Fish & Shellfish Immunology

Fish & Shellﬁsh Immunology 58 (2016) 259e265

Contents lists available at ScienceDirect

Fish & Shellﬁsh Immunology

journal homepage: www.elsevier.com/locate/fsi

Short communication Identiﬁcation and expressional analysis of NLRC5 inﬂammasome gene in smolting Atlantic salmon (Salmo salar)

* Juan Pablo Pontigo a, b, , María Jose Agüero a, Patricio Sanchez c, Ricardo Oyarzún a, d, Carolina Vargas-Lagos a, e, Jorge Mancilla d, f, Hans Kossmann g, Francisco J. Morera h, ** *** Alejandro J. Yanez~ c, i, , Luis Vargas-Chacoff a, j, a Instituto de Ciencias Marinas y Limnologicas, Universidad Austral de Chile, Valdivia, Chile b Programa Doctorado en Ciencias, Mencion Biología Celular y Molecular, Escuela de Graduados, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile c Instituto de Bioquímica y Microbiología, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile d Programa de Doctorado en Ciencias de la Acuicultura, Universidad Austral de Chile, Los Pinos s/n, Balneario Pelluco, Puerto Montt, Chile e Programa de Magister en Ciencias, Mencion Microbiología, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile f Marine Harvest Chile, Ruta 226 Km8, Puerto Montt, Chile g Trapananda Asesorias, Cristobal Colon 486, Puerto Montt, Chile h Instituto de Farmacología y Morfoﬁsiología, Facultad de Ciencias Veterinarias, Universidad Austral de Chile, Valdivia, Chile i Interdisciplinary Center for Aquaculture Research (INCAR), Concepcion, Chile j Centro Fondap de Investigacion de Altas Latitudes (IDEAL), Universidad Austral deChile, Casilla 567, Valdivia, Chile article info abstract

Article history: The NOD-like receptors (NLRs) were recently identified as an intracellular pathogen recognition receptor Received 8 August 2016 family in vertebrates. While the immune system participation of NLRs has been characterized and Received in revised form analyzed in various mammalian models, few studies have considered NLRs in teleost species. Therefore, 13 September 2016 this study analyzed the Atlantic salmon (Salmo salar) NLRC5. Structurally, Atlantic salmon NLRC5 pre- Accepted 14 September 2016 sented leucine-rich repeat subfamily genes. Phylogenetically, NLRC5 was moderately conserved between Available online 15 September 2016 S. salar and other species. Real-time quantitative PCR revealed NLRC5 expression in almost all analyzed organs, with greatest expressions in the head kidney, spleen, and hindgut. Furthermore, NLRC5 gene Keywords: Innate immunity expression decreased during smolt stage. These data suggest that NLRC5 participates in the Atlantic fi Inflammation salmon immune response and is regulated, at least partly, by the smolti cation process, suggesting that Leucine-rich repeats there is a depression of immune system from parr at smolt stage. This is the first report on the NLRC5 NLR gene in salmonid smolts. NOD-like receptors © 2016 Elsevier Ltd. All rights reserved. Nucleotide binding Pathogen

