to klf-3 o/e animals (248.0±15.2, N=15). Data is also represented in Fig 3-2F. # represents P-value<0.1 by Students T-test.

Supplementary Figure 3-5. Overexpression of klf-3 does not significantly alter pharyngeal pumping rates. Pharyngeal pumping was assayed in day 1 WT (N=10) and klf-3 o/e (N=10) worms on OP50. Further details in Methods. N.S. = not significant. P-value>0.05 by Students T-test.

KLF-mediated lifespan extension is dependent on regulation of autophagy

The breadth of klf-1 and klf-3 influence on lifespan suggested a common mechanism shared among the daf-2(e1370), eat-2(ad1116), sDR, and rapamycin lifespan extending regimens. It has been demonstrated that extended lifespan of these models is dependent on enhanced autophagy, a conserved mechanism critical for cellular homeostasis.302 Nematodes subjected to sDR or RNAi against let-363 (C. elegans Tor, orthologous to mechanistic target of rapamycin, mTOR) demonstrated induction of klf-1 and klf-3 (Fig. 3-3a, b). This was also observed in the daf-2(e1370) and eat-

2(ad1116) mutant nematodes. (Supplementary Fig. 3-6). Overexpression of klf-

3 induced the expression of several autophagy-related genes, while loss of function of both klf-1 and klf-3 suppressed expression (Fig. 3-3c), including unc-51, atg-2, and epg-2, suggesting klf-1 and klf-3 are positive transcriptional regulators of autophagy gene products. Further, nematodes overexpressing klf-3 with a deletion of the zinc finger DNA-binding region displayed no significant changes in transcript levels of the same genes (Supplementary Fig.

3-7).Consistent with this hypothesis, promoter analyses of these autophagy- related genes revealed one or more consensus KLF-binding elements

(CA/GCCC) within 1000 bp upstream or 200 base pairs downstream of the transcription start site (Supplementary Table 3-5). In support of the existence of overlap in autophagy gene targets of klf-1 and klf-3, klf-3(ok1975) single mutants demonstrated only modest reduction in transcript levels of the analyzed autophagy-related genes while klf-3(ok1975) mutants fed RNAi

87 targeting klf-1 displayed a significant reduction in the expression of the same autophagy gene targets (Supplementary Fig. 3-8). Additionally, we independently generated klf-1 o/e animals driven by the ges-1 promoter and found they also displayed enhanced expression of several autophagy-related genes (Supplementary Figs. 3-9 and 3-10).

Fig. 3-3. KLF-mediated lifespan extension is dependent on autophagy. Klf-3 transcript levels in wild-type animals subjected to two days of chronic dietary restriction (sDR, OP50 diluted to 108cfu/mL) (A) or inhibition of TOR signaling by RNAi against let-363 (B) starting from day 1 of adulthood. All lines were raised and maintained at 20oC. *P-value<0.05 by Student’s T-test, N=3 biological replicates. (C) qPCR analysis of a panel of autophagy–related genes in day 1 klf- 3 o/e and loss-of-function of both klf-3 and klf-1 animals compared to wild-type. Double loss-of-function of klf-3 and klf-1 was performed as described previously utilizing the klf-3(ok175) mutant and simultaneous RNAi feeding targeting klf-1. All lines were raised and maintained at 20oC. *P-value<0.05 by Student T-test, N=3 biological replicates. (D, representative picture, E) Autophagy in klf-3 o/e animals as determined by numbers of GFP::LGG-1 punctae in seam cells (red arrow denotes GFP-positive puncta) with knockdown of bec-1 in both wild-type and klf-3 o/e animals. *P-value<0.05, #P-value≤0.1 after one-way analysis of variance followed by the Tukey post hoc test. N=10-20 animals counted. (F, wild- type representative image, G, klf-3 o/e representative image) Electron microscopy images of klf-3 o/e and wild-type animals in animals aged 9 days. Arrowheads indicate sizeable (≥500nm) autolysosomes as recognized by single- membrane limited vacuolar structures with visible mixed cytoplasmic contents. Full images reproduced in Supplementary Figure 3-11, with additional images. (H) Lifespan analysis of wild-type and klf-3 o/e animals fed RNAi bacteria targeting bec-1 from day 1 of adulthood. All lines were raised and maintained at 20oC. P-value<0.05 by Mantel-Cox log-rank tests. See also Supplementary Table

3-6 for details of lifespan analyses and replicate experiments. All error bars represent standard error of the mean (SEM).

4.0 1.6 * 3.5 * * 3.0 1.2 2.5

2.0 0.8

transcript abundance

1.5 1

1 transcript abundance

- - 1.0 0.4

0.5 Relativeklf Relativeklf 0.0 0.0 WT eat-2 WT let- WT daf-2 363 RNAi

2.5 16 * * * 2.0 12 1.5 8

1.0

3 transcript abundancetranscript3

3 transcript abundance - - 4 0.5

0.0 0 Relative klf Relative WT eat-2 WT let- Relativeklf WT daf-2 363 RNAi

Supplementary Figure 3-6. Both klf-1 and klf-3 are induced in eat-2 animals and by inhibition of TOR at age Day 12. qPCR analysis of eat-2(ad1116), daf- 2(e1370) and WT worms subjected to RNAi against let-363. Significance determined by Student’s t-test, p-value<0.05. N=3.

Supplementary Figure 3-7. Loss of DNA binding region abolishes klf-3 mediated enhancement of autophagy gene expression. Gene expression of assessed autophagy genes is nonsignificantly different comparing wild-type worms with worms overexpressing klf-3 with zinc-finger containing region deleted. Significance determined by student’s t-test, p-value>0.05. N=3.

Supplementary Figure 3-8. Klf-3 mutants do not strongly suppress autophagy gene expression, and concurrent RNAi inactivation of klf-1 in klf-3 mutants weakly reduces expression. Additional comparisons using data displayed in Fig. 3-3C are shown. Gene expression of assessed autophagy genes is only modestly different comparing wild-type worms with klf-3(ok1975) mutants and klf-3(ok1975) mutants with klf-3(ok1975) mutants fed RNAi targeting klf-1. Significance determined by Student’s t-test, p-value<0.05. N=3.

Supplementary Figure 3-9. Klf-1 overexpression driven by ges-1 promoter. klf-1 transcript levels in klf-1 o/e animals overexpressing klf-1 driven by ges-1 promoter as determined by qPCR (N=3). Significance determined by Student’s T- test, p-value <0.05. N=3.

Supplementary Figure 3-10. Klf-1 overexpression driven by ges-1 promoter increases autophagy gene expression. Gene expression of assessed autophagy genes is shown comparing wild-type worms with klf-1 o/e worms. Significance determined by Student’s t-test, #p-value<0.01, *p-value<0.05. N=3.

Gene Mammalian Position Ortholog from start codon unc-51 ulk1 -11 epg-1 atg13 -400 -450 epg-3 vmp1 -547 -882 epg-9 isoform b atg101 -586 -590 vps34 isoform c pik3c3 4 vps15 isoform a pik3r4 151 -956 vps15 isoform b pik3r4 -356 -385 atg16.1 atg16L1, atg16L2 48 atg-7 atg7 -1055 atg-2 atg2 56 -610 -655 atg-9 isoform a atg9 -108 -173 atg-9 isoform b -1017 epg-5 epg5 61

Supplementary Table 3-5: In silico search identifies presence of KLF response elements GA/GCCC within 1000 base pairs upstream and 200 base pairs downstream of start codon in autophagy genes. Promoters of autophagy related genes were manually searched for presence of GACCC or GGCCC boxes using UCSD Genome browser, and positions indicated relative to start codon.

Given these observations, we next conducted an analysis of autophagy. A

GFP::LGG-1 (C. elegans ortholog of mammalian microtubule-associated protein light chain 3, MAPLC3A and MAPLC3B) translational reporter animal overexpressing klf-3 demonstrated increased GFP-positive puncta in hypodermal seam cells, an effect weakened by RNAi feeding targeting bec-1, while increased autophagic-like vesicles and autolysosomes with heterogeneous intraluminal contents, including electron dense material, were also found in klf-3 o/e worms by electron microscopy (Fig. 3-3d–g). Few to no autophagic-like vesicles could be detected by EM in age-matched wild-type or klf-3 worms fed RNAi targeting klf-1 (Supplementary Fig. 3-11). Finally, we sought to determine whether autophagy was required for klf-3-mediated lifespan extension. Importantly, the genetic inhibition of autophagy by RNAi against bec-1, atg-13, lgg-3, or atg-7 either strongly or moderately suppressed lifespan extension of the klf-3 o/e worms and RNAi against atg-13 and bec-1 suppressed lifespan extension in the klf-1 o/e worms, findings which remained in line with our gene expression data demonstrating redundant regulation of autophagy-related gene targets by klf-1 and klf-3 (Fig. 3-3h; Supplementary

Fig. 3-12; Supplementary Table 3-6). Deficiency of klf-1 and klf-3 in daf-

2(e1370) and eat-2(ad1116) animals reduced appearance of GFP-positive puncta (Supplementary Fig. 3-13). Therefore, klf-3 appears to be a regulator of autophagy in nematodes, and its influence on lifespan is autophagy- dependent.

Supplementary Figure 3-11. Little to no autophagic-like vesicles presence in wild-type and klf-3 RNAi klf-1 animals by TEM at Day 5 or Day 9 (post- fertile period). 10-20 transverse sections were taken from animals (n=5) and analyzed; majority of images were void of autophagic vesicles. Sections of klf-3 o/e worms are shown for comparison, and are reproduced in Fig. 3-3F-G. Scale indicated by horizontal bar, three representative sections from separate animals are shown. Typical autophagic-like vesicle with a double limiting membrane (arrows); autophagic-like vesicle and several autolysosomes (arrowheads).

100

101

Supplementary Figure 3-12. KLF-mediated lifespan extension is autophagy dependent. Lifespan analysis of klf-3 o/e and klf-1 o/e worms fed RNAi targeting empty vector, bec-1, lgg-3, atg-13, or atg-7. Representative traces are displayed from a single experiment. Klf-1 o/e experiments were performed in two independent lines. P-value calculated by Mantel-Cox log-rank tests. Lifespan traces for klf-3 o/e and WT with RNAi against bec-1 are reproduced from Fig. 3- 3H. See also Supplementary Table 3-6 for replicates.

102

1.5

1 * * 0.5

Relative numberof foci/seam cell 0 daf-2 daf-2 klf-1 daf-2;klf-3 daf-2;klf-3 RNAi klf-1 RNAi

0.6

# #

0.3

Relative numberof foci/seam cell 0 eat-2 eat-2 klf-1 eat-2;klf-3 eat-2;klf-3 klf- RNAi 1 RNAi

Supplementary Figure 3-13. Autophagy is decreased in daf-2 or eat-2 animals with single or compound deficiency of klf-1 and klf-3. Daf-2(e1370), eat-2(ad1116), daf-2;klf-3, eat-2;klf-3 animals were fed klf-1 RNAi from birth until L4 stage and all images were taken at L4. Compound deficiency of klf-1 and klf-3 most severely suppresses autophagy in daf-2(e1370) animals, but is nonsignificantly different from single deficiency in eat-2(ad1116) animals. 30-150 seams cells were counted in 10-20 animals in each group. * represents P- value<0.05, # represents P-value<0.1 by Students T-test.

103

Strains RNAi Avg lifespan ± Number 25% 50% 75% % P- treatm s.e.m. (Days) of animals (Days) (Day (Days chan value ents s) ) ge vs contro l

N2 Vector *18.329±0.74 64/90 23 18 14 contro 9 l N2 bec-1 *17.038 ± 79/90 19 15 15 -7 <0.00 0.426 01 klf-3 Vector *21.985±1.00 48/90 25 23 16 +20 0.029 o/e contro 1 l klf-3 bec-1 *17.769 ± 70/90 21 18 14 -19 <0.00 o/e 0.541 01 klf-3 bec-1 *18.198 ± 82/90 22 19 15 -17 <0.00 o/e 0.420 01 klf-3 bec-1 *13.711 ± 76/90 16 14 12 -38 <0.00 o/e 0.334 01 N2 Vector #18.685±0.59 73/90 22 18 14 contro 7 l N2 bec-1 #15.221±0.35 76/90 18 16 12 -18 <0.00 9 01 klf-3 Vector #21.462 ± 78/90 24 22 18 +15 0.002 o/e contro 0.688 4 l N2 Vector †20.457±0.64 81/90 24 19 15 contro 9 l

N2 lgg-3 †20.469 ± 77/90 24 22 17 <0.1 0.989 0.576

N2 atg-7 †20.067 ± 56/91 22 22 17 -2 0.816 0.681

104

N2 atg-13 †19.138±0.40 109/120 23 21 17 -6 0.008 7 51 klf-3 Vector †22.802 ± 66/90 29 22 17 +11 0.027 o/e contro 0.768 3 l klf-3 lgg-3 †21.426 ± 72/90 24 22 17 -6 0.056 o/e 0.702 7 klf-3 atg-7 †21.035 ± 58/91 29 22 15 -8 0.845 o/e 1.013 klf-3 atg-7 †19.030 ± 33/90 21 18 14 -16 0.016 o/e 0.876 1 klf-3 atg-13 †19.519±0.46 79/120 23 21 15 -14 <0.00 o/e 4 01 N2 Vector ∆15.441±0.59 59/60 20 14 12 contro 5 l N2 lgg-3 ∆15.628±0.65 43/60 20 16 12 +1 0.956 0 N2 atg-7 ∆16.370±0.60 54/60 20 16 14 +6 0.306 9 klf-3 Vector ∆17.830±0.61 53/60 20 20 14 +15 0.011 o/e contro 1 l klf-3 lgg-3 ∆14.578±0.60 45/60 18 14 12 -18 <0.00 o/e 5 1 klf-3 atg-7 ∆15.765±0.64 51/60 20 14 12 -12 0.030 o/e 5 Strains RNAi Avg lifespan ± Number 25% 50% 75% % P- treatm s.e.m. (Days) of animals (Days) (Day (Days chan value ents s) ) ge vs contro l

N2 Vector *15.289±0.33 45/60 17 17 13 contro 7 l N2 bec-1 *Line #1 46/60 17 15 15 +3 0.579 15.696±0.326

105

N2 bec-1 *Line #1 48/60 18 16 14 +4 0.081 15.896±0.335 N2 atg-13 *Line #1 48/60 17 15 13 -2 0.778 15.021±0.364 N2 atg-13 *Line #1 49/60 18 16 14 +9 0.002 16.735±0.419 klf-1 Vector *Line #1 37/60 17 17 15 +9 0.004 o/e contro 16.703±0.340 l klf-1 bec-1 *Line #1 41/60 17 15 13 -10 0.005 o/e 15.049±0.407 klf-1 atg-13 *Line #1 50/60 17 15 13 -11 0.001 o/e 14.820±0.360 N2 Vector #15.795±0.43 39/60 18 16 14 contro 2 l N2 bec-1 #Line #2 26/60 18 16 14 -1 0.670 15.615±0.415 N2 atg-13 #Line #2 36/60 18 18 16 +9 0.009 17.250±0.565 klf-1 Vector #Line #1 50/60 18 16 14 +6 0.004 o/e contro 16.180±0.429 l klf-1 bec-1 #Line #1 50/60 16 14 14 -8 0.007 o/e 14.920±0.329 klf-1 atg-13 #Line #1 49/60 18 16 14 -1 0.931 o/e 16.265±0.353

N2 Vector †16.020±0.36 51/60 18 16 14 contro 7 l

N2 bec-1 †Line #2 56/60 18 16 14 -1 0.490 15.821±0.311

N2 atg-13 †Line #2 41/60 18 18 14 +4 0.119 16.634±0.501 klf-1 Vector †Line #2 38/60 21 18 16 +14 <0.00 o/e contro 18.105±0.475 01 l

106

klf-1 bec-1 †Line #2 34/60 18 16 12 -17 <0.00 o/e 14.941±0.494 1

klf-1 atg-13 †Line #2 36/60 18 16 16 -9 0.001 o/e 16.389±0.307

klf-1 Vector ‡Line #2 71/90 21 18 16 +13 <0.00 o/e contro 18.113±0.332 01 l

klf-1 bec-1 ‡Line #2 79/90 18 16 14 -15 <0.00 o/e 15.468±0.285 01

klf-1 atg-13 ‡Line #2 53/60 18 18 14 -8 0.024 o/e 16.717±0.384

Supplementary Table 3-6: Lifespan analysis of C. elegans klf-3 and klf-1 o/e animals with reduced beclin-1, lgg-3, atg-13 or atg-7 levels. Results of lifespan analysis of wild-type (WT, N2), klf-1 o/e and klf-3 o/e animals with reduced beclin-1, lgg-3, atg-13 or atg-7 levels. Animals were raised and incubated at 20ºC and fed control bacteria or bacteria expressing dsRNA against bec-1, lgg-3, atg-13 or atg-7 beginning at adulthood. Data show the average lifespan, number of events, day at which 25, 50 or 75% of animals remained alive, % change, and p value vs control calculated by Mantel-Cox log-rank test. *,#,†,‡ symbols represent experimental and control groups used to calculate p- values.

107

Mammalian KLF4 regulates autophagy

To comprehensively investigate a role for the Klf gene family in the regulation of autophagy, we performed a qPCR screen for all known mammalian KLFs in

HEK293 cells treated with rapamycin or serum starvation, regimens which stimulate autophagy. Although several Klf family members were induced by either treatment, Klf4 was strongly induced by both treatments. These findings were consistent with previous literature (Fig. 3-4a, b) and encouraged us to pursue studies focused on KLF418. In MEFs, adenoviral overexpression of

Klf4 increased LC3-I lipidation by western blot analysis and the converse by siRNA knockdown was true. To confirm enhanced autophagic flux, we treated

MEFs with a late stage autophagy inhibitor, bafilomycin A1 (BFA) a v-ATPase inhibitor which prevents intralysosomal degradation. BFA treatment increased

LC3-I lipidation even further, indicating an increase in autophagic flux (Fig. 3-

4c). A qPCR array screening the entire autophagy pathway demonstrated that a large number of genes were up- and downregulated with KLF4 viral manipulation, suggesting a broad effect of KLF4 on the autophagy machinery

(Fig. 3-4d; Supplementary Table 3-7). Importantly, ChIP-qPCR analysis of

KLF4 binding sites (CA/GCCC boxes) on several core autophagy targets provided evidence for increased KLF4 recruitment to target genes (Fig. 3-4e), suggesting that KLF4 acts on autophagy as a direct regulator as opposed to indirect regulation through cytoplasmic interactions with autophagy-related genes.

108

Fig. 3-4. KLF regulation of autophagy is conserved in mammalian cells. qPCR screens of HEK293 cells exposed to rapamycin treatment (A) and starvation (B). Cells were treated with respective regimen for 2 days prior to RNA isolation and qPCR analysis. Further details in Methods section. *P-value<0.05 by Student’s T-test, N=3 biological replicates. (C) Western blot analysis of LC3-I lipidation with and without KLF4 manipulation. Briefly, MEFs were treated with adenoviral KLF4 or siRNA targeting KLF4 and effects assessed by Western blot 2 days afterwards. Data shown are representative of two independent experiments. Further details in Methods section. (D) Autophagy pathway qPCR array analysis in MEFs with Ad-KLF4 or Si-KLF4 normalized to appropriate viral or siRNA control. MEFs were treated for 72 hours prior to RNA isolation and qPCR analysis. Green oval represents significantly induced genes by Ad-KLF4 and blue oval represents genes reduced by Si-KLF4. P-value<0.05 by Student’s T-test. N=3 biological replicates. See also Supplementary Table 3-7 for full gene list of fold changes and p-values. (E) ChIP-qPCR in MEFs treated with control or

109 adenoviral KLF4 of several target genes normalized to input DNA, then to nontarget control confirms KLF4 recruitment to CA/GCCC elements in regions upstream of autophagy genes. A locus upstream of GATA6 was used as a nontarget control. *P-value<0.05 after one-way analysis of variance followed by the Dunnett’s post hoc test. N=3 biological replicates. All error bars represent standard error of the mean (SEM).

