The Secreted MSP Domain of C. Elegans VAPB Homolog VPR-1 Patterns the Adult Striated Muscle Mitochondrial Reticulum Via SMN-1

RESEARCH ARTICLE The secreted MSP domain of C. elegans VAPB homolog VPR-1 patterns the adult striated muscle mitochondrial reticulum via SMN-1 Jessica Schultz‡, Se-Jin Lee‡, Tim Cole, Hieu D. Hoang, Jack Vibbert, Pauline A. Cottee, Michael A. Miller§,¶ and Sung Min Han*,§

ABSTRACT biochemical functions. VAPs act in a cell-autonomous fashion as The major sperm protein domain (MSPd) has an extracellular scaffolding components at intracellular membrane contact sites signaling function implicated in amyotrophic lateral sclerosis. (Lev et al., 2008; Stefan et al., 2011). In this capacity, there is 2+ Secreted MSPds derived from the C. elegans VAPB homolog VPR- evidence for roles in lipid transport, Ca homeostasis, the unfolded 1 promote mitochondrial localization to actin-rich I-bands in body wall protein response and other processes. VAPs also have a non-cell- muscle. Here we show that the nervous system and germ line are key autonomous signaling function (Han et al., 2012, 2013; Tsuda et al., MSPd secretion tissues. MSPd signals are transduced through the 2008). In neurons and other cells, the MSPd is liberated from the CLR-1 Lar-like tyrosine phosphatase receptor. We show that CLR-1 is transmembrane domain and unconventionally secreted into the expressed throughout the muscle plasma membrane, where it is extracellular environment. The MSPd signals through Eph and Lar- accessible to MSPd within the pseudocoelomic fluid. MSPd signaling like receptors that modulate the actin cytoskeleton. An important is sufficient to remodel the muscle mitochondrial reticulum during MSPd target is striated muscle, where signaling regulates adulthood. An RNAi suppressor screen identified survival of motor mitochondrial morphology and localization (Han et al., 2012, 2013). neuron 1 (SMN-1) as a downstream effector. SMN-1 acts in muscle, Humans have two VAP paralogs called VAPA and VAPB, which where it colocalizes at myofilaments with ARX-2, a component of have broad, largely overlapping expression patterns (Gkogkas et al., the Arp2/3 actin-nucleation complex. Genetic studies suggest that 2008; Larroquette et al., 2015; Lev et al., 2008). A P56S substitution SMN-1 promotes Arp2/3 activity important for localizing mitochondria in the VAPB MSPd is associated with amyotrophic lateral sclerosis to I-bands. Our results support the model that VAPB homologs are (ALS) and spinal muscular atrophy (SMA) (Di et al., 2016; circulating hormones that pattern the striated muscle mitochondrial Nishimura et al., 2004). ALS clinical symptoms often emerge when reticulum. This function is crucial in adults and requires SMN-1 in the patient is in their fifties and are characterized by progressive muscle, likely independent of its role in pre-mRNA splicing. muscle weakness, atrophy, and spasticity, resulting from degeneration of upper and lower motor neurons (Rowland, 1998). Most ALS cases KEY WORDS: MSP, Major sperm protein domain, SMN-1, VAPA, occur sporadically without a clear family history. However, mutations VAPB, Mitochondria, Striated muscle, ALS, Amyotrophic lateral in over 20 genes, including VAPB, are associated with familial ALS sclerosis, SMA, Spinal muscular atrophy forms (Peters et al., 2015). The MSPd P56S mutation also causes a late-onset form of SMA, INTRODUCTION which is characterized by lower motor neuron degeneration (Burghes VAMP/synaptobrevin-associated proteins (VAPs) comprise an and Beattie, 2009). Although SMA is more common in infants and evolutionarily conserved protein family with an N-terminal children, rare adult-onset cases do occur (Nishimura et al., 2004; major sperm protein domain (MSPd), coiled-coil motif, and Tiziano et al., 2013). Reduced survival of motor neuron 1 (SMN-1) transmembrane region (Lev et al., 2008). They are synthesized as function causes ∼95% of all SMA cases (Burghes and Beattie, 2009; type II integral membrane proteins with the MSPd residing in the Lefebvre et al., 1995). SMN-1 is part of a protein complex that cytosol. The MSPd is named after nematode major sperm proteins, controls the assembly of small nuclear ribonucleoproteins (snRNPs) which function as sperm cytoskeletal elements and secreted essential for pre-mRNA splicing (Fallini et al., 2012; Liu et al., 1997). signaling molecules (Bottino et al., 2002; Miller et al., 2001; It is not clear whether this function or an alternative function is crucial Roberts and Stewart, 2012). In animals, VAPs have two diverse for SMA pathogenesis (Cauchi, 2010). For instance, SMN-1 localizes to myofilaments in Drosophila flight muscles, where it regulates actin Department of Cell, Developmental and Integrative Biology, University of Alabama dynamics (Rajendra et al., 2007). at Birmingham, Birmingham, AL 35294, USA. *Present address: Yale University School of Medicine, New Haven, CT 06510, USA. Evidence is accumulating that MSPd signaling may be important ‡These authors contributed equally to this work in sporadic ALS cases. The VAP MSPd is found in human blood §These authors contributed equally to this work and cerebrospinal fluid (CSF), although its circulating function is ¶Author for correspondence ([email protected]) not understood (Deidda et al., 2014; Tsuda et al., 2008). In an Italian cohort, a majority of sporadic ALS patients had undetectable VAPB J.S., 0000-0003-0392-2724; S.-J.L., 0000-0001-9577-4305; J.V., 0000-0001- MSPd levels in CSF (Deidda et al., 2014). The pathogenic P56S 7740-8301; P.A.C., 0000-0003-1266-6734; M.A.M., 0000-0003-4872-7121 mutation prevents MSPd secretion in cultured cells and animal This is an Open Access article distributed under the terms of the Creative Commons Attribution tissues (Han et al., 2012; Tsuda et al., 2008). EphA4, an ephrin License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed. receptor that also interacts with the VAPB MSPd (Lua et al., 2011; Tsuda et al., 2008), modifies pathogenesis in ALS patients and in a

Received 16 March 2017; Accepted 8 May 2017 zebrafish model (Van Hoecke et al., 2012). Eph and Lar-related DEVELOPMENT