1. Introduction vertebrates, which have poorly developed adaptive immunity [1]. The innate immune response rapidly recognizes pathogenic parti- Innate immunity is the first line of defense against pathogens in cle invasion and initiates defensive actions. In vertebrates, the innate immune system recognizes various pathogenic and non- pathogenic microorganisms via pattern recognition receptors able to recognize specific pathogen associated molecular patterns, Abbreviations: LRR, leucine rich repeat; NCBI, National Center for Biotechnology þ þ thereby initiating the immune response [2,3]. Information; NKA, Na /K -ATPase; NLRs, NOD-like receptors; NOD, nucleotide- binding oligomerization domain; SsNLRC5, Salmo salar NOD-like receptor C5. The immune response is comprised by different cells able to * Corresponding author. Instituto de Ciencias Marinas y Limnologicas, Uni- interact with and consequently respond to (e.g. via inflammation) versidad Austral de Chile, Valdivia, Chile. foreign particles. The inflammatory response is evidenced by ** Corresponding author. distinct mechanisms, such as leukocyte recruitment to the infection *** Corresponding author. site; antimicrobial effector system activation; and adaptive im- E-mail addresses: [email protected] (J.P. Pontigo), [email protected] (A.J. Yanez),~ [email protected] (L. Vargas-Chacoff). mune response stimulation [4]. Several pattern recognition http://dx.doi.org/10.1016/j.fsi.2016.09.031 1050-4648/© 2016 Elsevier Ltd. All rights reserved. 260 J.P. Pontigo et al. / Fish & Shellfish Immunology 58 (2016) 259e265 receptors are involved in pathogen elimination and control. These 2.2. Identification and sequencing of S. salar NLRC5 (SsNLRC5) include inducible retinoic acid receptors, Toll-like receptors, and through transcriptomic analyses nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs, alternatively termed intracellular nucleotide-binding Massive Illumina RNAseq assessments were performed for parr- domain, leucine rich repeat (LRR) containing receptors [1]. NLRs and smolt-stage Atlantic salmon head kidney tissues. The tran- particularly participate in innate defenses against bacteria. Specific scriptome was annotated by accessing the non-redundant National to NLR proteins is the presence of a nucleotide binding domain Center for Biotechnology Information (NCBI) database using a flanked by highly variable LRRs. These nucleotide binding-LRR dedicated Illumina MiSeq sequencing computer at the Austral- domains containing various receptors, including NLRs [5]. OMICS Center of the Faculty of Sciences, Universidad Austral de In farmed fish, pathogens can induce a systemic stress response, Chile. which is highly demanding on energy reserves [6,7]. The realloca- tion of metabolic energy negatively interferes with other physio- 2.3. Gene expression analyses logical processes, such as immunological capacity, thus influencing the ability of several immune system components to resist infection Total RNA was extracted with the TRIzol reagent (Invitrogen) [8e12]. For example, increased cortisol levels may decrease following the manufacturer's instructions, and the obtained sam- lymphocyte quantities, consequently inducing a selective sup- ples were treated with amplification grade DNase I (1 U mg1 RNA, pression of phagocytic and complementary immune activities in Invitrogen). The SuperScript III RNase H Reverse Transcriptase the head kidney and blood, as well as increasing infection suscep- platform (Invitrogen) synthesized first-strand cDNA from 1 mgof tibility in teleosts [13]. Fish are naturally exposed to stress, as is the total RNA using the oligo-dT18 primer at 50 C for 50 min. Quan- case for salmonids during changing environment. titative PCR analysis was carried out on the Mx3000p instrument In particular, Atlantic salmon (Salmo salar) undergo smoltifica- (Stratagene). Reaction mixtures were incubated for 10 min at 95 C, tion, a migratory process for growth [14] that is a critical stage for followed by 40 cycles of 15 s at 95 C, 1 min at 60 C, and finally 15 s successful aquaculture. Standard farming practices move smolting at 95 C, 1 min at 60 C, and 15 s at 95 C. The mRNA gene ex- fish from fresh to seawater. This transition is not simply a migration pressions were normalized to the Atlantic salmon ribosomal pro- from hypo-to hyperosmotic conditions; it also generates costs for tein S18 using the comparative DDCt method [18]. The primers used several biological functions, such as in the metabolic, endocrine, are listed in Table 1. In all cases, each qRT-PCR was performed with osmoregulatory and immune systems, been changes in amino acid triplicate samples and repeated with at least two independent levels, hormones as cortisol-growth hormone (increasing levels) or samples. þ prolactin (decreasing levels), and osmotic process (changes in Na , þ K -ATPase sub-units in gills) the more reported [9,10]. Conse- 2.4. Phylogenetic analysis quently, smolting can increase, at least temporarily, the suscepti- bility of fish to pathogenic infection, likely with significant A 10-sequence set was compiled to infer phylogenetic re- consequences. Therefore, active osmoregulation occurs during lationships among several species in a consensus tree. Sequences smoltification, with low osmolality inducing turgor in macrophages were manually trimmed by deleting alignment gaps. The sequence þ and decreasing K and Cl concentrations [15e17]. These modu- set was then analyzed using Treefinder (v. March 2011) with a lations normally activate the inflammasome, but a detailed char- mixed model and 1000 bootstrap replications. Bayesian inference acterization is lacking for salmonids. analysis was computed using the MrBayes software (v. 3.2.6) with a Considering the above-detailed knowledge gap, the aims of this mixed substitution model for 105 generations and burn-in of 25%. study were to identify and analyze NLRC5 inflammasome gene þ þ expression during S. salar smoltification and to more fully under- 2.5. Gill Na ,K -ATPase activity (NKA) stand why S. salar smolts suffered increased pathogenic infections in the transition to seawater. Gill NKA activity was determined using the microassay method described by McCormick [19].