110

Ad-KLF4 Si-KLF4 Gene Gene Fold change p-value Fold p-value Symbol change Akt1 Akt1 Thymoma viral 1.327340199 0.254401 0.009209 0.447711 proto-oncogene 1 Ambra1 Ambra1 1.228958126 0.416754 0.001683 0.177829 Autophagy/beclin 1 regulator 1 App App Amyloid beta 1.60474612 0.034567 0.154681 0.494304 (A4) precursor protein Atg10 Atg10 Autophagy- 1.425749629 0.023084 0.014835 0.256999 related 10 (yeast) Atg12 Atg12 Autophagy- 1.196807825 0.674936 0.320318 0.123725 related 12 (yeast) Atg16l1 Atg16l1 Autophagy- 1.483233049 0.204173 0.056958 0.016263 related 16-like 1 (yeast) Atg16l2 Atg16l2 Autophagy 1.245718812 0.105069 0.002388 0.256191 related 16 like 2 (S. cerevisiae) Atg3 Atg3 Autophagy- 1.281709031 0.043529 1.018364 0.074163 related 3 (yeast) Atg4a Atg4a Autophagy- 1.179714413 0.365416 0.038879 0.125473 related 4A (yeast) Atg4b Atg4b Autophagy- 1.051028754 0.835466 0.031047 0.047305 related 4B (yeast) Atg4c Atg4c Autophagy- 1.340569337 0.108125 0.003613 0.241178 related 4C (yeast) Atg4d Atg4d Autophagy- 1.178258062 0.295444 0.002987 0.284877 related 4D (yeast) Atg5 Atg5 Autophagy- 1.464541801 0.021238 0.01512 0.01482 related 5 (yeast) Atg7 Atg7 Autophagy- 1.757102179 0.033926 0.004523 0.01853 related 7 (yeast) Atg9a Atg9a Autophagy- 1.583941338 0.078667 0.01268 0.09882 related 9A (yeast) Atg9b Atg9b ATG9 6.014516821 0.001354 0.013333 0.040475 autophagy related 9 homolog B (S. cerevisiae) Bad Bad BCL2- 1.574183063 0.07013 0.006672 0.300996 associated agonist of cell death Bak1 Bak1 BCL2- 1.266228163 0.074049 0.063784 0.494212 antagonist/killer 1

111

Bax Bax Bcl2-associated 2.057840745 0.00171 0.169633 0.21892 X protein Bcl2 Bcl2 B-cell 1.112144673 0.431891 0.002189 0.382453 leukemia/lymphoma 2 Bcl2l1 Bcl2l1 Bcl2-like 1 1.915531535 0.025244 0.036572 0.103121 Becn1 Becn1 Beclin 1, 1.34217958 0.088816 0.188975 0.186299 autophagy related Bid Bid BH3 interacting 1.286287008 0.222125 0.02754 0.414679 domain death agonist Bnip3 Bnip3 1.085133749 0.682742 0.106987 0.113609 BCL2/adenovirus E1B interacting protein 3 Casp3 Casp3 Caspase 3 1.157902293 0.402601 0.019106 0.157401 Casp8 Casp8 Caspase 8 1.307296033 0.020224 0.105532 0.061667 Cdkn1b Cdkn1b Cyclin- 1.295627957 0.00797 0.051723 0.221934 dependent kinase inhibitor 1B Cdkn2a Cdkn2a Cyclin- 1.375764041 0.043348 0.231044 0.329122 dependent kinase inhibitor 2A Cln3 Cln3 Ceroid 1.489875867 0.012428 0.033266 0.167903 lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer- Vogt disease) Ctsb Ctsb Cathepsin B 1.273471195 0.081674 0.259226 0.212809 Ctsd Ctsd Cathepsin D 2.580733772 0.001128 0.174647 0.071874 Ctss Ctss Cathepsin S 0.941888961 0.85147 0.003004 0.006181 Cxcr4 Cxcr4 Chemokine 1.59861585 0.357793 0.007247 0.009969 (C-X-C motif) receptor 4 Dapk1 Dapk1 Death 39.98316719 0.003175 0.002045 0.100198 associated protein kinase 1 Dram1 Dram1 DNA-damage 1.23292354 0.311832 0.014585 0.221131 regulated autophagy modulator 1 Dram2 Dram2 VDNA- 1.042385441 0.863548 0.122662 0.083061 damage regulated autophagy modulator 2 Eif2ak3 Eif2ak3 Eukaryotic 1.506653863 0.002257 0.004903 0.479695 translation initiation factor 2 alpha kinase 3 Eif4g1 Eif4g1 Eukaryotic 1.309559236 0.069926 0.086649 0.258593

112

translation initiation factor 4, gamma 1 Esr1 Esr1 Estrogen 2.558243166 0.01055 0.00153 0.000873 receptor 1 (alpha) Fadd Fadd Fas 1.766063929 0.0024 0.018152 0.132465 (TNFRSF6)- associated via death domain Fas Fas Fas (TNF 1.756495976 0.000857 0.030314 0.455572 receptor superfamily member 6) Gaa Gaa Glucosidase, 1.352835291 0.03951 0.023321 0.395567 alpha, acid Gabarap Gabarap Gamma- 1.577727143 0.003181 4.32585 0.076842 aminobutyric acid receptor associated protein Gabarapl1 Gabarapl1 Gamma- 0.99642974 0.978842 0.070326 0.020267 aminobutyric acid (GABA) A receptor- associated protein- like 1 Gabarapl2 Gabarapl2 Gamma- 1.615659046 0.000495 0.626835 0.014046 aminobutyric acid (GABA) A receptor- associated protein- like 2 Hdac1 Hdac1 Histone 1.257022171 0.060447 0.128535 0.411764 deacetylase 1 Hdac6 Hdac6 Histone 1.069122585 0.684363 0.021849 0.359177 deacetylase 6 Hgs Hgs HGF-regulated 1.099562183 0.606127 0.002232 0.153286 tyrosine kinase substrate Hsp90aa1 Hsp90aa1 Heat 1.290278748 0.069164 3.212159 0.047711 shock protein 90, alpha (cytosolic), class A member 1 Hspa8 Hspa8 Heat shock 1.326943664 0.017792 4.235619 0.282432 protein 8 Htt Htt Huntingtin 1.517617176 0.085919 0.016382 0.058418 Igf1 Igf1 Insulin-like 0.726060141 0.023102 0.015319 0.240725 growth factor 1 Ins2 Ins2 Insulin II 1.340773171 0.372231 0.005285 0.011126 Irgm1 Irgm1 Immunity- 1.672913645 0.000162 0.134292 0.234999 related GTPase family M member 1 Lamp1 Lamp1 Lysosomal- 1.387001135 0.002644 1.450752 0.107813 associated membrane

113

protein 1 Map1lc3a Map1lc3a 1.42159875 0.023682 0.011569 0.439651 Microtubule- associated protein 1 light chain 3 alpha Map1lc3b Map1lc3b 1.365329598 0.030471 0.682735 0.082414 Microtubule- associated protein 1 light chain 3 beta Mapk14 Mapk14 Mitogen- 1.287663501 0.096587 0.025889 0.111233 activated protein kinase 14 Mapk8 Mapk8 Mitogen- 1.066681037 0.645991 0.084303 0.035607 activated protein kinase 8 Mtor Mtor Mechanistic 1.172830442 0.181199 0.007716 0.229621 target of rapamycin (serine/threonine kinase) Nfkb1 Nfkb1 Nuclear factor 0.86134866 0.215631 0.030293 0.189956 of kappa light polypeptide gene enhancer in B-cells 1, p105 Npc1 Npc1 Niemann Pick 1.519586063 0.109928 0.056143 0.018579 type C1 Pik3c3 Pik3c3 1.634336738 0.010575 0.030809 0.24255 Phosphoinositide-3- kinase, class 3 Pik3cg Pik3cg 1.25648993 0.362266 0.028767 0.066656 Phosphoinositide-3- kinase, catalytic, gamma polypeptide Pik3r4 Pik3r4 1.312284879 0.047011 0.019348 0.006781 Phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 Prkaa1 Prkaa1 Protein 1.273955047 0.024822 0.121013 0.090569 kinase, AMP- activated, alpha 1 catalytic subunit Pten Pten Phosphatase and 1.605137955 0.00352 0.26807 0.060306 tensin homolog Rab24 Rab24 RAB24, 1.400002233 0.010021 0.075073 0.198763 member RAS oncogene family Rb1 Rb1 Retinoblastoma 1.723245533 0.045258 0.022524 0.314655 1

114

Rgs19 Rgs19 Regulator of 0.985581106 0.883557 0.054465 0.094282 G-protein signaling 19 Rps6kb1 Rps6kb1 Ribosomal 1.300832513 0.203962 0.230742 0.003843 protein S6 kinase, polypeptide 1 Snca Snca Synuclein, 0.979739715 0.794658 0.006582 0.05751 alpha Sqstm1 Sqstm1 0.836892275 0.336786 0.726911 0.002866 Sequestosome 1 Tgfb1 Tgfb1 Transforming 1.402128686 0.009127 0.030374 0.128108 growth factor, beta 1 Tgm2 Tgm2 1.683038425 0.011647 0.012388 0.034136 Transglutaminase 2, C polypeptide Tmem74 Tmem74 0.784957053 0.247943 0.017321 0.05757 Transmembrane protein 74 Tnf Tnf Tumor necrosis 1.204004432 0.797815 0.000472 0.135775 factor Tnfsf10 Tnfsf10 Tumor 1.960977355 0.023288 0.008546 0.011834 necrosis factor (ligand) superfamily, member 10 Trp53 rp53 Transformation 1.175304136 0.037463 0.326284 0.052572 related protein 53 Ulk1 Ulk1 Unc-51 like 1.387537296 0.016975 0.01695 0.07797 kinase 1 (C. elegans) Ulk2 Ulk2 Unc-51 like 1.123750385 0.339582 0.012785 0.478719 kinase 2 (C. elegans) Uvrag Uvrag UV radiation 1.139726986 0.444456 0.013047 0.394375 resistance associated gene Wipi1 Wipi1 WD repeat 1.203542904 0.288162 0.009851 0.495238 domain, phosphoinositide interacting 1

Supplementary Table 3-7. KLF4 manipulation alters expression of a broad spectrum of genes in the autophagy pathway. MEFs were infected with adenovirus expressing KLF4 mRNA or KLF4-targeting shRNA for 72 h. Corresponding empty viruses (Ad-EV, Sh-EV) were used as control. Table shows fold changes and p-values for each gene assessed. (p<0.05 by Student T-test, N=3).

115

Endothelial restricted KLF4 overexpression delays vessel aging and enhances autophagy

We have found that a C. elegans KLF modulates nematode lifespan through regulation of autophagy and that this regulation is functionally conserved via mammalian KLF4. Previous studies by our lab have demonstrated a crucial role for KLF4 in vascular health and function, conferring protection from atherothrombosis, as well as mediating many of the effects of fluid shear stress on the endothelium.214,215 In humans, an aged vasculature is the dominant risk factor for the development of cardiovascular disease and is characterized by a number of changes, notably an increase in arterial stiffness and reduction in endothelial-dependent dilation in response to blood flow.303 We therefore questioned whether vascular KLF4 might also influence mammalian vascular aging.

Consistent with a role for KLF4 in mammalian vascular aging, Klf4 expression decreased with age in isolated murine endothelial cells (Fig. 3-5a). Indeed, expression of p16INK4a/Rb and p21, markers of cellular senescence, was increased with age in isolated endothelial cells from young (2 months) and middle-aged (~ 11 months) animals, and this increase was attenuated in age- matched endothelial restricted Klf4 transgenic mice (ECK4TG) (Fig. 3-5b, c).304

The physiologic effects of aging on the mammalian arterial tree have long been recognized as an increase in vascular stiffness, an effect ameliorated by the

116 application of caloric restriction.305,306 Therefore, we used ECK4TG mice and assessed vascular stiffness in vivo. Vascular distensibility decreased with age in ascending aortas of wild-type mice (Fig. 3-5d) and its loss was delayed in middle-aged transgenic mice compared with age-matched controls. Finally, we asked whether KLF4 levels in humans were altered with age. To investigate this, we analyzed skeletal muscle samples obtained from young and old healthy patients. As expected, total VO2max declined with age (Supplementary

Fig. 3-14A). Interestingly, we detected a concurrent age-associated decrease in KLF4 mRNA transcript levels from RNA isolated from whole samples, suggesting that an age-associated reduction in KLF4 may have physiologic significance (Supplementary Fig. 3-14B). Co-staining of skeletal muscle using antibodies directed against KLF4 and CD31 to identify endothelial KLF4 in the microvasculature revealed that levels of vascular KLF4 were strongly decreased with age, localizing a portion of the observed decrease in KLF4 in whole samples to the vascular component (Fig. 3-5e). Together, these findings point towards a role for vascular KLF4 in mammalian aging.

117

Fig. 3-5. KLF4 regulates autophagy and ageing in vasculature and decreases with age. (A) qPCR analysis of Klf4 in isolated cardiac endothelial cells in young and middle-aged wild-type mice. (young=3 months, middle- aged=10-12 months, N=3 biological replicates). *P-value<0.05 by Student’s T- test. qPCR analysis of p16 (B) and p21(C) in isolated cardiac endothelial cells in young and aged wild-type and ECK4TG mice (young=3 months, aged=10-12 months, N=3 biological replicates). *P-value<0.05 after one-way analysis of variance followed by the Tukey post hoc test. (D) Ascending aorta dilation at baseline in young and aged transgenic control and ECK4TG mice (young=3 months, aged=10 months, N=6-9). *P-value<0.05 after one-way analysis of variance followed by the Tukey post hoc test. (E) Expression of CD31 and KLF4 by immunofluorescence, with DAPI staining, representative images. CD31 positive areas are marked by dotted lines. Arrows indicate CD31 positive endothelial cells. Arrowheads indicate KLF4 positive endothelial nuclei. Scale bar = 50μm. Correlation studies were performed with R2 = 0.8626 (Pearson correlation, P-value = 0.003; N = 7 patients). Further details in Methods Section. (F) Ascending aorta diastolic (AA-d) and systolic (AA-s) diameter in control (CADcre, N=6) and Klf4 endothelial knockout (K4ECKO, N=9) mice before and during acetylcholine infusion (t=0). Diameter assessed by M-mode echocardiography. Ratio of baseline (Ratio of BL). *P-value<0.05 by Student’s T- test. Further details in Methods Section. (G) Western analysis of HUVECs overexpressing KLF4 with and without BFA treatment with knockdown of KLF4

118 in rapamycin treated HUVECs. Briefly, HUVECs were treated with adenoviral KLF4 or siRNA targeting KLF4 and effects assessed by Western blot 2 days afterwards. Data shown are representative of two independent experiments. Further details in Methods section. (H) Administration of chloroquine in middle- aged mice to inhibit autophagy and measurement of ascending aorta dilation in middle-aged transgenic control and ECK4TG mice (aged=10-12 months, NS = normal saline, CQ = chloroquine, N=6-9). *P-value<0.05, after one-way analysis of variance followed by the Tukey post hoc test. All error bars represent standard error of the mean (SEM).

119

Supplementary Figure 3-14. VO2max and KLF4 levels decrease with age in humans. (A) Maximal oxygen consumption (VO2max) in young and old patients. N=5 patients per group. * represents P-value<0.05 by Students T-test. Further details in Methods Section. (B) qPCR analysis of skeletal muscle biopsies (whole tissue) in young (20-40 years old) and aged (50-70 years old) patients. N=5 patients per group. * represents P-value<0.05 by Students T-test.

120

We further investigated other age-related alterations in the vessel that might contribute to vessel stiffness. Vessel distensibility in vivo may be influenced by structural components as well as functional responses. We observed no significant change in aortic diameter, aortic wall thickness, or aortic wall area between middle-aged ECK4TG and wild-type mice (Supplementary Fig. 3-15).

Quantitative analysis of Trichrome stained sections of murine thoracic aortae revealed little change in intermuscular collagen deposition between aged control and ECK4TG mice (Supplementary Fig. 3-15). Elastin staining demonstrated no significant differences between wild-type and ECK4TG mice in elastin disorganization and number of breaks (Supplementary Fig. 3-15).

Additionally, aortae demonstrated similar SMC α-actin immunoreactivity with uniform expression, which, together with the unaltered wall thickness, suggested little smooth muscle proliferation or migration (Supplementary Fig.

3-15). Together, these findings suggest that structural composition of the vessel wall is not a major determinant of the KLF4 effect on vessel distensibility. Next, we sought a functional contribution to distensibility by performing in vivo acetylcholine infusion in wild-type and endothelial-specific

Klf4 knockout mice. The vasodilatory response elicited by acetylcholine is strictly dependent on the endothelium, and the loss of endothelial-specific

KLF4 completely abolished this response, suggesting that the effect of KLF4 on vascular distensibility is primarily through its effects in the endothelium (Fig.

3-5f).

121

Supplementary Figure 3-15. Structural wall components are unchanged in aged WT versus aged ECK4TG mice. (A) Representative aortic sections from aged (12-14 months) WT and ECK4TG mice, N=3 per group. Top, hematoxylin and eosin staining, upper middle, elastin staining, lower middle, trichrome staining, bottom, antibody against α-smooth muscle actin (red) with 4′,6-diamidino-2-phenylindole (DAPI, blue) counterstaining to identify nuclei. Sections were taken at the T2 level of the thoracic aorta. All images were taken at 100x magnification. Scale bar, 50μm. (B) Quantitative morphometry (lumen diameter, aortic wall thickness, aortic wall area), and quantification of elastin degradation and collagen deposition of perfusion-fixed aortic cross sections from aged (12-14 months) WT and ECK4TG mice, N=3 per group. N.S. = non-significant by Student’s T-test. Further details in Methods Section.

122

While autophagy has been found to be critical in reducing endothelial lipid burden and maintaining hemostasis after vessel injury, to date, the transcriptional regulation of autophagy in endothelial cells is not well understood.307,308 Given our previous findings, we hypothesized that KLF4 modulation of vessel aging might be dependent on regulation of autophagy.

We treated human umbilical vein endothelial cells (HUVECs) by serum starvation or rapamycin and found strong induction of KLF4 (Supplementary

Fig. 3-16). We also found that overexpression of KLF4 in HUVECs increased

LC3-I lipidation. Upon BFA treatment, LC3-I lipidation was more strongly increased, suggesting enhanced autophagic flux, while conversely, siRNA knockdown of KLF4 weakened autophagy induction by rapamycin treatment

(Fig. 3-5g). A cardinal feature of endothelial function, which decays with age, is the regulation of vascular tone, achieved largely through the generation of nitric oxide and the elevation of expression of endothelial nitric oxide synthase

(eNOS) under conditions of laminar blood flow. Importantly, in HUVECs subjected to laminar shear stress, a stimulus that strongly induces KLF4, in the presence or absence of autophagy blockade via ATG7 siRNA knockdown, the increase in eNOS protein levels was blunted, suggesting that regulation of endothelial function is partially autophagy-dependent (Supplementary Fig. 3-

17). Additionally, the improvement of vessel distensibility in middle-aged

ECK4TG mice was strongly attenuated upon administration of the autophagy inhibitor chloroquine (Fig. 3-5h). Collectively, our findings point toward a role

123 for KLF4 in mammalian vascular aging, likely through conserved effects on endothelial autophagy.

