Fatal Lymphoproliferative Disease Associated with a Novel Gammaherpesvirus in a Captive Population of Common Marmosets

Jan C. Ramer,1* Richard L. Garber,2 Keith E. Steele,3 Jonathan F. Boyson,1† Christine O’Rourke,1†† and James A. Thomson1 Background and Purpose: Callitrichids (marmosets and tamarins) are extremely susceptible to experimental tumor induction by herpesviruses native to other primate species. A colony of common marmosets developed a syndrome of weight loss, inappetence, diarrhea, and in several animals, palpable abdominal masses. Methods: Marmosets in the colony were subjected to histologic examination and serologic testing for Epstein- Barr virus (EBV). The DNA from tumors that developed in the marmosets was subjected to consensus primer polymerase chain reaction (PCR) analysis designed to amplify conserved regions of herpesvirus genomes. Results: The mesenteric lymph nodes and intestinal mucosa were consistently infiltrated by principally B lymphocytes, which often obliterated the normal architecture. Of 84 clinically normal marmosets, 52 were seropositive for EBV. The tumor DNA contained previously unreported herpesvirus sequences closely related to but distinct from those of EBV, Herpesvirus papio, and these lymphocryptovirus, a novel gammaherpesvirus. Results of PCR analysis of circulating lymphocytes from EBV-positive, clinically normal marmosets were negative for EBV antibodies and were positive for marmoset lymphocryptovirus; PCR analysis of circulating lymphocytes from EBV- negative marmosets yielded negative results for EBV and this novel marmoset lymphocryptovirus. Conclusion: This novel gammaherpesvirus possibly associated with tumor development may have important management implications for captive callitrichids.