2. Materials and methods 2.6. Statistical analyses

2.1. Animals All data are shown as the mean ± standard error (SE). As- sumptions of normality and homogeneity were tested for the Atlantic salmon (Salmo salar) from the parr and smolt stages detected variances. Differences were evaluated using one-way were provided by the Calabozo Fish Farm, Chile (Marine Harvest). ANOVA and were considered significant at P < 0.05. Groups were established by developmental stages, and smoltifi- þ þ cation parameters were analyzed (i.e. total gill Na /K -ATPase 3. Results [NKA]; Supplementary Fig. S1). Mean water temperature and oxy- gen concentration at the sampling site were 10 C and 8.0 mg/L, 3.1. Identification and sequence analysis of SsNLRC5 respectively and the fish were fasted before sampling, and this was at 10:00 a.m. Twenty salmon from each group were administered The obtained SsNLRC5 sequence (NCBI Accession number: an anaesthetic overdose (1 mL/L 2-phenoxyethanol, Fluka-77699- 500 ML) and euthanized by spinal sectioning before tissue removal. Tissue portions were excised for each sampled fish from the gills, Table 1 Primer sequences for SsNLRC5 used in the experiments. spleen, liver, muscle, pituitary, head kidney, posterior kidney, foregut, midgut, and hindgut. Samples were frozen in liquid ni- Primer Nucleotide sequence (50 / 30) trogen and stored at 80 C until analyses. All experiments were NLRC5 - Forward TCTGTCTACCGTGACCATAAGCCT performed in accordance with guidelines for the use of laboratory NLRC5 - Reverse CCCACTCTACCAATGCTGGTCAAT animals established by the Comision Nacional de Ciencias y Tec- 18S - Forward GTCCGGGAAACCAAAGTC 18S Reverse TTGAGTCAAATTAAGCCGCA nología de Chile (CONICYT) and the Universidad Austral de Chile. J.P. Pontigo et al. / Fish & Shellfish Immunology 58 (2016) 259e265 261 pending acceptation) was analyzed by Illumina RNAseq. A search 3.2. Phylogenetic analysis of SsNLRC5 for conserved domains was conducted using the NCBI BLAST tool, revealing that the predicted SsNLRC5 protein contained LRR su- Ten taxa were retrieved from the GenBank database for use in perfamily domains (Supplemental Fig. S2). The deduced amino acid phylogenetic analyses. The obtained data were used to analyze the sequences (Fig. 1) of the SsNLRC5 were aligned with that of NLRC5 evolutionary relationships of NLRC5 genes between S. salar, O. from the other species, including NLRC5 from Oreochromis niloticus, niloticus, O. latipes, I. punctatus, D. rerio, C. milii, G. gallus, O. anatinus, Oryzias latipes, Ictalurus punctatus, Danio rerio, Callorhinchus milii, M. musculus, H. sapiens, and S. purpuratus. Mammalian, avian, Gallus gallus, Ornithorhynchus anatinus, Mus musculus, Homo sapi- amphibian, teleost, and invertebrate NLRC5 homologs were sup- ens, and Strongylocentrotus purpuratus (Fig. 2). The NLRC5 gene was ported by strong bootstrap values. Specifically, the invertebrate, found moderately conserved in the analyzed species. Specifically, teleost, amphibian, avian, and mammalian NLRC5 genes formed SsNLRC5 showed 47.9% and 45.2% identity with the NLRC5 protein three separate clades with high bootstrap support (Fig. 3). There- sequences of I. punctatus and O. niloticus, respectively. Regarding fore, the evolutional status of the SsNLRC5 gene was confirmed as it the other eight assessed NLRC5 sequences, SsNLRC5 showed ho- was clustered with the teleost NLRC5 gene group and was distant to mologies between 16 and 44% (Fig. 2 and Table 2). NLRC5 genes from non-fish species.

