NLRP10 Enhances Shigellainduced Proinflammatory Responses

Cellular Microbiology (2012) doi:10.1111/j.1462-5822.2012.01822.x

NLRP10 enhances Shigella-induced pro-inﬂammatory responses

Katja Lautz,1 Anna Damm,1 Maureen Menning,1 Introduction Julia Wenger,2 Alexander C. Adam,3 Paola Zigrino,4 Elisabeth Kremmer5 and Thomas A. Kufer1* The innate immune system is the first line of defence 1Institute for Medical Microbiology, Immunology and against invading pathogens in mammals. By gaining Hygiene, University of Cologne, Cologne, Germany. access to the cellular cytoplasm, some bacteria and 2Department of Molecular Biology, University of viruses adopted to escape host innate immune surveil- Salzburg, Salzburg, Austria. lance by membrane standing pattern-recognition recep- 3Department of Pathology, University of Cologne, tors (PRRs) such as the Toll-like receptor family. To cope Cologne, Germany. with such intracellular residing pathogens, the host has 4Department of Dermatology, University of Cologne, evolved sophisticated detection systems. In particular Cologne, Germany. members of the nucleotide-binding domain leucine-rich 5Helmholtz Zentrum München, Institute of Molecular repeat containing family (NLR) have been shown to sense Immunology, Munich, Germany. such invasive bacteria and viruses. NLRs are a heteroge- neous class of 23 AAA+ ATPases in humans, which are characterized by a tripartite structural organization com- Summary prising an effector domain, a STAND type ATPase domain Members of the NLR family evolved as intracellular (called NACHT domain) and a series of leucine-rich sensors for bacterial and viral infection. However, repeats (LRRs) at the carboxyl-terminus (Fritz et al., our knowledge on the implication of most of the 2006; Schroder and Tschopp, 2010). NLRs are classified human NLR proteins in innate immune responses based on the nature of their amino-terminal effector still remains fragmentary. Here we characterized domain into a CARD-domain (NLRC) and a PYD-domain the role of human NLRP10 in bacterial infection. Our subfamily (NLRP), as well as in an ‘atypical’ effector data revealed that NLRP10 is a cytoplasmic local- domain family, comprising CIITA, NAIP, NLRX1, NLRC3 ized protein that positively contributes to innate and NLRC5. Most of our current knowledge of the biology immune responses induced by the invasive bacte- of NLRs derives from studies on a small number of NLRs rial pathogen Shigella flexneri. SiRNA-mediated including NOD1, NOD2 and NLRC4 as well as NLRP3 knock-down studies showed that NLRP10 contrib- and NLRP1 (Fritz et al., 2006, Schroder and Tschopp, utes to pro-inflammatory cytokine release triggered 2010). Seminal work has shown that NOD1 and NOD2 by Shigella in epithelial cells and primary dermal are sensors for bacterial infection and mediate inflam- fibroblasts, by influencing p38 and NF-kB activa- matory responses whereas NLRP1 and NLRP3 can form tion. This effect is dependent on the ATPase activity multimeric protein complexes, the so-called inflammas- of NLRP10 and its PYD domain. Mechanistically, omes, which allow processing of caspase-1 and subse- NLRP10 interacts with NOD1, a NLR that is pivotally quent release of IL-1b and IL-18 after sensing of PAMPs involved in sensing of invasive microbes, and both or danger signals (Martinon et al., 2002; Inohara et al., proteins are recruited to the bacterial entry point 2003; Girardin et al., 2003a; 2003b). However, the contri- at the plasma membrane. Moreover, NLRP10 phy- bution of other NLRs in bacteria-mediated innate immune sically interacts with downstream components responses remains less well defined. of the NOD1 signalling pathway, such as RIP2, Here we used the Gram-negative, invasive bacte- TAK1 and NEMO. Taken together, our data revealed rium Shigella flexneri as a well-characterized model a novel role of NLRP10 in innate immune re- system for bacterial infection. S. flexneri is a human sponses towards bacterial infection and suggest pathogen, responsible for endemic dysentery and dis- that NLRP10 functions as a scaffold for the forma- plays a complex interplay with the host cell (Schroeder tion of the NOD1–Nodosome. and Hilbi, 2008). S. flexneri has been shown to trigger pro-inflammatory responses in human epithelial cells by activating the NLR proteins NOD1 and NOD2 (Girardin Received 15 March, 2012; revised 18 May, 2012; accepted 26 May, 2012. *For correspondence. E-mail [email protected]; et al., 2001; Kufer et al., 2006). In macrophages NLRC4, Tel. (+49) 221 478 7279; Fax (+49) 221 478 7288. NAIP and NLRP3 contribute to Shigella-mediated host

cellular microbiology 2 K. Lautz et al. responses as well by inducing a special type of caspase- NLRP10 and involves physical interactions with NOD1 1-dependent cell death (Damiano et al., 2004; Suzuki and the NOD1 signalling pathway components NEMO, et al., 2007; Willingham et al., 2007). The role of further RIP2 and TAK1. Conclusively, this defines a novel func- NLRs in Shigella-induced innate immune responses tion of NLRP10 in innate immune responses towards bac- however remains largely elusive. Of particular interest in terial infection and suggests that NLRP10 modulates our studies was NLRP10, the smallest of all human NLRs. signalling induced by the Nodosome complex. NLRP10 (Nalp10, alternatively named PAN5; NOD8; PYNOD; CLR11.1) is a prototypic member of the NLR family, although it lacks the LRRs (Ting et al., 2008), Results which are proposed to mediate detection of PAMPs. A NLRP10 is a cytoplasmic protein expressed in epithelial regulatory role for NLRP10 in innate immune responses and fibroblastic cells thus seems more likely than its function as a PRR. NLRP10 expression was proposed to be induced by In order to identify a suitable cellular model system for the PAMPs, such as LPS (Wang et al., 2004) and it was detailed functional characterization of NLRP10, we ana- shown that NLRP10 can inhibit ASC-mediated NF-kB acti- lysed the expression pattern of human NLRP10. While vation and IL-1b release in epithelial cells (Wang et al., human NLRP10 mRNA was shown to be expressed 2004; Kinoshita et al., 2005; Imamura et al., 2010). highly in heart, brain and muscle (Wang et al., 2004), Accordingly, transgenic mice that overexpress NLRP10 another study found that NLRP10 expression is highest in show a reduced IL-1b response towards bacterial and liver, small intestine and muscle (Lech et al., 2010). In PAMP stimulation and are less susceptible for endotoxic accordance with lack of detectable expression of NLRP10 shock (Imamura et al., 2010). These findings emphasize a in primary human CD14+ cells (Lech et al., 2010) we function of NLRP10 in innate immune responses and found that NLRP10 mRNA was not robustly detectable in suggest a role of NLRP10 in regulating inflammasome- the human myeloid cell line THP1 even after differentia- mediated responses. A physiological role for NLRP10 in tion to macrophage-like cells by PMA. Although NLRP10 immunity has been put forward by the characterization expression was slightly induced after additional stimula- of NLRP10-deficient mice. Surprisingly, these animals tion with LPS (Fig. 1A). Still, primary human peripheral display a migration defect of activated dendritic cells blood mononuclear cells (PBMCs) showed little expres- resulting in reduced adaptive immunity, whereas perito- sion of NLRP10 (Fig. 1A), as recently reported (Wang neal macrophages and bone marrow-derived dendritic et al., 2004). NLRP10 was found to be expressed in cells derived from NLRP10-deficient animals show normal human colon (Wang et al., 2004; Lech et al., 2010), we inflammasome activation (Eisenbarth et al., 2012). This therefore also tested NLRP10 mRNA expression in suggests that NLRP10 contributes to multiple cellular various human colon cell lines. This revealed that HT-29, functions. However, our understanding of the underlying CaCo2 and SW480 cells showed expression of NLRP10, molecular mechanisms remains largely elusive. although we found that epithelial HeLa cells had a much Here we show that NLRP10 contributes to pro- higher basal expression of NLRP10 (Fig. 1A). In contrast, inflammatory innate immune responses towards the inva- human embryonic kidney cells (HEK293T) showed no sive human pathogen S. flexneri. This effect is dependent detectable basal expression of NLPR10 transcript on a functional ATPase domain and the PYD domain of (Fig. 1A). Of note, primary human dermal fibroblasts