Most primates, human and non-human, are naturally in- callitrichid New World monkeys) has been known since these fected with species-specific gammaherpesviruses by adulthood viruses were first isolated in 1968 and 1970, but to our knowl- (1, 2). In general, gammaherpesviruses do not cause appreciable edge, spontaneous herpesvirus-induced lymphoproliferative dis- disease at primary infection in the natural host. Animals fre- ease in laboratory or zoo-housed callitrichids has not been quently remain latently infected, and serum antibodies are reported. There are few reports in the literature of spontaneous maintained throughout life. Immunosuppression in latently in- titers to EBV in callitrichids, but not reports of spontaneous fected individuals, or infection in a species that is not the natu- lymphoproliferative disease in these animals (7). We describe ral host, can lead to viral-induced lymphoproliferations, rapidly the clinical, pathologic, and serologic history of an outbreak of fatal malignant lymphoma, or chronic mononucleosis-type dis- spontaneous fatal lymphoproliferative disease in a captive eases (3-12). The best understood gammaherpesvirus is colony of common marmosets, and identification of a novel Epstein-Barr virus (EBV), the most common cause of infectious gammaherpesvirus in the tumors of these animals by use of mononucleosis in humans. EBV has been associated with polymerase chain reaction (PCR) analysis. Burkitt’s lymphoma, nasopharyngeal carcinoma, and Hodgkin’s disease (1, 2, 13-16). Numerous examples of gammaherpesvirus- Case History induced lymphoproliferative disease in nonhuman primates have The Wisconsin Regional Primate Research Center (WRPRC) been reported (2, 4, 5, 11, 17-23). houses an average population of 230 common marmosets It is well documented that callitrichids (marmosets and (Callithrix jacchus), ranging in age from neonates to adults over tamarins) are extremely susceptible to experimental tumor in- 10 years old. The colony was formed in the early 1990s with ani- duction by herpesviruses native to other primate species: H. mals from two sources. The marmosets are pair or family saimiri, present in > 85% of captive squirrel monkeys, H. ateles, housed indoors in four separate rooms, isolated from the present in 50 to 60% of captive spider monkeys, and EBV (6, 9, macaque colony (Macaca mulatta and M. arctoides). Group com- 24-29). The potential for severe spontaneous disease in position changes frequently. Lights were on from 6 AM to 6 PM, callitrichids housed with or near cebid monkeys (all non- ambient temperature was 27ЊC, and relative humidity was ap- proximately 50%. Animals were fed 45 g of Zu/Preem marmoset The Wisconsin Regional Primate Research Center, University of Wisconsin, Madison, Wisconsin1; PathoGenesis Corporation, Seattle, Washington2; and U.S. Diet (Hill’s Pet Products, Topeka, KS) topped with 1 tsp of plain Army Medical Research Institute of Infectious Diseases, Fort Detrick, Mary- yogurt mixed with 5 IU of calcium, 250 IU of vitamin D3, and 3 land3 *Address correspondence and requests for reprints to: J. C. Ramer, India- mg of vitamin C once daily. Continuous access to water was pro- napolis Zoo, 1200 West Washington Street, Indianapolis, IN 46222. vided by an in-line automatic watering system. All personnel †Present address is Department of Molecular and Cellular Biology, Harvard entering the area wore coveralls, masks, gloves, and protective University, Cambridge, Massachusetts. ††Present address is Wyeth-Ayerst Research, Chazy, New York. boots. Daily health records were kept for each animal. All ani- 59 Vol 50, No 1 Comparative Medicine February 2000 mal care met or exceeded standards outlined in the NIH Guide for the Care and Use of Laboratory Animals and the Animal Welfare Act and subsequent amendments. From 1992 to 1996, 16 cases of lymphoproliferative disease in adult common marmosets from the WRPRC were diagnosed at necropsy Affected animals ranged in age from 16 months to 9 years; six male and 10 female animals were affected. There was no appreciable familial relationship among the affected animals, as determined by low coefficient of relatedness (0.02). Affected animals typically developed weight loss, inappetence, and diarrhea. Frequently, a firm palpable mass was detected in the mid-portion of the abdomen, and several marmosets developed intestinal obstruction. In two marmosets, peripheral lymphadenopathy was observed. Results of complete blood count and serum biochemical analysis on marmosets were variable, ranging from within normal limits for this species in the WRPRC laboratory to neutrophilia with left shift and high liver enzyme activities. Atypical circulating lymphocytes were Figure 1. Photomicrograph of a section of marmoset gastrointestinal evident on blood smears from the two marmosets that had pe- tract with enlarged mesenteric lymph nodes. Bar = 1 cm. ripheral lymphadenopathy, but not on those from the remaining animals. Bacteriologic culture of feces from animals with diar- serosa of intestinal sections were identified as B lymphocytes rhea yielded negative results for Salmonella, Shigella, and (Figure 7), whereas scattered cells were identified as T lympho- Campylobacter species, and results of fecal flotation were nega- cytes. Many of the CD20-expressing cells had atypical morpho- tive for pathogens. logic features. Atypical lymphoid cells in the spleens also were Complete necropsy was performed on all 16 marmosets. A labeled with the B-lymphocyte marker. The CD3-labeled cells, consistent finding was grossly large mesenteric lymph nodes however, had normal lymphocyte features. Some, but not all, (Figure 1), which corresponded to the abdominal masses de- spleens also contained cells that were labeled by the EBV LMP- tected clinically. Tissues were fixed in neutral-buffered 10% for- 1 antibody (Figure 8). The LMP-expressing cells varied from malin, embedded in paraffin, sectioned at 5-␮m-thickness, and morphologically normal lymphocytes to small cells with smudgy stained with hematoxylin and eosin. In all instances, the me- nuclei to larger, atypical lymphoid cells and some histiocytoid senteric lymph node architecture was obliterated by heteroge- cells. They were observed principally within the red pulp and neous sheets of neoplastic round cells (Figure 2). Most cells had often in clusters. In marmoset tumor tissue, there was equivocal moderate amounts of eosinophilic cytoplasm, obscure cell bor- staining of rare lymphoid cells for LMP-1. ders, and round or oval to irregular nuclei (moderate nuclear A representative group of animals was tested for antibodies pleomorphism). Nuclei had finely granular, dispersed chromatin to EBV (Virus Reference Laboratory, Inc., Sam Antonio, TX). and one or more prominent nucleoli. Nuclear diameter varied Serum was obtained from 84 clinically normal marmosets rang- up to threefold. Mitotic figures were present at 1 to 2/high- ing in age from 1 year to 11 years. Indirect immunofluorescent power field. In some sections, the larger neoplastic cells were antibody (IFA) assays, using the viral capsid antigen (VCA; Gull intermixed with cells that were small, had scant cytoplasm, and Laboratory Kit, Salt Lake City, Utah) of EBV, were performed. had round nuclei with heterochromatic chromatin and one or Of the 84 marmosets, 52 were antibody positive, with titer rang- more inconspicuous nucleoli. All proximal colon sections had in- ing from 1:10 to 1:40. Nine marmosets were tested for antibod- filtrates of neoplastic round cells, similar to those described for ies to H. saimiri, using a dot immunobinding assay (30), and all the mesenteric lymph node, filling the lamina propria and, in results were negative. some sections, infiltrating and effacing the submucosa, muscu- Spleen, lymph node specimens, and cultured lymphocytes from laris externa, and serosa (Figures 3–5). In many marmosets, the two marmosets were submitted for virus isolation (Virus Reference jejunum, duodenum, and ileum were similarly affected. In sev- Laboratory, Inc.). Raji, Vero, MRC5, squirrel monkey lung, and eral marmosets, neoplastic cells were observed in liver, kidneys, marmoset embryo cell cultures were used. Virus was not isolated. and lungs (Figure 6). To further test the hypothesis that a herpesvirus was in- Cells were further characterized by immunohistochemical volved in the pathogenesis of this lymphoproliferative disease, analysis at the US Army Medical Research Institute of Infec- DNA was extracted from marmoset tumor tissue and subjected tious Diseases, Pathology Division, Fort Detrick, Md. Sections of to consensus primer PCR. Extraction of DNA from tissues and normal monkey spleen and sections of tissue from affected mar- cultured cells, the consensus primer PCR protocol, and the di- mosets were stained with antibodies to human CD20, clone L26 rect DNA sequencing of the PCR products have been described (B-lymphocyte marker), human CD3 (T-lymphocyte marker), (31, 32). The consensus primer PCR procedure uses highly de- and EBV latent membrane protein 1 (LMP-1; DAKO Corpora- generate oligonucleotide primer sets to target the two most tion, Carpinteria, CA), using an immunoperoxidase method highly conserved herpesvirus genes, DNA polymerase and (Envision System, DAKO Corporation). The normal monkey terminase. It has been used successfully against almost all spleen provided positive internal controls for the lymphocyte samples believed to contain herpesvirus DNA, including yield- markers. Most of the lymphocytes infiltrating and expanding ing the first molecular characterization of a number of new her- the lamina propria of villi, the submucosa, and occasionally, the pesviruses as well as further characterizing known species 60 Novel gammaherpesvirus associated with marmoset lymphosarcoma