2175 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025 receptors are expressed in motor neurons and striated muscles. the muscle cytoplasm or belly (Fig. 1D). As larvae develop, muscle While both cell types are implicated in ALS, their respective roles mitochondria become progressively associated with I-bands, are not well delineated (Dupuis et al., 2011; Turner et al., 2013; forming parallel arrays of mitochondrial tubules. By the early Zhou et al., 2010). Familial ALS patients carry the pathogenic adult stage, most tubules are closely associated with I-bands mutation throughout their lives. Disease-causing mutant proteins (Fig. 1D) (Han et al., 2012). Thus, mitochondria in muscle develop tend to be expressed early and ubiquitously, potentially triggering their stereotypical positioning during larval development. secondary effects and compensatory mechanisms that mask At hatching, muscle mitochondria in vpr-1(tm1411) mutants look the primary pathological event. Unfortunately, defining early similar to those in the wild type. The tm1411 allele is a molecular pathogenic processes has proven challenging. A better null mutation that deletes the translational start site and entire understanding of MSPd function might provide insight into these MSPd (Han et al., 2012, 2013; Tsuda et al., 2008). vpr-1 mutant processes. mitochondria are predominantly peri-nuclear with tubules C. elegans and Drosophila VAPs have an important signaling branching into the cytoplasm (Fig. 1E). However, mitochondria in function that impacts striated muscle mitochondria (Han et al., 2012, vpr-1 mutant muscles fail to target I-bands during larval 2013; Tsuda et al., 2008). MSPd signaling to C. elegans body wall development and adulthood. They largely remain in the muscle muscle remodels the actin cytoskeleton, thereby docking belly, forming branched networks as the muscle grows in size mitochondria to myofilaments, altering fission/fusion balance and (Fig. 1E). These mitochondrial networks increase in complexity as promoting energy metabolism (Han et al., 2012). MSPd antagonizes the worm ages. Rhodamine 6G and MitoTracker CMXRos dyes signaling via the CLR-1 Lar-related tyrosine phosphatase receptor. stain vpr-1(tm1411) mutant muscle mitochondria well during early Excess CLR-1 activity promotes actin filament formation in the larval development. Staining is less efficient at the L4 and adult muscle belly, displacing mitochondria from I-bands. In aging worms, stages, perhaps reflecting changes in transmembrane potential or muscle cytoskeletal or mitochondrial abnormalities induce elevated tubule architecture (Han et al., 2012). During adulthood, Forkhead Box O (FoxO) transcription factor activity (Han et al., mitochondrial tubules are hyperfused and fat droplets accumulate 2013). FoxO promotes muscle triacylglycerol (TAG) accumulation, in the belly (Han et al., 2012, 2013). Consistent with fission/fusion alters ATP metabolism, and extends lifespan, despite reduced imbalance, transgenic lines expressing the fission mediator DRP-1:: mitochondria electron transport chain activity. Vapb knockout mice mCherry and fusion mediator FZO-1::mCherry show abnormal also exhibit abnormal muscular FoxO metabolic gene regulation (Han localization in adult vpr-1 mutant muscle (Fig. S1). We conclude et al., 2013). These data support the model that the MSPd promotes that the vpr-1 mutant muscle mitochondrial defects initiate in larval striated muscle energy metabolism. development, resulting in abnormal mitochondrial fission/fusion Here we use C. elegans to further investigate the VAP-related 1 dynamics in adults. (VPR-1) signaling mechanism. Our results support the model that In neurons, synapses have a high energy demand that depends neurons and germ cells secrete the MSPd into the pseudocoelom, on closely associated mitochondria (Hollenbeck and Saxton, 2005). where it acts on CLR-1 receptors expressed throughout the muscle To determine if vpr-1 loss affects neuronal mitochondrial localization, plasma membrane. Although vpr-1 mutant muscle mitochondrial we generated wild-type and vpr-1(tm1411) transgenic lines defects initiate early in larval development, MSPd–to–CLR-1 expressing mitoGFP and the synaptic vesicle marker mCherry:: signaling is sufficient during the L4 stage and adulthood to localize RAB-3 (Ding et al., 2007; Nonet et al., 1997) in motor neurons. There mitochondria to I-bands. In a suppressor screen, we identified was no statistical difference between the two lines in the percentage of SMN-1 as a crucial MSPd downstream mediator in muscle, where it mitochondria associated with synapses (Fig. S2). We observed a regulates mitochondrial morphology and localization. We propose possible increase in mCherry::RAB-3 puncta size in vpr-1(tm1441) that VAPB homologs have an evolutionarily conserved signaling mutants, suggesting that synaptic size or vesicle density is increased. function to pattern the mitochondrial reticulum in striated muscle. Therefore, vpr-1 loss causes mitochondrial localization defects in This signaling activity is essential during adulthood and requires larval and adult muscles, but not in motor neurons. Whether vpr-1 SMN-1 in muscle. loss causes functional or subtle trafficking defects in neuronal mitochondria is not clear with the present data. RESULTS Muscle mitochondrial defects in vpr-1 mutants emerge in The nervous system and germ line are major origins of VPR-1 larval development signaling activity In adult central body wall muscles, mitochondrial tubules lie in Previous experiments showed that driving vpr-1 cDNA expression parallel arrays on top of (or beneath, depending on dorsal or ventral pan-neuronally using the unc-119 promoter rescued ∼30-40% of the orientation) dense bodies along myofilament I-bands (Fig. 1A,B). muscle mitochondrial defects in vpr-1(tm1411) mutants (Han et al., Muscle mitochondria are visualized using a mitoGFP reporter 2012). We found that vpr-1 genomic sequence, including the 3′ expressed under the muscle-specific myo-3 promoter (Fig. 1B), as UTR, is more efficient than the cDNA with the unc-54 3′ UTR in well as dyes such as Rhodamine 6G and MitoTracker CMXRos rescuing the vpr-1 mutant gonadogenesis defect (Cottee et al., 2017). (Han et al., 2012, 2013). Mitochondria localize along actin-rich thin Transgenes containing vpr-1 genomic DNA driven by pan-neuronal filaments (Fig. 1C), where they undergo fission and fusion with (unc-119p), GABA motor neuron (unc-25p), cholinergic motor adjacent tubules (Han et al., 2012). Myofilaments appear normal in neuron (unc-17p), head interneuron (glr-5p) or sensory neuron (osm- vpr-1 mutants, but ectopic Arp2/3-dependent actin network 6p) specific promoters rescue the vpr-1 mutant muscle mitochondrial reorganization in the adult muscle belly displaces most defects in about half the muscles, with variation apparent among mitochondria from I-bands (Han et al., 2012, 2013). animals (Fig. 2; data not shown). By contrast, the endogenous vpr-1 To investigate the origin of vpr-1 mutant mitochondrial defects, promoter and genomic locus provide complete rescue (Han et al., we conducted a developmental timecourse starting at the L1 larval 2013). These results indicate that vpr-1 expression in diverse neuron stage. Shortly after hatching, mitochondria in wild-type body wall classes is sufficient to promote muscle mitochondrial localization, muscle are predominantly peri-nuclear and extend thin tubules into but additional sources of VPR-1 might be involved. DEVELOPMENT

2176 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

Fig. 1. Mitochondrial organization in C. elegans body wall muscle. (A) Diagram of adult muscle myofilaments showing positions of mitochondria relative to I-bands. Mitochondrial tubules lie on top (or beneath, depending on orientation) of dense bodies (DBs). (B) Mitochondria in a single adult body wall muscle visualized with the myo-3p::mitoGFP transgene (Labrousse et al., 1999). Dense bodies are visible as dark dots along the muscle striations in the differential interference contrast (DIC) channel (arrow in higher magnification inset). FITC, fluorescein isothiocyanate. (C) Organization of mitochondria along thin filaments. The myo-3p::moesin::mCherry transgene labels muscle actin. Mitochondrial tubules extend along thin filaments, undergoing fission and fusion with adjacent tubules (Han et al., 2012). (D,E) Developmental timecourse of mitochondrial organization in wild-type (D) and vpr-1(tm1411) null mutant (E) muscles. Mitochondria are visualized by mitoGFP and Rhodamine 6G. Arrows indicate fat droplets; asterisk, nucleus; L1-L4, larval stages; Ad, adult stage. Scale bars: 5 µm.

Genetic mosaic analysis using the vpr-1 genomic locus indicates hermaphrodites lack maternal vpr-1 mRNA and contain a single that vpr-1 expression is essential in the nervous system and germ copy of the pie-1p::vpr-1 transgene provided in the paternal line but not in muscle to promote muscle metabolism (Han et al., genome. In both experiments, the vpr-1 mutant muscle 2013). The germ line is a source of maternal mRNAs provided to the mitochondrial defects were rescued in about half the muscle, with embryo, as well as zygotic gene expression in developing and adult variability among animals (Fig. 2B). Therefore, zygotic germline gonads. The germ line and muscle can exchange signaling vpr-1 expression is sufficient to promote body wall muscle molecules and other factors through the pseudocoelom (Fig. 2A). mitochondrial localization. In summary, the results of these Maternal vpr-1 mRNA is sufficient to weakly rescue the vpr-1 genetic mosaic and transgenic expression studies are consistent (tm1411) mitochondrial defects in adult muscle (Fig. 2B). To with the nervous system and germ line acting together as major investigate zygotic germline expression, we generated single-copy sources of VPR-1 MSPd signaling activity to body wall muscle. integrated transgenic lines that express vpr-1 under the pie-1 germline promoter (Seydoux and Dunn, 1997). Two independent Endogenous CLR-1 receptor is expressed throughout the integrated transgenes were crossed into the vpr-1(tm1411) sarcolemma in larval and adult worms background. Both transgenes completely rescued the muscle The VPR-1 MSPd might signal to muscle from the pseudocoelom mitochondria (Fig. 2B) and gonad development defects (Cottee or via the neuromuscular junction during larval development, et al., 2017). We used two strategies to evaluate zygotic germline adulthood, or both. MSPd signals are transduced in muscle vpr-1 expression (see Materials and Methods). These vpr-1 mutant through the CLR-1 receptor (Han et al., 2012, 2013). The CLR-1 DEVELOPMENT

2177 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

Fig. 2. Non-cell-autonomous VPR-1 action on body wall muscle mitochondria. (A) Diagram of an adult hermaphrodite showing the germ line, nervous system, muscles and pseudocoelom (adapted from Altun and Hall, 2017). The dotted line indicates the level of the transverse section. (B) Mitochondria in adult body wall muscle visualized using mitoGFP or Rhodamine 6G. The unc-25p::vpr-1g transgene expresses vpr-1 in GABA motor neurons along the nerve cord, whereas the glr-5p::vpr-1 transgene expresses vpr-1 in head interneurons mainly in the nerve ring. The pan-neuronal unc- 119 promoter, sensory neuron osm-6 promoter, and cholinergic motor neuron unc-17 promoter produced similar results (not shown). Maternal vpr-1 is provided in oocytes from a vpr-1 (tm1441)/hT2 heterozygous hermaphrodite. The pie-1p::vpr-1g integrated single-copy (MosSCI) transgene expresses vpr-1 in the germ line. Two independent vpr-1(tm1411); Si1[pie-1p::vpr- 1+unc-119(+)] lines showed complete rescue of gonad and muscle phenotypes and were maintained as homozygous mutant lines. vpr-1(tm1441) hermaphrodites expressing vpr-1 in the zygotic germ line only were generated by crossing vpr-1 (tm1411); Si1[pie-1p::vpr-1+unc-119(+)] males to maternally rescued F1 vpr-1(tm1441) hermaphrodites. Asterisk, nucleus. Scale bars: 5 µm.