Fig. 1. NLRP10 is a cytosolic protein predominantly expressed in human epidermis. A. Expression of NLRP10 mRNA in different human cell lines and primary human PBMCs, analysed by RT-PCR. Amplification of GAPDH served as control (lower panels). THP1 cells were incubated in 100 nM PMA for 24 h and exposed to LPS (100 ng ml-1) 4 h prior to the isolation of RNA where indicated. B. Expression of NLRP10 mRNA in human dermis and epidermis samples, tested by RT-PCR. N: negative control; P: plasmid positive control. Results are representative of three donors. C. Characterization of NLRP10-specific monoclonal antibody 4B4 in lysates from HEK293T transfected with NLRP10 or empty plasmid. Detection with a FLAG-specific antibody served as control. D. Immunohistochemical staining of healthy human skin tissue. Endogenous NLRP10 was detected with anti-NLRP10 4B4 (left panel). Control staining was conducted with a matched isotope (right panel). The result is representative of two donors. E. Indirect immunofluorescence micrographs of HeLa (left panel) and primary human dermal fibroblasts (right panel). Ectopically expressed FLAG-NLRP10 was detected by an anti-FLAG antibody (green), merge with staining for DNA (blue) is shown (left panel). Endogenous NLRP10 was detected with the 8H2 antibody (red) in primary human dermal fibroblasts. Merge with staining for DNA (blue) and actin (green) is shown. Data are representative for two donors. F. Immunoblot analysis of the primary epidermal fibroblasts treated for 72 h with an NLRP10-specific siRNA or a non-targeting control siRNA. Detection of endogenous NLRP10 in the same cells and with the same antibody used in (E) is shown. Probing for a-tubulin served as control for equal loading. Scale bars, 10 mm.

GAPDH GAPDH

HEKHeLa Fib N P NLRP10 GAPDH B C NP HEK293T FLAG-NLRP10 - + - + dermis epidermis NLRP10 130 95 GAPDH 72 55 43 D anti-NLRP10 (4B4) control IgG 34 kDa

antibody FLAG 4B4

E HeLa primary fibroblasts F siRNA ctrl NLRP10 kDa 130 95 72 NLRP10 NLRP10 (8H2) FLAG-NLRP10 (8H2) 55

34 merge merge

α-tubulin

expressed high levels of NLRP10 similar to HeLa cells antibodies specific for NLRP10. The antibody 4B4 reacted (Fig. 1A, lower panel). Given the high expression of strongly and specifically with ectopically expressed NLRP10 in dermal fibroblast we next analysed mRNA NLRP10 in HEK293T cells (Fig. 1C). Staining of histologi- derived from the dermis and epidermis of human donors. cal sections of healthy human skin with this antibody In all examined samples, we found higher levels of revealed a pronounced reactivity of this antibody in the NLRP10 transcripts in the epidermis compared with the cytoplasm of basal and suprabasal epidermal cell layers dermis (Fig. 1B). In order to analyse the expression of whereas fibroblastic cells in the dermis displayed less but NLRP10 at the protein level, we generated monoclonal detectable reactivity (Fig. 1D, left panel). No staining was

© 2012 Blackwell Publishing Ltd, Cellular Microbiology 4 K. Lautz et al. obtained with a matched IgG control (Fig. 1D, right panel). by transient expression of a siRNA-resistant GFP- In accordance with the literature (Lech et al., 2010), we tagged version of NLRP10 (GFP-NLPR10*) was able to could also detect NLRP10 in human adult liver in immu- re-establish the IL-8 release in response to S. flexneri nohistochemistry (data not shown). infection to similar levels as obtained from cells treated Next, we analysed the subcellular localization of with a non-targeting control siRNA (Fig. 2B), proofing spe- NLRP10. Ectopically expressed FLAG-NLRP10 showed a cificity of the knock-down. In subsequent detailed kinetics, clear cytoplasmic localization in HeLa cells (Fig. 1E, left a strong reduction of Shigella-mediated IL-6 and IL-8 panel). To substantiate these results, the subcellular release was observed 4 h and 6 h after infection (Fig. 2C). localization of endogenous NLRP10 was analysed in Knock-down efficiency was monitored by immunoblot primary human dermal fibroblasts. Staining of fixed cells (Fig. 2D) and by qPCR (Fig. 2E). Of note, this showed with the NLRP10-specific monoclonal antibody 8H2 that infection with S. flexneri led to an induction of (Fig. S1A), which showed the best reactivity in immun- NLRP10 mRNA to over 10-fold; however, NLRP10 protein ofluorescence, confirmed a cytoplasmic staining pattern levels seemed to be rather constant within 6 h post infec- for endogenous NLRP10 (Fig. 1E, right panel). In immu- tion (Fig. 2D and E). Next, to investigate the effect of noblot analysis of lysates of primary human dermal NLRP10 depletion on S. flexneri mediated immune fibroblasts 8H2 only reacted with one band of the responses in greater detail, we analysed activation of p38 expected size of NLRP10 (~ 72 kDa), which disappeared MAPK and p65 NF-kB. S. flexneri activates as both of after transfection of NLRP10-specific siRNA (Fig. 1F), these pathways and these cumulate in the release of IL-8 confirming the specificity of this antibody. and IL-6 in epithelial cells (Schroeder and Hilbi, 2008). In Taken together, our results show that NLRP10 is a line with the reduced cytokine release, we found dimin- cytoplasmic protein that is highly expressed in human ished Shigella-induced activation of p38 (T180/Y182 epidermis and identified HeLa cells as a suitable model phosphorylation) in cells with reduced NLRP10 levels, in system to study endogenous NLRP10. particular at early time points after infection compared with cells treated with non-targeting siRNA (Fig. 3A). Fur- thermore, ELISA-based DNA binding assays showed that NLRP10 contributes to innate immune responses the activity of the NF-kB factor p65 was significantly towards S. flexneri infection reduced upon infection after NLRP10 knock-down 4–6 h Recent findings revealed a role for NLRP10 in innate post infection, compared with siCTRL-treated cells immune pathways (Wang et al., 2004; Imamura et al., (Fig. 3B). 2010). We thus asked if NLRP10 might also be involved NLRP10 was recently suggested to dampen in innate immune responses triggered by S. flexneri, a inflammasome-dependent release of IL-1b (Wang et al., widely used model for invasive bacterial infection that 2004; Imamura et al., 2010). Accordingly, we monitored mediates the release of the pro-inflammatory cytokines IL-1b levels in the supernatants of infected HeLa cells IL-6 and IL-8 from epithelial cells, such as HeLa, upon and fibroblasts. However, both cell types did not produce invasion (Philpott et al., 2000; Pedron et al., 2003). IL-1b upon S. flexneri infection, nor did NLRP10 siRNA We first measured the Shigella-induced release of alone induce a detectable basal IL-1b secretion (data not pro-inflammatory cytokines in HeLa cells where NLRP10 shown). In HeLa cells, Shigella induced the secretion of was targeted by siRNA. Cells treated with a non-targeting IL-18, another cytokine activated by the inflammasome. siRNA (siCTRL) showed a strong release of IL-8 upon Quantification of IL-18 secretion by ELISA showed that infection with invasive S. flexneri M90T, whereas reduc- NLRP10 depletion did not enhance IL-18 release 6 h after tion of NLRP10 protein expression by two independent infection but rather reduce IL-18 secretion, whereas IL-18 siRNA duplexes significantly reduced IL-8 and IL-6 mRNA levels were not affected by Shigella infection release 6 h post infection (Fig. 2A, Fig. S2C). This effect or NLRP10 knock-down (Fig. 3C). This shows that in was not a consequence of reduced bacterial invasion this setting NLRP10 does not act as an inhibitor of the and/or propagation in the host cells (Fig. S2A) or host inflammasome. cell viability (Fig. S2B). Immunoblot arrays indicated that Shigella physiologically invades intestinal epithelial NLRP10 also affected the release of other cytokines, cells, we therefore analysed the effect of NLRP10 knock- most prominently G-CSF, CD40L and IFN-g (Fig. S2E). down in the colon-line HT-29. Reduction of NLRP10 by Of note, in the same experiments there was virtually the two different siRNA duplexes led to a robust reduction no effect of NLRP10 depletion on the TNF-triggered of the IL-8 secretion measured 6 h post infection IL-8 release (Fig. S2D). The siRNA duplex NLRP10B (Fig. 3D). Given the lower NLRP10 expression in these performed best in all of these experiments and was cells, the overall impact of NLRP10 depletion was therefore chosen for subsequent more detailed analysis. however less pronounced as in HeLa cells (Fig. 3D). Complementation of NLRP10B-induced knock-down Finally, to substantiate these results we analysed the

–1 ** –1 600 300 *** *** 400 IL-8 [pg ml IL-8 [pg ml 150 200

0 0 siCTRL A B siCTRLBB siCTRL siNLRP10 GFP GFP-NLRP10* C 1200 siNLRP10B 2000 1000 siCTRL siNLRP10B siCTRL 1600 ] 800 –1 ] –1 1200 600

800 IL-8 [pg ml 400 IL-6 [pg ml 400 200

0 0 0 2 4 6 0 2 4 6 [h.p.i.] [h.p.i.]