Supplementary Figure 3-16. KLF4 is induced in HUVECs by serum starvation and rapamycin. Rapamycin treatment (20ug/mL) (A) and serum starvation (B) induce KLF4 expression. Cells were incubated in rapamycin 24 hours before harvest. Starvation was accomplished via replacement of media with DPBS for the 1 hour before harvest. *P-value<0.05 by Student’s T-test. N=3.

124

Supplementary Figure 3-17. Flow-induced eNOS expression is autophagy dependent. HUVECs were subjected to siRNA against Atg7 for 48 hours, then to static or laminar flow (shear stress of 17 dyne/cm2) for an additional 24 hours prior to harvest. Representative blot is shown from two independent experiments. Further details in Methods section.

125

Discussion

Here we demonstrate that the KLFs are critical determinants of aging, influencing both lifespan and age-related deterioration, and are broadly required for lifespan extension in all four mechanistically distinct longevity models tested. Importantly, we provide evidence that these effects are mediated by KLF regulation of autophagy and are conserved in a mammalian system via a functional ortholog, KLF4. Together, our findings provide a role for the KLFs as a transcriptional regulatory point in longevity.

Mechanistically distinct long-lived model organisms share several hallmark features. For example, autophagy is enhanced in models of reduced

IIS signaling, TOR inhibition, and dietary restriction.309 Recent studies have begun to provide insight into how complex and disparate signaling pathways can have coordinated anti-aging responses. For example, the nuclear hormone receptor NHR-62, FOXA ortholog PHA-4, and TFEB ortholog HLH-30 have been found to induce expression of autophagy genes in C. elegans and are required for lifespan extension across a variety of dietary restriction models310.

In addition to these observations, we now demonstrate that the KLFs are required for autophagy under several distinct longevity pathways. We therefore suggest a model by which the transcriptional regulation of autophagy, which must maintain organelle and protein homeostasis in nearly every long-lived state, summates multiple upstream inputs through increased activity of common nodal transcriptional regulators. This may occur through increased

126

KLF activity, and may also involve the previously identified hlh-30. This allows unified pro-longevity responses in the face of diverse environmental and nutritional stimuli and implies the existence of convergence points in pathways modulating lifespan which may offer attractive targets for therapeutic intervention. What upstream signals interact with the KLFs and the relationship of the KLFs with other known autophagy transcriptional regulators like pha-

4/FoxA and hlh-30 will be important future directions for investigation.309

Our genetic loss-of-function data suggest functional redundancy exists between the KLF family members in C. elegans. Loss of both klf-1 and klf-3 reduce lifespan while single overexpression of either klf-1 or klf-3 is sufficient to extend it.148 Although it is possible that klf-1 and klf-3 operate through two independent pathways to modulate lifespan, our qPCR analysis demonstrating stronger reduction in transcript levels of autophagy genes with klf-1 and klf-3 loss compared to single loss argues more strongly for shared gene targets between klf-1 and klf-3. Such robustness in regulation of critical processes such as autophagy is not surprising and is likely not unique to the KLF family of transcriptional regulators, which may have implications for the discovery of novel longevity related genes through high-throughput screens.

Our studies are consistent with the body of evidence supporting the positive role of autophagy in health and longevity across phylogeny. Further our studies add to a growing appreciation of the importance of transcriptional regulation of autophagy in aging. Specifically, we demonstrate that the KLFs are direct transcriptional regulators of autophagy, likely through direct

127 regulation of a broad array of genes with distinct functions in the autophagic process. This regulation may be particularly relevant in defending against the repeated, chronic insults that occur during aging.

In C. elegans, klf-1 has been implicated in fat regulation and apoptosis, while klf-3 regulates lipid transport and metabolism.300,301,309 We report here that the KLFs regulate autophagy as well and that their effects on lifespan are dependent on it. However, our data do not exclude the contribution of other

KLF-regulated pathways such as fat metabolism; indeed, it is likely that autophagy may be involved in or mediate the effects of lipid metabolism on lifespan.311 The molecular mechanisms linking lipid metabolism and autophagy and how they impact health and longevity remain to be elucidated.312,313

The identification of a functional analog, KLF4, in a mammalian system raises the possibility that its modulatory effects on longevity may also be conserved as well. In humans, cardiovascular disease remains the leading cause of death in developed countries. Accumulating evidence suggest that dysfunction of the vascular endothelium underlies a number of cardiovascular diseases of aging including hypertension (vessel tone), atherosclerosis, and calcification. Klf4 is expressed in a diverse set of mammalian tissues, including endothelial cells and our findings point to KLF4 as serving an essential role in vascular health and aging.147 In rat carotid arteries, Klf4 is induced by rapamycin, while we previously demonstrated endothelial KLF4 to be protective against atherothrombosis, to generate an anti-inflammatory endothelial phenotype, and to be required for mitochondrial turnover in cardiac

128 muscle cells.201,216,269,314 Here we show additionally that endothelial-specific manipulation of KLF4 modulates several characteristic features of vessel aging, namely a decline in eNOS expression, increased stiffness, and a rise in endothelial replicative senescence. Combined with prior observations on the requirement of KLF4 for mechanotransduction pathways in endothelial cells, we propose that age-associated increases in disturbed blood flow lead to lowered levels of KLF4 in blood vessels to promote endothelial dysfunction and, over time, contribute to the increased risk of atherosclerosis and other vessel-related pathology seen in aged individuals.315,316 Indeed, expression of both KLF4 and KLF2 is reduced in endothelial cells at regions of turbulent flow such as arterial branch points and the inferior aspect of the aortic arch, and these regions experience low levels of autophagic flux leading to a proinflammatory phenotype.213,214,216,315,317-320 Whether KLF2 is also involved in the regulation of endothelial autophagy remains an open question. Our findings provide a novel physiological context for KLF4 in maintaining healthy, youthful endothelium whereby the beneficial effect of laminar shear stress on endothelium may be dependent on KLF4 regulation of autophagy. Our results also support the notion that endothelial autophagy may be sensitive to mechanical conditions created by blood flow in addition to nutrient status, which likely reflects the specialized nature of many endothelial functions.

Notably, the regulation of autophagy in the endothelium requires further study and, in recent years, this topic has attracted growing interest. The health of the endothelium is essential to its functions at the interface of circulating

129 fluid and the vessel wall. As an integrator and transducer of various physiologic stimuli, the endothelium is involved in many processes including the maintenance of a semi-permeable barrier, blood fluidity, and vasoreactivity.

Dysfunction of the endothelium also plays a critical role in the development of vascular pathology such as atherosclerosis. An accumulating body of evidence suggests diminished endothelial autophagy may underlie endothelial dysfunction stemming from a diverse set of risk factors. For example, in a series of studies, Torisu et al.307,308 provided evidence that mice with endothelial-specific loss of Atg5 and Atg7 exhibit impaired secretion of a major regulator of blood fluidity, von Willebrand factor homolog, suggesting that reduced autophagy in the endothelium may contribute to hypercoagulable states. On the other hand, increased autophagy in endothelial cells is protective against harmful effects of oxidized low-density lipoprotein, reactive oxygen species, hypoxia, and advanced glycation end products, observations in line with the finding that treatment of atherosusceptible (LDLR−/−) mice with an mTOR inhibitor was protective.321-326 Finally, attenuated autophagy is correlated with reduced arterial endothelium-dependent dilatation in aortas of old mice and treatment with trehalose to induce autophagy rescues the reduction.327 The precise mechanisms by which endothelial autophagy mediates these effects, mechanisms that include alterations in NO bioavailability, oxidative stress, and inflammation, remain active areas of investigation.

130

Finally, the degree in which the endothelial organ contributes to organismal aging remains an open and complex question, as does the question of whether KLF4 in other tissues or other KLFs, notably KLF2, have roles in mammalian aging as well. Vascular function, and correspondingly endothelial function, is highly dynamic especially as blood flows from large vessels to increasingly smaller ones down to the single cell level. Due to technical limitations, KLF4 expression and regulatory control of endothelial functions in large vessels is well understood, but its role in small vessel and especially microvessels deserves deeper investigation. Mice with dual endothelial specific loss of KLF2 and KLF4 injected with Evans Blue dye reveal extravasation into the lungs, kidneys, brain, and heart reflective of a reduction in expression of a series of tight junction and adherens junction genes. 328

These observations suggest enhanced vascular leak after loss of KLF2 and

KLF4, perhaps due to reduced microvascular barrier integrity.

As cardiovascular disease due to atherosclerosis is a primary cause of mortality in the United States and its incidence rises with age329, it is intriguing to consider that the events of atherogenesis (plaque formation, smooth muscle cell proliferation) are closely associated with endothelial senescence, as atheromas have been shown to contain senescent cells.330,331 During vessel aging, this rise in endothelial cellular senescence, which is affected by numerous factors including oxidative stress, DNA damage and telomere attrition, as well as changes in autophagic flux, may in part underlie the long observed age-associated increase in risk of cardiovascular pathology. Indeed,

131 endothelial senescence contributes to vascular leak via disruption of cell-cell junctions, raising the possibility that KLF effects on barrier integrity may be mediated by increased cellular senescence, perhaps even through decreased autophagy.332 Further, an endothelial senescent phenotype is a source of systemic chronic inflammation; senescent cells enhance secretion of 40-80 mostly pro-inflammatory factors including IL-1, GM-CSF, MCP-2, and MMP-1

(termed the senescence-associated secretory phenotype).64,333,334 As chronic inflammation is recognized today as a major contributor, even “hallmark”, of aging, the endothelial organ itself may drive organismal aging. Indeed, a natural extension of this is the idea that health of the cardiovasculature may be a limiting factor in human longevity and therefore be a primary determinant of human lifespan, expressed in Thomas Sydenham’s axiom, “man is only as old as his arteries.”

The ubiquitous nature of the endothelium almost certainly necessitates context specific interactions with the surrounding tissue. The marked decrease in vascular KLF4 in skeletal muscle we observe here likely has detrimental effects on muscle function; indeed, the role of small vessel function (e.g. blood flow, angiogenic capacity) in exercise adaptation is well known.335,336 The age- associated alterations we find in VO2max therefore are likely a consequence of alterations both in skeletal as well as vascular components. It seems likely that alterations in endothelial autophagic flux will therefore impact function in a tissue-specific way, although we discuss only skeletal muscle here.

Additionally, our data do not exclude some contribution of skeletal muscle

132

KLF4 to age-related change. Tissue-restricted and inducible gene expression studies may offer additional insights into the spatial and temporal contribution of the KLFs to longevity, and provide further avenues of investigation.

133

CHAPTER 4: A COMPLEMENT PROTEIN MEDIATES NEUROPROTECTION IN A MODEL OF PARKINSON’S DISEASE VIA A GUT-NEURON AXIS

Authors: Paishiun N. Hsieh, Yiyuan Yuan, Joseph Feng, Laurence Ducker,

Jason Ong, Yu Luo, Zhaoyang Feng, & Mukesh K. Jain

Portions of this chapter will be submitted for publication

Summary

Aging is accompanied by an increased risk of chronic disease, notably neurodegenerative diseases such as Parkinson’s disease. Therefore, a central challenge of aging research is the extension of time spent free of age-related debility, or healthspan. Over the last several decades, studies in model organisms like the roundworm Caenorhabditis elegans have identified transcriptional regulators (e.g. FOXO) which modify the fundamental biology of aging, modulating lifespan as well as delaying the onset of aging-associated pathology. Above, we demonstrated that the Krüppel like factors, a conserved subfamily of zinc-finger transcription factors, are bona fide regulators of aging in worms and also influence cardiovascular aging in mice. Here we show that a long-lived worm overexpressing klf-3 is resistant to age-related neurodegeneration in a model of Parkinson’s disease overexpressing mutant α- synuclein. Interestingly, we find that the neuroprotective effect of klf-3 is localized to the intestine, as intestine specific overexpression of klf-3 is sufficient to

134 phenocopy systemic overexpression. Further, using RNA-seq analysis, we identify a secreted C-type lectin, clec-186, which is required for and mediates the neuroprotective effect of intestinal klf-3. Systemic deletion or intestine specific knockdown of clec-186 completely abolishes klf-3 mediated neuroprotection while dopamine specific knockdown of clec-186 has no effect. Sequence analysis of C. elegans klf-3 points to the complement protein COLEC11 as a mammalian ortholog. COLEC11 is detectable in rat brains and CSF and studies currently ongoing will assess a conserved neuroprotective role for COLEC11 in mammals.

Collectively, these observations identify a mechanism mediating neuroprotection via a gut-neuron axis whereby intestinal klf-3 regulation of the secreted complement protein clec-186 modulates distant neuronal responses to proteotoxic stress due to misfolded α-synuclein. Our findings additionally shed light on the mechanisms coupling longevity with extension of healthspan and have implications for targeting the underlying aging biology in age-dependent diseases, which currently pose an enormous burden on healthcare systems worldwide.

135

Introduction

Parkinson’s disease (PD) is a neurodegenerative disorder characterized by the loss of nigrostriatal dopaminergic neurons and appearance of ubiquitylated cytoplasmic inclusions called Lewy bodies which contain α- synuclein. Its incidence rises sharply with age (mean age of onset is 55) and clinically, patients with PD experience a range of motor disabilities (tremors at rest, rigidity, bradykinesia, hypokinesia, akinesia, freezing) which eventually impair normal daily activities, as well as cognitive deficits.

Modulation of longevity pathways modifies the progression and severity of disease in models of PD. Dietary restriction enhances resistance of dopaminergic neurons to 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) treatment in mice and rats,337 and calorie restriction in rhesus monkeys treated with MPTP alleviated motor symptoms.338 Further, the mTOR inhibitor rapamycin is neuroprotective in MPTP and genetic mouse models of PD through various mechanisms.339,340 Interestingly, reduced IGF-1 signaling in heterozygous IGF-1 receptor mice treated with MPTP to induce selective dopaminergic neuron injury increased severity of MPTP-induced lesions, likely due to an enhanced neuro- inflammatory response, potentially due to unanticipated effects of MPTP. 341

The pathogenesis of PD remains the subject of debate, complicating the development of accurate models. While MPTP or 6-hydroxydopamine is commonly administered to mimic dopaminergic neuron loss, other genetic models have been developed based on current knowledge of genes causally linked to PD, for example identification of mutations in α-synuclein.342 These

136 models however, are limited in that they do not mimic the progressive nature of

PD neurodegeneration, and often do not exhibit the same pathological features, such as Lewy bodies. Further, a recent link between the gut microbiota and dopaminergic neuron health in a mouse model of PD suggests that the pathogenesis of PD may in fact extend beyond human physiology.343

The Kruppel like factors are a family of zinc-finger transcriptional regulators with recently recognized links to longevity in C. elegans and mice.148,149 Importantly, overexpression of klf-3 in c. elegans delays the appearance of several age-associated phenotypes, thus extending nematode healthspan.149 Therefore, we hypothesized that increased KLF activity would also impact the progression of age-related neurodegeneration. Using a genetic model of PD in C. elegans overexpressing α-synuclein in the dopaminergic neurons, we show that overexpressing klf-3 delays neurodegeneration and localize this benefit to the intestine of the worm. We further identify a secreted mediator of this effect, intestinal c-type lectin clec-186, and propose that its mammalian orthologue COLEC11 may have conserved effects in modulating neurodegeneration with respect to PD.

Results

Overexpression of klf-3 delays neurodegeneration in a C. elegans model of

Parkinson’s Disease

To assess the role of klf-3 in modulating healthspan, we utilized a C. elegans model of Parkinson’s Disease previously characterized in our laboratory.344 This

137 nematode overexpresses pathogenic human α-synuclein (αSyn) and dsRed driven by the dopaminergic neuron specific promoter of dat-1 and experiences accumulation of α-synuclein leading to neuron and dendrite loss, motor deficits, food-sensing failure (a dopamine dependent behavior) and reversal of some of these phenotypes upon administration of levo-dopa.345 Therefore, it recapitulates many features of Parkinson’s disease. In αSyn worms, overexpression of klf-3 driven by a putative promoter ~2.5kb upstream of the start codon delayed neurodegeneration; klf-3 o/e nematodes had roughly double the number of fluorescently labeled dopaminergic neurons at Day 10 after adulthood of control

αSyn animals, suggesting an age-specific neuroprotective effect of klf-3 (Fig. 4-

1).

We then assessed basal slowing response, a food sensing behavior dependent on dopaminergic neuron function.284 Nematodes deficient in cat-2, the C. elegans orthologue for tyrosine hydroxylase, have an impaired response.344

Unexpectedly, both overexpression and global loss of klf-3 in nematodes abolished basal slowing response (Fig. 4-2). The reason for this is unclear; however, baseline banding speed was lower in klf-3 o/e animals and higher in klf-3 mutants, implying a direct impact of klf-3 on locomotion. Therefore, it is possible that this primary effect masks a modest effect of klf-3 on basal slowing response in the context of α-synuclein expression. Next, we measured age- related loss of locomotory speed in αSyn animals. As expected, locomotory speed declines with age in αSyn worms. Consistent with a direct effect of klf-3 on locomotion and in line with our prior basal slowing response experiments, young

138

Day 1 klf-3 o/e worms exhibited slower maximum locomotory speeds compared with control αSyn animals. While at Day 5, klf-3 o/e worms maintained locomotory function to a moderately higher degree than control αSyn animals, this did not reach the level of significance. Together, these results provide a potential role for klf-3 in attenuating proteotoxic stress induced by α-synuclein in dopaminergic neurons.

139

Fig. 4-1. Klf-3 delays neurodegeneration in a C. elegans model of Parkinson’s Disease. In vivo confocal images of day 1 and day 10 control αSyn or αSyn overexpressing klf-3 under a putative promoter 2.5kb upstream of the start codon. All worms express DsRed driven by a dopaminergic neuron specific promoter. Number of fluorescent dopaminergic neurons in nematode head were counted. Representative images shown on left. Arrows and arrowheads indicate dopaminergic neuron bodies. Cells were counted in 10 animals in each group. * represents P-value<0.05 by Students T-test.

140

7 * 6 5 4 On food 3 Off food 2

1 Number of bands per 20 seconds 20 per bands of Number 0 WT klf-3klf-3 o/e o/e klfklf-3-3

Fig. 4-2. Klf-3 alters dopaminergic neuron dependent functions. Basal slowing response of day 1 adult control N2 wild-type, klf-3 o/e, and klf-3 mutant animals. Food response assays conducted with (black bars) or without (white bars) food. Cells were counted in 10 animals in each group. * represents P- value<0.05 by Students T-test.

141

Figure 4-3. Klf-3 does not impact motor deficit in αSyn animals. Age-related decay in locomotory speed in klf-3 o/e worms compared to control αSyn worms (N=10 per group). Worms were picked onto fresh NGM plate without OP50 and scored for 2 minutes before being returned to plate. Otherwise, animals were fed OP50 and maintained at 20oC. * represents P-value<0.05 after Student’s T-test. All error bars represent standard error of the mean (SEM).