expression pattern should provide clues as to where and when the plasma membrane, called the sarcolemma, and in puncta MSPd signal transduction initiates. To determine endogenous within the muscle cytoplasm (Fig. 3B). We did not detect CLR-1 expression, we used Cas9 to fuse tdTomato to the clr-1 enrichment or absence at post-synaptic plasma membrane sites genomic locus, creating a C-terminal fusion protein (Fig. 3A). near the nerve cord, showing that CLR-1 is uniformly expressed. Reduced clr-1 function in the hypodermis causes fluid to Cell surface CLR-1 expression did not significantly change in the accumulate throughout the pseudocoelom, arresting development vpr-1(tm1411) background (Fig. S4). Therefore, the CLR-1 and causing gonad degeneration (Huang and Stern, 2004; Kokel extracellular domain is accessible to MSPd signals secreted from et al., 1998). tdTomato insertion did not disrupt CLR-1 function, adjacent motor neurons or from more distant neurons and germ as shown by growth to adulthood, fertility, and the absence of cells via the pseudocoelom. fluid accumulation. We observe endogenous CLR-1::tdTomato expression in muscle and a variety of other cell types, including MSPd signaling via CLR-1 is sufficient during adulthood somatic gonad, hypodermis and neurons (Fig. 3B and Fig. S3). In The MSPd interacts with the CLR-1 extracellular domain to larval and adult body wall muscle, CLR-1 is expressed throughout antagonize CLR-1 receptor tyrosine phosphatase signaling (Han

Fig. 3. Endogenous CLR-1 receptor expression in larval and adult muscles. (A) Cas9 engineering showing the tdTomato insertion site within the clr-1 genomic locus. The C. briggsae unc-119 gene was used for screening. Asterisks indicate downstream genes (*, mrps-16; **, F56D1.2). (B) DIC, fluorescence [tetramethylrhodamine isothiocyanate (TRITC)] and merged images focusing on body wall muscles. In the DIC image, the characteristic rhomboid shapes of body wall muscles are hand drawn in yellow (Francis and Waterston, 1985). Arrowheads point down to locations of clr-1::tdTomato expression along the muscle sarcolemma. Scale bars: 10 µm. DEVELOPMENT

2178 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025 et al., 2012). Accordingly, CLR-1 loss suppresses the vpr-1 (tm1411) mitochondrial defects (Han et al., 2012). To investigate the temporal requirements of MSPd signaling, we took advantage of the clr-1(e1745ts) temperature-sensitive allele (Kokel et al., 1998). Shifting clr-1(e1745ts) worms from the permissive temperature (16°C) to the restrictive temperature (25°C) reduces CLR-1 function, resulting in fluid accumulation. To avoid confounding issues due to fluid, we generated vpr-1(tm1411); clr-1(e1745ts) transgenic animals that express clr-1 specifically in the hypodermis using the rol-6 promoter. The rol-6p::clr-1 transgene largely rescued the clr-1(e1745ts) fluid accumulation defect, allowing for development (Fig. S5). At the permissive temperature, muscle mitochondria in transgenic double mutants exhibited either the highly branched networks seen in vpr-1 null muscle or more fragmented networks with no apparent organization (Fig. 4A). We shifted the double mutants to the restrictive temperature at various times during development, thereby simulating MSPd signaling through CLR-1 inactivation. When the mutants were shifted at embryonic or early larval stages (L1-L2) and grown to adulthood, mitochondria aligned at myofilaments, but with abnormal morphology (Fig. 4B). However, shifting them at L4 and early adulthood rescued the muscle mitochondrial defects scored 3 days later (Fig. 4C). These data suggest that MSPd signaling via CLR-1 is sufficient in late larval and adult stages, when a major source of MSPd signals, the germ line, is expanding and differentiating. Temporally inducing vpr-1 expression in head neurons using the Fig. 4. Temporally controlled MSPd activity in vpr-1 null mutants. The clr-1 binary Q system (Wei et al., 2012) also promoted muscle (e1745ts) temperature-sensitive mutation was used to inactivate CLR-1 (Kokel mitochondrial alignment (Cottee et al., 2017). et al., 1998), thereby simulating MSPd signaling. The rol-6p::clr-1 transgene In 1-day adult vpr-1 mutants, the muscle mitochondrial reticulum drives clr-1 expression specifically in the hypodermis to alleviate fluid is strongly disrupted due to excess CLR-1 activity (Fig. 1E) (Han accumulation (Huang and Stern, 2004). myo-3p::mitoGFP was used to visualize muscle mitochondria. The diagram summarizes the restrictive et al., 2012). To test whether this reticulum can be remodeled, we temperature shift initiation period according to developmental stage. E, shifted 1-day adult worms to the restrictive temperature and observed embryonic stage. (A) vpr-1(tm1411);clr-1(e1745ts) adult worm grown at the their mitochondria 24, 48 and 72 h later. After 24 h, the mitochondria permissive temperature. Mitochondrial tubules are found throughout the are still largely disorganized and surround fat droplets in the muscle muscle belly, along with fat droplets (arrows) (Han et al., 2013). In some belly (Fig. 4D). Mitochondria disorganization and increased fat animals, the mitochondria appear fragmented. (B) vpr-1(tm1411);clr-1 droplets are both due to abnormal Arp2/3 activity (Han et al., 2012, (e1745ts) adult worm shifted to restrictive temperature as embryos. The 2013). Shifting for 24 h is sufficient to induce fluid accumulation in mitochondria largely align at I-bands, but are often fragmented and poorly organized. Few fat droplets are seen. Similar results are observed when nontransgenic mutants, indicating that CLR-1 function is shifting at L1 and L2 stages. (C) vpr-1(tm1411);clr-1(e1745ts) adult worm compromised. At 48 h, most mitochondrial tubules are aligned at shifted to restrictive temperature for 3 days starting as an L4. (D-F) Timecourse myofilaments, although morphology is still abnormal (Fig. 4E). By showing vpr-1(tm1411);clr-1(e1745ts) adult worm shifted to the restrictive 72 h, mitochondria are positioned correctly at I-bands with temperature for (D) 24 h, (E) 48 h and (F) 72 h. Asterisk, nucleus. Scale bar: morphology similar to those in wild-type muscle (Fig. 4F). Very 10 µm. few fat droplets are observed in the cytoplasm. These data suggest that MSPd signals continuously instruct muscle mitochondria to localization in the muscle cytoplasm, preventing mitochondria from remodel via an active process throughout adulthood. targeting I-bands. Disrupting this pathway suppresses the vpr-1 (tm1411) muscle mitochondrial defects, which is likely to be A vpr-1 mutant mitochondrial suppressor screen identifies because a redundant mechanism localizes mitochondria to I-bands. smn-1 Our suppressor screen should identify those gene products We next sought to understand how MSPd signals are transduced in specifically required for abnormal mitochondrial localization muscle. To identify downstream mediators, we developed a vpr-1 caused by MSPd deficiency. As a pilot investigation, we tested 31 (tm1411) RNAi suppressor screen based on prior work using arx-2 RNAi clones corresponding to C. elegans homologs of genes and clr-1. arx-2 (also known as arp-2) encodes a component of the implicated in ALS and SMA (Table S1). Three potential Arp2/3 complex (Roh-Johnson and Goldstein, 2009). Arp2/3 loss in suppressors were identified: the nuclear export receptor xpo-1, the vpr-1 mutants suppresses the muscle mitochondrial defects (Han Gemin3 homolog mel-48, and the survival of motor neuron 1 gene et al., 2012). Transgenic lines that express functional ARX-2:: smn-1. In this paper, we focus on smn-1. Similar to inactivation of mCherry (see below) in wild-type muscle show punctate clr-1 or arx-2 (Fig. 4D and Fig. 5C), smn-1 RNAi largely suppresses localization between thin filaments, slightly above mitochondrial the muscle mitochondrial defects in vpr-1 mutant animals (Fig. 5C). tubules (Fig. 5A,B). Little ARX-2::mCherry is found in the muscle smn-1 RNAi initiated in the parental generation often causes larval belly (Fig. 5B). In vpr-1 mutants, ARX-2::mCherry is observed at arrest in vpr-1 mutant progeny and muscle mitochondria to localize myofilaments and throughout the belly (Fig. 5B), where actin to I-bands with more globular morphology. smn-1 RNAi initiated in filaments and most mitochondria exist. These data support the L2-L3 larva is sufficient to partially suppress the vpr-1 mutant model that excess CLR-1 signaling promotes Arp2/3 activity and/or mitochondrial defect, suggesting that smn-1 activity is essential DEVELOPMENT