Figure 3. Photomicrographs of sections of marmoset small intestine. The lamina propria is expanded by a population of small, heterogeneous lymphocytes that blunt villi and widely separate crypts. A. H&E stain; bar = 100 ␮m. B. Higher magnification of boxed area in A. H&E stain; bar = 25 ␮m. (32-36). When applied to tumor material from three marmosets, the expected size PCR products were observed by use of agarose gel electrophoresis, suggesting that both targeted herpesvirus Figure 2. Photomicrographs of sections of marmoset mesenteric lymph node. Notice similar morphology of lymphocytes in Figure 3B. B. No- genes were present in the tissues. tice different morphology of lymphocytes in Figure 4B. H&E stain; Direct DNA sequencing of the PCR amplicons indicated the bar = 25 ␮m for both sections. presence of herpesvirus-like sequences in affected tissues from 61 Vol 50, No 1 Comparative Medicine February 2000

Figure 5. Photomicrographs of sections of marmoset small intestine. Architecture of the mucosa is obliterated by sheets of large lymphocytes that extend into the muscularis externa and serosa. A. H&E stain; bar = 200 ␮m. B. Higher magnification of boxed area in A. Ar- rows = mitotic figures. H&E stain; bar = 25 ␮m.

Figure 4. Photomicrographs of sections of marmoset small intestine. The mucosa and submucosa are expanded by a heterogeneous popu- Figure 6. Photomicrograph of perivascular cuffs of lymphocytes. H&E lation of large lymphocytes. A few lymphocytes are present in the stain; bar = 100 ␮m. muscularis externa and serosa. A. H&E stain; bar = 100 ␮. B. Higher magnification of boxed area in A. Arrows = mitotic figures. H&E stain; this newly recognized marmoset disease (Figure 9). Sequence bar = 25 ␮. similarity searching was carried out against published DNA 62 Novel gammaherpesvirus associated with marmoset lymphosarcoma