Fig. 1. Nucleotide sequence and deduced amino acid sequence of NLRC5. The start codon (ATG) was shown by underlined blue line. Numbers at right side represent nucleotide and at left side represent the deduced amino acid sequence. The NLRC5 nucleotide sequence was submitted to GenBank under accession number x. 262 J.P. Pontigo et al. / Fish & Shellﬁsh Immunology 58 (2016) 259e265

Fig. 2. Multiple alignment of NLRC5 amino acid sequence from Atlantic salmon (Salmo salar). A comparison of deduced amino acid sequence of Salmo salar NLRC5 was conducted with sequences from Oreochromis niloticus (XP_013120523.1), Oryzias latipes (XP_011474651.1), Ictalurus punctatus (NP_001186995.1), Danio rerio (AFN73230.1), Cal- lorhinchus milii (XP_007905775.1), Gallus gallus (AEY11256.1), Ornithorhynchus anatinus (XP_016083704.1), Mus musculus (ACP40992.1), Homo sapiens (NP_115582.4), and Strongylocentrotus purpuratus (XP_011666309.1). Identical residue are shown in white letters with a blue background.

3.3. Expression profiles of SsNLRC5 in different healthy tissues profile of SsNLRC5 mRNA in ten tissues excised from parr stage of Atlantic salmon, was used as a control. Analyses evidenced Quantitative real-time RT-PCR determined the expression constitutive SsNLRC5 mRNA expression in most of the examined J.P. Pontigo et al. / Fish & Shellfish Immunology 58 (2016) 259e265 263

Table 2 Pairwise similarities of selected NLRC5 protein.

Salmon Tilapia Medaka Catﬁsh Zebraﬁsh Ghost shark Chicken Platypus Mouse Human

45,2% 40,7% 47,9% 44,1% 32,9% 26,3% 16,6% 22,8% 24,9% Salmon 50,0% 35,2% 36,0% 27,1% 22,9% 15,4% 20,8% 23,0% Tilapia 30,5% 30,4% 25,3% 20,5% 16,1% 19,6% 20,4% Medaka 47,1% 27,4% 19,8% 15,9% 22,4% 23,0% Catﬁsh 29,4% 22,6% 15,9% 22,0% 22,6% Zebraﬁsh 31,2% 21,0% 29,0% 29,4% Ghost shark 32,0% 31,5% 34,6% Chicken 28,4% 33,2% Platypus 61,5% Mouse Human