2179 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

Fig. 5. Arp2/3 complex localization and function in wild-type and vpr-1 mutant muscles. (A) ARX-2 localization at the muscle myofilament, visualized using a functional myo-3p::arx-2::mCherry transgene and myo-3p::moesin::GFP transgene that labels actin. ARX-2::mCherry puncta lie between thin filaments, possibly at dense bodies. (B) ARX-2::mCherry and mitoGFP localization in adult wild-type and vpr-1 mutant muscle. Columns show different depths of view, starting at the myofilament. The muscle belly lies 1-3 μm beneath myofilaments. (C) Representative results from the suppressor screen showing arx-2 RNAi and smn-1 RNAi. Asterisk, nucleus. Scale bars: 5µminA;10µminB,C.

during late larval development and adulthood. smn-1 RNAi also To test whether smn-1 is necessary in muscle, we specifically partially suppresses vpr-1 null mutant muscle fat droplet depleted smn-1 in body wall muscle of wild-type animals using an accumulation, as measured using fluorescent BODIPY fatty acid RNAi mosaic strategy (Durieux et al., 2011; Esposito et al., 2007). analogs (Fig. S6). We did not observe mitochondrial or fat droplet sid-1 (systemic RNA interference deficiency-1) mutants are suppression following RNAi of C. elegans homologs of Gemin2, defective for siRNA transport between cells, thereby preventing Gemin6, Gemin7 or other genes crucial for pre-mRNA splicing systemic RNAi effects. However, producing siRNA within tissues (Table S1 and Fig. S7). Hence, smn-1 function may be independent still induces cell-autonomous RNAi (Winston et al., 2002). We of its role in spliceosome assembly. expressed smn-1 sense and antisense RNAs in body wall muscle smn-1 is broadly expressed and smn-1(ok355) null mutants of sid-1(pk3321) mutants. Muscle smn-1 RNAi causes arrest development around the L3 stage, after maternal smn-1 mitochondrial morphological defects similar to those seen in mRNA is depleted (Briese et al., 2009). During this stage, smn-1 mutants or systemic RNAi hermaphrodites (Fig. 6A,C). mitochondria in smn-1 knockout body wall muscle are largely smn-1 reduction of function suppresses the vpr-1 null muscle globular in morphology and abnormally positioned throughout the mitochondrial defects, whereas smn-1 loss throughout belly (Fig. 6A). To test whether smn-1 functions in muscle, we development causes more globular mitochondrial morphology. generated smn-1(ok355) transgenic worms that express smn-1:: In summary, a vpr-1 mitochondrial suppressor screen identified mCherry specifically in muscle using the myo-3 promoter. The smn-1, which is necessary and sufficient in muscle to control myo-3p::smn-1::mCherry transgene rescued the muscle mitochondrial morphology. mitochondrial defects of smn-1(ok355) worms (Fig. 6B). In addition, muscle smn-1 expression partially suppresses the larval SMN-1 and ARX-2 colocalize at muscle myofilaments arrest and sterility phenotypes in a subset (<15%) of smn-1(ok355) SMN-1 expressed from the rescuing smn-1::mCherry transgene mutants (Fig. 6B). We conclude that the smn-1::mCherry is seen in the nucleus and cytoplasm (Fig. 7A). In the cytoplasm, transgene is functional and smn-1 expression in muscle is most SMN-1::mCherry is found at myofilaments in regularly sufficient to regulate mitochondria. spaced puncta. These puncta appear more ordered in adult DEVELOPMENT

2180 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

Fig. 6. SMN-1 functions in body wall muscle. (A) Mitochondria visualized with mitoGFP in smn-1 (ok355) mutant muscle. smn-1(ok355) hermaphrodites arrest development around the L3 stage when maternal smn-1 runs out (Briese et al., 2009). (B) Muscle mitochondria in smn-1(ok355) mutants expressing smn-1::mCherry specifically in muscle. The top two panels are from the same L4 stage hermaphrodite; the bottom three panels are from different adult hermaphrodites. Some transgenic mutants are able to progress to L4 and young adult stages and contain embryos (E), which are not seen in nontransgenic smn-1(ok355) mutants. (C) Mitochondria in adult muscle following muscle- specific smn-1 RNAi using sid-1 mutants. Asterisk, nucleus. Scale bars: 5 µm in A,C; as indicated in B.

muscle as compared with younger muscle (Fig. 7A). The SMN-1 SMN-1 may promote Arp2/3 activity in muscle expression pattern at muscle myofilaments resembles that of The above data and dependence of mitochondrial localization on ARX-2::mCherry (Fig. 5A). To test whether ARX-2 and SMN-1 actin remodeling raise the possibility that SMN-1 promotes Arp2/3 colocalize, we generated transgenic animals expressing both activity. In this case, smn-1 depletion should cause a similar muscle smn-1::GFP and arx-2::mCherry in muscle. SMN-1::GFP mitochondrial phenotype as arx-2 depletion. Although arx-2 null colocalizes with ARX-2::mCherry at the thin filaments worms are embryonic lethal, restricting arx-2 inactivation to wild- (Fig. 7B). However, only SMN-1 is observed in the nucleus. type larval and adult stages via RNAi feeding causes muscle We occasionally observed SMN-1::GFP and ARX-2::mCherry in mitochondria to adopt globular morphologies (Fig. 8A) (Han et al., peri-nuclear puncta (data not shown). SMN-1::GFP and ARX-2:: 2012). Muscle mitochondria in smn-1(ok355) and smn-1 RNAi mCherry also colocalize in the vpr-1(tm1411) background, hermaphrodites exhibit similar globular morphologies (Fig. 6 and indicating that MSPd signaling does not influence their Fig. 8A). Moreover, smn-1(ok355) heterozygotes also contain association (Fig. 7B). We conclude that SMN-1 and ARX-2 abnormally shaped mitochondria (Fig. 8A), suggesting that the colocalize at muscle myofilaments adjacent to elongated smn-1 expression level is important. Thus, reduced smn-1 or arx-2 mitochondrial tubules. function causes similar muscle mitochondrial phenotypes.

Fig. 7. SMN-1 and ARX-2 localization in body wall muscle myofilaments. (A) The rescuing myo-3p::smn-1::mCherry transgene shows SMN-1 expression in the nucleus (asterisk) and in puncta at myofilaments. Expression is sometimes observed in peri-nuclear puncta in the muscle belly. (B) Confocal images showing SMN-1::GFP and ARX-2::mCherry localization at myofilaments of adult control and vpr-1 mutant muscles. Boxed areas are magnified on the right. Puncta are also observed in the muscle belly of vpr-1 mutants (see Fig. 5B). Scale bars: 5 µm. DEVELOPMENT

