Influence of N-Glycosylation on Expression and Function Of

Home , Human alphaherpesvirus 1, Human alphaherpesvirus 2, Pseudorabies, Viral envelope

pathogens

Article Article InfluenceInﬂuence of N-glycosylation of N-glycosylation on Expression on Expression and andFunction Function of of PseudorabiesPseudorabies Virus Virus Glycoprotein Glycoprotein gB gB

Melina Vallbracht,Melina Vallbracht Barbara G., Barbara Klupp and G. Klupp Thomas and C. Thomas Mettenleiter C. Mettenleiter * *

Institute ofInstitute Molecular of MolecularVirology and Virology Cell Biology, and Cell Friedrich-Loeffler-Institut, Biology, Friedrich-Loeffler-Institut, 17493 Greifswald-Insel 17493 Greifswald-Insel Riems, Riems, Germany; [email protected]; Melina.Vallbracht@fli.de (M.V.); [email protected] (M.V.); barbara.klupp@fli.de (B.G.K.) (B.G.K.) * Correspondence:* Correspondence: [email protected]; thomas.mettenleiter@fli.de; Tel.: +49-383-517-1250 Tel.: +49-383-517-1250

Abstract: Abstract:Envelope Envelopeglycoprotein glycoprotein (g)B is conserved (g)B is conserved throughout throughout the Herpesviridae the Herpesviridae and mediatesand mediatesfusion fusion of the viralof envelope the viral with envelope cellular with membranes cellular membranes for infectious for infectious entry and entry spread. and Like spread. all viral Like envelope all viral envelope fusion proteins,fusion proteins,gB is modified gB is modifiedby asparagine by asparagine (N)-linked (N)-linked glycosylation. glycosylation. Glycans can Glycans contribute can contribute to to protein function,protein function,intracellular intracellular transport, transport, trafficking, trafficking, structure structure and immune and immune evasion. evasion. gB of the gB ofal- the alpha- phaherpesvirusherpesvirus pseudorabies pseudorabies virus virus(PrV) (PrV)contains contains six consensus six consensus sites for sites N-linked for N-linked glycosylation, glycosylation, but but their functionaltheir functional relevance relevance is unknown. is unknown. Here, Here, we investigated we investigated the occupancy the occupancy and andfunctional functional rel- relevance evance ofof N-glycosylation N-glycosylation sites sites in inPrV PrV gB. gB. To To this this end, end, all all predicted predicted N-glycosylation N-glycosylation sites sites were were in- inactivated activated either singly or in combination by the introduction of conservative mutations (N Q). The resulting resulting proteins were tested for expression,expression, fusionfusion activityactivity inin cell–cellcell–cell fusionfusion assaysassays andand complementationcomple- mentationof of a a gB-deficient gB-deficient PrV PrV mutant. mutant. Our Our results results indicate indicate that that all all six six sites sites are are indeed indeed modified. modified. However, However,while while glycosylation glycosylation at at most most sites sites was was dispensable dispensable for for gB gB expression expression and and fusogenicity, fusogenicity, inactivation inactivationof N154of N154 and and N700 N700 affected affected gB processinggB processing by furinby furin cleavage cleavage and and surface surface localization. localization. Although all Althoughsingle all single mutants mutants were were functional functional in cell–cell in cell– fusioncell fusion and and viral viral entry, entry, simultaneous simultaneous inactivation inacti- of all six vation of N-glycosylationall six N-glycosylation sites severely sites severely impaired impaired fusion fusion activity activity and viral and entry, viral suggestingentry, suggesting a critical role of