D E 12 siCTRL siNLRP10B 10 0 2 4 6 0 2 4 6 [h.p.i.] NLRP10 8 siNLRP10B GAPDH 6 siCTRL 4

NLRP10 expression [fold] 2

2 4 6 [h.p.i.]

Fig. 2. NLRP10 is involved in mounting IL-6 and IL-8 responses towards Shigella flexneri infection. A. HeLa cells were treated with two NLRP10-specific siRNAs (siNLRP10A and siNLRP10B) or a non-targeting control (siCTRL) for 72 h and subsequently infected with invasive S. flexneri M90T. Six hours after infection with S. flexneri supernatants were collected and the level of secreted IL-8 was determined by ELISA. Knock-down efficiency of NLRP10 is shown by immunoblot analysis of lysates from the same cells (inlay) (mean + SD n = 3 is shown). B. HeLa cells were treated with the NLRP10-specific siRNA siNLRP10B or a non-targeting control (siCTRL) for 48 h and subsequently transfected with GFP-NLRP10* or GFP-expressing plasmids 24 h prior to infection. Six hours after infection with S. flexneri M90T supernatants were collected and the level of secreted IL-8 was determined by ELISA. Expression of GFP and NLRP10*-GFP is shown by anti-GFP immunoblot (inlay). C. Cytokine release kinetics. HeLa cells were treated with NLRP10B siRNA (open bars) or a non-targeting control (siCTRL, filled bars) for 72 h. Cells were spitted and individual cultures were infected for the indicated time with S. flexneri M90T and IL-6 (left panel) and IL-8 (right panel) were measured by ELISA in the culture supernatant. (Mean + SD from triplicate measurements of one representative experiment is shown. Results were reproduced in three independent experiments.) D. Immunoblot analysis of the cells from (C) with the 8B3 anti-NLRP10 antibody. E. qPCR analysis showing relative expression of NLRP10 normalized to GAPDH expression. NLRP10 expression in siCTRL cells at 0 h was set to 1 (mean + SD, n = 3). h.p.i., hours post infection.

© 2012 Blackwell Publishing Ltd, Cellular Microbiology 6 K. Lautz et al. function of NLRP10 in primary human dermal fibroblasts the release of these cytokines (data not shown). In con- since these cells express high basal levels of endogenous trast, knock-down of NLRP10 had a quantitative lower NLRP10 (Fig. 1A and F). siRNA-mediated reduction of effect on TNF-induced pro-inflammatory responses NLRP10 led to significantly reduced IL-8 and IL-6 release (Fig. 3E). Of note, qualitatively similar results were upon infection with S. flexneri (Fig. 3E), whereas a non- obtained in primary cells derived from a second donor invasive isogenic S. flexneri strain (BS176) did not induce (data not shown).

A S. flexneri [h.p.i.] B siNLRP10B 0.5 siCTRL 0 1 2 3 6 * p-p38 0.4 siCTRL * p38 0.3

p-p38 0.2 siNLRP10B 0.1 p38 p65 DNA binding [A.U.] 0 C 0 2 4 6 120 [h.p.i.] siNLRP10B siCTRL

] 100 2 –1

siRNA CTRL NLRP10B 80 NLRP10

GAPDH 1 RT-PCR

IL-18 [pg mlIL-18 [pg 40

0 mRNA [fold] IL-18 0 S.flexneri [6 h] siRNACTRL CTRL 10B 10B D S.flexneri 0 h 6 h 0 h 6 h BS176 1.800 M90T

] 1.400 siRNA CTRL NLRP10A NLRP10B –1

NLRP10 1.000

GAPDH

IL-8 [pg ml [pg IL-8 600 HT29 200

siCTRL siNLRP10A siNLRP10B E S.flexneri [6 h] 18 siRNA CTRL NLRP10B 1.4 NLRP10

1.2 GAPDH 14 ] n.s. ] ***

–1 1 –1 10 0.8 pg ml 0.6 6 IL-8 [ IL-8

*** ml[ng IL-6 0.4 ***

2 0.2

- TNF S.flexneri - TNF S.flexneri

Taken together, these data show that NLRP10 posi- in enhancing IL-8 release (Fig. 4B), suggesting that the tively contributes to NF-kB (p65) and p38 activation PYD domain is necessary for this function of NLRP10. upon bacterial infection to enhance secretion of the pro- Taken together, these results show that overexpressed inﬂammatory cytokines IL-6 and IL-8 in different human NLRP10 can functionally complement missing endog- cell types. enous NLRP10 in HEK293T cells and that both an intact ATPase domain and the presence of the PYD domain are necessary for the function of NLRP10 in bacterial ATPase function and the PYD domain of NLRP10 are infection. needed for enhancing IL-8 responses

For other NLR proteins it has been shown that the induc- NLRP10 colocalizes with NOD1 at the site of tion of inflammatory responses towards pathogens bacterial infection depends on a functional ATPase domain. To investigate the role of the ATPase domain of NLRP10 in bacterial To study the function of NLRP10 in Shigella-induced infection, we complemented the lacking endogenous immune responses at the cellular level, we monitored the expression of NLRP10 in HEK293T cells (Fig. 1A) by tran- subcellular distribution of NLRP10 within epithelial HeLa sient exogenous expression of NLRP10 and different cells upon S. flexneri infection. This revealed that MYC- NLRP10 mutants harbouring point mutations in functional NLRP10 was localized at the actin enriched S. flexneri positions of the ATPase domain. To this end, we intro- entry foci (Fig. 5A). Indeed, live-cell imaging confirmed duced a mutation either in the Walker A box (P-loop) a dynamic recruitment of GFP-tagged NLRP10 to (K179A) or in the extended Walker B box (D252A), a S. flexneri entry foci (Fig. S3A), whereas this was not NLR-specific extension of the canonical Walker B motif in observed for GFP alone (data not shown). These obser- NLRP10 (Proell et al., 2008). We assume that these two vations are highly reminiscent of the reported subcellular mutants have strongly impaired ATPase activity, as this is localization of NOD1 and NOD2. These proteins are the case for the corresponding mutations in NOD1 and enriched at the plasma membrane and also recruited to NOD2 (Zurek et al., 2012). Infection of all transfected the site of bacterial entry (Barnich et al., 2005; McDonald HEK293T cells with the invasive S. flexneri strain M90T et al., 2005; Kufer et al., 2006; 2008; Travassos et al., induced IL-8 secretion that was not observed with non- 2010). Immunofluorescence analysis of HeLa cells coex- invasive S. flexneri strain BS176 (Fig. 4A). Furthermore, pressing YFP-NOD1 and MYC-NLRP10 revealed a colo- expression of NLRP10 wild-type protein but not of the calization of both proteins at bacterial entry foci (Fig. 5B). Walker A (K179A) or extended Walker B (D252A) mutants Furthermore, NLRP10 physically interacted with ectopi- significantly enhanced the IL-8 response towards invasive cally expressed NOD1 in HEK293T cells (Fig. 5C). This S. flexneri. In contrast, expression of these proteins did interaction was dependent on a functional ATPase domain not affect basal IL-8 secretion in cells treated with non- of NOD1 as the non-functional Walker A mutant (K208A) invasive bacteria (Fig. 4A). Equal expression of the used and a less functional extended Walker B motif mutant constructs was assured by immunoblot analysis (Fig. 4A, (D278A) of NOD1 (Zurek et al., 2012) both showed right panel). Most interestingly, deletion of the PYD reduced binding affinity for NLRP10 (Fig. 5C, left panel). domain of NLRP10 also impaired the function of NLRP10 In contrast, deletion of the LRR domain of NOD1, which is