2181 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

Current data suggest that arx-2 and smn-1 act in the same cytoplasm, actin cytoskeletal reorganization events requiring the pathway. To further investigate their relationship, we expressed the Arp2/3 complex and SMN-1 shift mitochondria from the cytoplasm myo-3p::arx-2cDNA::mCherry transgene in smn-1(ok355) null to I-bands, where they form parallel arrays that fuse and divide. mutants (Fig. 8B-F). arx-2 expression may escape endogenous Continuous MSPd signaling during adulthood is required to RNA regulatory interactions because the transgene lacks arx-2 maintain mitochondrial localization. Below, we further discuss the introns and 3′ UTR (Fig. 8C). We found that ARX-2::mCherry model, focusing on its developmental origin and implications for localizes to myofilament puncta in smn-1(ok355) muscle (Fig. 8B), motor neuron diseases. similar to the localization in wild-type muscle (Fig. 5). Importantly, Genetic mosaic analysis demonstrates that vpr-1 loss in the ARX-2::mCherry overexpression partially suppresses the smn-1 nervous system or germ line, but not in muscle, causes the muscle mutant mitochondrial defect, as mitochondria adopt elongated metabolic abnormalities (Han et al., 2013). Expressing vpr-1 morphologies often along I-bands (Fig. 8D,E). ARX-2::mCherry specifically in germ cells or neuron subsets is sufficient to rescue the overexpression also mildly, but significantly, increased smn-1 vpr-1 mutant muscle and gonad phenotypes, although not in all mutant mobility in the thrashing assay (Briese et al., 2009), which animals. Expression from multiple cell types provides complete measures the ability to contract body wall muscles in liquid medium rescue. The data point to neurons and germ cells as primary MSPd (Fig. 8F). Taken together, the results support the model that SMN-1 secretion sites, which act collectively. Secreted MSPds are likely to and Arp2/3 promote actin remodeling events needed to localize enter the pseudocoelom, a primitive circulatory system that bathes mitochondria in muscle. the body wall muscles and other internal organs (Hall et al., 1999). We show that endogenous CLR-1 receptor is expressed throughout DISCUSSION the muscle plasma membrane in larval and adult worms, where it is The results presented here, together with those in prior studies, accessible to the pseudocoelomic fluid. These results are consistent suggest that VAPB proteins have a noncanonical function as an with the MSPd having endocrine and paracrine signaling activity to endocrine factor to pattern the striated muscle mitochondrial muscle. reticulum. The primary mechanism hinges on a secreted VAP A temperature-sensitive clr-1 mutation (Kokel et al., 1998) was proteolytic fragment, the MSPd (Tsuda et al., 2008). In C. elegans, used to temporally induce MSPd signaling in vpr-1 null animals. the secreted MSPd antagonizes the CLR-1 Lar-like phosphatase MSPd signaling at the L4 stage or during adulthood is sufficient to receptor, triggering changes in muscle mitochondrial localization, localize mitochondrial tubules to muscle I-bands. Earlier inductions fission/fusion and function (Han et al., 2012). Disrupting MSPd promote mitochondrial localization, but morphology is abnormal. It signaling causes energy deficit in adult muscle, along with is possible that MSPd levels rise throughout larval development as compensatory metabolic changes during aging (Han et al., 2013). germ cells increase in number, further antagonizing CLR-1 Here we show that muscle mitochondria target myofilament I-bands signaling. In wild-type animals, reducing muscle clr-1 function during late larval development and adulthood. This mitochondrial throughout larval development causes globular instead of patterning mechanism fails in vpr-1 null mutants. Our results tubular mitochondrial morphology (Han et al., 2012). A balance support the model that neurons and germ cells secrete the MSPd into in CLR-1 signaling might be important early in development, the pseudocoelomic fluid, where it interacts with CLR-1 throughout whereas CLR-1 is largely inactive during adulthood. Muscle the muscle plasma membrane. Downstream in the muscle mitochondrial networks are already disorganized in young adult

Fig. 8. SMN-1 promotes Arp2/3 activity in muscle. (A) Muscle mitochondria in control, mutant, and RNAi hermaphrodites. smn-1 reduction of function closely resembles arx-2 reduction of function (Han et al., 2012). The hT2 balancer chromosome has a wild-type copy of smn-1. (B) Merged DIC and fluorescence (TRITC) image showing ARX-2::mCherry localization at muscle myofilament of an smn-1 (ok355) mutant. (C) The arx-2::mCherry transgene. (D,E) Muscle mitochondria in nontransgenic (D) and transgenic (E) smn-1 (ok355) mutants. Asterisk (A,D,E), nucleus. (F) Body bends per minute of L3 stage worms of the indicated genotypes in liquid medium (N=15). Bars indicate s.d. The wild-type value is 242±21 thrashes per minute. *P<0.01, Student’s t-test. Scale bars: 5 µm. DEVELOPMENT

2182 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025 vpr-1 mutants, yet CLR-1 inactivation at this time induces (q782) qIs48] (I;III); XM1101 vpr-1(tm1411)/hT2 [bli-4(e937) let-?(q782) remodeling events that target mitochondria to I-bands within 48 qIs48]; clr-1(e1745ts); XM1102 clr-1(e2530)/mIn1 [dpy-10(e128) mIs14] to 72 h. Therefore, MSPd activity on muscle appears to be (II); and LM99 smn-1(ok355)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). instructive. Studies with the clr-1(e1745ts) temperature-sensitive (ts) allele were In muscle, CLR-1 activity triggers actin remodeling in the muscle performed at permissive (16°C) and restrictive (25°C) temperatures. Strain construction involved PCR, sequencing (UAB Heflin Center for Genomics belly that is dependent on the Arp2/3 complex (Han et al., 2012). Sciences), and phenotypic analyses. vpr-1(tm1441) mutants are maternal These actin networks prevent mitochondria from associating with effect sterile (Cottee et al., 2017). Phenotypes were evaluated in vpr-1 2+ actin-rich I-bands, where ATP and Ca levels fluctuate (Moerman (tm1411) homozygous F2 progeny from vpr-1(tm1411)/hT2 heterozygotes and Williams, 2006). The MSPd attenuates CLR-1 signaling, (P0), unless otherwise indicated. vpr-1(tm1411) homozygous F1 progeny thereby restricting Arp2/3 activity to the I-band. Mitochondria then contain maternal vpr-1 mRNA. align along the I-band, alter their fission/fusion properties, and alter function (Han et al., 