142

Intestinal specific overexpression of klf-3 delays neurodegeneration

We next examined tissue specific contribution of klf-3 to neuroprotection. As the majority of klf-3 in C. elegans is expressed in the intestine of the worm, we generated intestine specific transgenic animals overexpressing klf-3 driven by the intestine specific ges-1 promoter and measured dopaminergic neurodegeneration.300 Impressively, intestinal klf-3 o/e animals exhibited nearly the same degree of neuroprotection as klf-3 o/e (Fig. 4-4). As we have shown above, overexpression of klf-3 extends nematode lifespan; therefore, we interrogated lifespan of worms overexpressing klf-3 in an intestine restricted manner. Surprisingly, intestinal klf-3 o/e animals do not experience extended life, suggesting that distinct mechanisms drive the effects of klf-3 on lifespan versus healthspan, and that these mechanisms may be separated by tissue specificity of klf-3 functions (Fig. 4-5).

As intestinal klf-3 was sufficient to provide neuroprotection, we hypothesized that a released factor, synthesized and secreted by the intestine and regulated by klf-

3, was responsible for mediating neuroprotection in dopaminergic neurons. A catalog of putative secreted proteins containing a signal peptide in the C. elegans genome has been created.346 Thus, we performed an RNA-seq analysis of single klf-3 o/e animals and by cross-referencing with this catalog of secreted proteins, identified 11 mRNA transcripts predicted to be secreted and significantly altered in klf-3 o/e worms compared to wild-type worms (Fig. 4-6). Of note, several c- type lectin proteins were identified, and we targeted our top hit, the gene clec-

186, for further validation.

143

Fig. 4-4. Intestinal klf-3 delays dopaminergic neurodegeneration. In vivo confocal images of day 7 control αSyn or αSyn overexpressing klf-3 under the intestine specific ges-1 promoter. All worms express DsRed driven by a dopaminergic neuron specific promoter. Number of fluorescent dopaminergic neurons in nematode head were counted. Representative images shown on left. Arrowheads indicate dopaminergic neuron bodies. Cells were counted in 10 animals in each group. * represents P-value<0.05 by Students T-test.

144

Figure 4-5. Intestinal klf-3 overexpression does not extend lifespan. Lifespan analysis of animals overexpressing klf-3 driven by intestine specific ges- 1 promoter. P-value>0.05 by Mantel-Cox log-rank tests compared to control.

145

Figure 4-6. RNA-seq analysis of putative secreted genes in klf-3 o/e animals. Single klf-3 o/e or wild-type animals at young adult stage were harvested for RNA, (N=3 for klf-3 o/e, N=2 for wild-type). Genes are arranged, going from top to bottom, by degree of upregulation (red, orange, yellow) proceeding to downregulation (green).

146

Intestinal clec-186 is required for intestinal klf-3 mediated neuroprotection

We generated intestinal klf-3 o/e αSyn animals with global loss of clec-186 by mating and measured neurodegeneration. Intestinal klf-3 overexpression in the absence of clec-186 no longer provided neuroprotection as intestinal klf-3 o/e

αSyn animals experienced the same degree of neurodegeneration as αSyn clec-

186 mutants without klf-3 overexpression (Fig. 4-7). These observations confirm that clec-186 is required for klf-3 neuroprotection. To test the specificity of this effect, as an alternative explanation for our results is that clec-186 sickens the animals, we repeated the experiment using nlp-24. Nlp-24 was not required for neuroprotection in intestinal klf-3 o/e nematodes, confirming the specific requirement of clec-186 (Fig. 4-8).

To determine that clec-186 originating from the intestine was required for neuroprotection, we generated worms capable only of RNAi in the intestine or the dopaminergic neuron as previously described using rde-1 mosaic nematodes.347

First, to confirm that whole animal RNAi recapitulated the phenotype of clec-186 genetic inactivation, we assessed neurodegeneration in intestinal klf-3 o/e αSyn animals fed control RNAi bacteria or RNAi bacteria containing dsRNA targeting clec-186. Again, we found that loss of clec-186 systemically abolished the neuroprotective effect of intestinal klf-3 (Fig. 4-9). Next we fed intestine specific

RNAi, intestinal klf-3 o/e αSyn animals control RNAi bacteria or RNAi bacteria containing dsRNA targeting clec-186 (Fig. 4-10). Remarkably, intestine restricted loss of clec-186 suppressed neuroprotection mediated by intestinal klf-3 (Fig. 4-

147

11). We investigated the specificity of our RNAi model by utilizing a dopaminergic neuron specific RNAi, intestinal klf-3 o/e αSyn nematode and feeding it control

RNAi bacteria or RNAi bacteria containing dsRNA targeting clec-186. This worm experienced no change in intestinal klf-3 mediated neuroprotection, suggesting that indeed, our RNAi models are specific, and that only intestinal clec-186 is required for the neuroprotective effect of intestinal klf-3 (Fig. 4-12). We next searched for a mammalian orthologue for C. elegans clec-186. Sequence analysis using Ortholist suggested high similarity to COLEC11, a gene in the alternative complement pathway.348

148

Fig. 4-7. Intestinal klf-3 mediated dopaminergic neuroprotection requires systemic clec-186. In vivo confocal images of day 7 clec-186 αSyn or clec-186 αSyn overexpressing klf-3 under the intestine specific ges-1 promoter. All worms express DsRed driven by a dopaminergic neuron specific promoter. Number of fluorescent dopaminergic neurons in nematode head were counted. Cells were counted in 10 animals in each group.

149

Fig. 4-8. Intestinal klf-3 mediated dopaminergic neuroprotection does not require systemic nlp-24. In vivo confocal images of day 7 nlp-24 αSyn or nlp-24 αSyn overexpressing klf-3 under the intestine specific ges-1 promoter. All worms express DsRed driven by a dopaminergic neuron specific promoter. Number of fluorescent dopaminergic neurons in nematode head were counted. Cells were counted in 10 animals in each group. * represents P-value<0.05 by Students T- test.

150

Fig. 4-9. Whole animal RNAi depletion of clec-186 abrogates intestinal klf-3 mediated dopaminergic neuroprotection. In vivo confocal images of day 7 intestinal klf-3 o/e αSyn animals RNAi-capable systemically fed control RNAi bacteria or bacteria containing dsRNA targeting clec-186. All worms express DsRed driven by a dopaminergic neuron specific promoter. Number of fluorescent dopaminergic neurons in nematode head were counted. Cells were counted in 10 animals in each group. * represents P-value<0.05 by Students T- test.

151

Fig. 4-10. Scheme for generation of intestine and dopaminergic neuron specific RNAi models. Rde-1 is required for exogenous RNAi transport into cells, therefore these systemic rde-1 knockout worms cannot carry out RNAi induced by dsRNA RNAi bacteria feeding. Introduction of rde-1 under Nhx-2p or dat-1p allows tissue specific rescue of RNAi. Nhx-2p and ges-1p are intestine specific promoters. Dat-1p is a dopaminergic neuron specific promoter. Lin-15b and eri-1 are sensitizing mutations for dopaminergic neuron RNAi. Sid-1 is a double-stranded RNA transporter used for rescue of RNAi function behind an SL2 trans-splice site so that sid-1 and rde-1 are a single transcriptional unit. Both sid-1 and rde-1 are introduced in dopaminergic specific RNAi worms to enhance RNAi efficacy. Myo-2p is a smooth muscle specific promoter used as a marker for worms carrying ges-1p::klf-3. UV/TMP gene integration was carried out to avoid transgene silencing effects.

152

Fig. 4-11. Intestinal klf-3 mediated dopaminergic neuroprotection requires intestinal clec-186. In vivo confocal images of day 7 intestinal klf-3 o/e αSyn animals RNAi-capable only in the intestine fed control RNAi bacteria or bacteria containing dsRNA targeting clec-186. All worms express DsRed driven by a dopaminergic neuron specific promoter. Number of fluorescent dopaminergic neurons in nematode head were counted. Cells were counted in 10 animals in each group. * represents P-value<0.05 by Students T-test.

153

Fig. 4-12. Intestinal klf-3 mediated dopaminergic neuroprotection does not require dopaminergic neuron clec-186. In vivo confocal images of day 7 intestinal klf-3 o/e αSyn animals RNAi-capable only in the dopaminergic neuron fed control RNAi bacteria or bacteria containing dsRNA targeting clec-186. All worms express DsRed driven by a dopaminergic neuron specific promoter. Number of fluorescent dopaminergic neurons in nematode head were counted. Cells were counted in 10 animals in each group. P-value>0.05 by Students T- test.

154

Discussion

We show here that C. elegans klf-3 modulates neurodegeneration associated with PD. This effect originates from the intestine and is mediated by the c-type lectin clec-186, an orthologue of the mammalian complement protein

COLEC11. Our observations provide evidence that the KLFs not only modulate longevity, but also healthspan, delaying the onset and progression of PD. In ongoing experiments we plan to measure levels of COLEC11 in rat models of

Parkinson’s, assess conservation of function via injection of COLEC11 into rats after dopaminergic neuron loss, and determine the mechanistic basis of

COLEC11’s effect on neurodegeneration. Indeed, future studies must demonstrate sufficiency in addition to requirement.

The identification of clec-186 as required for the klf-3 mediated neuroprotection provides a mechanistic basis for the observed separation of lifespan and healthspan in klf-3 overexpressing nematodes, where animals overexpressing klf-3 driven by a putative endogenous promoter experience extended lifespan while animals overexpressing klf-3 only in the intestine do not, but are protected in a model of PD from neurodegeneration. Whether complement, or innate immunity more generally, mediates healthspan extension in other contexts beyond PD remains to be seen. Additionally, as regulators of systemic chronic inflammation have been linked to longevity, our findings imply the existence of some currently underappreciated specificity to the modulation of lifespan and healthspan by immune mechanisms.

155

It will be of interest to examine the broader role of innate immune molecules in mediating gut-brain communication. Perhaps it is not surprising that as an organ directly sampling the outside world, the intestine might act as a transducer of external signals to other organs like the brain. Understanding the mechanisms that govern this process will have immediate clinical impact, as the identification of circulating mediators will allow for development of blood based biomarkers for disease as well as rational design of interventions (i.e. novel drug targets).

156

CHAPTER 5: CONCLUSIONS AND DISCUSSION

Portions of this chapter have been published in Trends in Cell & Molecular

Biology 12:1-15; 20171,d

Conclusions

Modern efforts to understand aging couple insights from short-lived model organisms with observations from higher order mammals. The Krüppel like factors are relatively new to the field of aging. Their roles in diverse mammalian processes have been fruitful areas of investigation, yet until recently, they have not been evaluated as factors regulating the aging process. We propose that many of the functions of the KLFs, previously viewed through the lens of a particular physiologic or disease process, in fact modify the fundamental progression of aging. We show here evidence that modulation of KLF activity correspondingly alters length of life in the nematode C. elegans, and that this effect is dependent on KLF enhancement of proteostatic mechanisms, namely autophagy. Further, this KLF-autophagy pathway extends even into a mammalian system, with conserved effects on aging of the vasculature and potentially organismal aging. Finally, independent of lifespan, the KLFs are regulators of healthspan and delay the neurodegeneration associated with α- synuclein proteotoxicity likely through the action of a gut-secreted complement protein. Collectively, our findings present the KLFs as bona fide aging regulators

d This work is a derivative of Aging and the Krüppel-like factors, used with permission under an open access license.

157 in metazoans, contributing to the burgeoning body of knowledge on biologic regulation of aging. As the KLFs are a large family and expressed in a diverse array of tissues, much more exists to be learned about their respective contributions to longevity.

Discussion

We demonstrate here that nematode KLFs can modulate lifespan and healthspan and that endothelial KLF4 has effects on vascular aging; however little is known regarding the KLFs and organismal aging. Studies of murine lifespan in our KLF4 endothelial specific transgenic mouse are ongoing. Further,

KLF4 is a regulator of autophagy not only in endothelial cells, but also in the myocardium, suggesting a potential role for enhancing proteostasis and therefore preventing age-related deterioration in cardiac function.201 Thus, whether a KLF- autophagy axis relevant to longevity exists in other tissues is an important question. Additionally, it may be fruitful to consider whether KLF4 control of other aging-related functions impacts aging as well and in which tissues. As KLF4 is widely expressed and regulates dozens of cellular processes in a context and tissue specific manner, the resulting observations may provide unexpected links between specialized tissues or functions and whole body aging. Indeed, our lab has recently reported that endothelial KLF4 and KLF2 together are required for microvascular integrity, raising the question of whether microvascular rather than macrovascular function (we show here measurements of vasoreactivity in the aorta) is more critical to the progression of aging.328

158

The transcriptional landscape of aging is not well understood. Future investigations can begin to parse the complex interactions of KLFs with different known transcriptional regulators of longevity or aging, in particular FOXO, and how they change over time. Additionally, what upstream signals control KLF activity during the aging process are not known and will therefore be of critical importance.

Our observation of a gut KLF-neuron signaling pathway mediated by secretion of innate immune signaling molecules provides several new avenues of investigation. In worms, other mediators of gut-neuron communication regulated by the KLFs will be important to identify, as well as what signals control KLF activation and upregulation of KLF gene targets which ultimately are secreted. In mammals, gut-brain communication is still being elucidated and it is yet unclear how well conserved our findings in worm will be. The mechanism by which clec-

186, or COLEC11 in mice, exerts its neuroprotective effect also remains unclear.

While it might be possible that a receptor on dopaminergic neurons exists for

COLEC11, therefore mediating a direct effect of COLEC11 on intracellular protective mechanisms, it is equally likely that COLEC11 is neuroprotective through secondary effects, for example via modulation of microglial activation, thereby providing a link between intestinal signaling and neuroinflammation.

Further studies will be needed to explore these possibilities.

Closing Thoughts

While hallmarks of aging are emerging, it remains to be seen whether these diverse molecular, cellular, and organismal features can or ought to be

159 unified under an overarching theory. Pathways implicated in the biologic regulation of aging likely cooperate, perhaps synergistically and in complex fashion, to modulate aging. This must be reconciled with the partly stochastic nature of aging and the role of environmental factors. Future investigations will benefit from systems approaches to provide a holistic view of aging.

Additionally, aging researchers are bringing increased scrutiny to the way medical research funding and clinical medicine are structured. Currently, novel treatments are developed for a single disease in isolation, while the treatment of multiple comorbidities in an aging population is increasingly complex. Combating chronic disease therefore may require stepping towards an integrated approach which recognizes the overlapping pathology and interdependent nature of many age-associated chronic diseases. Devising novel scientific funding and clinical strategies to target a fundamental, shared driver of chronic disease, aging, will provide enormous clarity into diseases which represent some of the greatest threats to human health of our times.

I end with some speculative thoughts regarding study of the intrinsic nature of aging not yet expressed in the preceding chapters. In the modern era, the breakneck pace of technical advancement has allowed scientists to answer longstanding questions and to pose new ones never previously considered. With the current expanding experimental toolkit (-omics technologies, genome editing, etc.) and ability to design ever more rigorous and intricate experiments, there has never been a better time to study intractable problems like aging; concurrently, it has never been easier to become caught up in glamorous techniques and

160 concepts increasingly tangential or of questionable relevance to the original question. Therefore, it is of critical import that any scientific endeavor embarked upon rest on solid logical foundations; in other words, that in applying a particular approach towards a problem, we are sure of our premises and can therefore be sure of the conclusion. No matter how diligently you dig or how large your shovel, you won’t find treasure if you’re digging on the wrong island.

This is well illustrated within the aging field by an interesting recent report.349 In it, Stroustrup et al. point out that lifespan curves are invariant except for their scale in time. As others have observed, no matter the intervention, lifespan extension generates a curve described by an exponential increase in probability of death (consistent with our data as well), with the only difference being timescale; temporal rescaling of any lifespan curve therefore makes all interventions which extend lifespan look identical. Stroustrup et al. posit that the most natural explanation for this is that a single state variable can describe the

“collective action of all physiological determinants of risk.”349 Nearly all aging modifiers act upon this state variable to extend or shorten lifespan and correspondingly shift a lifespan curve without altering its general shape. This state variable suggests that colloquial descriptions of “strong” or “resilient” individuals (perhaps related to Fries’s description in 1980 of “preservation of organ reserve” or the capacity to restore homeostasis in supercentenarians142) in fact have a biological basis and that this state variable is entirely unknown but must encompass essential, general, and intrinsic functions to aging. A more pessimistic person might claim that nearly all investigations of aging therefore

161 have yet to reveal to us what aging truly is, as they do not impact this “resiliency” factor.

However, this variable described by Stroustrup et al. also provides novel directions for investigation, for there are indeed a few longevity interventions which do impact this resiliency factor. Disruption of complex I in mitochondria

(nuo-6(qm200) mutant worms) produces lifespan extension as well as a deviation in the temporal scaling factor. Whether this suggests that mitochondrial function disruption alters fundamental characteristics of aging remains to be seen.

Lifespan extension by knockout of components of the electron transport chain has been shown to require upregulation of the UPRmt and in unpublished data, we have found that lifespan extension in clk-1 mutants requires KLF activity.42

The KLFs in mammals are well characterized by us and others as regulators of mitochondrial biogenesis, dynamics, and mitophagy.201,257 It might be valuable to consider whether further investigation of the KLF effect on aging in this context, perhaps as regulators or mediators of mitonuclear communication or through some novel mechanism, might reveal unexpected insights into the intrinsic nature of aging. Studies of longevity can be guided, with unwavering confidence, by such seemingly simple, yet fundamental observations towards sustained insight into the nature of aging.

162

REFERENCES

1 Hsieh, P. N., Sweet, D. R., Fan, L. & Jain, M. K. Aging and the Kruppel-

like factors. Trends in cell & molecular biology 12, 1-15 (2017).

2 Weismann, A., Poulton, E. B. & Shipley, A. E. Essays upon heredity and

kindred biological problems. Vol. 1 (Clarendon press, 1891).

3 Hayflick, L. & Moorhead, P. S. The serial cultivation of human diploid cell

strains. Experimental cell research 25, 585-621 (1961).

4 Hayflick, L. THE LIMITED IN VITRO LIFETIME OF HUMAN DIPLOID

CELL STRAINS. Experimental cell research 37, 614-636 (1965).

5 Medawar, P. B. An Unsolved Problem of Biology... An Inaugural Lecture

Delivered at University College, London, 6 December, 1951. (London,

1952).

6 Williams, G. C. Pleiotropy, Natural Selection, and the Evolution of

Senescence. Evolution 11, 398-411, doi:10.2307/2406060 (1957).

7 Kirkwood, T. B. Evolution of ageing. Nature 270, 301-304 (1977).

8 Arantes-Oliveira, N., Apfeld, J., Dillin, A. & Kenyon, C. Regulation of life-

span by germ-line stem cells in Caenorhabditis elegans. Science (New

York, N.Y.) 295, 502-505, doi:10.1126/science.1065768 (2002).

9 Crittenden, S. L. et al. Regulation of the mitosis/meiosis decision in the

Caenorhabditis elegans germline. Philosophical transactions of the Royal

163

Society of London. Series B, Biological sciences 358, 1359-1362,

doi:10.1098/rstb.2003.1333 (2003).

10 Blagosklonny, M. V. Aging: ROS or TOR. Cell cycle (Georgetown, Tex.) 7,

3344-3354, doi:10.4161/cc.7.21.6965 (2008).