Fig. 4. NLRC5 constitutive expression in several tissue of Atlantic salmon in Parr Fig. 3. Phylogenetic relationships of NLRC5 with related sequences from other stage. NLRC5 expression level in the muscle, liver, gill, foregut, midgut, hindgut, head species. A phylogenetic tree was constructed using the Bayesian inference method. kidney, posterior kidney, spleen and pituitary was determinate by real-time quanti- Bayesian posterior probabilities (>0.5) and ML bootstrap support values (>50%) are tative RT-PCR. The expression level of NLRC5 in muscle was set a 1. NLRC5 mRNA was indicated at the nodes. The sequence of Strongylocentrotus purpuratus was used as an expressed in the most tissues detected with higher expression levels in hindgut, head outgroup. kidney and spleen. The 18s gene was used as an internal control to calibrate the cDNA template for all the samples. Bars represent mean values (S.E.) of twenty samples. Symbol represent statistical difference by one-way ANOVA (P < 0.05). tissues, excepting the gills. The highest expression levels were found in the head kidney, spleen, and hindgut, whereas lower levels were found in the midgut, liver, posterior kidney, foregut, and gene expression parr and smolt stage, which could influence sus- pituitary. Specifically, 7-fold head kidney and 4-fold hindgut and ceptibility to pathogenic infection during the fresh-to seawater spleen expressional changes were observed as compared to muscle transfer process. The NLRs are intracellular constituents of the (Fig. 4). inflammasome complex and are responsible for protecting against invading microbes. While the functional role of the inflammatory 3.4. SsNLRC5 expression profile parr and smolt stage immune response has been identified in mammals, this is an un- explored topic fish. Furthermore, although several NLR subfamilies Gene expression profiles of Atlantic salmon NLRC5 were have been characterized in humans, mice, and zebrafish, NLR assessed in the head kidney, hindgut, and spleen to determine the research in other species, particularly teleosts of commercial in- relationship of this NLR, and of the NLR family in general, with the terest, are limited [21]. Nevertheless, several NLR were recently fish immune system [20]. These tissues evidenced high expression described in vertebrates, including fish [22]. The present study levels of SsNLRC5 (Fig. 4). Subsequently, expressional differences contributed to expanding on the available knowledge by identi- were assessed between parr- and smolt-stage S. salar to analyze the fying and characterizing SsNLRC5 expression in parr- and smolt- expressional modulations of this gene prior to seawater transfer, stage S. salar, with the goal of establishing contributions to im- gill NKA activity between Parr (9.7 mmol ADP/mg protein/h) and mune system function and NKA activity during fresh-to seawater smolt (17.0 mmol ADP/mg protein/h) was used as control of smol- transfer. tification (to see Supplementary Fig. S1). In the three analyzed or- The deduced SsNLRC5 protein was found typical of the LRR su- gans, SsNLRC5 gene expression decreased in smolting as compared perfamily (Supplementary Fig. S2), presenting similarities to other to parr Atlantic salmon (Fig. 5). mammalian and fish NLRC5 sequences (i.e. O. niloticus, O. latipes, I. punctatus, D. rerio, C. milii, G. gallus, O. anatinus, M. musculus, 4. Discussion H. sapiens, and S. purpuratus). These results strongly support the evolutionary phylogenetic relationship and conservation of NLRC5, The results of this study demonstrated a decrease in SsNLRC5 264 J.P. Pontigo et al. / Fish & Shellfish Immunology 58 (2016) 259e265