2013). Whether Arp2/3 restriction occurs by Zygotic vpr-1 germline expression controlling localization or actin nucleation activity is not clear. We We used two strategies to evaluate zygotic germline vpr-1 expression. In the identified smn-1 in an RNAi screen for vpr-1 mutant mitochondrial first, we mated vpr-1(tm1411); Si1[pie-1p::vpr-1+unc-119(+)] males to F1 vpr-1(tm1411) hermaphrodites derived from vpr-1(tm1411)/hT2 suppressors. SMN-1 acts in muscle, where it colocalizes with the heterozygous hermaphrodites. All cross progeny were scored. These Arp2/3 complex. Genetic studies are consistent with SMN-1 vpr-1(tm1411) null worms lack maternal vpr-1 and contain a single copy of promoting Arp2/3 activity. This function is sensitive to gene the male-derived pie-1p::vpr-1 transgene for zygotic germline expression. dosage, suggesting that the SMN-1 expression level is important. It In the second strategy, we mated vpr-1(tm1411); Si1[pie-1p::vpr-1+unc- might also require the Gemin3 homolog MEL-46, but appears 119(+)] males to vpr-1(tm1411); Ex[unc-119p::vpr-1+myo-3p::mitoGFP] independent of other gemins, SM proteins, and other proteins hermaphrodites. vpr-1(tm1411) cross progeny lacking the extrachromosomal involved in snRNP assembly. Prior studies have implicated SMN-1 array were scored. These progeny contained a single copy of the male-derived in mRNA transport and actin remodeling independent of its snRNP pie-1p::vpr-1 transgene. Both experiments show rescue of the vpr-1 mutant role, although the mechanism is not well understood (Burghes and muscle mitochondrial defects in about half the muscle, with variability among Beattie, 2009; Fallini et al., 2012; Rajendra et al., 2007). animals. In humans, reduced VAPB MSPd function is associated with Molecular cloning sporadic and familial ALS cases (Deidda et al., 2014; Kabashi et al., To create the Cas9 DNA template for tdTomato insertion into the clr-1 2013; Larroquette et al., 2015; Mitne-Neto et al., 2011; Teuling et al., genomic locus, Gibson assembly was used to construct a plasmid containing 2007; Tsuda et al., 2008). Patients with the VAPB P56S mutation clr-1 2 kb left homology arm::tdTomato::clr-1 3′UTR::unc-119::2 kb right present with ALS, atypical ALS forms, or late-onset SMA (Marques homology arm. The unc-119 rescue fragment is from plasmid pCFJ66 et al., 2006; Nishimura et al., 2004). Outside of these patients, the vast (Addgene plasmid #24981) and includes C. briggsae unc-119. The single majority of late-onset (type IV) SMA cases are due to reduced SMN1 guide RNA (sgRNA) plasmid was derived from Addgene plasmid 46169. function (Burghes and Beattie, 2009). Delayed onset is thought to Cas9 targeting sequence was 5′-ACTATATCTCTAAGACATAT-3′.PCR result from extra copies of SMN2, which can weakly compensate for was used to amplify the entire sgRNA backbone, except for 20 bp that belong SMN1 loss (Butchbach, 2016). SMN1 and SMN2 copy number have to unc-119. DNA fusions were constructed using Gibson assembly. The rol- also been implicated in ALS (Blauw et al., 2012; Butchbach, 2016). 6p::clr-1 construct was made with clr-1 genomic DNA. 2 kb upstream of the rol-6 start codon was amplified by PCR. unc-119p::mitoGFP was created Our results show that C. elegans VAPB and SMN-1 homologs act in a using the unc-119 promoter (Maduro and Pilgrim, 1995) and mitoGFP signaling pathway governing a striated muscle mitochondrial sequences (Labrousse et al., 1999). Pan-neuronal (unc-119p, 2000 bp), transition. Motor neurons expressing the MSPd/ephrin receptor GABA motor neuron (unc-25p, 1893 bp) (Jin et al., 1999), cholinergic motor VAB-1 might also participate in some way (Brisbin et al., 2009). neuron (unc-17p, 2003 bp) (Lickteig et al., 2001), head interneuron (glr-5p, In mammalian fast-twitch muscle fibers, mitochondrial doublets 2003 bp) (Brockie et al., 2001) and sensory neuron (osm-6p,430bp)(Collet encircle myofibers at I-bands, where they couple to the sarcotubular et al., 1998) promoters were fused upstream of the vpr-1 genomic locus, which system (Boncompagni et al., 2009; Pham et al., 2012). Similar to included the 3′ UTR. PCR was used to amplify sequences from genomic C. elegans, mitochondria acquire this I-band positioning during DNA. The pie-1 promoter sequence included 1095 bp upstream of the pie-1 postnatal development (Boncompagni et al., 2009). These data raise translational start site. The vpr-1 DNA sequence included exons and introns, ′ an intriguing model. Reduced VAPB or SMN-1 function might as well as 745 bp of 3 UTR. Gateway recombination (Invitrogen) was used to generate myo-3p:: perturb a mitochondrial transition in the postnatal neuromuscular moesin::mCherry, myo-3p::moesin::GFP, myo-3p::arx-2::mCherry, myo- system. Motor neurons innervating fast-twitch fibers are the first to 3p::smn-1::mCherry, myo-3p::smn-1::GFP, myo-3p::drp-1::mCherry and degenerate in ALS mouse models (Van Hoecke et al., 2012; Vinsant myo-3p::fzo-1::mCherry. To generate entry plasmids, drp-1, fzo-1 and arx-2 et al., 2013a,b). Either muscle mitochondrial dysfunction or entry plasmids were prepared by PCR using a cDNA library as the template. compensatory mechanisms could predispose these motor neurons smn-1 cDNA was amplified by PCR from a plasmid containing the smn-1 to degeneration during aging. An important implication is that ORF (Open Biosystems). Drosophila Moesin (dmoesin) was amplified by motor neuron disease may initiate many years before clinical PCR from pJWZ6 (Addgene plasmid #21744). All PCR products were symptoms emerge. Therefore, a much larger window could exist for cloned into pDONR221 entry vector and sequenced. The entry vectors were ′ therapeutic interventions and biomarker development to track subsequently used for the LR recombination reaction. The unc-54 3 UTR ′ ′ disease progression. was used, except where indicated. Primers (5 -3 ; F, forward; R, reverse) are: drp-1 F1, GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGGA- AAATCTCATTCCTGTCG; drp-1 R1, GGGGACCACTTTGTACAAG- MATERIALS AND METHODS AAAGCTGGGTACCAAACTTGTGTTTCTCTCAC; fzo-1 F1, GGGG- C. elegans genetics and strains ACAAGTTTGTACAAAAAAGCAGGCTCCATGTCTGGCACAGCAAG- C. elegans were maintained at 20°C unless otherwise indicated, and fed with CTTA; fzo-1 R1, GGGGACCACTTTGTACAAGAAAGCTGGGTATGG- NA22 E. coli bacteria (Brenner, 1974; Edmonds et al., 2010; Kubagawa CGTTGGCGGAGAGTC; arx-2 F, GGGGACAAGTTTGTACAAAAAA- et al., 2006). The following strains were used: N2 Bristol (wild type); GCAGGCTCCATGGATTCGCAAGGGCGAAAG; arx-2 R, GGGGACC-