11 Hsin, H. & Kenyon, C. Signals from the reproductive system regulate the

lifespan of C. elegans. Nature 399, 362-366, doi:10.1038/20694 (1999).

12 Partridge, L. & Prowse, N. The effects of reproduction on longevity and

fertility in male Drosophila melanogaster. Journal of insect physiology 43,

501-512 (1997).

13 Fowler, K. & Partridge, L. A cost of mating in female fruitflies. Nature 338,

760-761 (1989).

14 Mitteldorf, J. Female fertility and longevity. Age (Dordrecht, Netherlands)

32, 79-84, doi:10.1007/s11357-009-9116-1 (2010).

15 Beekman, M. et al. Genome-wide association study (GWAS)-identified

disease risk alleles do not compromise human longevity. Proceedings of

the National Academy of Sciences of the United States of America 107,

18046-18049, doi:10.1073/pnas.1003540107 (2010).

16 Hasler, R. et al. Genetic interplay between human longevity and metabolic

pathways - a large-scale eQTL study. Aging cell 16, 716-725,

doi:10.1111/acel.12598 (2017).

17 Murabito, J. M., Yuan, R. & Lunetta, K. L. The search for longevity and

healthy aging genes: insights from epidemiological studies and samples of

long-lived individuals. The journals of gerontology. Series A, Biological

164

sciences and medical sciences 67, 470-479, doi:10.1093/gerona/gls089

(2012).

18 Brooks-Wilson, A. R. Genetics of healthy aging and longevity. Human

genetics 132, 1323-1338, doi:10.1007/s00439-013-1342-z (2013).

19 Broer, L. & van Duijn, C. M. GWAS and Meta-Analysis in Aging/Longevity.

Advances in experimental medicine and biology 847, 107-125,

doi:10.1007/978-1-4939-2404-2_5 (2015).

20 Erikson, G. A. et al. Whole-Genome Sequencing of a Healthy Aging

Cohort. Cell 165, 1002-1011, doi:10.1016/j.cell.2016.03.022 (2016).

21 Dato, S. et al. The genetics of human longevity: an intricacy of genes,

environment, culture and microbiome. Mechanisms of ageing and

development 165, 147-155, doi:10.1016/j.mad.2017.03.011 (2017).

22 Budovsky, A. et al. LongevityMap: a database of human genetic variants

associated with longevity. Trends in genetics : TIG 29, 559-560,

doi:10.1016/j.tig.2013.08.003 (2013).

23 Tacutu, R. et al. Human Ageing Genomic Resources: integrated

databases and tools for the biology and genetics of ageing. Nucleic acids

research 41, D1027-1033, doi:10.1093/nar/gks1155 (2013).

24 Burtner, C. R. & Kennedy, B. K. Progeria syndromes and ageing: what is

the connection? Nature reviews. Molecular cell biology 11, 567-578,

doi:10.1038/nrm2944 (2010).

165

25 Campisi, J. & d'Adda di Fagagna, F. Cellular senescence: when bad

things happen to good cells. Nature reviews. Molecular cell biology 8, 729-

740, doi:10.1038/nrm2233 (2007).

26 Gavrilov, L. A. & Gavrilova, N. S. The reliability-engineering approach to

the problem of biological aging. Annals of the New York Academy of

Sciences 1019, 509-512, doi:10.1196/annals.1297.094 (2004).

27 Kim, Y., Nam, H. G. & Valenzano, D. R. The short-lived African turquoise

killifish: an emerging experimental model for ageing. Disease models &

mechanisms 9, 115-129, doi:10.1242/dmm.023226 (2016).

28 Sinclair, D. A. & Guarente, L. Extrachromosomal rDNA circles--a cause of

aging in yeast. Cell 91, 1033-1042 (1997).

29 Smith, E. D., Kennedy, B. K. & Kaeberlein, M. Genome-wide identification

of conserved longevity genes in yeast and worms. Mechanisms of ageing

and development 128, 106-111, doi:10.1016/j.mad.2006.11.017 (2007).

30 Ruby, J. G., Smith, M. & Buffenstein, R. Naked Mole-Rat mortality rates

defy gompertzian laws by not increasing with age. eLife 7,

doi:10.7554/eLife.31157 (2018).

31 Buffenstein, R. Negligible senescence in the longest living rodent, the

naked mole-rat: insights from a successfully aging species. Journal of

comparative physiology. B, Biochemical, systemic, and environmental

physiology 178, 439-445, doi:10.1007/s00360-007-0237-5 (2008).

166

32 Seim, I. et al. Genome analysis reveals insights into physiology and

longevity of the Brandt's bat Myotis brandtii. Nature communications 4,

2212, doi:10.1038/ncomms3212 (2013).

33 Lopez-Otin, C., Blasco, M. A., Partridge, L., Serrano, M. & Kroemer, G.

The hallmarks of aging. Cell 153, 1194-1217,

doi:10.1016/j.cell.2013.05.039 (2013).

34 Harman, D. Aging: a theory based on free radical and radiation chemistry.

Journal of gerontology 11, 298-300 (1956).

35 Bratic, A. & Larsson, N. G. The role of mitochondria in aging. The Journal

of clinical investigation 123, 951-957, doi:10.1172/jci64125 (2013).

36 Cortopassi, G. A. & Arnheim, N. Detection of a specific mitochondrial DNA

deletion in tissues of older humans. Nucleic acids research 18, 6927-6933

(1990).

37 Piko, L., Hougham, A. J. & Bulpitt, K. J. Studies of sequence

heterogeneity of mitochondrial DNA from rat and mouse tissues: evidence

for an increased frequency of deletions/additions with aging. Mechanisms

of ageing and development 43, 279-293 (1988).

38 Rodgers, J. T. et al. Nutrient control of glucose homeostasis through a

complex of PGC-1alpha and SIRT1. Nature 434, 113-118,

doi:10.1038/nature03354 (2005).

39 Rera, M. et al. Modulation of longevity and tissue homeostasis by the

Drosophila PGC-1 homolog. Cell metabolism 14, 623-634,

doi:10.1016/j.cmet.2011.09.013 (2011).

167

40 Palikaras, K., Lionaki, E. & Tavernarakis, N. Coordination of mitophagy

and mitochondrial biogenesis during ageing in C. elegans. Nature 521,

525-528, doi:10.1038/nature14300 (2015).

41 Rana, A., Rera, M. & Walker, D. W. Parkin overexpression during aging

reduces proteotoxicity, alters mitochondrial dynamics, and extends

lifespan. Proceedings of the National Academy of Sciences of the United

States of America 110, 8638-8643, doi:10.1073/pnas.1216197110 (2013).

42 Durieux, J., Wolff, S. & Dillin, A. The cell-non-autonomous nature of

electron transport chain-mediated longevity. Cell 144, 79-91,

doi:10.1016/j.cell.2010.12.016 (2011).

43 Jiang, P., Du, W., Mancuso, A., Wellen, K. E. & Yang, X. Reciprocal

regulation of p53 and malic enzymes modulates metabolism and

senescence. Nature 493, 689-693, doi:10.1038/nature11776 (2013).

44 Youm, Y. H. et al. Canonical Nlrp3 inflammasome links systemic low-

grade inflammation to functional decline in aging. Cell metabolism 18,

519-532, doi:10.1016/j.cmet.2013.09.010 (2013).

45 Trifunovic, A. et al. Premature ageing in mice expressing defective

mitochondrial DNA polymerase. Nature 429, 417-423,

doi:10.1038/nature02517 (2004).

46 Kujoth, G. C. et al. Mitochondrial DNA mutations, oxidative stress, and

apoptosis in mammalian aging. Science (New York, N.Y.) 309, 481-484,

doi:10.1126/science.1112125 (2005).

168

47 Williams, S. L. et al. The mtDNA mutation spectrum of the progeroid Polg

mutator mouse includes abundant control region multimers. Cell

metabolism 12, 675-682, doi:10.1016/j.cmet.2010.11.012 (2010).

48 Tyynismaa, H. et al. Mutant mitochondrial helicase Twinkle causes

multiple mtDNA deletions and a late-onset mitochondrial disease in mice.

Proceedings of the National Academy of Sciences of the United States of

America 102, 17687-17692, doi:10.1073/pnas.0505551102 (2005).

49 Blackburn, E. H. Switching and signaling at the telomere. Cell 106, 661-

673 (2001).

50 McEachern, M. J., Krauskopf, A. & Blackburn, E. H. Telomeres and their

control. Annual review of genetics 34, 331-358,

doi:10.1146/annurev.genet.34.1.331 (2000).

51 Kim, N. W. et al. Specific association of human telomerase activity with

immortal cells and cancer. Science (New York, N.Y.) 266, 2011-2015

(1994).

52 Blasco, M. A. Telomere length, stem cells and aging. Nature chemical

biology 3, 640-649, doi:10.1038/nchembio.2007.38 (2007).

53 Flores, I., Benetti, R. & Blasco, M. A. Telomerase regulation and stem cell

behaviour. Current opinion in cell biology 18, 254-260,

doi:10.1016/j.ceb.2006.03.003 (2006).

54 Tomas-Loba, A. et al. Telomerase reverse transcriptase delays aging in

cancer-resistant mice. Cell 135, 609-622, doi:10.1016/j.cell.2008.09.034

(2008).

169

55 Bernardes de Jesus, B. et al. Telomerase gene therapy in adult and old

mice delays aging and increases longevity without increasing cancer.

EMBO molecular medicine 4, 691-704, doi:10.1002/emmm.201200245

(2012).

56 Bernardes de Jesus, B. et al. The telomerase activator TA-65 elongates

short telomeres and increases health span of adult/old mice without

increasing cancer incidence. Aging cell 10, 604-621, doi:10.1111/j.1474-

9726.2011.00700.x (2011).

57 Baker, D. J. et al. Naturally occurring p16(Ink4a)-positive cells shorten

healthy lifespan. Nature 530, 184-189, doi:10.1038/nature16932 (2016).

58 Nasto, L. A. et al. ISSLS prize winner: inhibition of NF-kappaB activity

ameliorates age-associated disc degeneration in a mouse model of

accelerated aging. Spine 37, 1819-1825,

doi:10.1097/BRS.0b013e31824ee8f7 (2012).

59 Zhang, G. et al. Hypothalamic programming of systemic ageing involving

IKK-beta, NF-kappaB and GnRH. Nature 497, 211-216,

doi:10.1038/nature12143 (2013).

60 Adler, A. S. et al. Motif module map reveals enforcement of aging by

continual NF-kappaB activity. Genes & development 21, 3244-3257,

doi:10.1101/gad.1588507 (2007).

61 Zhang, Q. et al. Circulating mitochondrial DAMPs cause inflammatory

responses to injury. Nature 464, 104-107, doi:10.1038/nature08780

(2010).

170

62 Baker, D. J. et al. Clearance of p16Ink4a-positive senescent cells delays

ageing-associated disorders. Nature 479, 232-236,

doi:10.1038/nature10600 (2011).

63 Dall'Olio, F. et al. N-glycomic biomarkers of biological aging and longevity:

a link with inflammaging. Ageing research reviews 12, 685-698,

doi:10.1016/j.arr.2012.02.002 (2013).

64 Coppe, J. P., Desprez, P. Y., Krtolica, A. & Campisi, J. The senescence-

associated secretory phenotype: the dark side of tumor suppression.

Annual review of pathology 5, 99-118, doi:10.1146/annurev-pathol-

121808-102144 (2010).

65 Franceschi, C., Bonafe, M. & Valensin, S. Human immunosenescence:

the prevailing of innate immunity, the failing of clonotypic immunity, and

the filling of immunological space. Vaccine 18, 1717-1720 (2000).

66 McElhaney, J. E. & Effros, R. B. Immunosenescence: what does it mean

to health outcomes in older adults? Current opinion in immunology 21,

418-424, doi:10.1016/j.coi.2009.05.023 (2009).

67 Shaw, A. C., Joshi, S., Greenwood, H., Panda, A. & Lord, J. M. Aging of

the innate immune system. Current opinion in immunology 22, 507-513,

doi:10.1016/j.coi.2010.05.003 (2010).

68 Frasca, D. & Blomberg, B. B. Inflammaging decreases adaptive and

innate immune responses in mice and humans. Biogerontology 17, 7-19,

doi:10.1007/s10522-015-9578-8 (2016).

171

69 Grant, R. W. & Dixit, V. D. Mechanisms of disease: inflammasome

activation and the development of type 2 diabetes. Frontiers in

immunology 4, 50, doi:10.3389/fimmu.2013.00050 (2013).

70 Franceschi, C. & Campisi, J. Chronic inflammation (inflammaging) and its

potential contribution to age-associated diseases. The journals of

gerontology. Series A, Biological sciences and medical sciences 69 Suppl

1, S4-9, doi:10.1093/gerona/glu057 (2014).

71 Zhang, Y. et al. Hypothalamic stem cells control ageing speed partly

through exosomal miRNAs. Nature 548, 52-57, doi:10.1038/nature23282

(2017).

72 Maegawa, S. et al. Caloric restriction delays age-related methylation drift.

Nature communications 8, 539, doi:10.1038/s41467-017-00607-3 (2017).

73 Greer, E. L. et al. Transgenerational epigenetic inheritance of longevity in

Caenorhabditis elegans. Nature 479, 365-371, doi:10.1038/nature10572

(2011).

74 Greer, E. L. et al. Members of the H3K4 trimethylation complex regulate

lifespan in a germline-dependent manner in C. elegans. Nature 466, 383-

387, doi:10.1038/nature09195 (2010).

75 Maures, T. J., Greer, E. L., Hauswirth, A. G. & Brunet, A. The H3K27

demethylase UTX-1 regulates C. elegans lifespan in a germline-

independent, insulin-dependent manner. Aging cell 10, 980-990,

doi:10.1111/j.1474-9726.2011.00738.x (2011).

172

76 Dang, W. et al. Histone H4 lysine 16 acetylation regulates cellular lifespan.

Nature 459, 802-807, doi:10.1038/nature08085 (2009).

77 Brunet, A. & Berger, S. L. Epigenetics of aging and aging-related disease.

The journals of gerontology. Series A, Biological sciences and medical

sciences 69 Suppl 1, S17-20, doi:10.1093/gerona/glu042 (2014).

78 Takahashi, K. et al. Induction of pluripotent stem cells from adult human

fibroblasts by defined factors. Cell 131, 861-872,

doi:10.1016/j.cell.2007.11.019 (2007).

79 Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from

mouse embryonic and adult fibroblast cultures by defined factors. Cell

126, 663-676, doi:10.1016/j.cell.2006.07.024 (2006).

80 Okita, K., Ichisaka, T. & Yamanaka, S. Generation of germline-competent

induced pluripotent stem cells. Nature 448, 313-317,

doi:10.1038/nature05934 (2007).

81 Mosteiro, L. et al. Tissue damage and senescence provide critical signals

for cellular reprogramming in vivo. Science (New York, N.Y.) 354,

doi:10.1126/science.aaf4445 (2016).

82 Abad, M. et al. Reprogramming in vivo produces teratomas and iPS cells

with totipotency features. Nature 502, 340-345, doi:10.1038/nature12586

(2013).

83 Taylor, R. C., Berendzen, K. M. & Dillin, A. Systemic stress signalling:

understanding the cell non-autonomous control of proteostasis. Nature

reviews. Molecular cell biology 15, 211-217, doi:10.1038/nrm3752 (2014).

173

84 Vilchez, D., Saez, I. & Dillin, A. The role of protein clearance mechanisms

in organismal ageing and age-related diseases. Nature communications 5,

5659, doi:10.1038/ncomms6659 (2014).

85 Rubinsztein, D. C., Marino, G. & Kroemer, G. Autophagy and aging. Cell

146, 682-695, doi:10.1016/j.cell.2011.07.030 (2011).

86 Harrison, D. E. et al. Rapamycin fed late in life extends lifespan in

genetically heterogeneous mice. Nature 460, 392-395,

doi:10.1038/nature08221 (2009).

87 Hsu, A. L., Murphy, C. T. & Kenyon, C. Regulation of aging and age-

related disease by DAF-16 and heat-shock factor. Science (New York,

N.Y.) 300, 1142-1145, doi:10.1126/science.1083701 (2003).

88 Taylor, R. C. & Dillin, A. XBP-1 is a cell-nonautonomous regulator of

stress resistance and longevity. Cell 153, 1435-1447,

doi:10.1016/j.cell.2013.05.042 (2013).

89 Panda, A. et al. Human innate immunosenescence: causes and

consequences for immunity in old age. Trends in immunology 30, 325-

333, doi:10.1016/j.it.2009.05.004 (2009).

90 Gibon, E., Lu, L. & Goodman, S. B. Aging, inflammation, stem cells, and

bone healing. Stem cell research & therapy 7, 44, doi:10.1186/s13287-

016-0300-9 (2016).

91 Conboy, I. M. & Rando, T. A. Heterochronic parabiosis for the study of the

effects of aging on stem cells and their niches. Cell cycle (Georgetown,

Tex.) 11, 2260-2267, doi:10.4161/cc.20437 (2012).

174

92 Sousa-Victor, P., Garcia-Prat, L., Serrano, A. L., Perdiguero, E. & Munoz-

Canoves, P. Muscle stem cell aging: regulation and rejuvenation. Trends

in endocrinology and metabolism: TEM 26, 287-296,

doi:10.1016/j.tem.2015.03.006 (2015).

93 Lavasani, M. et al. Muscle-derived stem/progenitor cell dysfunction limits

healthspan and lifespan in a murine progeria model. Nature

communications 3, 608, doi:10.1038/ncomms1611 (2012).

94 Villeda, S. A. et al. The ageing systemic milieu negatively regulates

neurogenesis and cognitive function. Nature 477, 90-94,

doi:10.1038/nature10357 (2011).

95 Niccoli, T. & Partridge, L. Ageing as a risk factor for disease. Current

biology : CB 22, R741-752, doi:10.1016/j.cub.2012.07.024 (2012).

96 Rowe, J. W. & Kahn, R. L. Human aging: usual and successful. Science

(New York, N.Y.) 237, 143-149 (1987).

97 Weir, P. L., Meisner, B. A. & Baker, J. Successful aging across the years:

does one model fit everyone? Journal of health psychology 15, 680-687,

doi:10.1177/1359105309353648 (2010).

98 Horvath, S. DNA methylation age of human tissues and cell types.

Genome biology 14, R115, doi:10.1186/gb-2013-14-10-r115 (2013).

99 Angelini, F. et al. Getting Old through the Blood: Circulating Molecules in

Aging and Senescence of Cardiovascular Regenerative Cells. Frontiers in

cardiovascular medicine 4, 62, doi:10.3389/fcvm.2017.00062 (2017).

175

100 Wyss-Coray, T. Ageing, neurodegeneration and brain rejuvenation. Nature

539, 180-186, doi:10.1038/nature20411 (2016).

101 Riera, C. E., Merkwirth, C., De Magalhaes Filho, C. D. & Dillin, A.

Signaling Networks Determining Life Span. Annual review of biochemistry

85, 35-64, doi:10.1146/annurev-biochem-060815-014451 (2016).

102 Nakagawa, S., Lagisz, M., Hector, K. L. & Spencer, H. G. Comparative

and meta-analytic insights into life extension via dietary restriction. Aging

cell 11, 401-409, doi:10.1111/j.1474-9726.2012.00798.x (2012).