ferent from the marmoset lymphosarcoma herpesvirus (not shown; see Table 1 for GenBank accession numbers). Alignment of the DNA polymerase or terminase protein sequences of all gammaherpesviruses (published or determined newly in this study; see Table 1), using the MEGALIGN soft- ware (DNAStar Incorporated, Madison, WI), permitted con- struction of phylogenetic trees representing the relatedness of these species. The tree representing DNA polymerases is shown in Figure 10. Abbreviated names for the viruses have been used following the virus nomenclature standards (37). Herpesvirus papio and rhesus lymphocryptovirus were found to be close relatives of EBV. The marmoset lymphosarcoma herpesvirus also falls into the genus Lymphocryptovirus. The newly reported gammaherpesvirus bovine lymphotropic virus is more distantly related to the four clear lymphocryptoviruses; it is premature at this time to classify it as a lymphocryptovirus or rhadinovirus without further sequence and biological information (36). Al- though not as many herpesvirus species have been sequenced in the terminase gene, the marmoset lymphosarcoma herpesvirus terminase protein has similar phylogenetic relationships, as seen for DNA polymerase (not shown). To test the hypothesis that clinically normal animals might be latently infected with marmoset lymphocryptovirus and not EBV, circulating lymphocytes were isolated from four clinically normal EBV antibody-positive animals and the DNA was tested for herpesviruses by use of PCR. All four yielded the sequences of the new marmoset gammaherpesvirus in the consensus primer PCR assay. As can be seen in Figures 9B and 9C, there is a small amount of heterogeneity in the viral sequences isolated from these animals. Although most differences were silent at the amino acid level, in one marmoset, the nucleotide variation resulted in a conserved amino acid change in DNA polymerase. Using a nested primer set specific for the BMRF1 gene of EBV, Figure 7. Photomicrographs of sections of marmoset small intestine all were EBV negative. The first reaction in this assay involved stained by use of immunocytochemical analysis. A. CD20; bar = 100 primers EBV-1 (CAGGCTTCCCTGCAATTTTACAAGCGG) and ␮m. B. CD20; bar = 25 ␮m. C. CD3; bar = 100 ␮m. D = negative control (no primary antibody); bar = 100 ␮m. Detection was done by use of EBV-2 (CCCAGAAGTATACGTGGTGACGTAGA), using the fol- horseradish peroxidase/diaminobenzadine, and positive-reacting cells lowing cycling parameters: 2 minutes’ denaturation at 95ЊC, 35 are black. Hematoxylin counterstain. cycles of 95ЊC for 1 minute and 72ЊC for 2 minutes, and extension for 7 minutes at 72ЊC. Each reaction of 50 ␮l contained 67 and protein sequences. The TBLASTP 2.0.5 sequence similarity mM Tris-HCl, pH 8.8, 2 mM MgCl2, 16 mM (NH4)2SO4, 10 mM searching was carried out at the National Center for Biotechnol- 2-mercaptoethanol, bovine serum albumin (100 ␮g/ml), 0.2 mM ogy Information website against the combined nonredundant da- each dNTP, 0.2 ␮M each primer, 1.25 U of Taq DNA polymerase tabase of GenBank + European Molecular Biology Laboratory + (Boehringer Mannheim, Indianapolis, IN), and 300 ng of tem- DNA Database of Japan + Protein Database. The marmoset plate DNA. The second reaction involved primers EBV-3 (AAG DNA polymerase protein sequence indicated substantial align- AGCCACCACACCTGCGC) and EBV-4 (TTCTGCAACGAGGA ment with EBV, ovine herpesvirus 2, bovine lymphotropic herp- AGCCGTC), using the following cycling parameters: 2 minutes’ esvirus, H. saimiri, and alcelaphine herpesvirus 1 (in decreasing denaturation at 95ЊC, 35 cycles of 95ЊC for 1 minute, 60ЊC for 1 order of scores). For the marmoset terminase protein sequence, the minute, and 72ЊC for 1 minute, and extension at 72ЊC for 7 min- five best matches were EBV, Kaposi’s sarcoma-associated herpes- utes. The composition was the same as that for the first reac- virus, H. saimiri, alcelaphine herpesvirus 1, and equine herpesvi- tion, except for the change in primers and the use of 2 ␮l from rus 2. From these results, the putative marmoset lymphosarcoma the primary PCR as template DNA. Purified EBV DNA (Ad- herpesvirus is assigned membership in the gammaherpesvirus vanced Biotechnologies, Inc., Columbia, Md.) was used as a subfamily, and it is most closely related to EBV. positive control. No template DNA was used as a negative con- Epstein-Barr virus is in the lymphocryptovirus subdivision of trol. The DNA was extracted from circulating lymphocytes of the gammaherpesviruses; however, comparative sequence infor- three EBV antibody-negative marmosets, and all had negative mation was not previously available for two other known mem- results of PCR, using the same techniques described previously. bers of this genus, H. papio and rhesus lymphocryptovirus. To complete our study, samples of these two were obtained and se- Discussion quences were determined in the DNA polymerase and Our documentation of a gammaherpesvirus in tumor tissues terminase genes. Both viruses were found to be unique and dif- of common marmosets and the genetic, biological, and epidemio- 63 Vol 50, No 1 Comparative Medicine February 2000