Fig. 3. NLRP10 knock-down phenotype in HeLa and primary cells. A. Immunoblot analysis of lysates from HeLa cells treated with the NLRP10-specific siRNA siNLRP10B or a non-targeting control (siCTRL) for 72 h prior to infection with S. flexneri M90T for the indicated time. Probing for activated (Thr180/Tyr182 phosphorylated) p38 (upper panels) and total p38 (lower panels) is shown. Data are representative of two independent experiments. B. Activation of p65 was analysed by an ELISA-based DNA binding assay in HeLa cells nuclear lysates after infection (mean + SD from triplicate measurements of two independent experiments is shown). C. HeLa cells were treated with NLRP10B siRNA (open bars) or a non-targeting control (siCTRL, filled bars) for 72 h. IL-18 were measured by ELISA in the culture supernatant 6 h post infection. (SD from duplicates of one representative experiment is shown. Results were reproduced in three independent experiments.) Knock-down efficiency is shown by RT-PCR (right panel). D. S. flexneri (M90T) induced IL-8 secretion measured 6 h post infection in the supernatant of HT-29 cells treated with the NLRP10-specific or a non-targeting siRNA for 72 h prior infection. The non-invasive S. flexneri strain BS176 served as control. Knock-down efficiency is shown by immunoblotting for NLRP10 (8B3) with probing for GAPDH as loading control (right panel). (SD from duplicates of one representative experiment out of two is shown.) E. S. flexneri- and TNF-induced IL-6 (left panel) and IL-8 (right panel) secretion measured 6 h post infection in primary human dermal fibroblasts treated for 72 h with the NLRP10-specific siRNA siNLRP10B (open bars) or a non-targeting duplex (siCTRL, filled bars). (Mean + SD from triplicate measurements of one representative experiment is shown. Results were reproduced in two independent experiments with cells from two donors.) Efficiency of the NLRP10 knock-down is shown by immunoblot analysis in the inlay. h.p.i., hours post infection.

900 ] –1

600

FLAG-NLRP10 IL-8 [pg ml [pg IL-8

300 pCDNAWT K179A D252A NLRP10

GAPDH 0

pcDNA

NLRP10 WT B NLRP10 K179A NLRP10 D252A 800 **

600 ] –1

400 pg ml IL-8 [ 200

ΔPYD pcDNA

NLRP10 WT NLRP10

Fig. 4. NLRP10-mediated signalling is dependent on ATPase activity and the PYD domain. A. HEK293T cells were transiently transfected with the indicated plasmids for 24 h. Subsequently, the cells were infected with S. ﬂexneri M90T or non-invasive BS176 and secreted IL-8 was detected in the supernatant by ELISA after 6 h. B. Same assay as in (A) including the NLRP10DPYD construct. (Mean + SD from triplicate measurements of one representative experiment is shown. Results were reproduced in two independent experiments.) known to increase autoactivation of NOD1 (Tanabe et al., in HeLa cells (Kufer et al., 2006). This would suggest that 2004), enhanced binding affinity for NLRP10 (Fig. 5C, left NLRP10 might also interact with NOD2. Indeed we panel). Mapping the interaction domain in NLRP10 observed such an interaction, suggesting that both NOD1 revealed that the PYD domain and a functional Walker A and NOD2 are regulated by NLRP10 (data not shown). motif in NLRP10 contributed to high-affinity binding of Here, we concentrate on NOD1, as this NLR contributes NOD1 (Fig. 5C, right panel). This suggests that NLRP10 the most to Shigella-mediated NF-kB activation. Overex- and NOD1 likely interact via their NACHT domains and pression of functional NOD1 leads to autoactivation and that the PYD domain of NLRP10 and ATPase activity of its recruitment to the plasma membrane (Kufer et al., both proteins contribute to the interaction. We recently 2008; Zurek et al., 2012). As NOD1 and NLRP10 colocal- showed that also NOD2 contributes to sensing of Shigella ize at the plasma membrane we analysed if NOD1

© 2012 Blackwell Publishing Ltd, Cellular Microbiology NLRP10 in bacterial infection 9 can recruit NLRP10 to the membrane. To this end, ducted pull-down assays using recombinantly expressed we conducted subcellular fractionation experiments in NLRP10 purified from Escherichia coli in lysates from HEK293T cells. These experiments revealed that a small HeLa cells. Purified NLRP10 co-precipitated endogenous part of the ectopically expressed NLRP10 was associated TAK1 and RIP2, whereas no enrichment of actin or with detergent-resistant membrane. Coexpression of GAPDH was detected in the precipitations (Fig. 6D). NOD1 increased the amount of NLRP10 detected in the In conclusion, these findings suggest that NLRP10 membrane fraction (Fig. 5D). In contrast, expression of forms functional complexes with NOD1, RIP2, TAK1 and the NOD1 Walker A mutant (K208A) that is not recruited to NEMO. As all these components act in proximity to the membrane (Kufer et al., 2008; Zurek et al., 2012) mediate NOD1-induced NF-kB activation, a plausible diminished the association of NLRP10 with the membrane explanation of how NLRP10 controls inflammatory fraction (Fig. 5D). Densitometric evaluation of four inde- responses is that NLRP10 acts as a scaffold to recruit pendently conducted experiments confirmed these results and/or to stabilize the active NOD1–Nodosome complex. and revealed a statistical significance of these changes (Fig. 5D). This strongly suggests that NOD1 recruits Discussion NLRP10 to the plasma membrane. NOD1 is pivotally involved in the recognition of intrac- Our knowledge of the molecular functions of most human ellular S. flexneri in epithelial cells (Girardin et al., 2001). NLR proteins is still fragmentary. NLRP10 has been Accordingly, siRNA-mediated knock-down of NOD1 shown to negatively influence inflammasome-mediated strongly reduced the S. flexneri-mediated IL-8 response immune responses by acting on ASC-mediated NF-kB in HeLa cells (Fig. S3B). Depletion of NLRP10 dampened and caspase-1 activation (Wang et al., 2004; Imamura the IL-8 response to a lesser extent as did NOD1 deple- et al., 2010). However, most of these conclusions are tion. Of note, depletion of both NOD1 and NLRP10 based on studies using overexpression of NLRP10 in cell resulted in a comparable effect as knock-down of NOD1 lines or NLRP10-overexpressing transgenic mice. Using alone (Fig. S3B). These data further support that NLRP10 this mouse model, no obvious differences in the release of acts in synergy with NOD1 and suggest that NOD1 is the pro-inflammatory cytokine IL-6 towards Salmonella likely epistatic to NLRP10. Interestingly, comparison of the infection were observed (Imamura et al., 2010). This is in evolutionary relations of the human NLRs by alignment line with our observation that overexpression of NLRP10 of their full-length protein sequences revealed a close also failed to enhance pro-inflammatory cytokine homology of NLRP10 and NOD1 (Fig. S4). responses towards S. flexneri over the level obtained with In summary, our data provide evidence that NLRP10 intact expression of endogenous NLRP10 (Fig. 2B). To functionally collaborates with NOD1 in the same subcel- assess the function of endogenous NLRP10 we therefore lular compartment to enhance cell-autonomous immune used siRNA-mediated knock-down. This revealed a novel responses to S. flexneri. role for NLRP10 in cell-autonomous immunity by enhancing pro-inflammatory cytokine release of epithelial cells in response to invasive S. flexneri. Our data show that NLRP10 interacts with components of the NOD1 NLRP10 acts by augmenting the activation of NF-kB and signalling pathway MAPK pathways after bacterial infection. In contrast to the In order to decipher how NLRP10 exerts its effect on significant effects on innate immune responses induced NOD1 signalling, we tested if NLRP10 physically interacts by bacteria, NLRP10 knock-down influenced pro- with components of the NOD1 signalling cascade. The inflammatory responses induced by TNF (TNFR) stimula- most proximal factor that links NOD1 to NF-kB and MAPK tion in HeLa cells and primary cells to a far lesser extent, activation is the kinase RIP2. Co-immunoprecipitation suggesting that the effect of NLRP10 is specific to bacte- experiments showed that RIP2 interacted with NLRP10 rial activation of pro-inflammatory pathways. It is well when these proteins were ectopically coexpressed in established that invasive Shigella are mainly sensed by HEK293T cells (Fig. 6A). RIP2 mediates triggering of the the NLR protein NOD1, and to a lesser extent by NOD2, IKK complex by activation of TAK1 and interaction with the in epithelial cells, which detects peptidoglycan released regulatory component of the IKK complex (NEMO) (Kufer, from the cytosolic bacteria (Girardin et al., 2001; Nigro 2008). Co-immunoprecipitation experiments revealed a et al., 2008). Active NOD1 thereby is present at the physical interaction also for NLRP10 and NEMO plasma membrane and recruited to the point of bacterial (Fig. 6B). Moreover, NLRP10 also interacted with TAK1 invasion at the plasma membrane (Kufer et al., 2008; (Fig. 6C). Of note, NLRP10 had a much higher affinity for Zurek et al., 2012). Interestingly, we found that also both NEMO and TAK1, compared with the NLRPs NLRP10 was recruited to Shigella entry foci and colocal- NLRP1, NLRP2 and NLRP12 (Fig. 6B and C). In order ized at these structures with NOD1. Furthermore, a sig- to substantiate these findings, we additionally con- nalling inactive mutant of NOD1 (K208A) which is not

© 2012 Blackwell Publishing Ltd, Cellular Microbiology 10 K. Lautz et al. recruited to the membrane (Kufer et al., 2008) failed to Investigating the possibility of NLRP10 to interact with interact with NLRP10. Of note, using subcellular fractiona- the key components of the NOD1 signalling pathway we tion, we show that NOD1-WT recruited NLRP10 to the found that NLRP10 forms complexes with NEMO, RIP2 plasma membrane whereas NOD1 K208R failed to target and TAK1. Binding of these components to NLRP10 sup- NLRP10 to the plasma membrane. This strongly suggests ports a role for NLRP10 in amplifying signalling mediated that activated NOD1 also recruits NLRP10 to the site of by NOD1, presumably by assuring proximity of the Nodo- bacterial invasion. some (NOD1/RIP2) and the IKK and TAK1 complexes.