Fig. 5. The relative expression of NLRC5 transcript in three different tissues (head kidney, spleen and hindgut) in parr versus smolt in Atlantic salmon. The 18s gene was used as an housekeeping to calibrate the cDNA template for all the samples. Bars represent mean values (S.E.) of twenty samples. Symbol represent statistical difference by one-way ANOVA (P < 0.05). from lower to higher organisms. In miiuy croaker (Miichthys miiuy), Appendix A. Supplementary data the responses of NLRC3 and NLRC5 to Vibrio anguillarum infection have been characterized in different tissues, suggesting that these Supplementary data related to this article can be found at http:// proteins participate in host immune response through bacterial dx.doi.org/10.1016/j.fsi.2016.09.031. inhibition [23]. Furthermore, I. punctatus NLRC5 is highly expressed in different tissues during bacterial and viral infections [18], with Conflict of interest resulting characterizations of various inflammasome-related proteins. These prior studies support the probability that SsNLRC5 The authors declare no conflicts of interest. participates in the immune response as a constituent of the inflammasome. References The present study also evaluated SsNLRC5 expression in ten different organs from parr-stage individuals. Expression was [1] G. Biswas, H. Korenaga, R. Nagamine, H. Takayama, S. Kawahara, S. Takeda, Y. Kikuchi, B. Dashnyam, T. Kono, M. Sakai, Cytokine responses in the Japanese observed in all organs, except the gills. Particularly high expres- pufferfish (Takifugu rubripes) head kidney cells induced with heat-killed sions were found in the head kidney, spleen, and hindgut. probiotics isolated from the Mongolian dairy products, Fish. Shellfish Immu- Considering the key functions of the head kidney, spleen, and nol. 34 (2013) 1170e1177, http://dx.doi.org/10.1016/j.fsi.2013.01.024. hindgut in immune system functioning, these increased expres- [2] T. Kawai, S. Akira, The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors, Nat. Immunol. 11 (2010) 373e384, http:// sions would be expected. dx.doi.org/10.1038/ni.1863. Prior to this study, evaluations did not exist for the relationship [3] O. Takeuchi, S. Akira, Pattern recognition receptors and inflammation, Cell 140 e between SsNLRC5 gene expression and smoltification in a salmonid (2010) 805 820, http://dx.doi.org/10.1016/j.cell.2010.01.022. fi [4] R. Medzhitov, C.A. Janeway, Decoding the patterns of self and nonself by the species. Considering the signi cant economic losses incurred by the innate immune system, Science 296 (2002) 298e300, http://dx.doi.org/ aquaculture industry as a result of pathogenic infection during the 10.1126/science.1068883. fresh-to seawater migration process, fully understanding the un- [5] Y. Kadota, K. Shirasu, R. Guerois, NLR sensors meet at the SGT1eHSP90 crossroad, Trends Biochem. Sci. 35 (2010) 199e207, http://dx.doi.org/ derlying molecular basis for immune function are fundamental for 10.1016/j.tibs.2009.12.005. decreasing smoltification-related losses. This study provides a first [6] F.J. Arjona, L. Vargas-Chacoff, I. Ruiz-Jarabo, O. Gonçalves, I. Pascoa, approximation between the S. salar immune and osmoregulatory M.P. Martín del Río, J.M. Mancera, Tertiary stress responses in Senegalese sole (Solea senegalensis Kaup, 1858) to osmotic acclimation: implications for systems. osmoregulation, energy metabolism and growth, Aquaculture 287 (2009) In summary, this is the first study to identify and determine 419e426. participation in parr and smolt stage for the NLRC5 inflammasome [7] M. Vijayan, J. Ballantyne, J. Leatherland, Gen. Comp. Endocrinol. 199 (1991) 2467e2475. gene in Atlantic salmon, the main salmonid in aquaculture. [8] B.A. Barton, G.K. Iwama, Physiological changes in fish from stress in aqua- Phylogenetic analysis indicated moderately conserved homology of culture with emphasis on the response and effects of corticosteroids, Annu. SsNLRC5. Moreover, SsNLRC5 was found expressed in all assessed Rev. Fish. Dis. 1 (1991) 3e26, http://dx.doi.org/10.1016/0959-8030(91)90019- S. salar organs, excepting gills. Particularly high expression was G. [9] S.E.W. Bonga, The stress response in fish, Physiol. Rev. 77 (1997) 591e625. found in the head kidney, spleen, and hindgut, suggesting a [10] T.P. Mommsen, M.M. Vijayan, T.W. Moon, Cortisol in teleosts: dynamics, participation in the salmonid immune system prior to migration, a mechanisms of action, and metabolic regulation, Rev. Fish Biol. Fish. 9 (n.d.) e process after or during which NKA activity demands more energy, 211 268. doi:http:dx.doi.org/10.1023/A:1008924418720. [11] L. Vargas-Chacoff, D. Martínez, R. Oyarzún, D. Nualart, V. Olavarría, A. Yanez,~ resulting in a natural suppression of the immune system. While the C. Bertran, I. Ruiz-Jarabo, J.M. Mancera, Combined effects of high stocking present study provides initial groundwork, further research is density and Piscirickettsia salmonis treatment on the immune system, needed on the underlying functional mechanisms of NLRC5 in fish. metabolism and osmoregulatory responses of the Sub-Antarctic Notothenioid fish Eleginops maclovinus, Fish. Shellfish Immunol. 40 (2014) 424e434, http:// dx.doi.org/10.1016/j.fsi.2014.07.024. [12] A.D. Pickering, T.G. Pottinger, J.P. Sumpter, J.F. Carragher, P.Y. Le Bail, Effects of acute and chronic stress on the levels of circulating growth hormone in the Acknowledgements rainbow trout, Oncorhynchus mykiss, Gen. Comp. Endocrinol. 83 (1991) 86e93, http://dx.doi.org/10.1016/0016-6480(91)90108-I. [13] J. Ortuno,~ M.A. Esteban, J. Meseguer, Effects of short-term crowding stress on This work was supported by INNOVA CORFO [Grant 13IDL2 the gilthead seabream (Sparus aurata L.) innate immune response, Fish 23565], Fondecyt [Grant 1160877], FONDAP INCAR [Grant Shellfish Immunol. 11 (2001) 187e197, http://dx.doi.org/10.1006/ 15110027] and FONDAP IDEAL [Grant 15150003]. The authors also fsim.2000.0304. [14] S.D. McCormick, A.P. Farrell, C.J. Brauner, Fish Physiology: Euryhaline Fishes, acknowledge support provided by the Direccion de Investigacion of Academic Press, 2013. the Universidad Austral de Chile. [15] J.P. de Rivero Vaccari, G. Lotocki, O.F. Alonso, H.M. Bramlett, W.D. Dietrich, J.P. Pontigo et al. / Fish & Shellfish Immunology 58 (2016) 259e265 265