CB3241 clr-1(e1745ts); VC1478 vpr-1(tm1411)/hT2 [bli-4(e937) let-? ACTTTGTACAAGAAAGCT DEVELOPMENT

2183 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

GGGTAAGCTTTGATTCCAAGTTTGGC; smn-1 F, GGGGACAAGTTT- Acknowledgements GTACAAAAAAGCAGGCTCCATGGCAAAAATCTGGTCGAAAAG; We thank Matthew Schultz, M.A.M. lab members and other colleagues for smn-1 R, GGGGACCACTTTGTACAAGAAAGCTGGGTAATTTTGA- discussions regarding this work and manuscript comments. Three anonymous ACATTTTTCTGATCCGC; arx-2 F2, GGGGACAGCTTTCTTGTACA- reviewers provided valuable criticisms. We also thank Sarah Peterson and David Miller for the unc-25p::mCherry:rab-3 plasmid. AAGTGGCCATGGATTCGCAAGGGCGAAAG; arx-2 R2, GGGGAC- AACTTTGTATAATAAAGTTGGAATCAGTTAATAAATGAGTTGGA; Competing interests arx-2 R3, GGGGACCACTTTGTACAAGAAAGCTGGGTGAATCAGT- M.A.M. filed a patent application (PCT/US2014/030598) in 2014. TAATAAATGAGTTGGA; dmoesin F, GGGGACAAGTTTGTACAAA- AAAGCAGGCTCCATGGACGAAGTGGAAGACGCCC; dmoesin R, Author contributions GGGGACCACTTTGTACAAGAAAGCTGGGTACATGTTCTCAAAC- Conceptualization: M.A.M., S.M.H.; Validation: J.S., S.L., T.C., M.A.M., S.M.H.; TGATCGAC; dmoesin F1, GGGGACAAGTTTGTACAAAAAAGCAG- Formal analysis: M.A.M.; Investigation: J.S., S.L., T.C., H.D.H., J.V., P.A.C., M.A.M., GCTTCATGGTCTCAAAGGGTGAAG; dmoesin R2, GGGGACCACTT- S.M.H.; Writing - original draft: J.S.; Writing - review & editing: M.A.M., S.M.H. TGTACAAGAAAGCTGGGTAGGATCTTTACATGTTCTCAAAC. Funding Statistical tests This project was funded by the Muscular Dystrophy Association (MDA381893 to Two-tailed Student’s t-tests were computed using Excel 2013 (Microsoft) M.A.M.). Financial support for J.S. came from the National Science Foundation Graduate Research Fellowship Program and the University of Alabama at without the assumption of equal variance. Birmingham Howard Hughes Medical Institute Med-Grad Program. Some strains were provided by the Caenorhabditis Genetics Center, which is funded by the Imaging National Institutes of Health Office of Research Infrastructure Programs (P40 Confocal images were taken with a Nikon 2000 U inverted microscope, OD010440). Deposited in PMC for immediate release. fitted with a PerkinElmer UltraVIEW ERS 6FE-US spinning disk laser apparatus. Confocal images were processed with ImageJ version Supplementary information 1.48 (NIH). All other worm images were taken by a motorized Zeiss Supplementary information available online at Axioskop equipped with epifluorescence and AxioVision software http://dev.biologists.org/lookup/doi/10.1242/dev.152025.supplemental version 4.8. Muscle mitochondria were visualized using the myo-3p::mitoGFP References Altun, Z. F. and Hall, D. H. (2017). Handbook of C. elegans anatomy. In WormAtlas, transgene, Rhodamine 6G dye, or MitoTracker CMXRos dye (Han et al., http://www.wormatlas.org/hermaphrodite/hermaphroditehomepage.htm. 2012, 2013). An advantage of the transgene is that muscle mitochondria are Blauw, H. M., Barnes, C. P., van Vught, P. W. J., van Rheenen, W., Verheul, M., specifically labeled, but a disadvantage is that mitoGFP overexpression can Cuppen, E., Veldink, J. H. and van den Berg, L. H. (2012). SMN1 gene cause abnormal mitochondrial morphology and location. The dyes do not duplications are associated with sporadic ALS. Neurology 78, 776-780. appreciably affect mitochondrial morphology or location, although they Boncompagni, S., Rossi, A. E., Micaroni, M., Beznoussenko, G. V., Polishchuk, stain mitochondria in most cells. R. S., Dirksen, R. T. and Protasi, F. (2009). Mitochondria are linked to calcium stores in striated muscle by developmentally regulated tethering structures. Mol. Biol. Cell 20, 1058-1067. RNA-mediated interference (RNAi) Bottino, D., Mogilner, A., Roberts, T., Stewart, M. and Oster, G. (2002). How RNAi was performed by the feeding method (Timmons and Fire, 1998). nematode sperm crawl. J. Cell Sci. 115, 367-384. HT115(DE3) bacterial feeding strains were obtained from the genome-wide Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94. library (Kamath et al., 2003). PCR and sequencing (UAB Heflin Center for Briese, M., Esmaeili, B., Fraboulet, S., Burt, E. C., Christodoulou, S., Towers, Genomics Sciences) were used to confirm that strains contained the correct P. R., Davies, K. E. and Sattelle, D. B. (2009). Deletion of smn-1, the clones. RNAi phenotypes were compared with those of null mutants to Caenorhabditis elegans ortholog of the spinal muscular atrophy gene, results in determine effectiveness. locomotor dysfunction and reduced lifespan. Hum. Mol. Genet. 18, 97-104. Brisbin, S., Liu, J., Boudreau, J., Peng, J., Evangelista, M. and Chin-Sang, I. (2009). A role for C. elegans Eph RTK signaling in PTEN regulation. Dev. Cell 17, Transgenics 459-469. To generate transgenic C. elegans, plasmids (5-60 ng/μl) were injected Brockie, P. J., Madsen, D. M., Zheng, Y., Mellem, J. and Maricq, A. V. (2001). into young adult hermaphrodite gonads. The myo-3p::mitoGFP transgene Differential expression of glutamate receptor subunits in the nervous system of was used to evaluate body wall muscle mitochondria (Labrousse et al., Caenorhabditis elegans and their regulation by the homeodomain protein UNC- 1999). Multiple independent transgenic lines were analyzed. An 42. J. Neurosci. 21, 1510-1522. Burghes, A. H. M. and Beattie, C. E. (2009). Spinal muscular atrophy: why do low extrachromosomal array expressing pan-neuronal mitoGFP (unc-119p:: levels of survival motor neuron protein make motor neurons sick? Nat. Rev. mitoGFP) and the synaptic marker RAB-3 (unc-25p::mCherry::rab-3) was Neurosci. 10, 597-609. integrated into the genome by gamma irradiation. The unc-25p::mCherry:: Butchbach, M. E. R. (2016). Copy number variations in the survival motor neuron rab-3 transgene was a gift from Dr David Miller (Vanderbilt University). genes: implications for spinal muscular atrophy and other neurodegenerative The pie-1p::vpr-1g transgenic lines were generated using MosSCI single- diseases. Front. Mol. Biosci. 3,7. copy insertion (ttTi5605 Mos1 allele, near the center of chromosome II) by Cauchi, R. J. (2010). SMN and Gemins: ‘we are family’ .. or are we?: insights into the Knudra Transgenics. Integrated transgenes were crossed into the vpr-1 partnership between Gemins and the spinal muscular atrophy disease protein SMN. BioEssays 32, 1077-1089. (tm1411) background and maintained as transgenic vpr-1 mutant Collet, J., Spike, C. A., Lundquist, E. A., Shaw, J. E. and Herman, R. K. (1998). homozygotes. Analysis of osm-6, a gene that affects sensory cilium structure and sensory neuron function in Caenorhabditis elegans. Genetics 148, 187-200. Cottee, P. A., Cole, T., Schultz, J., Hoang, H. D., Vibbert, J., Han, S. M. and Miller, CRISPR/Cas9 M. A. (2017). The C. elegans VAPB homolog VPR-1 is a permissive signal for CRISPR/Cas9 methods were performed as previously published (Friedland gonad development. Development 144, 2187-2199. et al., 2013). DNA template, sgRNA, Cas9, and myo-3p::mitoGFP plasmids Deidda, I., Galizzi, G., Passantino, R., Cascio, C., Russo, D., Colletti, T., La were injected into unc-119(ed3) worms. Progeny were screened for rescue Bella, V. and Guarneri, P. (2014). Expression of vesicle-associated membrane- of the unc-119 movement defect and loss of myo-3p::mitoGFP. Individual protein-associated protein B cleavage products in peripheral blood leukocytes worms were isolated repeatedly to ensure 100% segregation. PCR and and cerebrospinal fluid of patients with sporadic amyotrophic lateral sclerosis. sequencing (UAB Heflin Center for Genomics Sciences) were used to Eur. J. Neurol. 21, 478-485. Di, L., Chen, H., Da, Y., Wang, S. and Shen, X.-M. (2016). Atypical familial confirm tdTomato insertion. The clr-1::tdTomato Cas9 line did not exhibit amyotrophic lateral sclerosis with initial symptoms of pain or tremor in a Chinese the fluid accumulation phenotype caused by reduced clr-1 function (Kokel family harboring VAPB-P56S mutation. J. Neurol. 263, 263-268. et al., 1998), indicating that tdTomato fusion does not compromise CLR-1 Ding, M., Chao, D., Wang, G. and Shen, K. (2007). Spatial regulation of an E3 activity. ubiquitin ligase directs selective synapse elimination. Science 317, 947-951. DEVELOPMENT