103 McCay, C. M., Crowell, M. F. & Maynard, L. A. The effect of retarded

growth upon the length of life span and upon the ultimate body size. 1935.

Nutrition (Burbank, Los Angeles County, Calif.) 5, 155-171; discussion 172

(1989).

104 Weindruch, R., Naylor, P. H., Goldstein, A. L. & Walford, R. L. Influences

of aging and dietary restriction on serum thymosin alpha 1 levels in mice.

Journal of gerontology 43, B40-42 (1988).

105 Longo, V. D. & Finch, C. E. Evolutionary medicine: from dwarf model

systems to healthy centenarians? Science (New York, N.Y.) 299, 1342-

1346, doi:10.1126/science.1077991 (2003).

106 Clancy, D. J., Gems, D., Hafen, E., Leevers, S. J. & Partridge, L. Dietary

restriction in long-lived dwarf flies. Science (New York, N.Y.) 296, 319,

doi:10.1126/science.1069366 (2002).

176

107 Kaeberlein, M. et al. Regulation of yeast replicative life span by TOR and

Sch9 in response to nutrients. Science (New York, N.Y.) 310, 1193-1196,

doi:10.1126/science.1115535 (2005).

108 Kenyon, C. J. The genetics of ageing. Nature 464, 504-512,

doi:10.1038/nature08980 (2010).

109 Kenyon, C., Chang, J., Gensch, E., Rudner, A. & Tabtiang, R. A C.

elegans mutant that lives twice as long as wild type. Nature 366, 461-464,

doi:10.1038/366461a0 (1993).

110 Friedman, D. B. & Johnson, T. E. Three mutants that extend both mean

and maximum life span of the nematode, Caenorhabditis elegans, define

the age-1 gene. Journal of gerontology 43, B102-109 (1988).

111 Bluher, M., Kahn, B. B. & Kahn, C. R. Extended longevity in mice lacking

the insulin receptor in adipose tissue. Science (New York, N.Y.) 299, 572-

574, doi:10.1126/science.1078223 (2003).

112 Holzenberger, M. et al. IGF-1 receptor regulates lifespan and resistance to

oxidative stress in mice. Nature 421, 182-187, doi:10.1038/nature01298

(2003).

113 Tatar, M. et al. A mutant Drosophila insulin receptor homolog that extends

life-span and impairs neuroendocrine function. Science (New York, N.Y.)

292, 107-110, doi:10.1126/science.1057987 (2001).

114 Foukas, L. C. et al. Long-term p110alpha PI3K inactivation exerts a

beneficial effect on metabolism. EMBO molecular medicine 5, 563-571,

doi:10.1002/emmm.201201953 (2013).

177

115 Ortega-Molina, A. et al. Pten positively regulates brown adipose function,

energy expenditure, and longevity. Cell metabolism 15, 382-394,

doi:10.1016/j.cmet.2012.02.001 (2012).

116 Nojima, A. et al. Haploinsufficiency of akt1 prolongs the lifespan of mice.

PloS one 8, e69178, doi:10.1371/journal.pone.0069178 (2013).

117 Clancy, D. J. et al. Extension of life-span by loss of CHICO, a Drosophila

insulin receptor substrate protein. Science (New York, N.Y.) 292, 104-106,

doi:10.1126/science.1057991 (2001).

118 Brown-Borg, H. M., Borg, K. E., Meliska, C. J. & Bartke, A. Dwarf mice

and the ageing process. Nature 384, 33, doi:10.1038/384033a0 (1996).

119 Flurkey, K., Papaconstantinou, J., Miller, R. A. & Harrison, D. E. Lifespan

extension and delayed immune and collagen aging in mutant mice with

defects in growth hormone production. Proceedings of the National

Academy of Sciences of the United States of America 98, 6736-6741,

doi:10.1073/pnas.111158898 (2001).

120 Flachsbart, F. et al. Association of FOXO3A variation with human

longevity confirmed in German centenarians. Proceedings of the National

Academy of Sciences of the United States of America 106, 2700-2705,

doi:10.1073/pnas.0809594106 (2009).

121 Suh, Y. et al. Functionally significant insulin-like growth factor I receptor

mutations in centenarians. Proceedings of the National Academy of

Sciences of the United States of America 105, 3438-3442,

doi:10.1073/pnas.0705467105 (2008).

178

122 Ben-Avraham, D. et al. The GH receptor exon 3 deletion is a marker of

male-specific exceptional longevity associated with increased GH

sensitivity and taller stature. Science advances 3, e1602025,

doi:10.1126/sciadv.1602025 (2017).

123 Ogg, S. et al. The Fork head transcription factor DAF-16 transduces

insulin-like metabolic and longevity signals in C. elegans. Nature 389, 994-

999, doi:10.1038/40194 (1997).

124 Lin, K., Dorman, J. B., Rodan, A. & Kenyon, C. daf-16: An HNF-3/forkhead

family member that can function to double the life-span of Caenorhabditis

elegans. Science (New York, N.Y.) 278, 1319-1322 (1997).

125 Flynn, J. M. et al. Late-life rapamycin treatment reverses age-related heart

dysfunction. Aging cell 12, 851-862, doi:10.1111/acel.12109 (2013).

126 Kapahi, P. et al. Regulation of lifespan in Drosophila by modulation of

genes in the TOR signaling pathway. Current biology : CB 14, 885-890,

doi:10.1016/j.cub.2004.03.059 (2004).

127 Vellai, T. et al. Genetics: influence of TOR kinase on lifespan in C.

elegans. Nature 426, 620, doi:10.1038/426620a (2003).

128 Jager, S., Handschin, C., St-Pierre, J. & Spiegelman, B. M. AMP-activated

protein kinase (AMPK) action in skeletal muscle via direct phosphorylation

of PGC-1alpha. Proceedings of the National Academy of Sciences of the

United States of America 104, 12017-12022,

doi:10.1073/pnas.0705070104 (2007).

179

129 Altarejos, J. Y. & Montminy, M. CREB and the CRTC co-activators:

sensors for hormonal and metabolic signals. Nature reviews. Molecular

cell biology 12, 141-151, doi:10.1038/nrm3072 (2011).

130 Mair, W. et al. Lifespan extension induced by AMPK and calcineurin is

mediated by CRTC-1 and CREB. Nature 470, 404-408,

doi:10.1038/nature09706 (2011).

131 Stenesen, D. et al. Adenosine nucleotide biosynthesis and AMPK regulate

adult life span and mediate the longevity benefit of caloric restriction in

flies. Cell metabolism 17, 101-112, doi:10.1016/j.cmet.2012.12.006

(2013).

132 Apfeld, J., O'Connor, G., McDonagh, T., DiStefano, P. S. & Curtis, R. The

AMP-activated protein kinase AAK-2 links energy levels and insulin-like

signals to lifespan in C. elegans. Genes & development 18, 3004-3009,

doi:10.1101/gad.1255404 (2004).

133 Martin-Montalvo, A. et al. Metformin improves healthspan and lifespan in

mice. Nature communications 4, 2192, doi:10.1038/ncomms3192 (2013).

134 Burnett, C. et al. Absence of effects of Sir2 overexpression on lifespan in

C. elegans and Drosophila. Nature 477, 482-485,

doi:10.1038/nature10296 (2011).

135 Guarente, L. Calorie restriction and sirtuins revisited. Genes &

development 27, 2072-2085, doi:10.1101/gad.227439.113 (2013).

136 Kanfi, Y. et al. The sirtuin SIRT6 regulates lifespan in male mice. Nature

483, 218-221, doi:10.1038/nature10815 (2012).

180

137 Satoh, A. et al. Sirt1 extends life span and delays aging in mice through

the regulation of Nk2 homeobox 1 in the DMH and LH. Cell metabolism

18, 416-430, doi:10.1016/j.cmet.2013.07.013 (2013).

138 Brunet, A. et al. Stress-dependent regulation of FOXO transcription factors

by the SIRT1 deacetylase. Science (New York, N.Y.) 303, 2011-2015,

doi:10.1126/science.1094637 (2004).

139 Mouchiroud, L. et al. The NAD(+)/Sirtuin Pathway Modulates Longevity

through Activation of Mitochondrial UPR and FOXO Signaling. Cell 154,

430-441, doi:10.1016/j.cell.2013.06.016 (2013).

140 Riera, C. E. et al. TRPV1 pain receptors regulate longevity and

metabolism by neuropeptide signaling. Cell 157, 1023-1036,

doi:10.1016/j.cell.2014.03.051 (2014).

141 Andersen, S. L., Sebastiani, P., Dworkis, D. A., Feldman, L. & Perls, T. T.

Health span approximates life span among many supercentenarians:

compression of morbidity at the approximate limit of life span. The journals

of gerontology. Series A, Biological sciences and medical sciences 67,

395-405, doi:10.1093/gerona/glr223 (2012).

142 Fries, J. F. Aging, natural death, and the compression of morbidity. The

New England journal of medicine 303, 130-135,

doi:10.1056/nejm198007173030304 (1980).

143 Bansal, A., Zhu, L. J., Yen, K. & Tissenbaum, H. A. Uncoupling lifespan

and healthspan in Caenorhabditis elegans longevity mutants. Proceedings

181

of the National Academy of Sciences of the United States of America 112,

E277-286, doi:10.1073/pnas.1412192112 (2015).

144 Charles, K. N. et al. Uncoupling of Metabolic Health from Longevity

through Genetic Alteration of Adipose Tissue Lipid-Binding Proteins. Cell

reports 21, 393-402, doi:10.1016/j.celrep.2017.09.051 (2017).

145 Colman, R. J. et al. Caloric restriction reduces age-related and all-cause

mortality in rhesus monkeys. Nature communications 5, 3557,

doi:10.1038/ncomms4557 (2014).

146 Colman, R. J. et al. Caloric restriction delays disease onset and mortality

in rhesus monkeys. Science (New York, N.Y.) 325, 201-204,

doi:10.1126/science.1173635 (2009).

147 McConnell, B. B. & Yang, V. W. Mammalian Kruppel-like factors in health

and diseases. Physiological reviews 90, 1337-1381,

doi:10.1152/physrev.00058.2009 (2010).

148 Carrano, A. C., Dillin, A. & Hunter, T. A Kruppel-like factor downstream of

the E3 ligase WWP-1 mediates dietary-restriction-induced longevity in

Caenorhabditis elegans. Nature communications 5, 3772,

doi:10.1038/ncomms4772 (2014).

149 Hsieh, P. N. et al. A conserved KLF-autophagy pathway modulates

nematode lifespan and mammalian age-associated vascular dysfunction.

Nature communications 8, 914, doi:10.1038/s41467-017-00899-5 (2017).

182

150 Wong, C. W. et al. Kruppel-like transcription factor 4 contributes to

maintenance of telomerase activity in stem cells. Stem cells (Dayton,

Ohio) 28, 1510-1517, doi:10.1002/stem.477 (2010).

151 Hsieh, M. H. et al. PARP1 controls KLF4-mediated telomerase expression

in stem cells and cancer cells. Nucleic acids research 45, 10492-10503,

doi:10.1093/nar/gkx683 (2017).

152 Hoffmeyer, K. et al. Wnt/beta-catenin signaling regulates telomerase in

stem cells and cancer cells. Science (New York, N.Y.) 336, 1549-1554,

doi:10.1126/science.1218370 (2012).

153 Hara, T., Mizuguchi, M., Fujii, M. & Nakamura, M. Kruppel-like factor 2

represses transcription of the telomerase catalytic subunit human

telomerase reverse transcriptase (hTERT) in human T cells. The Journal

of biological chemistry 290, 8758-8763, doi:10.1074/jbc.M114.610386

(2015).

154 Yoon, H. S., Chen, X. & Yang, V. W. Kruppel-like factor 4 mediates p53-

dependent G1/S cell cycle arrest in response to DNA damage. The

Journal of biological chemistry 278, 2101-2105,

doi:10.1074/jbc.M211027200 (2003).

155 Zhang, W. et al. The gut-enriched Kruppel-like factor (Kruppel-like factor

4) mediates the transactivating effect of p53 on the p21WAF1/Cip1

promoter. The Journal of biological chemistry 275, 18391-18398,

doi:10.1074/jbc.C000062200 (2000).

183

156 Yoon, H. S. & Yang, V. W. Requirement of Kruppel-like factor 4 in

preventing entry into mitosis following DNA damage. The Journal of

biological chemistry 279, 5035-5041, doi:10.1074/jbc.M307631200 (2004).

157 Shie, J. L., Chen, Z. Y., Fu, M., Pestell, R. G. & Tseng, C. C. Gut-enriched

Kruppel-like factor represses cyclin D1 promoter activity through Sp1

motif. Nucleic acids research 28, 2969-2976 (2000).

158 Hagos, E. G., Ghaleb, A. M., Dalton, W. B., Bialkowska, A. B. & Yang, V.

W. Mouse embryonic fibroblasts null for the Kruppel-like factor 4 gene are

genetically unstable. Oncogene 28, 1197-1205, doi:10.1038/onc.2008.465

(2009).

159 El-Karim, E. A., Hagos, E. G., Ghaleb, A. M., Yu, B. & Yang, V. W.

Kruppel-like factor 4 regulates genetic stability in mouse embryonic

fibroblasts. Molecular cancer 12, 89, doi:10.1186/1476-4598-12-89 (2013).

160 Yoon, H. S. et al. Kruppel-like factor 4 prevents centrosome amplification

following gamma-irradiation-induced DNA damage. Oncogene 24, 4017-

4025, doi:10.1038/sj.onc.1208576 (2005).

161 Wang, C. et al. The interplay between TEAD4 and KLF5 promotes breast

cancer partially through inhibiting the transcription of p27Kip1. Oncotarget

6, 17685-17697, doi:10.18632/oncotarget.3779 (2015).

162 Chen, C. et al. KLF5 promotes cell proliferation and tumorigenesis through

gene regulation and the TSU-Pr1 human bladder cancer cell line.

International journal of cancer 118, 1346-1355, doi:10.1002/ijc.21533

(2006).

184

163 Narla, G. et al. KLF6, a candidate tumor suppressor gene mutated in

prostate cancer. Science (New York, N.Y.) 294, 2563-2566,

doi:10.1126/science.1066326 (2001).

164 Simmen, R. C. et al. Molecular markers of endometrial epithelial cell

mitogenesis mediated by the Sp/Kruppel-like factor BTEB1. DNA and cell

biology 21, 115-128, doi:10.1089/104454902753604998 (2002).

165 Fan, G. et al. Loss of KLF14 triggers centrosome amplification and

tumorigenesis. Nature communications 6, 8450, doi:10.1038/ncomms9450

(2015).

166 Gordon, D. J., Resio, B. & Pellman, D. Causes and consequences of

aneuploidy in cancer. Nature reviews. Genetics 13, 189-203,

doi:10.1038/nrg3123 (2012).

167 Shay, J. W. Role of Telomeres and Telomerase in Aging and Cancer.

Cancer discovery 6, 584-593, doi:10.1158/2159-8290.cd-16-0062 (2016).

168 de Magalhaes, J. P. How ageing processes influence cancer. Nature

reviews. Cancer 13, 357-365, doi:10.1038/nrc3497 (2013).

169 Tetreault, M. P., Yang, Y. & Katz, J. P. Kruppel-like factors in cancer.

Nature reviews. Cancer 13, 701-713, doi:10.1038/nrc3582 (2013).

170 Gamper, A. M. et al. Regulation of KLF4 turnover reveals an unexpected

tissue-specific role of pVHL in tumorigenesis. Molecular cell 45, 233-243,

doi:10.1016/j.molcel.2011.11.031 (2012).

185

171 Yang, W. T. & Zheng, P. S. Kruppel-like factor 4 functions as a tumor

suppressor in cervical carcinoma. Cancer 118, 3691-3702,

doi:10.1002/cncr.26698 (2012).

172 Ohnishi, S. et al. Downregulation and growth inhibitory effect of epithelial-

type Kruppel-like transcription factor KLF4, but not KLF5, in bladder

cancer. Biochemical and biophysical research communications 308, 251-

256 (2003).

173 Katz, J. P. et al. Loss of Klf4 in mice causes altered proliferation and

differentiation and precancerous changes in the adult stomach.

Gastroenterology 128, 935-945 (2005).

174 Dang, D. T. et al. Decreased expression of the gut-enriched Kruppel-like

factor gene in intestinal adenomas of multiple intestinal neoplasia mice

and in colonic adenomas of familial adenomatous polyposis patients.

FEBS letters 476, 203-207 (2000).

175 Zhang, N. et al. Kruppel-like factor 4 negatively regulates beta-catenin

expression and inhibits the proliferation, invasion and metastasis of gastric

cancer. International journal of oncology 40, 2038-2048,

doi:10.3892/ijo.2012.1395 (2012).

176 Hu, W. et al. Putative tumor-suppressive function of Kruppel-like factor 4

in primary lung carcinoma. Clinical cancer research : an official journal of

the American Association for Cancer Research 15, 5688-5695,

doi:10.1158/1078-0432.CCR-09-0310 (2009).

186

177 Wei, D., Kanai, M., Jia, Z., Le, X. & Xie, K. Kruppel-like factor 4 induces

p27Kip1 expression in and suppresses the growth and metastasis of

human pancreatic cancer cells. Cancer research 68, 4631-4639,

doi:10.1158/0008-5472.CAN-07-5953 (2008).

178 Wei, D. et al. Drastic down-regulation of Kruppel-like factor 4 expression is

critical in human gastric cancer development and progression. Cancer

research 65, 2746-2754, doi:10.1158/0008-5472.CAN-04-3619 (2005).

179 Zhao, W. et al. Identification of Kruppel-like factor 4 as a potential tumor

suppressor gene in colorectal cancer. Oncogene 23, 395-402,

doi:10.1038/sj.onc.1207067 (2004).

180 Foster, K. W. et al. Increase of GKLF messenger RNA and protein

expression during progression of breast cancer. Cancer research 60,

6488-6495 (2000).

181 Foster, K. W. et al. Oncogene expression cloning by retroviral transduction

of adenovirus E1A-immortalized rat kidney RK3E cells: transformation of a

host with epithelial features by c-MYC and the zinc finger protein GKLF.

Cell growth & differentiation : the molecular biology journal of the

American Association for Cancer Research 10, 423-434 (1999).

182 Rowland, B. D., Bernards, R. & Peeper, D. S. The KLF4 tumour

suppressor is a transcriptional repressor of p53 that acts as a context-

dependent oncogene. Nature cell biology 7, 1074-1082,

doi:10.1038/ncb1314 (2005).

187

183 Wei, D. et al. KLF4alpha up-regulation promotes cell cycle progression

and reduces survival time of patients with pancreatic cancer.

Gastroenterology 139, 2135-2145, doi:10.1053/j.gastro.2010.08.022

(2010).

184 Ma, D. et al. 1, 25(OH)2D3-induced interaction of vitamin D receptor with

p50 subunit of NF-kappaB suppresses the interaction between KLF5 and

p50, contributing to inhibition of LPS-induced macrophage proliferation.

Biochemical and biophysical research communications 482, 366-374,

doi:10.1016/j.bbrc.2016.11.069 (2017).

185 Turner, J. & Crossley, M. Basic Kruppel-like factor functions within a

network of interacting haematopoietic transcription factors. The

international journal of biochemistry & cell biology 31, 1169-1174 (1999).

186 Luo, Q. et al. Activation and repression of interleukin-12 p40 transcription

by erythroid Kruppel-like factor in macrophages. The Journal of biological

chemistry 279, 18451-18456, doi:10.1074/jbc.M400320200 (2004).