The ability to diagnose latently infected animals by serologic testing will be important in colony management. Indi- viduals persistently infected with other gammaherpesviruses have infected B cells in the blood, and therefore, maintain serum antibody responses throughout life (2, 42, 43). It is well known that gammaherpesvirus genomes encode highly homologous structural proteins and replicate by similar mechanisms (2, 43-46). The positive serologic reaction of marmoset cells to EBV probes, in the absence of detectable EBV DNA sequences, suggests that the marmoset lymphocryptovirus and EBV are sufficiently closely related to share some antigenic determinants between their products. This cross-reaction also occurs between other closely related herpesviruses, and suggests that antibody titer to EBV may be used to screen for animals infected with the marmoset gammaherpesvirus. This assumption is further substanti- ated by the PCR detection of herpesvirus sequences in circulating lymphocytes of EBV antibody-positive animals that are identical to those found in marmoset tumor tissue, lack of a PCR-positive signal for EBV in these same lymphocytes, Figure 8. Photomicrograph of a section of marmoset spleen stained by use of immunocytochemical analysis. A cluster of lymphoid cells indicates cytoplas- and lack of PCR detection of any herpesvirus sequences in mic expression of Epstein-Barr virus latent membrane protein 1; bar = 40 ␮m. EBV antibody-negative animals. Detection was done by use of horseradish peroxidase/diaminobenzidine, and The gammaherpesviruses are classified into two genera on positive-reacting cells are black. Hematoxylin counterstain. the basis of their biology: Rhadinovirus and Lympho- cryptovirus. The DNA-based phylogenetic tree of gamma- logic features shared between this novel virus and other known herpesviruses (Figure 10) suggests a further subdivision of tumorigenic herpesviruses suggests viral induction of tumors in what is currently called the rhadinoviruses into two groups: one these marmosets as well. Although we cannot rule out the po- centers on H. saimiri and the other on Kaposi’s sarcoma-associ- tential contribution of other factors toward inducing the ated herpesvirus. Herpesvirus cuniculi of rabbits is only dis- lymphoproliferative lesions in these primates, the association tantly related to the other two. The marmoset lymphosarcoma between disease and virus in the colony is noteworthy (11). herpesvirus can be placed by sequence similarity into the genus The immunohistochemical studies indicate the lymphoprolif- Lymphocryptovirus. The other members of this group are endemic erative lesions to be of B lineage, whereas the T cells in these to humans and Old World primates. To the authors’ knowledge, the lesions appear to be reactive, non-neoplastic cells, which is char- new marmoset herpesvirus is the first lymphocryptovirus to be re- acteristic of lymphoproliferative disease associated with other ported in New World monkeys. gammaherpesviruses (38). Further, the presence of EBV LMP-1 The presence of titer to EBV in 52 of 84 clinically normal mar- in some lymphoid cells not only indicates expression of EBV-like mosets and the low numbers of marmosets who died of antigens in affected marmoset tissues, but also documents pres- lymphoproliferative disease in this colony suggests that the mar- ence of an oncogene. Latent membrane protein is considered to moset lymphocryptovirus may have biological behavior in marmo- be essential for B-cell transformation in most human and sim- sets similar to that of the well studied gammaherpesviruses in ian lymphotropic herpesviral diseases (1) and has been detected their natural host. Latently infected animals may only develop in tissues from humans with Hodgkin’s disease, nasopharyn- disease when immunocompromised either through research-re- geal carcinoma, and acute infectious mononucleosis (13-16, 39- lated manipulation, concurrent disease, or coinfection with an 41). The reason for the lack of LMP-1 immunostaining of unrecognized marmoset retrovirus. Although this new herpesvi- lymphoid cells in proliferative lesions is uncertain. Because the rus species was discovered in marmosets, it is not certain whether antibodies used recognize epitopes of the carboxy-terminal cyto- marmosets are the natural host. In addition to PCR analysis of plasmic domain of EBV (DAKO product specification sheet), free ranging animals, PCR analysis of white blood cells from other which is known to differ significantly from the cytoplasmic do- primates that are EBV antibody positive could clarify this. mains of simian EBVs, it is conceivable that these antibodies The potential presence of this novel virus in other captive recognized virus antigens expressed in splenic cells but did not colonies of common marmosets, and possibly in other closely re- recognize antigens expressed in the cells of proliferative lesions (1). lated callitrichids, in research facilities and zoological parks, The prevalence and consistency of abdominal involvement in has important management implications. It might be prudent the affected marmosets is consistent with the US form of to identify and isolate infected animals. Our initial serosurvey Burkitt’s lymphoma, in contrast to the African form, which in- suggests that virus-free colonies may be possible; one of three volves head and neck tumors (38). Tumorigenesis associated research colonies of marmosets tested has not detected serop- with other lymphotropic herpesviruses often requires addi- ositive animals to date. It is interesting that serum from two tional factors, including coinfection with immunosuppressive wild-caught animals currently housed in Brazil were tested for agents, such as human immunodeficiency virus or simian im- antibodies to EBV and results were positive (unpublished find- munodeficiency virus (11). It will be important to further investi- ings). These animals had been in a captive environment and gate these animals for the presence of immunosuppressive agents. exposed to humans and other callitrichids for more than 1 year. 64 Novel gammaherpesvirus associated with marmoset lymphosarcoma

65 Vol 50, No 1 Comparative Medicine February 2000

ariants

A. Samples used in consensus primer

polymerase sequences from seven animals. V

polymerase and terminase genes and their protein products.

ariant nucleotides are reverse highlighted. C. The DNA

erminase sequences from seven animals. V

Sequence of portions of the marmoset lymphosarcoma herpesvirus DNA

Figure 9. PCR and DNA sequencing. B. T PCR and DNA nucleotides and amino acids are indicated as above. 66 Novel gammaherpesvirus associated with marmoset lymphosarcoma