A NLRP10 actin LPS merge

B NLRP10 NOD1 actin merge

FLAG-NOD1 C MYC-NLRP10 PYD control WT K208AD287AΔLRR control WT Δ K179A NLRP10 INPUT NOD1

NLRP10 NOD1

IP NOD1

NLRP10 ΔPYD NOD1ΔLRR

NLRP10 NLRP10 D * NLRP10 NOD1 NOD1K208A 2.0

C MC M C M 1.6 MYC-NLRP10 1.2

FLAG-Nod1 0.8 ratio M:C GAPDH 0.4

0.0 Flot-2 NLRP10 NLRP10 NLRP10 NOD1 NOD1K208A

The notion that NLRP10 acts at the level of NOD1 is separate these multiple and on first sight controversial further supported by our observation that NLRP10 deple- functions of NLRP10 in innate immunity. A distinct function tion had minor effects on TNF-mediated pro-inflammatory of NLRP10 in different cell types (i.e. inflammasome regu- responses, compared with those mediated by bacteria. lation in macrophages versus mediating inflammatory These findings suggest that NLRP10 acts as a scaffold for responses in epithelial cells) seems likely. Physical inter- the assembly of the NOD1 signalling complex, likely action with NLRP10 might also be indirectly regulated by involving interaction of NOD1 and NLRP10 via their additional cell-specific proteins. NLRP10, for example, NACHT domains. Of note, CIITA, another NLR member has been reported to bind overexpressed ASC and also acts as a scaffold for the recruitment of transcrip- caspase-1 in human epithelial cells (Wang et al., 2004; tional activators in the nucleus at MHC class II gene Imamura et al., 2010); however, no evidence for a strong promoters without having an apparent function as PRR direct interaction between the pyrin domain of NLRP10 (Reith and Mach, 2001). This implies that some NLRs act and ASC or caspase-1 was obtained in a yeast two- as PRRs whereas others might predominantly serve as hybrid-based interaction screen (Wagner et al., 2009). platforms for signal transduction. The observation of func- Moreover, DCs and BMDMs derived from NLRP10 knock- tional interactions of certain plant NLR-related immune out mice display no altered inflammasome function receptors of the NB-LRR family further supports this (Eisenbarth et al., 2012). Thus it appears plausible that hypothesis (Eitas and Dangl, 2010). In mammals the NLR NLRP10 might also function independent of ASC. Our protein NLRC4 functions together with NAIP protein in observation that overexpression of NLRP10 enhances the sensing of bacterial flagellin and components of the bac- Shigella-mediated IL-8 response in HEK293T cells, which terial type III secretion apparatus (Kofoed and Vance, are known to lack the inflammasome components, further 2011; Zhao et al., 2011). Moreover, NLRP1 and NLRP3 at supports this notion. Moreover, it has been shown that the least functionally cooperate with NOD2 to trigger IL-1b PYD containing NLR NLRP1 can trigger cell death by an release upon stimulation of macrophages with MDP (Pan ASC-independent mechanism (Broz et al., 2010) and that et al., 2007; Hsu et al., 2008). NLRP3 also has ASC-independent functions (Shigeoka Considering the evolutionary development of the et al., 2010). These findings suggest a role for PYD human NLR family, NLRP10 is most closely related to containing NLRs in both ASC-dependent and ASC- NOD1 and NLRP6 (Fig. S4). NLRP6 is expressed in epi- independent pathways. Of note, in HeLa cells, Shigella- thelial cells and immune cells and was recently shown to induced IL-18 secretion was not increased in cells in be critically involved in the regulation of immune homeos- which NLRP10 was depleted, but even slightly reduced tasis in the intestine in mice (Grenier et al., 2002; Chen (Fig. 3C). As IL-18 mRNA levels were not affected, this et al., 2011a; Elinav et al., 2011; Normand et al., 2011). suggests that NLRP10 might act on the NF-kB mediated The potential involvement of NLRP10 in NLRP6-mediated induction of caspase-1 or of other components involved in signalling will be the focus of further studies. IL-18 processing. Alternatively, NLRP10 could have addi- It has been reported that NLRP10 negatively affects tional functions in IL-18 processing and secretion. Future caspase-1 activation and ASC-mediated NF-kB activation studies will help to clarify this issue. (Wang et al., 2004; Imamura et al., 2010). However, the In line with previous reports, our work identified in study presented here revealed an inflammasome- human skin high basal expression of NLRP10 (Wang independent function of NLRP10 in innate immune et al., 2004; Imamura et al., 2010) in epidermal keratino- responses. Further research is needed to address and cytes and in dermal fibroblast-like cells. In vitro,we

Fig. 5. NLRP10 cooperates with NOD1 at S. flexneri entry foci. A. Indirect immunofluorescence micrographs of HeLa cells transiently transfected with MYC-NLRP10. The cells were infected with S. flexneri M90T for 30 min before fixation. Signal for NLRP10 (red), actin (green) and S. flexneri LPS 5a (blue) as well as a merge of these channels is shown. B. Indirect immunofluorescence micrographs of HeLa cells transiently transfected with MYC-NLRP10 and YFP-NOD1. Signals for NLRP10 (red) NOD1 (green) and actin as well as a merge of the NLRP10 and NOD1 signal together with the signal for S. flexneri LPS 5a (blue) is shown. C. Domain mapping. Co-immunoprecipitation of HEK293T cells in which MYC-NLRP10 was coexpressed with the indicated FLAG-NOD1 constructs (left panel) or FLAG-NOD1 together with the indicated MYC-NLRP10 constructing (right panel) respectively. Lysates were precipitated with anti-FLAG antibody (left panel) or anti-MYC antibody (right panel). MYC-NLRP10 and FLAG-NOD1 constructs were detected in the lysates (INPUT) and immunoprecipitates (IP). D. Cytosolic (C) and membrane (M) fractions of HEK293T cells expressing MYC-NLRP10 alone or together with FLAG-NOD1WT or FLAG-NOD1K208A respectively. Proteins were separated by SDS-PAGE and subjected to immunoblot analysis using anti-FLAG or anti-MYC antibodies. Probing for GAPDH and flotillin-2 served as markers for the fractions. Right panel: Densiometric quantification of immunoblot signals (mean + SD of four independent experiments is shown). Scale bars, 10 mm.