187 Wara, A. K. et al. TGF-beta1 signaling and Kruppel-like factor 10 regulate

bone marrow-derived proangiogenic cell differentiation, function, and

neovascularization. Blood 118, 6450-6460, doi:10.1182/blood-2011-06-

363713 (2011).

188 Das, H. et al. Kruppel-like factor 2 (KLF2) regulates proinflammatory

activation of monocytes. Proceedings of the National Academy of

Sciences of the United States of America 103, 6653-6658,

doi:10.1073/pnas.0508235103 (2006).

188

189 Mahabeleshwar, G. H. et al. The myeloid transcription factor KLF2

regulates the host response to polymicrobial infection and endotoxic

shock. Immunity 34, 715-728, doi:10.1016/j.immuni.2011.04.014 (2011).

190 Liao, X. et al. Kruppel-like factor 4 regulates macrophage polarization. The

Journal of clinical investigation 121, 2736-2749, doi:10.1172/jci45444

(2011).

191 Date, D. et al. Kruppel-like transcription factor 6 regulates inflammatory

macrophage polarization. The Journal of biological chemistry 289, 10318-

10329, doi:10.1074/jbc.M113.526749 (2014).

192 Kim, G. D. et al. Kruppel-like Factor 6 Promotes Macrophage-mediated

Inflammation by Suppressing B Cell Leukemia/Lymphoma 6 Expression.

The Journal of biological chemistry 291, 21271-21282,

doi:10.1074/jbc.M116.738617 (2016).

193 Park, C. S. et al. Kruppel-like factor 4 (KLF4) promotes the survival of

natural killer cells and maintains the number of conventional dendritic cells

in the spleen. Journal of leukocyte biology 91, 739-750,

doi:10.1189/jlb.0811413 (2012).

194 Tussiwand, R. et al. Klf4 expression in conventional dendritic cells is

required for T helper 2 cell responses. Immunity 42, 916-928,

doi:10.1016/j.immuni.2015.04.017 (2015).

195 Rosenzweig, J. M., Glenn, J. D., Calabresi, P. A. & Whartenby, K. A. KLF4

modulates expression of IL-6 in dendritic cells via both promoter activation

189

and epigenetic modification. The Journal of biological chemistry 288,

23868-23874, doi:10.1074/jbc.M113.479576 (2013).

196 Jurkin, J. et al. Human skin dendritic cell fate is differentially regulated by

the monocyte identity factor Kruppel-like factor 4 during steady state and

inflammation. The Journal of allergy and clinical immunology 139, 1873-

1884 e1810, doi:10.1016/j.jaci.2016.09.018 (2017).

197 Das, M. et al. Kruppel-like factor 2 (KLF2) regulates monocyte

differentiation and functions in mBSA and IL-1beta-induced arthritis.

Current molecular medicine 12, 113-125 (2012).

198 Lingrel, J. B. et al. Myeloid-specific Kruppel-like factor 2 inactivation

increases macrophage and neutrophil adhesion and promotes

atherosclerosis. Circulation research 110, 1294-1302,

doi:10.1161/circresaha.112.267310 (2012).

199 Sharma, N. et al. Myeloid Kruppel-like factor 4 deficiency augments

atherogenesis in ApoE-/- mice--brief report. Arteriosclerosis, thrombosis,

and vascular biology 32, 2836-2838, doi:10.1161/atvbaha.112.300471

(2012).

200 Alberts-Grill, N. et al. Dendritic Cell KLF2 Expression Regulates T Cell

Activation and Proatherogenic Immune Responses. Journal of

immunology (Baltimore, Md. : 1950) 197, 4651-4662,

doi:10.4049/jimmunol.1600206 (2016).

190

201 Liao, X. et al. Kruppel-like factor 4 is critical for transcriptional control of

cardiac mitochondrial homeostasis. The Journal of clinical investigation

125, 3461-3476, doi:10.1172/JCI79964 (2015).

202 Riz, I., Hawley, T. S. & Hawley, R. G. KLF4-SQSTM1/p62-associated

prosurvival autophagy contributes to carfilzomib resistance in multiple

myeloma models. Oncotarget 6, 14814-14831,

doi:10.18632/oncotarget.4530 (2015).

203 Wu, Y. et al. Autophagy and mTORC1 regulate the stochastic phase of

somatic cell reprogramming. Nature cell biology 17, 715-725,

doi:10.1038/ncb3172 (2015).

204 Liu, C. et al. Impaired autophagy in mouse embryonic fibroblasts null for

Kruppel-like Factor 4 promotes DNA damage and increases apoptosis

upon serum starvation. Molecular cancer 14, 101, doi:10.1186/s12943-

015-0373-6 (2015).

205 Guixe-Muntet, S. et al. Cross-talk between autophagy and KLF2

determines endothelial cell phenotype and microvascular function in acute

liver injury. Journal of hepatology 66, 86-94,

doi:10.1016/j.jhep.2016.07.051 (2017).

206 Sydor, S. et al. Kruppel-like factor 6 is a transcriptional activator of

autophagy in acute liver injury. Scientific reports 7, 8119,

doi:10.1038/s41598-017-08680-w (2017).

207 Yasuda, K. et al. The Kruppel-like factor Zf9 and proteins in the Sp1 family

regulate the expression of HSP47, a collagen-specific molecular

191

chaperone. The Journal of biological chemistry 277, 44613-44622,

doi:10.1074/jbc.M208558200 (2002).

208 Liu, Y. et al. KLF4 is a novel regulator of the constitutively expressed

HSP90. Cell stress & chaperones 15, 211-217, doi:10.1007/s12192-009-

0135-8 (2010).

209 Liu, Y. et al. Upregulation of the constitutively expressed HSC70 by KLF4.

Cell stress & chaperones 13, 337-345, doi:10.1007/s12192-008-0033-5

(2008).

210 Liu, Y. et al. Induction of KLF4 in response to heat stress. Cell stress &

chaperones 11, 379-389 (2006).

211 Sugiura, K. et al. The unfolded protein response is activated in

differentiating epidermal keratinocytes. The Journal of investigative

dermatology 129, 2126-2135, doi:10.1038/jid.2009.51 (2009).

212 Donato, A. J., Morgan, R. G., Walker, A. E. & Lesniewski, L. A. Cellular

and molecular biology of aging endothelial cells. Journal of molecular and

cellular cardiology 89, 122-135, doi:10.1016/j.yjmcc.2015.01.021 (2015).

213 SenBanerjee, S. et al. KLF2 Is a novel transcriptional regulator of

endothelial proinflammatory activation. The Journal of experimental

medicine 199, 1305-1315, doi:10.1084/jem.20031132 (2004).

214 Hamik, A. et al. Kruppel-like factor 4 regulates endothelial inflammation.

The Journal of biological chemistry 282, 13769-13779,

doi:10.1074/jbc.M700078200 (2007).

192

215 Atkins, G. B. & Jain, M. K. Role of Kruppel-like transcription factors in

endothelial biology. Circulation research 100, 1686-1695,

doi:10.1161/01.RES.0000267856.00713.0a (2007).

216 Zhou, G. et al. Endothelial Kruppel-like factor 4 protects against

atherothrombosis in mice. The Journal of clinical investigation 122, 4727-

4731, doi:10.1172/JCI66056 (2012).

217 McConnell, B. B., Ghaleb, A. M., Nandan, M. O. & Yang, V. W. The

diverse functions of Kruppel-like factors 4 and 5 in epithelial biology and

pathobiology. BioEssays : news and reviews in molecular, cellular and

developmental biology 29, 549-557, doi:10.1002/bies.20581 (2007).

218 Nandan, M. O. et al. Inducible intestine-specific deletion of Kruppel-like

factor 5 is characterized by a regenerative response in adult mouse colon.

Developmental biology 387, 191-202, doi:10.1016/j.ydbio.2014.01.002

(2014).

219 McConnell, B. B. et al. Kruppel-like factor 5 is important for maintenance

of crypt architecture and barrier function in mouse intestine.

Gastroenterology 141, 1302-1313, 1313 e1301-1306,

doi:10.1053/j.gastro.2011.06.086 (2011).

220 Nandan, M. O., Ghaleb, A. M., Bialkowska, A. B. & Yang, V. W. Kruppel-

like factor 5 is essential for proliferation and survival of mouse intestinal

epithelial stem cells. Stem cell research 14, 10-19,

doi:10.1016/j.scr.2014.10.008 (2015).

193

221 Kuruvilla, J. G., Ghaleb, A. M., Bialkowska, A. B., Nandan, M. O. & Yang,

V. W. Role of Kruppel-like factor 5 in the maintenance of the stem cell

niche in the intestinal crypt. Stem cell and translational investigation 2

(2015).

222 Nandan, M. O. et al. Kruppel-like factor 5 mediates cellular transformation

during oncogenic KRAS-induced intestinal tumorigenesis.

Gastroenterology 134, 120-130, doi:10.1053/j.gastro.2007.10.023 (2008).

223 McConnell, B. B. et al. Haploinsufficiency of Kruppel-like factor 5 rescues

the tumor-initiating effect of the Apc(Min) mutation in the intestine. Cancer

research 69, 4125-4133, doi:10.1158/0008-5472.CAN-08-4402 (2009).

224 Nandan, M. O. et al. Kruppel-like factor 5 is a crucial mediator of intestinal

tumorigenesis in mice harboring combined ApcMin and KRASV12

mutations. Molecular cancer 9, 63, doi:10.1186/1476-4598-9-63 (2010).

225 Dang, D. T. et al. Overexpression of Kruppel-like factor 4 in the human

colon cancer cell line RKO leads to reduced tumorigenecity. Oncogene

22, 3424-3430, doi:10.1038/sj.onc.1206413 (2003).

226 Segre, J. A., Bauer, C. & Fuchs, E. Klf4 is a transcription factor required

for establishing the barrier function of the skin. Nature genetics 22, 356-

360, doi:10.1038/11926 (1999).

227 Li, J. et al. Expression of Kruppel-like factor KLF4 in mouse hair follicle

stem cells contributes to cutaneous wound healing. PloS one 7, e39663,

doi:10.1371/journal.pone.0039663 (2012).

194

228 Li, J. et al. Deficiency of the Kruppel-like factor KLF4 correlates with

increased cell proliferation and enhanced skin tumorigenesis.

Carcinogenesis 33, 1239-1246, doi:10.1093/carcin/bgs143 (2012).

229 Stingl, J. et al. Purification and unique properties of mammary epithelial

stem cells. Nature 439, 993-997, doi:10.1038/nature04496 (2006).

230 Forsberg, E. C. et al. Molecular signatures of quiescent, mobilized and

leukemia-initiating hematopoietic stem cells. PloS one 5, e8785,

doi:10.1371/journal.pone.0008785 (2010).

231 Hayashi, S., Manabe, I., Suzuki, Y., Relaix, F. & Oishi, Y. Klf5 regulates

muscle differentiation by directly targeting muscle-specific genes in

cooperation with MyoD in mice. eLife 5, doi:10.7554/eLife.17462 (2016).

232 Norton, L. J. et al. Direct competition between DNA binding factors

highlights the role of Kruppel-like Factor 1 in the erythroid/megakaryocyte

switch. Scientific reports 7, 3137, doi:10.1038/s41598-017-03289-5

(2017).

233 Nuez, B., Michalovich, D., Bygrave, A., Ploemacher, R. & Grosveld, F.

Defective haematopoiesis in fetal liver resulting from inactivation of the

EKLF gene. Nature 375, 316-318, doi:10.1038/375316a0 (1995).

234 Basu, P. et al. KLF2 is essential for primitive erythropoiesis and regulates

the human and murine embryonic beta-like globin genes in vivo. Blood

106, 2566-2571, doi:10.1182/blood-2005-02-0674 (2005).

195

235 Pang, C. J. et al. Kruppel-like factor 1 (KLF1), KLF2, and Myc control a

regulatory network essential for embryonic erythropoiesis. Molecular and

cellular biology 32, 2628-2644, doi:10.1128/MCB.00104-12 (2012).

236 Watkins, H., Ashrafian, H. & Redwood, C. Inherited cardiomyopathies.

The New England journal of medicine 364, 1643-1656,

doi:10.1056/NEJMra0902923 (2011).

237 Matsumoto, N. et al. Developmental regulation of yolk sac hematopoiesis

by Kruppel-like factor 6. Blood 107, 1357-1365, doi:10.1182/blood-2005-

05-1916 (2006).

238 Schuettpelz, L. G. et al. Kruppel-like factor 7 overexpression suppresses

hematopoietic stem and progenitor cell function. Blood 120, 2981-2989,

doi:10.1182/blood-2012-02-409839 (2012).

239 Wang, H., Zhou, Y., Yu, D. & Zhu, H. Klf2 contributes to the stemness and

self-renewal of human bone marrow stromal cells. Cytotechnology 68,

839-848, doi:10.1007/s10616-014-9837-6 (2016).

240 Jiang, J. et al. A core Klf circuitry regulates self-renewal of embryonic

stem cells. Nature cell biology 10, 353-360, doi:10.1038/ncb1698 (2008).

241 Jeon, H. et al. Comprehensive Identification of Kruppel-Like Factor Family

Members Contributing to the Self-Renewal of Mouse Embryonic Stem

Cells and Cellular Reprogramming. PloS one 11, e0150715,

doi:10.1371/journal.pone.0150715 (2016).

196

242 Hall, J. et al. Oct4 and LIF/Stat3 additively induce Kruppel factors to

sustain embryonic stem cell self-renewal. Cell stem cell 5, 597-609,

doi:10.1016/j.stem.2009.11.003 (2009).

243 Zhang, P., Andrianakos, R., Yang, Y., Liu, C. & Lu, W. Kruppel-like factor

4 (Klf4) prevents embryonic stem (ES) cell differentiation by regulating

Nanog gene expression. The Journal of biological chemistry 285, 9180-

9189, doi:10.1074/jbc.M109.077958 (2010).

244 Wang, M., Tang, L., Liu, D., Ying, Q. L. & Ye, S. The transcription factor

Gbx2 induces expression of Kruppel-like factor 4 to maintain and induce

naive pluripotency of embryonic stem cells. The Journal of biological

chemistry 292, 17121-17128, doi:10.1074/jbc.M117.803254 (2017).

245 Zhao, T., Liu, C. & Chen, L. Roles of Klf5 Acetylation in the Self-Renewal

and the Differentiation of Mouse Embryonic Stem Cells. PloS one 10,

e0138168, doi:10.1371/journal.pone.0138168 (2015).

246 Bialkowska, A. B., Yang, V. W. & Mallipattu, S. K. Kruppel-like factors in

mammalian stem cells and development. Development (Cambridge,

England) 144, 737-754, doi:10.1242/dev.145441 (2017).

247 Moore, D. L. et al. KLF family members regulate intrinsic axon

regeneration ability. Science (New York, N.Y.) 326, 298-301,

doi:10.1126/science.1175737 (2009).

248 Moore, D. L., Apara, A. & Goldberg, J. L. Kruppel-like transcription factors

in the nervous system: novel players in neurite outgrowth and axon

197

regeneration. Molecular and cellular neurosciences 47, 233-243,

doi:10.1016/j.mcn.2011.05.005 (2011).

249 Blackmore, M. G. et al. High content screening of cortical neurons

identifies novel regulators of axon growth. Molecular and cellular

neurosciences 44, 43-54, doi:10.1016/j.mcn.2010.02.002 (2010).

250 Wang, Y. et al. KLF7-transfected Schwann cell graft transplantation

promotes sciatic nerve regeneration. Neuroscience 340, 319-332,

doi:10.1016/j.neuroscience.2016.10.069 (2017).

251 Blackmore, M. G. et al. Kruppel-like Factor 7 engineered for transcriptional

activation promotes axon regeneration in the adult corticospinal tract.

Proceedings of the National Academy of Sciences of the United States of

America 109, 7517-7522, doi:10.1073/pnas.1120684109 (2012).

252 Holthofer, H. et al. Altered gene expression and functions of mitochondria

in human nephrotic syndrome. FASEB journal : official publication of the

Federation of American Societies for Experimental Biology 13, 523-532

(1999).

253 Solin, M. L., Pitkanen, S., Taanman, J. W. & Holthofer, H. Mitochondrial

dysfunction in congenital nephrotic syndrome. Laboratory investigation; a

journal of technical methods and pathology 80, 1227-1232 (2000).

254 Barisoni, L. et al. Collapsing glomerulopathy associated with inherited

mitochondrial injury. Kidney international 74, 237-243,

doi:10.1038/sj.ki.5002767 (2008).

198

255 Papeta, N. et al. Prkdc participates in mitochondrial genome maintenance

and prevents Adriamycin-induced nephropathy in mice. The Journal of

clinical investigation 120, 4055-4064, doi:10.1172/JCI43721 (2010).

256 Mallipattu, S. K. et al. Kruppel-like factor 6 regulates mitochondrial

function in the kidney. The Journal of clinical investigation 125, 1347-

1361, doi:10.1172/JCI77084 (2015).

257 Tandler, B., Fujioka, H., Hoppel, C. L., Haldar, S. M. & Jain, M. K.

Megamitochondria in Cardiomyocytes of a Knockout (Klf15-/-) Mouse.

Ultrastructural pathology 39, 336-339,

doi:10.3109/01913123.2015.1042610 (2015).

258 Soufi, A., Donahue, G. & Zaret, K. S. Facilitators and impediments of the

pluripotency reprogramming factors' initial engagement with the genome.

Cell 151, 994-1004, doi:10.1016/j.cell.2012.09.045 (2012).

259 Ocampo, A. et al. In Vivo Amelioration of Age-Associated Hallmarks by

Partial Reprogramming. Cell 167, 1719-1733 e1712,

doi:10.1016/j.cell.2016.11.052 (2016).

260 Solon-Biet, S. M. et al. The ratio of macronutrients, not caloric intake,

dictates cardiometabolic health, aging, and longevity in ad libitum-fed

mice. Cell metabolism 19, 418-430, doi:10.1016/j.cmet.2014.02.009

(2014).

261 Lee, C. & Longo, V. Dietary restriction with and without caloric restriction

for healthy aging. F1000Research 5, doi:10.12688/f1000research.7136.1

(2016).

199

262 Ooka, H., Segall, P. E. & Timiras, P. S. Histology and survival in age-

delayed low-tryptophan-fed rats. Mechanisms of ageing and development

43, 79-98 (1988).

263 Segall, P. E. & Timiras, P. S. Patho-physiologic findings after chronic

tryptophan deficiency in rats: a model for delayed growth and aging.

Mechanisms of ageing and development 5, 109-124 (1976).

264 Brandhorst, S. et al. A Periodic Diet that Mimics Fasting Promotes Multi-

System Regeneration, Enhanced Cognitive Performance, and Healthspan.

Cell metabolism 22, 86-99, doi:10.1016/j.cmet.2015.05.012 (2015).

265 Longo, V. D. et al. Interventions to Slow Aging in Humans: Are We

Ready? Aging cell 14, 497-510, doi:10.1111/acel.12338 (2015).

266 Slack, C. et al. The Ras-Erk-ETS-Signaling Pathway Is a Drug Target for

Longevity. Cell 162, 72-83, doi:10.1016/j.cell.2015.06.023 (2015).

267 Takashima, M. et al. Role of KLF15 in regulation of hepatic

gluconeogenesis and metformin action. Diabetes 59, 1608-1615,

doi:10.2337/db09-1679 (2010).