Table 1. Herpesviruses (HV) of the gamma subfamily for which sequences are published or were determined in this study Subfamily Gammaherpesvirinae GenBank accession numbers* Symbol Virus name Alternative name DNA polymerase Terminase Genus Lymphocryptovirus HHV-4 Human herpesvirus 4 Epstein-Barr virus V01555 V01555 CeHV-12 Cercopithecine herpesvirus 12 Herpesvirus papio, baboon HV AF091051 AF091052 CeHV-15 Cercopithecine herpesvirus 15 Rhesus lymphocryptovirus AF091053 AF091054 Marmoset lymphosarcoma virus AF091055 AF091062

Genus Rhadinovirus SaHV-2 Saimiriine herpesvirus 2 H. saimiri, squirrel monkey HV X64346 X64346 AlHV-1 Alcelaphine herpesvirus 1 Malignant catarrharal fever virus AF005370 AF005370 AtHV-2 Ateline herpesvirus 2 H. ateles, spider monkey HV U63457 None BoHV-4 Bovine herpesvirus 4 Movar virus AF031811 AF091068† BoHV-6 Bovine herpesvirus 6 Bovine lymphotropic virus AF031808 None CeHV-17 Cercopithecine herpesvirus 17 Rhesus rhadinovirus AF029302 None CeHV-18 Cercopithecine herpesvirus 18 Retroperitoneal fibromatosis- AF005478 None associated HV from Macaca nemestrina CeHV-19 Cercopithecine herpesvirus 19 Retroperitoneal fibromatosis- AF05479 None associated HV from Macaca mulatta EHV-2 Equid herpesvirus 2 Equine cytomegalovirus U20824 U20824 HHV-8 Human herpesvirus 8 Kaposi’s sarcoma-associated HV U75698 U75698 MuHV-4 Murid herpesvirus 4 Mouse HV strain 68 U97553 U97553 OvHV-2 Ovine herpesvirus 2 Sheep-associated malignant AF031812 None catarrharal fever virus LeHV-2 Leporid herpesvirus 2 H. cuniculi, rabbit HV U63468 AF091069 CalHV-1 Callitrichid herpesvirus 1 H. sanguinus U63458 AF091070 *The 9 bolded GenBank accession numbers were generated in this study. †A partial bovine herpesvirus (BoHV-4) sequence was published as GenBank accession No. M90781.

Figure 10. Phylogenetic tree showing the relationships between the DNA polymerases of known gammaherpesviruses. Abbreviations for the species names and the sources of the sequences used in this comparison are listed in Table 1.

Testing and segregation may be particularly important in a re- lymphocryptovirus (Fred Wang, Harvard Medical School) and movar search setting where research manipulations can result in im- herpesvirus (Vicky Van Santen, Auburn Medical School). munosuppression, and research results could be compromised This research was supported by NIH grant No. RR00167 to the Wisconsin Regional Primate Research Center. This report is publica- by subsequent disease. In zoological parks, it may be wise to tion No. 39-004. segregate test-positive marmosets to prevent infection and subsequent disease in primates that are not the natural host. Further investigations into this virus and the associated dis- References ease in the common marmoset will be an important addition to 1. Franken, M., O. Devergne, M. Rosenzweig, et al. 1996. Com- the understanding of the biology of gammaherpesviruses as parative analysis identifies conserved tumor necrosis factor re- well as the care of primates maintained in captivity. ceptor-associated factor 3 binding sites in the human and simian Epstein-Barr virus oncogene LMP1. J. Virol. 70:7819–7826. 2. Moghaddam, A., M. Rosenzweig, D. Lee-Parritz, et al. 1997. An animal model for acute and persistent Epstein-Barr virus in- Acknowledgments fection. Science 276:2030–2033. We thank Julie Vanderloop and Steve Brice for their assistance in 3. Hunt, R. D. 1993. Herpesviruses of primates: an introduction, p. animal handling and sample collection, and Nancy Schultz-Darken 74–78. In T. C. Jones, U. Mohr, and R. D. Hunt (ed.), Monographs for working out the coefficient of relatedness. Thanks is given to the on pathology of laboratory animals; nonhuman primates I. following people for providing samples of other viral species: rhesus Springer-Verlag, Berlin. 67 Vol 50, No 1 Comparative Medicine February 2000