2184 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

Dupuis, L., Pradat, P.-F., Ludolph, A. C. and Loeffler, J.-P. (2011). Energy Liu, Q., Fischer, U., Wang, F. and Dreyfuss, G. (1997). The spinal muscular metabolism in amyotrophic lateral sclerosis. Lancet Neurol. 10, 75-82. atrophy disease gene product, SMN, and its associated protein SIP1 are in a Durieux, J., Wolff, S. and Dillin, A. (2011). The cell-non-autonomous nature of complex with spliceosomal snRNP proteins. Cell 90, 1013-1021. electron transport chain-mediated longevity. Cell 144, 79-91. Lua, S., Qin, H., Lim, L., Shi, J., Gupta, G. and Song, J. (2011). Structural, Edmonds, J. W., Prasain, J. K., Dorand, D., Yang, Y., Hoang, H. D., Vibbert, stability, dynamic and binding properties of the ALS-causing T46I mutant of the J.,Kubagawa,H.M.andMiller,M.A.(2010). Insulin/FOXO signaling hVAPB MSP domain as revealed by NMR and MD simulations. PLoS ONE 6, regulates ovarian prostaglandins critical for reproduction. Dev. Cell 19, e27072. 858-871. Maduro, M. and Pilgrim, D. (1995). Identification and cloning of unc-119, a gene Esposito, G., Di Schiavi, E., Bergamasco, C. and Bazzicalupo, P. (2007). expressed in the Caenorhabditis elegans nervous system. Genetics 141, Efficient and cell specific knock-down of gene function in targeted C. elegans 977-988. neurons. Gene 395, 170-176. Marques, V. D., Barreira, A. A., Davis, M. B., Abou-Sleiman, P. M., Silva, W. A., Fallini, C., Bassell, G. J. and Rossoll, W. (2012). Spinal muscular atrophy: The role Jr., Zago, M. A., Sobreira, C., Fazan, V. and Marques, W., Jr. (2006). Expanding of SMN in axonal mRNA regulation. Brain Res. 1462, 81-92. the phenotypes of the Pro56Ser VAPB mutation: proximal SMA with Francis, G. R. and Waterston, R. H. (1985). Muscle organization in Caenorhabditis dysautonomia. Muscle Nerve 34, 731-739. elegans: localization of proteins implicated in thin filament attachment and I-band Miller, M. A., Nguyen, V. Q., Lee, M. H., Kosinski, M., Schedl, T., Caprioli, R. M. organization. J. Cell Biol. 101, 1532-1549. and Greenstein, D. (2001). A sperm cytoskeletal protein that signals oocyte Friedland, A. E., Tzur, Y. B., Esvelt, K. M., Colaiacovo, M. P., Church, G. M. and meiotic maturation and ovulation. Science 291, 2144-2147. Calarco, J. A. (2013). Heritable genome editing in C. elegans via a CRISPR-Cas9 Mitne-Neto, M., Machado-Costa, M., Marchetto, M. C., Bengtson, M. H., Joazeiro, C. A., Tsuda, H., Bellen, H. J., Silva, H. C. A., Oliveira, A. S. B., system. Nat. Methods 10, 741-743. Lazar, M. et al. (2011). Downregulation of VAPB expression in motor neurons Gkogkas, C., Middleton, S., Kremer, A. M., Wardrope, C., Hannah, M., derived from induced pluripotent stem cells of ALS8 patients. Hum. Mol. Genet. Gillingwater, T. H. and Skehel, P. (2008). VAPB interacts with and modulates 20, 3642-3652. the activity of ATF6. Hum. Mol. Genet. 17, 1517-1526. Moerman, D. G. and Williams, B. D. (2006). Sarcomere Assembly in C. elegans Hall, D. H., Winfrey, V. P., Blaeuer, G., Hoffman, L. H., Furuta, T., Rose, K. L., Muscle. WormBook, 1-16. doi:10.1895/wormbook.1.81.1. Hobert, O. and Greenstein, D. (1999). Ultrastructural features of the adult Nishimura, A. L., Mitne-Neto, M., Silva, H. C. A., Richieri-Costa, A., Middleton, S., hermaphrodite gonad of Caenorhabditis elegans: relations between the germ line Cascio, D., Kok, F., Oliveira, J. R. M., Gillingwater, T., Webb, J. et al. (2004). A and soma. Dev. Biol. 212, 101-123. mutation in the vesicle-trafficking protein VAPB causes late-onset spinal muscular Han, S. M., Tsuda, H., Yang, Y., Vibbert, J., Cottee, P., Lee, S.-J., Winek, J., atrophy and amyotrophic lateral sclerosis. Am. J. Hum. Genet. 75, 822-831. Haueter, C., Bellen, H. J. and Miller, M. A. (2012). Secreted VAPB/ALS8 major Nonet, M. L., Staunton, J. E., Kilgard, M. P., Fergestad, T., Hartwieg, E., Horvitz, sperm protein domains modulate mitochondrial localization and morphology via H. R., Jorgensen, E. M. and Meyer, B. J. (1997). Caenorhabditis elegans rab-3 growth cone guidance receptors. Dev. Cell 22, 348-362. mutant synapses exhibit impaired function and are partially depleted of vesicles. Han, S. M., El Oussini, H., Scekic-Zahirovic, J., Vibbert, J., Cottee, P., Prasain, J. Neurosci. 17, 8061-8073. J. K., Bellen, H. J., Dupuis, L. and Miller, M. A. (2013). VAPB/ALS8 MSP ligands Peters, O. M., Ghasemi, M. and Brown, R. H., Jr. (2015). Emerging mechanisms regulate striated muscle energy metabolism critical for adult survival in of molecular pathology in ALS. J. Clin. Invest. 125, 1767-1779. caenorhabditis elegans. PLoS Genet. 9, e1003738. Pham,A.H.,McCaffery,J.M.andChan,D.C.(2012). Mouse lines with photo- Hollenbeck, P. J. and Saxton, W. M. (2005). The axonal transport of mitochondria. activatable mitochondria to study mitochondrial dynamics. Genesis 50, 833-843. J. Cell Sci. 118, 5411-5419. Rajendra, T. K., Gonsalvez, G. B., Walker, M. P., Shpargel, K. B., Salz, H. K. Huang, P. and Stern, M. J. (2004). FGF signaling functions in the hypodermis to and Matera, A. G. (2007). A Drosophila melanogaster model of spinal regulate fluid balance in C. elegans. Development 131, 2595-2604. muscular atrophy reveals a function for SMN in striated muscle. J. Cell Biol. Jin,Y.,Jorgensen,E.,Hartwieg,E.andHorvitz,H.R.(1999). The 176, 831-841. Caenorhabditis elegans gene unc-25 encodes glutamic acid decarboxylase Roberts, T. M. and Stewart, M. (2012). Role of major sperm protein (MSP) in the and is required for synaptic transmission but not synaptic development. protrusion and retraction of Ascaris sperm. Int. Rev. Cell Mol. Biol. 297, 265-293. J. Neurosci. 19, 539-548. Roh-Johnson, M. and Goldstein, B. (2009). In vivo roles for Arp2/3 in cortical actin Kabashi, E., El Oussini, H., Bercier, V., Gros-Louis, F., Valdmanis, P. N., organization during C. elegans gastrulation. J. Cell Sci. 122, 3983-3993. McDearmid, J., Mejier, I. A., Dion, P. A., Dupre, N., Hollinger, D. et al. (2013). Rowland, L. P. (1998). Diagnosis of amyotrophic lateral sclerosis. J. Neurol. Sci. Investigating the contribution of VAPB/ALS8 loss of function in amyotrophic lateral 160 Suppl. 1, S6-S24. sclerosis. Hum. Mol. Genet. 22, 2350-2360. Seydoux, G. and Dunn, M. A. (1997). Transcriptionally repressed germ cells lack a Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, subpopulation of phosphorylated RNA polymerase II in early embryos of A., Le Bot, N., Moreno, S., Sohrmann, M. et al. (2003). Systematic functional Caenorhabditis elegans and Drosophila melanogaster. Development 124, analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 2191-2201. 231-237. Stefan, C. J., Manford, A. G., Baird, D., Yamada-Hanff, J., Mao, Y. and Emr, S. D. Kokel, M., Borland, C. Z., DeLong, L., Horvitz, H. R. and Stern, M. J. (1998). clr-1 (2011). Osh proteins regulate phosphoinositide metabolism at ER-plasma encodes a receptor tyrosine phosphatase that negatively regulates an FGF membrane contact sites. Cell 144, 389-401. receptor signaling pathway in Caenorhabditis elegans. Genes Dev. 12, Teuling, E., Ahmed, S., Haasdijk, E., Demmers, J., Steinmetz, M. O., 1425-1437. Akhmanova, A., Jaarsma, D. and Hoogenraad, C. C. (2007). Motor neuron Kubagawa, H. M., Watts, J. L., Corrigan, C., Edmonds, J. W., Sztul, E., disease-associated mutant vesicle-associated membrane protein-associated Browse,J.andMiller,M.A.(2006). Oocyte signals derived from protein (VAP) B recruits wild-type VAPs into endoplasmic reticulum-derived tubular aggregates. J. Neurosci. 27, 9801-9815. polyunsaturated fatty acids control sperm recruitment in vivo. Nat. Cell Biol. Timmons, L. and Fire, A. (1998). Specific interference by ingested dsRNA. Nature 8, 1143-1148. 395, 854. Labrousse, A. M., Zappaterra, M. D., Rube, D. A. and van der Bliek, A. M. (1999). Tiziano, F. D., Melki, J. and Simard, L. R. (2013). Solving the puzzle of spinal C. elegans dynamin-related protein DRP-1 controls severing of the mitochondrial muscular atrophy: what are the missing pieces? Am. J. Med. Genet. A 161A, outer membrane. Mol. Cell 4, 815-826. 2836-2845. Larroquette, F., Seto, L., Gaub, P. L., Kamal, B., Wallis, D., Lariviere,̀ R., Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Vallée, J., Robitaille, R. and Tsuda, H. (2015). Vapb/Amyotrophic lateral Zoghbi, A., Harati, Y., Kwan, J. et al. (2008). The amyotrophic lateral sclerosis 8 sclerosis 8 knock-in mice display slowly progressive motor behavior defects protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell accompanying ER stress and autophagic response. Hum. Mol. Genet. 24, 133, 963-977. 6515-6529. Turner, M. R., Bowser, R., Bruijn, L., Dupuis, L., Ludolph, A., McGrath, M., ̈ Lefebvre, S., Burglen, L., Reboullet, S., Clermont, O., Burlet, P., Viollet, L., Manfredi, G., Maragakis, N., Miller, R. G., Pullman, S. L. et al. (2013). Benichou, B., Cruaud, C., Millasseau, P., Zeviani, M. et al. (1995). Identification Mechanisms, models and biomarkers in amyotrophic lateral sclerosis. Amyotroph. and characterization of a spinal muscular atrophy-determining gene. Cell 80, Lateral Scler. Frontotemporal Degener. 14 Suppl. 1, 19-32. 155-165. Van Hoecke, A., Schoonaert, L., Lemmens, R., Timmers, M., Staats, K. A., Lev, S., Halevy, D. B., Peretti, D. and Dahan, N. (2008). The VAP protein Laird, A. S., Peeters, E., Philips, T., Goris, A., Dubois, B. et al. (2012). EPHA4 family: from cellular functions to motor neuron disease. Trends Cell Biol. 18, is a disease modifier of amyotrophic lateral sclerosis in animal models and in 282-290. humans. Nature Med. 18, 1418-1422. Lickteig, K. M., Duerr, J. S., Frisby, D. L., Hall, D. H., Rand, J. B. and Miller, Vinsant, S., Mansfield, C., Jimenez-Moreno, R., Del Gaizo Moore, V., D. M. III (2001). Regulation of neurotransmitter vesicles by the homeodomain Yoshikawa, M., Hampton, T. G., Prevette, D., Caress, J., Oppenheim, R. W. protein UNC-4 and its transcriptional corepressor UNC-37/groucho in and Milligan, C. (2013a). Characterization of early pathogenesis in the SOD1 Caenorhabditis elegans cholinergic motor neurons. J. Neurosci. 21, (G93A) mouse model of ALS: part I, background and methods. Brain Behav. 3,

2001-2014. 335-350. DEVELOPMENT

2185 RESEARCH ARTICLE Development (2017) 144, 2175-2186 doi:10.1242/dev.152025

Vinsant, S., Mansfield, C., Jimenez-Moreno, R., Del Gaizo Moore, V. D. G., Winston, W. M., Molodowitch, C. and Hunter, C. P. (2002). Systemic RNAi in Yoshikawa, M., Hampton, T. G., Prevette, D., Caress, J., Oppenheim, R. W. and C. elegans requires the putative transmembrane protein SID-1. Science 295, Milligan, C. (2013b). Characterization of early pathogenesis in the SOD1(G93A) 2456-2459. mouse model of ALS: part II, results and discussion. Brain Behav. 3, 431-457. Zhou, J., Yi, J., Fu, R., Liu, E., Siddique, T., Rios, E. and Deng, H.-X. (2010). Wei, X., Potter, C. J., Luo, L. and Shen, K. (2012). Controlling gene expression with Hyperactive intracellular calcium signaling associated with localized the Q repressible binary expression system in Caenorhabditis elegans. Nat. mitochondrial defects in skeletal muscle of an animal model of amyotrophic Methods 9, 391-395. lateral sclerosis. J. Biol. Chem. 285, 705-712. DEVELOPMENT

2186