NLRP B ctrl 1 4 10 12 A ctrl NLRP10 INPUT GFP-NEMO INPUT * RIP2

* GFP-NEMO RIP2 IP IP NLRP1, 12 NLRP10 NLRP4

NLRP10

CDNLRP ctrl 1 2 10 12 input NLRP10support kDa 130 INPUT TAK1 100 70 * TAK1 55

NLRP1 30

NLRP2 25 IP NLRP12 TAK1 NLRP10 RIP2

GAPDH

actin

Fig. 6. NLRP10 physically interacts with components of the NOD1 signalling pathway. A. Co-immunoprecipitation of FLAG-NLRP10 coexpressed with Vsv-RIP2 in HEK293T cells. Lysates were precipitated with anti-FLAG antibody. *: unspecific band. B. Co-immunoprecipitation of GFP-NEMO coexpressed with MYC-tagged NLRP1, NLRP4, NLRP10 or NLRP12 in HEK293T cells. GFP-NEMO and MYC-NLRPs were detected in the lysates (INPUT) and immunoprecipitates (IP) with the corresponding epitope tag-specific antibodies. C. Co-immunoprecipitation of MYC-tagged NLRP1, NLRP2, NLRP10 or NLRP12 coexpressed with FLAG-TAK1 in HEK293T cells. Lysates were precipitated with anti-myc antibody and MYC-NLRPs and FLAG-TAK1 were detected in the lysates (INPUT) and immunoprecipitates (IP). D. Pull-down assay, using recombinant expressed NLRP10 produced in E. coli bound to nickel sepharose. NLRP10 protein or the support alone was incubated in lysates from HeLa cells and stringently washed. CBB-stained gel showing the lysate and the precipitations is shown in the upper panel. Co-precipitated proteins were detected by immunoblot using the indicated antibodies (lower panels). Probing for GAPDH and actin served as control for unspecific binding. Asterisk indicates the recombinant NLRP10 protein.

provide a biological function for this by showing that in Experimental procedures primary human dermal fibroblast NLRP10 plays a role in Plasmids and reagents augmenting pro-inflammatory responses towards bacterial infection. Understanding the detailed function of NLRP10 in the skin will broaden our knowledge of inflam- Human NLRP10 (GI:28436373) was cloned by PCR into pCMV- matory skin disorders and skin infection and finally might Tag2B using BamHI and XhoI. A deletion mutant of NLRP10 lacking the PYD domain (aa 1–97) was created accordingly. Point help to develop new therapeutic strategies, especially as mutations in the Walker A and B motifs were introduced by the the first NLR-specific chemical inhibitors are emerging quick site mutagenesis protocol. MYC-NLRP10 was generated (Lamkanfi et al., 2009; Bielig et al., 2010; Correa et al., by subcloning of NLRP10 into a pcDNA3.1 vector encoding an 2011; Khan et al., 2011). amino-terminal 3¥-myc epitope. For siRNA complementation

© 2012 Blackwell Publishing Ltd, Cellular Microbiology NLRP10 in bacterial infection 13 experiments a siRNA-resistant mutant of NLRP10 (NLRP10*) For quantitative PCR analyses, 50 ng of cDNA was analysed in was generated by site directed mutagenesis PCR (using the a total volume of 25 ml using the iQ SYBR Green Supermix oligonucleotide CCATGGACAGAAGGAAGGGAAAGATAATATA (Bio-Rad), as described in the manufacturer’s protocol. GCA together with a reverse-complement sequence) into a modi- The following primer pairs were used (5′–3′): NLRP10fw: ﬁed pCMV-Tag2B vector, harbouring an amino-terminal GFP tag. GGAGGCTGTGAAAGTTGTCC; NLRP10rev: GCAAGTGAT Plasmids encoding NOD1 are described in Kufer et al. (2008). TCTGGGCTCTC; GAPDHfw: GGTATCGTGGAAGGACTCAT GFP-NEMO was a kind gift from Robert Weil (Institute Pasteur, GAC; GAPDHrev: ATGCCAGTGAGCTTCCCGTTCAG; IL18fw: Paris). Vsv-RIP2 was a kind gift from Margot Thome (University CCAAGGAAATCGGCCTCTAT; IL18rev: GCCATACCTCTAG of Lausanne, Switzerland). FLAG-TAK1 was a gift from Tatsushi GCTGGCT (Chen et al., 2011b). Muta (Kyushu University, Japan). All plasmids were veriﬁed by DNA sequencing. siRNA knock-down

Gene silencing was performed by transfection of 10 nM siRNA Cells and cell culture duplexes (Qiagen) using HiPerfect (Qiagen) according to the manufacturer’s instructions for 72 h. HEK293T, HeLa, HT-29 CaCo2 and SW480 cells were grown siRNA sequences used: NLRP10_2 (siNLRP10 A): CAGCTC at 37°C with 5% CO in Dulbecco’s Modified Medium (DMEM) 2 CTATTTCACGGATGA; NALP10_1 (siNLRP10 B): AAGGAG (Biochrom AG) containing 10% heat-inactivated FCS (fetal GGCAAAGATAATATA; Hs_CARD4_4 (siNOD1): CACCCTGAGT calf serum) (BioWest) and 100 U ml-1 penicillin-streptomycin CTTGCGTCCAA and AllStars negative control (siCtrl) (Qiagen). (Biochrom AG). THP1 cells were grown RPMI-1640 medium (Biochrom AG) containing 10% heat-inactivated FCS (fetal calf serum) (BioWest) and 100 U ml-1 penicillin-streptomycin Indirect immunofluorescence (Biochrom AG). Primary human dermal fibroblasts were obtained by outgrowth from skin explants and cultured as previously Indirect immunofluorescence microscopy was performed as described (Zigrino et al., 2001). Cells were continuously tested described (Neerincx et al., 2012). Primary antibodies used: for absence of mycoplasma contamination by PCR. Primary mouse anti-MYC 9E10 (Sigma), mouse anti-FLAG M2 (Sigma), human PBMCs were purified from peripheral blood of healthy rat anti-NLRP10 8H2 (this study) and rabbit anti-S. flexneri 5a donors [kindly provided by Hinrich Abken (University of LPS (kind gift from A. Phalipon, Institut Pasteur). Secondary Cologne)]. antibodies used: Alexa 488-conjugated goat anti-mouse IgG (1:500, Molecular Probes), Alexa Fluor 546 goat anti-mouse IgG (1:1000, Molecular Probes), Alexa Fluor 405 goat anti-rabbit Generation of monoclonal antibodies IgG (1:500, Molecular Probes). Actin was stained with Phalloidin- FITC (1:200, Sigma) and DNA with DAPI (1 mgml-1, Molecular The PYD-domain of NLRP10 was produced as recombinant Probes). Stained cells were mounted in Prolong-Gold (Invitro- protein in E. coli and purified to homogeneity. Rats were immu- gen). Images were acquired on an Olympus FV-1000 micro- nized with 50 mg of PYD protein using CpG 2006 and incomplete scope. For 4D live-time imaging GFP-tagged NLRP10 was Freund adjuvant. Anti-NLRP10 4B4, 8H2 and 8B3 all of the rat transfected in HeLa cells for 24 h and infected with S. flexneri. immunoglobulin G2a (IgG2a) subclass was used in this study. Micrographs were processed using ImageJ.

Immunohistochemistry Bacterial infection Four-micrometre sections of formalin fixed paraffin embedded Bacterial infection of cells was performed using the S. flexneri human skin tissue were mounted on silane-coated slides, dried, strain M90T afaE as described previously (Philpott et al., 2000). deparaffinized by routine technique in xylene and rehydrated in M90T afaE is a wild-type (WT) invasive strain of S. flexneri sero- ethanol at descending grades (100% to 50%). Sections were type 5a harbouring the plasmid pIL22, which encodes the afim- swilled in Tris(hydroxymethyl)-aminomethan buffer. Labelling brial adhesin from uropathogenic E. coli to allow better synchrony was detected semi-automatically by DAKO TechMate™ 500 Plus of infection (Clerc and Sansonetti, 1987). Briefly, bacteria were with the DAKO REAL™ Detection System using the principles of added to the cells, which were transferred to serum- and marked streptavidin–biotin system according to manufacturer’s antibiotic-free medium and incubated for 10 min at room tem- protocol (Dako REAL™ Biotinylated Secondary Antibodies: goat perature prior to transfer to 37°C (time zero). As control a non- anti-rat Dako REAL™ Streptavidin Peroxidase; Dako REAL™ invasive derivative (BS176 afaE) cured of the 220 kB virulence AEC/H2O2 Substrate Solution; Dako REAL™ Blocking Solution; plasmid, pWR100 was used (Clerc and Sansonetti, 1987). Dako REAL™ Buffer Kit). Endogenous peroxidase was quenched by 3% hydrogen peroxide for 10 min. Slides were incubated for 30 min with primary antibody and again 30 min with PCR secondary antibody at room temperature. End-point RT-PCR was performed using Taq polymerase (Fer- mentas) on cDNA obtained from isolated RNA of the indicated Immunoprecipitation and immunoblotting cell lines. RNA was isolated using the RNeasy kit (Qiagen) and 1 mg total RNA was transcribed into cDNA with the First Strand Immunoprecipitations and immunoblotting were performed as cDNA Synthesis Kit (Fermentas) using an oligodT primer. described elsewhere (Kufer et al., 2006). Primary antibodies for