a critical roleN-glycans of N-glycans for maintaining for maintaining gB structure gB structure and function. and function. Citation: Vallbracht, M.; Klupp, Keywords:Keywords: herpesvirus;herpesvirus; pseudorabies pseudorabies virus; glycoprotein virus; glycoprotein B; membrane B; membrane fusion; N-linked fusion; N-linked glycosyl- glycosyla- Citation: Vallbracht, M.; Klupp, B.G.; B.G.; Mettenleiter, T.C. Influence of Mettenleiter, T.C. Influence of ation; virustion; entry virus entry N-glycosylation on Expression and N-glycosylation on Expression and Function of Pseudorabies Virus Function of Pseudorabies Virus Glycoprotein gB. Pathogens 2021, 10, Glycoprotein gB. Pathogens 2021, 10, x. https://doi.org/10.3390/xxxxx 61. https://doi.org/10.3390/ 1. Introduction1. Introduction pathogens10010061 Received: 14 December 2020 HerpesvirusesHerpesviruses are large-enveloped are large-enveloped double-stranded double-stranded DNA viruses DNA that viruses include that many include many Accepted: 7 January 2021 importantimportant human and human animal and pathogens. animal pathogens. Members Members of the Alphaherpesvirinae of the Alphaherpesvirinae subfamilysubfamily Received: 14 December 2020 Published: 12 January 2021 have thehave broadest the broadest host range, host are range, neurotropic are neurotropic and can and persist can persist in the ininfected the infected hosts hostsfor life for life [1]. Accepted: 7 January 2021 [1]. In additionIn addition to the to thehuman human herpes herpes simplex simplex viruses viruses 1 and 1 and 2 (HSV-1, 2 (HSV-1, -2) -2) and and Varicella Varicella zoster Published: 12 January 2021 Publisher’s Note: MDPI stays zoster virusvirus (VZV), (VZV), this this subfamily containscontains manymany economically economically important important veterinary veterinary pathogens neutral with regard to jurisdictional such as the Varicellovirus Pseudorabies virus (PrV, Suid alphaherpesvirus 1). PrV is the Publisher’s Note: MDPI stayspathogens neu- such as the Varicellovirus Pseudorabies virus (PrV, Suid alphaherpesvirus 1). PrV claims in published maps and causative agent of Aujeszky’s disease in swine and is capable of causing lethal disease in a tral with regard to jurisdictionalis clai-the causative agent of Aujeszky’s disease in swine and is capable of causing lethal dis- institutional affiliations. variety of other mammalian species [2,3]. ms in published maps and institutio-ease in a variety of other mammalian species [2,3]. Infectious entry and spread of herpesviruses require the fusion of the viral envelope nal affiliations. Infectious entry and spread of herpesviruses require the fusion of the viral envelope with thewith host cell the membrane. host cell membrane. Whereas many Whereas enveloped many viruses enveloped encode viruses a single encode but mul- a single but multifunctional glycoprotein (g) for host–cell receptor-binding and membrane fusion [4], Copyright: © 2021 by the authors. tifunctional glycoprotein (g) for host–cell receptor-binding and membrane fusion [4], herpesvirusesherpesviruses utilize a multiprotein utilize a multiprotein machinery machinery to mediate to these mediate processes. these processes. The so-called The so-called Submitted forCopyright: possible open© 2021 access by the authors. Li- “core-fusion“core-fusion machinery” machinery” which is which conserved is conserved in all herpesviruses in all herpesviruses is formed is by formed gB, the by gB, the publication undercensee the MDPI, terms Basel,and Switzerland. bona fide fusion protein, and the heterodimeric complex of the membrane-bound gH and bona fide fusion protein, and the heterodimeric complex of the membrane-bound gH and conditions ofThis the articleCreative is anCommons open access article anchorless gL (gH/gL) [5]. In addition to the core-fusion machinery, herpesviruses require Attribution (CC BY) license anchorless gL (gH/gL) [5]. In addition to the core-fusion machinery, herpesviruses require distributed under the terms and con- the assistance of nonconserved subgroup-specific receptor-binding proteins such as gD of (http://creativecommons.org/licenses the assistance of nonconserved subgroup-specific receptor-binding proteins such as gD of ditions of the Creative Commons At- the Alphaherpesvirinae for entry [6–8]. /by/4.0/). the Alphaherpesvirinae for entry [6–8]. tribution (CC BY) license (https:// Herpesvirus-mediated membrane fusion is a highly regulated process whose molec- creativecommons.org/licenses/by/ ular details remain incompletely understood. The current model for alphaherpesvirus 4.0/).

Pathogens 2021, 10, x. https://doi.org/10.3390/xxxxx www.mdpi.com/journal/pathogens Pathogens 2021, 10, 61. https://doi.org/10.3390/pathogens10010061 https://www.mdpi.com/journal/pathogens Pathogens 2021, 10, 61 2 of 15