268 Gray, S. et al. Regulation of gluconeogenesis by Kruppel-like factor 15.

Cell metabolism 5, 305-312, doi:10.1016/j.cmet.2007.03.002 (2007).

269 Wang, Y. et al. Kruppel-like factor 4 is induced by rapamycin and

mediates the anti-proliferative effect of rapamycin in rat carotid arteries

after balloon injury. British journal of pharmacology 165, 2378-2388,

doi:10.1111/j.1476-5381.2011.01734.x (2012).

200

270 Song, Y. et al. Transcription factor Kruppel-like factor 2 plays a vital role in

endothelial colony forming cells differentiation. Cardiovascular research

99, 514-524, doi:10.1093/cvr/cvt113 (2013).

271 Gracia-Sancho, J., Villarreal, G., Jr., Zhang, Y. & Garcia-Cardena, G.

Activation of SIRT1 by resveratrol induces KLF2 expression conferring an

endothelial vasoprotective phenotype. Cardiovascular research 85, 514-

519, doi:10.1093/cvr/cvp337 (2010).

272 Stiernagle, T. Maintenance of C. elegans. WormBook : the online review

of C. elegans biology, 1-11, doi:10.1895/wormbook.1.101.1 (2006).

273 Mello, C. C., Kramer, J. M., Stinchcomb, D. & Ambros, V. Efficient gene

transfer in C.elegans: extrachromosomal maintenance and integration of

transforming sequences. The EMBO journal 10, 3959-3970 (1991).

274 Kuwahara, T. et al. Familial Parkinson mutant alpha-synuclein causes

dopamine neuron dysfunction in transgenic Caenorhabditis elegans. The

Journal of biological chemistry 281, 334-340,

doi:10.1074/jbc.M504860200 (2006).

275 Greer, E. L. et al. An AMPK-FOXO pathway mediates longevity induced

by a novel method of dietary restriction in C. elegans. Current biology : CB

17, 1646-1656, doi:10.1016/j.cub.2007.08.047 (2007).

276 Robida-Stubbs, S. et al. TOR signaling and rapamycin influence longevity

by regulating SKN-1/Nrf and DAF-16/FoxO. Cell metabolism 15, 713-724,

doi:10.1016/j.cmet.2012.04.007 (2012).

201

277 Gerstbrein, B., Stamatas, G., Kollias, N. & Driscoll, M. In vivo

spectrofluorimetry reveals endogenous biomarkers that report healthspan

and dietary restriction in Caenorhabditis elegans. Aging cell 4, 127-137,

doi:10.1111/j.1474-9726.2005.00153.x (2005).

278 Hughes, S. E., Evason, K., Xiong, C. & Kornfeld, K. Genetic and

pharmacological factors that influence reproductive aging in nematodes.

PLoS genetics 3, e25, doi:10.1371/journal.pgen.0030025 (2007).

279 Fujioka, H., Tandler, B. & Hoppel, C. L. Mitochondrial division in rat

cardiomyocytes: an electron microscope study. Anatomical record

(Hoboken, N.J. : 2007) 295, 1455-1461, doi:10.1002/ar.22523 (2012).

280 Zhang, H. et al. Guidelines for monitoring autophagy in Caenorhabditis

elegans. Autophagy 11, 9-27, doi:10.1080/15548627.2014.1003478

(2015).

281 Melendez, A. et al. Autophagy genes are essential for dauer development

and life-span extension in C. elegans. Science (New York, N.Y.) 301,

1387-1391, doi:10.1126/science.1087782 (2003).

282 Feng, Z. et al. A C. elegans model of nicotine-dependent behavior:

regulation by TRP-family channels. Cell 127, 621-633,

doi:10.1016/j.cell.2006.09.035 (2006).

283 Li, W., Feng, Z., Sternberg, P. W. & Xu, X. Z. A C. elegans stretch

receptor neuron revealed by a mechanosensitive TRP channel

homologue. Nature 440, 684-687, doi:10.1038/nature04538 (2006).

202

284 Sawin, E. R., Ranganathan, R. & Horvitz, H. R. C. elegans locomotory

rate is modulated by the environment through a dopaminergic pathway

and by experience through a serotonergic pathway. Neuron 26, 619-631

(2000).

285 Lim, Y. C. et al. Heterogeneity of endothelial cells from different organ

sites in T-cell subset recruitment. The American journal of pathology 162,

1591-1601, doi:10.1016/s0002-9440(10)64293-9 (2003).

286 Ly, K., Reid, S. J. & Snell, R. G. Rapid RNA analysis of individual

Caenorhabditis elegans. MethodsX 2, 59-63,

doi:10.1016/j.mex.2015.02.002 (2015).

287 Okuda, M. et al. Shear stress stimulation of p130(cas) tyrosine

phosphorylation requires calcium-dependent c-Src activation. The Journal

of biological chemistry 274, 26803-26809 (1999).

288 Kirwan, J. P. et al. Regular exercise enhances insulin activation of IRS-1-

associated PI3-kinase in human skeletal muscle. Journal of applied

physiology (Bethesda, Md. : 1985) 88, 797-803,

doi:10.1152/jappl.2000.88.2.797 (2000).

289 Ben-Zvi, A., Miller, E. A. & Morimoto, R. I. Collapse of proteostasis

represents an early molecular event in Caenorhabditis elegans aging.

Proceedings of the National Academy of Sciences of the United States of

America 106, 14914-14919, doi:10.1073/pnas.0902882106 (2009).

203

290 Olzscha, H. et al. Amyloid-like aggregates sequester numerous

metastable proteins with essential cellular functions. Cell 144, 67-78,

doi:10.1016/j.cell.2010.11.050 (2011).

291 Woerner, A. C. et al. Cytoplasmic protein aggregates interfere with

nucleocytoplasmic transport of protein and RNA. Science (New York,

N.Y.) 351, 173-176, doi:10.1126/science.aad2033 (2016).

292 Fontana, L. & Partridge, L. Promoting health and longevity through diet:

from model organisms to humans. Cell 161, 106-118,

doi:10.1016/j.cell.2015.02.020 (2015).

293 Lapierre, L. R. et al. The TFEB orthologue HLH-30 regulates autophagy

and modulates longevity in Caenorhabditis elegans. Nature

communications 4, 2267, doi:10.1038/ncomms3267 (2013).

294 Hansen, M. et al. A role for autophagy in the extension of lifespan by

dietary restriction in C. elegans. PLoS genetics 4, e24,

doi:10.1371/journal.pgen.0040024 (2008).

295 Panowski, S. H., Wolff, S., Aguilaniu, H., Durieux, J. & Dillin, A. PHA-

4/Foxa mediates diet-restriction-induced longevity of C. elegans. Nature

447, 550-555, doi:10.1038/nature05837 (2007).

296 Greer, E. L. & Brunet, A. Different dietary restriction regimens extend

lifespan by both independent and overlapping genetic pathways in C.

elegans. Aging cell 8, 113-127, doi:10.1111/j.1474-9726.2009.00459.x

(2009).

204

297 Feng, Y., Yao, Z. & Klionsky, D. J. How to control self-digestion:

transcriptional, post-transcriptional, and post-translational regulation of

autophagy. Trends in cell biology 25, 354-363,

doi:10.1016/j.tcb.2015.02.002 (2015).

298 Settembre, C. et al. TFEB links autophagy to lysosomal biogenesis.

Science (New York, N.Y.) 332, 1429-1433, doi:10.1126/science.1204592

(2011).

299 Palmieri, M. et al. Characterization of the CLEAR network reveals an

integrated control of cellular clearance pathways. Human molecular

genetics 20, 3852-3866, doi:10.1093/hmg/ddr306 (2011).

300 Zhang, J. et al. Mutation in Caenorhabditis elegans Kruppel-like factor,

KLF-3 results in fat accumulation and alters fatty acid composition.

Experimental cell research 315, 2568-2580,

doi:10.1016/j.yexcr.2009.04.025 (2009).

301 Zhang, J. et al. Regulation of fat storage and reproduction by Kruppel-like

transcription factor KLF3 and fat-associated genes in Caenorhabditis

elegans. Journal of molecular biology 411, 537-553,

doi:10.1016/j.jmb.2011.06.011 (2011).

302 Lapierre, L. R. & Hansen, M. Lessons from C. elegans: signaling

pathways for longevity. Trends in endocrinology and metabolism: TEM 23,

637-644, doi:10.1016/j.tem.2012.07.007 (2012).

205

303 Lakatta, E. G. & Levy, D. Arterial and cardiac aging: major shareholders in

cardiovascular disease enterprises: Part I: aging arteries: a "set up" for

vascular disease. Circulation 107, 139-146 (2003).

304 Krishnamurthy, J. et al. Ink4a/Arf expression is a biomarker of aging. The

Journal of clinical investigation 114, 1299-1307, doi:10.1172/jci22475

(2004).

305 Nichols, W. W. et al. Effects of age on ventricular-vascular coupling. The

American journal of cardiology 55, 1179-1184 (1985).

306 Weiss, E. P. & Fontana, L. Caloric restriction: powerful protection for the

aging heart and vasculature. American journal of physiology. Heart and

circulatory physiology 301, H1205-1219, doi:10.1152/ajpheart.00685.2011

(2011).

307 Torisu, T. et al. Autophagy regulates endothelial cell processing,

maturation and secretion of von Willebrand factor. Nature medicine 19,

1281-1287, doi:10.1038/nm.3288 (2013).

308 Torisu, K. et al. Intact endothelial autophagy is required to maintain

vascular lipid homeostasis. Aging cell 15, 187-191,

doi:10.1111/acel.12423 (2016).

309 Lapierre, L. R., Kumsta, C., Sandri, M., Ballabio, A. & Hansen, M.

Transcriptional and epigenetic regulation of autophagy in aging.

Autophagy 11, 867-880, doi:10.1080/15548627.2015.1034410 (2015).

206

310 Kapahi, P., Kaeberlein, M. & Hansen, M. Dietary restriction and lifespan:

Lessons from invertebrate models. Ageing research reviews 39, 3-14,

doi:10.1016/j.arr.2016.12.005 (2017).

311 Hashmi, S. et al. A Kruppel-like factor in Caenorhabditis elegans with

essential roles in fat regulation, cell death, and phagocytosis. DNA and

cell biology 27, 545-551, doi:10.1089/dna.2008.0739 (2008).

312 Rabinowitz, J. D. & White, E. Autophagy and metabolism. Science (New

York, N.Y.) 330, 1344-1348, doi:10.1126/science.1193497 (2010).

313 Hansen, M., Flatt, T. & Aguilaniu, H. Reproduction, fat metabolism, and

life span: what is the connection? Cell metabolism 17, 10-19,

doi:10.1016/j.cmet.2012.12.003 (2013).

314 Liao, X. et al. Kruppel-like factor 4 regulates pressure-induced cardiac

hypertrophy. Journal of molecular and cellular cardiology 49, 334-338,

doi:10.1016/j.yjmcc.2010.04.008 (2010).

315 Dekker, R. J. et al. Prolonged fluid shear stress induces a distinct set of

endothelial cell genes, most specifically lung Kruppel-like factor (KLF2).

Blood 100, 1689-1698, doi:10.1182/blood-2002-01-0046 (2002).

316 Parmar, K. M. et al. Integration of flow-dependent endothelial phenotypes

by Kruppel-like factor 2. The Journal of clinical investigation 116, 49-58,

doi:10.1172/jci24787 (2006).

317 Fang, Y. & Davies, P. F. Site-specific microRNA-92a regulation of

Kruppel-like factors 4 and 2 in atherosusceptible endothelium.

207

Arteriosclerosis, thrombosis, and vascular biology 32, 979-987,

doi:10.1161/atvbaha.111.244053 (2012).

318 Ni, C. W. et al. Discovery of novel mechanosensitive genes in vivo using

mouse carotid artery endothelium exposed to disturbed flow. Blood 116,

e66-73, doi:10.1182/blood-2010-04-278192 (2010).

319 Atkins, G. B. et al. Hemizygous deficiency of Kruppel-like factor 2

augments experimental atherosclerosis. Circulation research 103, 690-

693, doi:10.1161/circresaha.108.184663 (2008).

320 Vion, A. C. et al. Autophagy is required for endothelial cell alignment and

atheroprotection under physiological blood flow. Proceedings of the

National Academy of Sciences of the United States of America 114,

E8675-e8684, doi:10.1073/pnas.1702223114 (2017).

321 Peng, N. et al. An activator of mTOR inhibits oxLDL-induced autophagy

and apoptosis in vascular endothelial cells and restricts atherosclerosis in

apolipoprotein E(-)/(-) mice. Scientific reports 4, 5519,

doi:10.1038/srep05519 (2014).

322 Zhang, Y. L. et al. The autophagy-lysosome pathway: a novel mechanism

involved in the processing of oxidized LDL in human vascular endothelial

cells. Biochemical and biophysical research communications 394, 377-

382, doi:10.1016/j.bbrc.2010.03.026 (2010).

323 Mattart, L. et al. The peroxynitrite donor 3-morpholinosydnonimine

activates Nrf2 and the UPR leading to a cytoprotective response in

208

endothelial cells. Cellular signalling 24, 199-213,

doi:10.1016/j.cellsig.2011.09.002 (2012).

324 Chen, G. et al. Hypoxia-induced autophagy in endothelial cells: a double-

edged sword in the progression of infantile haemangioma? Cardiovascular

research 98, 437-448, doi:10.1093/cvr/cvt035 (2013).

325 Xie, Y. et al. Protective role of autophagy in AGE-induced early injury of

human vascular endothelial cells. Molecular medicine reports 4, 459-464,

doi:10.3892/mmr.2011.460 (2011).

326 Mueller, M. A., Beutner, F., Teupser, D., Ceglarek, U. & Thiery, J.

Prevention of atherosclerosis by the mTOR inhibitor everolimus in LDLR-/-

mice despite severe hypercholesterolemia. Atherosclerosis 198, 39-48,

doi:10.1016/j.atherosclerosis.2007.09.019 (2008).

327 LaRocca, T. J. et al. Translational evidence that impaired autophagy

contributes to arterial ageing. The Journal of physiology 590, 3305-3316,

doi:10.1113/jphysiol.2012.229690 (2012).

328 Sangwung, P. et al. KLF2 and KLF4 control endothelial identity and

vascular integrity. JCI insight 2, e91700, doi:10.1172/jci.insight.91700

(2017).

329 Heidenreich, P. A. et al. Forecasting the future of cardiovascular disease

in the United States: a policy statement from the American Heart

Association. Circulation 123, 933-944,

doi:10.1161/CIR.0b013e31820a55f5 (2011).

209

330 Wang, J. C. & Bennett, M. Aging and atherosclerosis: mechanisms,

functional consequences, and potential therapeutics for cellular

senescence. Circulation research 111, 245-259,

doi:10.1161/circresaha.111.261388 (2012).

331 Burrig, K. F. The endothelium of advanced arteriosclerotic plaques in

humans. Arteriosclerosis and thrombosis : a journal of vascular biology 11,

1678-1689 (1991).

332 Krouwer, V. J., Hekking, L. H., Langelaar-Makkinje, M., Regan-Klapisz, E.

& Post, J. A. Endothelial cell senescence is associated with disrupted cell-

cell junctions and increased monolayer permeability. Vascular cell 4, 12,

doi:10.1186/2045-824x-4-12 (2012).

333 Coppe, J. P. et al. Senescence-associated secretory phenotypes reveal

cell-nonautonomous functions of oncogenic RAS and the p53 tumor

suppressor. PLoS biology 6, 2853-2868, doi:10.1371/journal.pbio.0060301

(2008).

334 Young, A. R. & Narita, M. SASP reflects senescence. EMBO reports 10,

228-230, doi:10.1038/embor.2009.22 (2009).

335 Chinsomboon, J. et al. The transcriptional coactivator PGC-1alpha

mediates exercise-induced angiogenesis in skeletal muscle. Proceedings

of the National Academy of Sciences of the United States of America 106,

21401-21406, doi:10.1073/pnas.0909131106 (2009).

210

336 Arany, Z. et al. HIF-independent regulation of VEGF and angiogenesis by

the transcriptional coactivator PGC-1alpha. Nature 451, 1008-1012,

doi:10.1038/nature06613 (2008).

337 Duan, W. & Mattson, M. P. Dietary restriction and 2-deoxyglucose

administration improve behavioral outcome and reduce degeneration of

dopaminergic neurons in models of Parkinson's disease. Journal of

neuroscience research 57, 195-206, doi:10.1002/(sici)1097-

4547(19990715)57:2<195::Aid-jnr5>3.0.Co;2-p (1999).

338 Maswood, N. et al. Caloric restriction increases neurotrophic factor levels

and attenuates neurochemical and behavioral deficits in a primate model

of Parkinson's disease. Proceedings of the National Academy of Sciences

of the United States of America 101, 18171-18176,

doi:10.1073/pnas.0405831102 (2004).

339 Tain, L. S. et al. Rapamycin activation of 4E-BP prevents parkinsonian

dopaminergic neuron loss. Nature neuroscience 12, 1129-1135,

doi:10.1038/nn.2372 (2009).

340 Malagelada, C., Jin, Z. H., Jackson-Lewis, V., Przedborski, S. & Greene,

L. A. Rapamycin protects against neuron death in in vitro and in vivo

models of Parkinson's disease. The Journal of neuroscience : the official

journal of the Society for Neuroscience 30, 1166-1175,

doi:10.1523/jneurosci.3944-09.2010 (2010).

211

341 Nadjar, A. et al. IGF-1 signaling reduces neuro-inflammatory response

and sensitivity of neurons to MPTP. Neurobiology of aging 30, 2021-2030,

doi:10.1016/j.neurobiolaging.2008.02.009 (2009).

342 Dawson, T. M., Ko, H. S. & Dawson, V. L. Genetic animal models of

Parkinson's disease. Neuron 66, 646-661,

doi:10.1016/j.neuron.2010.04.034 (2010).

343 Sampson, T. R. et al. Gut Microbiota Regulate Motor Deficits and

Neuroinflammation in a Model of Parkinson's Disease. Cell 167, 1469-

1480.e1412, doi:10.1016/j.cell.2016.11.018 (2016).

344 Cao, P. et al. Alpha-synuclein disrupted dopamine homeostasis leads to

dopaminergic neuron degeneration in Caenorhabditis elegans. PloS one

5, e9312, doi:10.1371/journal.pone.0009312 (2010).

345 Lakso, M. et al. Dopaminergic neuronal loss and motor deficits in

Caenorhabditis elegans overexpressing human alpha-synuclein. Journal

of neurochemistry 86, 165-172 (2003).

346 Suh, J. & Hutter, H. A survey of putative secreted and transmembrane

proteins encoded in the C. elegans genome. BMC genomics 13, 333,

doi:10.1186/1471-2164-13-333 (2012).

347 Firnhaber, C. & Hammarlund, M. Neuron-specific feeding RNAi in C.

elegans and its use in a screen for essential genes required for GABA

neuron function. PLoS genetics 9, e1003921,

doi:10.1371/journal.pgen.1003921 (2013).

212

348 Shaye, D. D. & Greenwald, I. OrthoList: a compendium of C. elegans

genes with human orthologs. PloS one 6, e20085,

doi:10.1371/journal.pone.0020085 (2011).

349 Stroustrup, N. et al. The temporal scaling of Caenorhabditis elegans

ageing. Nature 530, 103-107, doi:10.1038/nature16550 (2016).

213