4. Hunt, R. D., and B. J. Blake. 1993. Herpesvirus saimiri and 25. Falk, L, F. Deinhardt, L. Wolfe, et al. 1976. Epstein-Barr vi- herpesvirus ateles infection, p. 87–93. In T. C. Jones, U. Mohr, and rus: experimental infection of Callithrix jacchus marmosets. Int. R. D. Hunt (ed.), Monographs on pathology of laboratory animals; J. Cancer 17:785–788. nonhuman primates I. Springer-Verlag, Berlin. 26. Sundar, S. K., P. H. Levine, D. V. Ablashi, et al. 1981. Epstein- 5. Johnson, D. R. 1984. Herpesvirus-induced lymphoproliferative Barr virus-induced malignant lymphoma in a white-lipped mar- diseases in non-human primates, p. 243–261. In D. T. Purtilo (ed.), moset. Int. J. Cancer. 27:107–111. The immune deficiency and cancer: Epstein-Barr virus and 27. Wolfe, L. G. and F. Deinhardt. 1978. Overview of viral oncology lymphoproliferative malignancies. Plenum Press, New York. studies in Saguinus and Callithrix species. Prim. Med. 10:96–118. 6. Plotkay, S. 1992. Diseases of callitrichidae: a review. J. Med. 28. Ablashi, D. V., G. S. Aulakh, J. Luetzeler, et al. 1983. Fatal Primatol. 21:189–236. lymphoproliferative disease in a common marmoset (Callithrix 7. de-The, G., P. Dubouch, C. Fontaine, et al. 1980. Natural an- jacchus) following inoculation of Ag876 strain of Epstein-Barr tibodies to EBV-VCA antigens in common marmosets (Callithrix virus and a tumor-promoting agent: preliminary report. Comp. jacchus) and response after EBV inoculation. Intervirology 14: Immun. Microbiol. Infect. Dis. 6:151–160. 284–291. 29. Trimble, J. J., and R. C. Desrosiers. 1991. Transformation by 8. Wedderburn, N., J. M. B. Edwards, C. Desgranges, et al. 1984. herpesvirus saimiri. Adv. Cancer Res. 56:335–355. Infectious mononucleosis-like response in common marmosets in- 30. Heberling, R. L., and S. S. Kalter. 1986. Rapid dot fected with Epstein-Barr virus. J. Infect. Dis. 150:878–882. immunobinding assay on nitrocellulose for viral antibodies. J. Clin. 9. Emini, E. A., J. Luka, M. E. Armstrong, et al. 1986. Establish- Microbiol. 23:109–113. ment of characterization of a chronic infectious mononucleosis- 31. Hargis, A. M., P. E. Ginn, J. E. K. L. Mansell, et al. 1999. like syndrome in common marmosets. J. Med. Virol. 18:369–379. Ulcerative facial and nasal dermatitis and stomatitis in cats as- 10. Niedobitek, G., A. Agathanggelou, S. Finerty, et al. 1994. sociated with feline herpesvirus 1. Vet. Dermatol., in press. Latent Epstein-Barr virus infection in cottontop tamarins. Am. J. 32. Vandevanter, D. R., P. Warrener, L. Bennett, et al. 1996. De- Pathol. 145:969–978. tection and analysis of diverse herpes-viral species by consensus 11. Feichtinger, H., P. Putkonen, C. Parravicini, et al. 1990. primer PCR. J. Clin. Microbiol. 34:1666–1671. Malignant lymphomas in cynomologus monkeys infected with sim- 33. Garber, R. L., L. Lockwood, L. H. Herbst, et al. Three new ian immunodeficiency virus. Am. J. Pathol. 137:1311–1315. herpesviruses associated with diseases of turtles and tortoises. 12. Frank, A., W. A. Andiman, and G. Miller. 1976. Epstein-Barr In preparation. virus and nonhuman primates: natural and experimental infec- 34. Quackenbush, S. L., T. M. Work, G. H. Balazs, et al. 1998. tion. Adv. Cancer Res. 23:171–201. Three closely related herpesviruses are associated with 13. Delsol, G., P. Brousset, S. Chittal, et al. 1992. Correlation of fibropapillomatosis in marine turtles. Virology 246:392–399. the expression of Epstein-Barr virus latent membrane protein 35. Richman, L. K., R. J. Montali, R. L. Garber, et al. 1999. Novel and in situ hybridization with biotinylated BamHI-W probes in endotheliotropic herpesviruses fatal for Asian and African el- Hodgkin’s disease. Am. J. Pathol. 140:247–253. ephants. Science. 283:1171–1176. 14. Young, L. S., S. Finerty, L. Brooks, et al. 1989. Epstein- Barr 36. Rovnak, J., S. L. Quackenbush, R. A. Reyes, et al. 1998. De- virus gene expression in malignant lymphomas induced by experi- tection of a novel bovine lymphotropic herpesvirus. J. Virol. mental virus infection of cottontop tamarins. J. Virol. 