© 2012 Blackwell Publishing Ltd, Cellular Microbiology 14 K. Lautz et al. immunoblotting were mouse anti-FLAG M2 (Sigma), rabbit anti- chromium complexes acting as specific inhibitors of NOD2 c-MYC (sc-789, Santa Cruz), rat anti-NLRP10 8H2 and 8B3 (this signalling. ChemMedChem 5: 2065–2071. study), mouse anti-a-tubulin (Sigma), mouse anti-phospho-p38 Broz, P., von Moltke, J., Jones, J.W., Vance, R.E., and MAPK (Thr180/Tyr182) (clone 28B10, Cell Signaling), rabbit anti- Monack, D.M. (2010) Differential requirement for p38 MAPK (#9212, Cell Signaling), mouse anti-GFP (Roche), caspase-1 autoproteolysis in pathogen-induced cell death mouse anti-RIP2 (160785, Cayman Chemical), rabbit anti- and cytokine processing. Cell Host Microbe 8: 471–483. Flotillin-2 (C42A3, Cell Signaling), rabbit anti-TAK1 (T-9689, Chen, G.Y., Liu, M., Wang, F., Bertin, J., and Nunez, G. Sigma), mouse anti-actin HRP conjugate (sc-47778, Santa Cruz) (2011a) A functional role for Nlrp6 in intestinal inflammation and rabbit anti-GAPDH (sc-25778, Santa Cruz). Secondary anti- and tumorigenesis. J Immunol 186: 7187–7194. bodies used included HRP-conjugated goat anti-mouse IgG (Bio- Chen, Y., Lind Enoksson, S., Johansson, C., Karlsson, M.A., Rad), HRP-conjugated goat anti-rabbit IgG (Bio-Rad), anti-rat Lundeberg, L., Nilsson, G., et al. (2011b) The expression of IgG (Jackson ImmunoResearch), HRP-conjugated mouse anti- BAFF, APRIL and TWEAK is altered in eczema skin but not rabbit IgG light chain specific (Dianova) and HRP-conjugated in the circulation of atopic and seborrheic eczema patients. goat anti-mouse IgG light chain specific (Dianova), all used at PLoS ONE 6: e22202. 1:2000). Signals were revealed using SuperSignal West Femto Clerc, P., and Sansonetti, P.J. (1987) Entry of Shigella flexneri Max Sensitivity Substrate (Pierce) and recorded on an electronic into HeLa cells: evidence for directed phagocytosis involv- imaging system (LAS4000, Fuji). ing actin polymerization and myosin accumulation. Infect Immun 55: 2681–2688. Correa, R.G., Khan, P.M., Askari, N., Zhai, D., Gerlic, M., Detection of cytokines Brown, B., et al. (2011) Discovery and characterization of 2-aminobenzimidazole derivatives as selective NOD1 For cytokine profiling, the human cytokine array kit (R&D inhibitors. Chem Biol 18: 825–832. Systems) was used. The signal was recorded using an electronic Damiano, J.S., Newman, R.M., and Reed, J.C. (2004) Multi- imaging system (LAS4000, Fuji). Human IL-8, IL-6 and IL-18 ple roles of CLAN (caspase-associated recruitment concentrations in cell culture supernatants were quantified by domain, leucine-rich repeat, and NAIP CIIA HET-E, and specific ELISAs (DY208, and DY206 and R&D Systems and MBL TP1-containing protein) in the mammalian innate immune # 7620) according to the manufacturer’s instructions. response. J Immunol 173: 6338–6345. Eisenbarth, S.C., Williams, A., Colegio, O.R., Meng, H., Strowig, T., Rongvaux, A., et al. (2012) NLRP10 is a NOD- p65 activation assays like receptor essential to initiate adaptive immunity by den- For the quantitative measurement of p65 activity in nuclear frac- dritic cells. Nature 484: 510–513. tions of HeLa cells, TransAM NF-kB p65 assays (Active Motif) Eitas, T.K., and Dangl, J.L. (2010) NB-LRR proteins: pairs, were used according to the manufacturer’s instructions. pieces, perception, partners, and pathways. Curr Opin Plant Biol 13: 472–477. Elinav, E., Strowig, T., Kau, A.L., Henao-Mejia, J., Thaiss, Statistics C.A., Booth, C.J., et al. (2011) NLRP6 inflammasome regu- lates colonic microbial ecology and risk for colitis. Cell 145: The Prism graphing and analysis program (GraphPad Software) 745–757. was used for generation of graphs and for calculation of statistical Fritz, J.H., Ferrero, R.L., Philpott, D.J., and Girardin, S.E. measures including mean values, standard deviations and two- (2006) Nod-like proteins in immunity, inflammation and way ANOVA. Differences were regarded as significant (*) when disease. Nat Immunol 7: 1250–1257. P < 0.05, highly significant (**) with P < 0.001 and (***) corre- Girardin, S.E., Tournebize, R., Mavris, M., Page, A.L., sponds to P < 0.0001. Li, X., Stark, G.R., et al. (2001) CARD4/Nod1 mediates NF-kappaB and JNK activation by invasive Shigella flexneri. EMBO Rep 2: 736–742. Acknowledgements Girardin, S.E., Boneca, I.G., Carneiro, L.A., Antignac, A., Jehanno, M., Viala, J., et al. (2003a) Nod1 detects a unique We thank Martin Krönke (University of Cologne) for continuous muropeptide from gram-negative bacterial peptidoglycan. support and Helen Springer for excellent help with experiments. Science 300: 1584–1587. This work was supported by the Deutsche Forschungsgemein- Girardin, S.E., Boneca, I.G., Viala, J., Chamaillard, M., schaft (DFG) Grant SFB670-NG01 to T.A.K.. Labigne, A., Thomas, G., et al. (2003b) Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) References detection. J Biol Chem 278: 8869–8872. Grenier, J.M., Wang, L., Manji, G.A., Huang, W.J., Al-Garawi, Barnich, N., Aguirre, J.E., Reinecker, H.C., Xavier, R., and A., Kelly, R., et al. (2002) Functional screening of five Podolsky, D.K. (2005) Membrane recruitment of NOD2 in PYPAF family members identifies PYPAF5 as a novel intestinal epithelial cells is essential for nuclear factor- regulator of NF-kappaB and caspase-1. FEBS Lett 530: {kappa}B activation in muramyl dipeptide recognition. 73–78. J Cell Biol 170: 21–26. Hsu, L.C., Ali, S.R., McGillivray, S., Tseng, P.H., Mariathasan, Bielig, H., Velder, J., Saiai, A., Menning, M., Meemboor, S., S., Humke, E.W., et al. (2008) A NOD2–NALP1 complex Kalka-Moll, W., et al. (2010) Anti-inflammatory arene– mediates caspase-1-dependent IL-1beta secretion in