entry proposes that gD, gH/gL and gB drive membrane fusion in a cascade-like, pH- independent fashion [9–11]. Binding of gD to an appropriate host cell receptor, such as nectin-1 or herpesvirus entry mediator (HVEM), serves as the initial fusion trigger [12,13]. A conformational change in receptor-bound gD is proposed to allow its crosstalk with gH/gL, possibly by direct interaction between their ectodomains [14]. The gH/gL complex is believed to function as a fusion regulator and, upon triggering, is thought to activate gB, the sole fusion executor [5,9,11,15]. Although the exact molecular mechanism of gB fusion activation by gH/gL is unclear, direct interactions between the respective ectodomains and/or cytoplasmic domains have been reported to be essential for fusion activation [16,17]. Activated gB is proposed to facilitate fusion by refolding from a trimeric metastable high-energy pre-fusion conformation to a stable post-fusion state. During the fusogenic conformational change, gB exposes two internal fusion loops that interact with the target membrane [18]. The subsequent fold-back process into the energetically more favorable post-fusion conformation juxtaposes the viral and cellular membranes, ultimately leading to their fusion [5]. gB is the most highly conserved component of the herpesvirus fusion machinery and exhibits around 50% amino acid (aa) sequence identity within each subfamily [5]. High-resolution crystal structures of the stable post-fusion state have been determined for gB ectodomains of five different herpesviruses, including PrV [18,19], HSV-1 [20], and VZV [21], all revealing rod-shaped trimers which are composed of five domains (DI-V) per protomer (Figure1). Based on these structural studies, gB was identified as a class III fusion protein [22]. In contrast to the well-characterized post-fusion conformation, structural information on the gB pre-fusion conformation is limited to HSV-1 [23,24] and the betaherpesvirus human cytomegalovirus (HCMV) gB [25]. The majority of viral envelope proteins, including herpesvirus gB, gH and gD, are modified by asparagine (N)-linked glycosylation, which can play crucial roles in correct folding, trafficking, function and immune evasion [28–30]. N-glycosylation starts in the endoplasmic reticulum (ER) with the en bloc attachment of oligosaccharides to the asparagine side chain in N-X-threonine (T) or -serine (S) sequons of the nascent polypeptide chain (X represents any amino acid except proline) [31]. Following the linkage of high mannose-type glycans to N of each sequon in the ER, glycan maturation takes place in the Golgi apparatus. Glycan processing involves trimming of glucose and mannose residues and subsequent addition of various terminal sugars resulting in different classes of glycans, including high mannose, hybrid and complex N-glycans [28,32]. Functional and structural studies on N-linked glycans from several viral fusion proteins, including influenza hemagglutinin [33,34], coronavirus spike protein [35–38], Ebola virus glycoprotein GP [39], envelope glycoprotein (Env) of human immunodeficiency virus-1 (HIV-1) [40,41], or envelope (E) protein of the flaviviruses Zika [42] and Dengue virus [43] have shown that these structures can play diverse functional and structural roles, e.g., in immune evasion by shielding from neutralizing antibodies, enhancement of infection, or stability and maturation of the respective fusion protein. Recently, we have investigated the occupancy and functional relevance of N-glycosylation sites in PrV gH, highlighting a modulatory but non-essential role of N-linked glycans for gH function during membrane fusion [30]. In contrast to gH, there is only limited information on the role of N-linked glycans on gB. In fact, the only gB homolog tested for the role of all predicted N-linked glycans is HSV-2 gB [29]. Therefore, in the present study, we set out to expand our analyses to the N-linked glycans in PrV gB. PrV gB contains six potential N-glycosylation sites, all located in the ectodomain. Occupation of three predicted sites by N-glycans (N264 in DI, N444 in DII, N636 in DIV) was confirmed by crystal structure analysis of the PrV gB post-fusion ectodomain, but their functional relevance is unknown. Pathogens 2021, 10, 61 3 of 15 Pathogens 2021, 10, x FOR PEER REVIEW 3 of 15