63:1967–1974. 72:4237–4242. 15. Desgranges, C., H. Wolf, G. de The, et al. 1975. Nasopharyn- 37. Murphy F. A., C. M. Fauquet, D. H. L. Bishop, et al. 1995. geal carcinoma. X. Presence of Epstein-Barr virus genomes in Virus taxonomy; Sixth report of the International Committee on epithelial cells of tumors from high and medium risk areas. Int. Taxonomy of Viruses. Springer-Verlag. New York. J. Cancer. 16:7–15. 38. Warnke, R. A., L. M. Weiss, J. K. Chan, et al. 1995. In J. R. 16. Epstein, M., B. Achong, and Y. Barr. 1964. Virus particle in cul- Rosai and L. H. Sobin (ed.), Atlas of tumor pathology: tumors of tured lymphoblasts from Burkitt’s lymphoma. Lancet 1:702–703. the lymph nodes and spleen. Armed Forces Institute of Pathol- 17. Stetter, M. D., M. B. Worley, and B. Ruiz. 1995. Herpesvirus- ogy, Washington, D.C. associated malignant lymphoma in a slow loris (Nycticebus 39. Murray, P. G., L. S. Young, M. Rowe, et al. 1992. Immunohis- coucagn). J. Zoo Wildl. Med. 26:155–160. tochemical demonstration of the Epstein-Barr virus- encoded la- 18. Anzil, A. P., D. M. Bowden, and D. Ploog. Malignant lymphoma in a tent membrane protein in paraffin sections of Hodgkin’s disease. squirrel monkey (Saimiri sciureus). J. Med. Primatol. 6:251–256. J. Pathol. 166:1–5. 19. Cicmanec, J. L., W. F. Loeb, and M. G. Valerio. 1974. Lym- 40. Chen, C. L., M. M. Hsu, and H. C. Hsu. 1997. Differential ex- phoma in owl monkeys (Aotus trivirgatus) inoculated with herp- pression of EBER1 in nontumor nasopharyngeal biopsies and esvirus saimiri: Clinical, Hematologic and Pathologic Findings. nontumor component of nasopharyngeal carcinoma. Intervirology J. Med. Primatol. 3:8–17. 39:230–235. 20. Deinhardt, R. 1974. Oncogenic herpesviruses in species other 41. Isaacson, P. G., C. Schmid, L. Pan, et al. 1992. Epstein- Barr than owl monkeys. J. Med. Primatol. 3:79–88. virus latent membrane protein expression by Hodgkin and Reed- 21. Ablashi, D. V., W. F. Loeb, and G. R. Armstrong, et al. 1972. Sternberg-like cells in acute infectious mononucleosis. J. Pathol. Oncogenicity of Herpesvirus saimiri induced lymphoma and the 167:267–271. DNA polymerases of the lymphoma derived cell line and herpes- 42. Kalter, S. S., R. L. Heberling, and J. J. Ratner. 1972. EBV virus saimiri. Med. Primatol. Proc. 3rd Conf. Exp. Med. Surg. Pri- antibody in sera of non-human primates. Nature 238:353–354. mates, Part III:134–142. 43. Gerber, P., and D. Lorenz. 1974. Complement-fixing antibod- 22. Falk, L., L. Wolfe, and F. Deinhardt. 1972. Epidemiology of ies reactive with Epstein-Barr virus in sera of marmosets and herpesvirus saimiri infection in squirrel monkeys. Primatol. Proc. prosimians. Proc. Soc. Exp. Biol. Med. 145:654–657. 3rd Conf. Exp. Med. Surg. Primates, Part III:151–158. 44. Heller, M., P. Gerber, and E. Kieff. 1981. Herpesvirus papio 23. Lapin, B. A., V. Z. Agrba, A. F. Voevodin, et al. 1979. Charac- DNA is similar in organization to Epstein-Barr virus DNA. J. Virol. terization of the baboon herpesvirus (HVP) associated with ma- 37:698–709. lignant lymphoma in the Sukhumi hamadrayas baboon colony, p. 45. Ryon, J. J., E. D. Rixman, C. Houchens, et al. 1993. The lytic 413–414. In Yohn, Lapin, Blakeslee (ed.) Advances in compara- origin of herpesvirus papio is highly homologous to Epstein-Barr tive leukemia research. Elsevier North Holland, Inc. virus ori-Lyt: evolutionary conservation of transcriptional acti- 24. Hunt, R. D., L. V. Melendez, and B. F. Trum. 1972. Herpesvi- vation and replication signals. J. Virol. 67:4006–4016. rus ateles lymphoma in cotton-topped marmosets. Med. Primatol. 46. Ohno, S., J. Luka, L. A. Falk, et al. 1978. Serological reactivi- Proc. 3rd Conf. Exp. Med. Surg. Primates, Part III:159–162. ties of human and baboon sera against EBNA and herpesvirus papio-determined nuclear antigen. Eur. J. Cancer 14:955–950.