R.W. Keane, Therapeutic neutralization of the NLRP1 inflammasome reduces channel catfish (Ictalurus punctatus) after infection with Edwardsiella tarda, the innate immune response and improves histopathology after traumatic Aeromonas hydrophila, Streptococcus iniae and channel catfish hemorrhage brain injury, J. Cereb. Blood Flow. Metab. Off. J. Int. Soc. Cereb. Blood Flow. reovirus, Fish Shellfish Immunol. 33 (2012) 1033e1041, http://dx.doi.org/ Metab. 29 (2009) 1251e1261, http://dx.doi.org/10.1038/jcbfm.2009.46. 10.1016/j.fsi.2012.06.033. [16] L. Feldmeyer, M. Keller, G. Niklaus, D. Hohl, S. Werner, H.-D. Beer, The [21] Z. Sha, J.W. Abernathy, S. Wang, P. Li, H. Kucuktas, H. Liu, E. Peatman, Z. Liu, inflammasome mediates UVB-induced activation and secretion of Interleukin- NOD-like subfamily of the nucleotide-binding domain and leucine-rich repeat 1b by keratinocytes, Curr. Biol. 17 (2007) 1140e1145, http://dx.doi.org/ containing family receptors and their expression in channel catfish, Dev. 10.1016/j.cub.2007.05.074. Comp. Immunol. 33 (2009) 991e999, http://dx.doi.org/10.1016/ [17] R. Zhou, A. Tardivel, B. Thorens, I. Choi, J. Tschopp, Thioredoxin-interacting j.dci.2009.04.004. protein links oxidative stress to inflammasome activation, Nat. Immunol. 11 [22] G. Biswas, S. Bilen, T. Kono, M. Sakai, J. Hikima, Inflammatory immune (2010) 136e140, http://dx.doi.org/10.1038/ni.1831. response by lipopolysaccharide-responsive nucleotide binding oligomeriza- [18] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using tion domain (NOD)-like receptors in the Japanese pufferfish (Takifugu rubri- real-time quantitative PCR and the 2DDCT method, Methods 25 (2001) pes), Dev. Comp. Immunol. 55 (2016) 21e31, http://dx.doi.org/10.1016/ 402e408, http://dx.doi.org/10.1006/meth.2001.1262. j.dci.2015.10.008. [19] S.D. McCormick, Methods for nonlethal gill biopsy and measurement of Naþ, [23] J. Li, L. Kong, Y. Gao, C. Wu, T. Xu, Characterization of NLR-A subfamily Kþ-ATPase activity, Can. J. Fish. Aquat. Sci. 50 (1993) 656e658, http:// members in miiuy croaker and comparative genomics revealed NLRX1 un- dx.doi.org/10.1139/f93-075. derwent duplication and lose in actinopterygii, Fish Shellfish Immunol. 47 [20] M. Li, Q. Wang, Y. Lu, S. Chen, Q. Li, Z. Sha, Expression profiles of NODs in (2015) 397e406, http://dx.doi.org/10.1016/j.fsi.2015.09.024.