response to Bacillus anthracis infection and muramyl carcinogenesis upon injury. Proc Natl Acad Sci USA 108: dipeptide. Proc Natl Acad Sci USA 105: 7803–7808. 9601–9606. Imamura, R., Wang, Y., Kinoshita, T., Suzuki, M., Noda, T., Pan, Q., Mathison, J., Fearns, C., Kravchenko, V.V., Da Silva Sagara, J., et al. (2010) Anti-inflammatory activity of Correia, J., Hoffman, H.M., et al. (2007) MDP-induced PYNOD and its mechanism in humans and mice. interleukin-1beta processing requires Nod2 and CIAS1/ J Immunol 184: 5874–5884. NALP3. J Leukoc Biol 82: 177–183. Inohara, N., Ogura, Y., Fontalba, A., Gutierrez, O., Pons, F., Pedron, T., Thibault, C., and Sansonetti, P.J. (2003) The Crespo, J., et al. (2003) Host recognition of bacterial invasive phenotype of Shigella flexneri directs a distinct muramyl dipeptide mediated through NOD2. Implications gene expression pattern in the human intestinal epithelial for Crohn’s disease. J Biol Chem 278: 5509–5512. cell line Caco-2. J Biol Chem 278: 33878–33886. Khan, P.M., Correa, R.G., Divlianska, D.B., Peddibhotla, S., Philpott, D.J., Yamaoka, S., Israel, A., and Sansonetti, P.J. Sessions, E.H., Magnuson, G., et al. (2011) Identification of (2000) Invasive Shigella flexneri activates NF-kappa B inhibitors of NOD1-induced nuclear factor-kappaB activa- through a lipopolysaccharide-dependent innate intracellu- tion. ACS Med Chem Lett 2: 780–785. lar response and leads to IL-8 expression in epithelial cells. Kinoshita, T., Wang, Y., Hasegawa, M., Imamura, R., and J Immunol 165: 903–914. Suda, T. (2005) PYPAF3, a PYRIN-containing APAF-1-like Proell, M., Riedl, S.J., Fritz, J.H., Rojas, A.M., and protein, is a feedback regulator of caspase-1-dependent Schwarzenbacher, R. (2008) The Nod-like receptor (NLR) interleukin-1beta secretion. J Biol Chem 280: 21720– family: a tale of similarities and differences. PLoS ONE 3: 21725. e2119. Kofoed, E.M., and Vance, R.E. (2011) Innate immune recog- Reith, W., and Mach, B. (2001) The bare lymphocyte syn- nition of bacterial ligands by NAIPs determines inflamma- drome and the regulation of MHC expression. Annu Rev some specificity. Nature 477: 592–595. Immunol 19: 331–373. Kufer, T.A. (2008) Signal transduction pathways used by Schroder, K., and Tschopp, J. (2010) The inflammasomes. NLR-type innate immune receptors. Mol Biosyst 4: 380– Cell 140: 821–832. 386. Schroeder, G.N., and Hilbi, H. (2008) Molecular pathogen- Kufer, T.A., Kremmer, E., Banks, D.J., and Philpott, D.J. esis of Shigella spp.: controlling host cell signaling, inva- (2006) Role for erbin in bacterial activation of Nod2. Infect sion, and death by type III secretion. Clin Microbiol Rev 21: Immun 74: 3115–3124. 134–156. Kufer, T.A., Kremmer, E., Adam, A.C., Philpott, D.J., and Shigeoka, A.A., Mueller, J.L., Kambo, A., Mathison, J.C., Sansonetti, P.J. (2008) The pattern-recognition molecule King, A.J., Hall, W.F., et al. (2010) An inflammasome- Nod1 is localized at the plasma membrane at sites of independent role for epithelial-expressed Nlrp3 in renal bacterial interaction. Cell Microbiol 10: 477–486. ischemia-reperfusion injury. J Immunol 185: 6277–6285. Lamkanfi, M., Mueller, J.L., Vitari, A.C., Misaghi, S., Suzuki, T., Franchi, L., Toma, C., Ashida, H., Ogawa, M., Fedorova, A., Deshayes, K., et al. (2009) Glyburide inhibits Yoshikawa, Y., et al. (2007) Differential regulation of the Cryopyrin/Nalp3 inflammasome. J Cell Biol 187: caspase-1 activation, pyroptosis, and autophagy via Ipaf 61–70. and ASC in Shigella-infected macrophages. PLoS Pathog Lech, M., Avila-Ferrufino, A., Skuginna, V., Susanti, H.E., 3: e111. and Anders, H.J. (2010) Quantitative expression of RIG- Tanabe, T., Chamaillard, M., Ogura, Y., Zhu, L., Qiu, S., like helicase, NOD-like receptor and inflammasome- Masumoto, J., et al. (2004) Regulatory regions and critical related mRNAs in humans and mice. Int Immunol 22: residues of NOD2 involved in muramyl dipeptide recogni- 717–728. tion. EMBO J 23: 1587–1597. McDonald, C., Chen, F.F., Ollendorff, V., Ogura, Y., Mar- Ting, J.P., Willingham, S.B., and Bergstralh, D.T. (2008) chetto, S., Lecine, P., et al. (2005) A role for Erbin in the NLRs at the intersection of cell death and immunity. Nat regulation of Nod2-dependent NF-kappaB signaling. J Biol Rev 8: 372–379. Chem 280: 40301–40309. Travassos, L.H., Carneiro, L.A., Ramjeet, M., Hussey, S., Martinon, F., Burns, K., and Tschopp, J. (2002) The inflam- Kim, Y.G., Magalhaes, J.G., et al. (2010) Nod1 and Nod2 masome: a molecular platform triggering activation of direct autophagy by recruiting ATG16L1 to the plasma inflammatory caspases and processing of proIL-beta. Mol membrane at the site of bacterial entry. Nat Immunol 11: Cell 10: 417–426. 55–62. Neerincx, A., Rodriguez, G., Steimle, V., and Kufer, T.A. Wagner, R.N., Proell, M., Kufer, T.A., and Schwarzenbacher, (2012) NLRC5 controls basal MHC class I gene expression R. (2009) Evaluation of Nod-like receptor (NLR) effector in an MHC-enhanceosome dependent manner. J Immunol domain interactions. PLoS ONE 4: e4931. 188: 4940–4950. Wang, Y., Hasegawa, M., Imamura, R., Kinoshita, T., Kondo, Nigro, G., Fazio, L.L., Martino, M.C., Rossi, G., Tattoli, I., C., Konaka, K., and Suda, T. (2004) PYNOD, a novel Liparoti, V., et al. (2008) Muramylpeptide shedding modu- Apaf-1/CED4-like protein is an inhibitor of ASC and lates cell sensing of Shigella flexneri. Cell Microbiol 10: caspase-1. Int Immunol 16: 777–786. 682–695. Willingham, S.B., Bergstralh, D.T., O’Connor, W., Morrison, Normand, S., Delanoye-Crespin, A., Bressenot, A., Huot, A.C., Taxman, D.J., Duncan, J.A., et al. (2007) Microbial L., Grandjean, T., Peyrin-Biroulet, L., et al. (2011) Nod- pathogen-induced necrotic cell death mediated by the like receptor pyrin domain-containing protein 6 inflammasome components CIAS1/cryopyrin/NLRP3 and (NLRP6) controls epithelial self-renewal and colorectal ASC. Cell Host Microbe 2: 147–159.

Zhao, Y., Yang, J., Shi, J., Gong, Y.N., Lu, Q., Xu, H., et al. B. XTT proliferation assay of HeLa cells transfected with indi- (2011) The NLRC4 inflammasome receptors for bacterial cated NLRP10-specific siRNAs (siNLRP10A and siNLRP10B) flagellin and type III secretion apparatus. Nature 477: 596– or a non-targeting control (siCTRL) for 72 h. 600. C. IL-6 levels determined by ELISA in the supernatants of the Zigrino, P., Drescher, C., and Mauch, C. (2001) Collagen- experiment shown in Fig. 2A. induced proMMP-2 activation by MT1-MMP in human D. IL-8 levels of HeLa cells treated with the indicated siRNA for dermal fibroblasts and the possible role of alpha2beta1 72 h and induced with 10 ng ml-1 TNF for 6 h. Knock-down effi- integrins. Eur J Cell Biol 80: 68–77. ciency is shown in the immunoblot (lower panel). Zurek, B., Proell, M., Wagner, R.N., Schwarzenbacher, R., E. Detection of changes in cytokine expression induced by and Kufer, T.A. (2012) Mutational analysis of human NOD1 NLRP10 knock-down in S. flexneri M90T infected HeLa cells and NOD2 NACHT domains reveals different modes of using an immunoblot-based antibody array. Cytokines are rep- activation. Innate Immun 18: 100–111. resented by two spots each. Measured cytokines are indicted on the left panel. Fig. S3. NLRP10 functionally interacts with NOD1 (relates to Fig. 5). Supporting information A. Time-laps of a 4-D image acquisition of HeLa cells transiently transfected with GFPNLRP10 and subsequently infected Additional Supporting Information may be found in the online with S. flexneri M90T at t = 0. version of this article: B. IL-8 secretion, measured by ELISA in the supernatant of HeLa cells treated with the indicated siRNA for 72 h prior to Fig. S1. Characterization of NLRP10-specific antibodies (relates infection with S. flexneri M90T or non-invasive BS176 for 6 h. to Fig. 1). Characterization of NLRP10-specific monoclonal rat Fig. S4. NLRP10 and NOD1 are evolutionary related (relates to antibodies. Immunoblot analysis of lysates from HeLa cells Fig. 5). Sequence alignment of the protein sequences of the probed with the indicated antibodies is shown. Detection of over- human NLR family. Accession numbers of the sequences used expressed FLAG-NLRP10 in HEK293T lysates served as control for the alignment are according to Ting et al. (2008a). An align- for the expected size of NLRP10 (left). ment was prepared using Clustal-W XXL (Larkin et al., 2007). Fig. S2. Knock-down of NLRP10 does not affect bacterial inva- The dendrogram was plotted using NJplot. sion and cellular proliferation but does influence the inflammatory response (relates to Fig. 2). Please note: Wiley-Blackwell are not responsible for the content A. Bacterial invasion measured by gentamicin protection assay or functionality of any supporting materials supplied by the of an experiment conducted under identical conditions as that authors. Any queries (other than missing material) should be shown in Fig. 2A. directed to the corresponding author for the article.