FigureFigure 1. Position1. Position of potentialof potential N-linked N-linked glycosylation glycosylation sites sites in thein the PrV PrV gB ectodomain.gB ectodomain. (A) ( SchematicA) Sche- diagrammatic diagram of PrV gB of with PrV thegB with signal the peptide signal (SP),peptid ectodomaine (SP), ectodomain (ECD), transmembrane (ECD), transmembrane domain (TMD) domain (TMD) and a cytoplasmic domain (CD) indicated. The five domains (DI-V) forming the ectodo- and a cytoplasmic domain (CD) indicated. The five domains (DI-V) forming the ectodomain are main are colored in blue (DI), green (DII), yellow (DIII), orange (DIV) and red (DV) according to colored in blue (DI), green (DII), yellow (DIII), orange (DIV) and red (DV) according to the ribbon the ribbon diagrams in (B) and (C), and regions not resolved in the post-fusion structure are de- diagramspicted in in grey. (B,C), Position and regions of the not furin-cleavage resolved in the site post-fusion (FCL) and structure the potential are depicted asparagine in grey. (N)-linked Position ofglycosylation the furin-cleavage sites N154, site (FCL) N264, and N444, the N519, potential N636 asparagine and N700 (N)-linked are indicated. glycosylation (B) Ribbon sites diagram N154, of N264,the PrV N444, gB N519,post-fusion N636 trimer and N700 (PDB are ID: indicated. 6ESC) [18] (B, (left) Ribbon panel) diagram and the of mo thenomer PrV (right gB post-fusion panel) is trimershown. (PDB Domains ID: 6ESC) I–V [18 of], one (left protomer panel) and are the highlight monomered (rightin different panel) colors, is shown. and Domains the predicted I–V of glyco- one protomersylation are sites highlighted are indicated in different by purple colors, spheres. and N519 the predicted lies within glycosylation a flexible region sites (dotted are indicated yellow by purpleline) spheres.that was N519 not solved lies within in the a flexiblecrystal regionstructure (dotted and yellowis marked line) by that an wasarrow. not The solved yellow in the star crystal indi- structurecates the and furin-cleavage is marked by site. an arrow. (C) Model The yellowof pre-fusion star indicates PrV gB thetrimer furin-cleavage (left panel) site.was (generatedC) Model ofus- ing the protein structure homology-modeling server SWISS-MODEL [26] and the pre-fusion struc- pre-fusion PrV gB trimer (left panel) was generated using the protein structure homology-modeling ture of HSV-1 gB as template [24]. Domains I–V of one protomer (right panel) are colored as in (A) serverand SWISS-MODEL(B), and the predicted [26] and glycosylation the pre-fusion sites structure are show ofn HSV-1 as purple gB asspheres, template and [24 the]. Domainsfurin-cleavage I–V of onesite is protomer marked (rightby a yellow panel) arestar. colored The structure as in (A images,B), and were the predicted generated glycosylation using UCSF sitesChimera are shown (ver- assion purple 1.13.1) spheres, [27].and the furin-cleavage site is marked by a yellow star. The structure images were generated using UCSF Chimera (version 1.13.1) [27]. The majority of viral envelope proteins, including herpesvirus gB, gH and gD, are modifiedTo investigate by asparagine the significance (N)-linked of N-glycosylationglycosylation, which on PrV can gB, play we systematicallycrucial roles in inacti- correct vatedfolding, all six trafficking, potential sites function by the and introduction immune evasion of a conservative [28–30]. N-glycosylation mutation in the individualstarts in the sequonsendoplasmic in the plasmid reticulum cloned (ER) gBwith gene the (UL27),en bloc resultingattachment in theof oligosaccharides replacement of asparagine to the aspar- (N)agine by glutamine side chain (Q). in ResultingN-X-threonine gB mutants (T) or were-serine tested (S) forsequons correct of expression the nascent and polypeptide glycosylation as well as fusogenicity in a virus-free transfection-based cell–cell fusion assay [44]. chain (X represents any amino acid except proline) [31]. Following the linkage of high mannose-type glycans to N of each sequon in the ER, glycan maturation takes place in the

Pathogens 2021, 10, 61 4 of 15 Article Influence of N-glycosylation on Expression and Function of In addition, the ability of the gB variants to function in virus entry was investigated by Pseudorabies Virustranscomplementation Glycoprotein of a gB-deﬁcient gB PrV mutant.

Melina Vallbracht, Barbara G.2. Klupp Results and Thomas C. Mettenleiter * 2.1. Effect of N-Glycosylation Site Mutations on gB Processing and Expression InstituteThe of Molecular amino acid Virology sequence and Cell ofBiology, PrV Friedrich-Loeffler-Institut, gB strain Kaplan (Ka) 17493 contains Greifswald-Insel six potential Riems, N- linkedGermany; glycosylation [email protected] sites matching (M.V.); [email protected] the consensus motif (B.G.K.) N-X-T/S, where X represents any amino* Correspondence: acid (aa) [email protected]; except proline [31]. All Tel.: predicted +49-383-517-1250 N-glycosylation sites map to the gB ectodomain (Figure1). The three sites at aa positions N154, N264, N444 reside within theAbstract: N-terminal Envelope subunit glycoprotein of furin-cleaved (g)B is conserved gB, while throughout sites N519,the Herpesviridae N636 and and N700 mediates are located fusion withinof the viral the envelope C-terminal with subunit cellular (Figuremembranes1A–C). for infectious Crystal structure entry and analysis spread. Like of the all PrVviral gBenvelope post- fusion proteins, ectodomain gB is expressed modified by in asparagine insect cells (N revealed)-linked glycosylation. occupation of Glycans three N-glycosylation can contribute to sites,protein namely function, N264 intracellular in domain transport, I (DI), trafficking, N444 in DIIstructure and N636and immune in DIV evasion. [18]. Based gB of on the the al- recentlyphaherpesvirus published pseudorabies pre-fusion viru structures (PrV) contains of HSV-1 six consensus gB, a model sites of for PrV N-linked pre-fusion glycosylation, gB was generatedbut their functional using therelevance protein is unknown. structure Here, homology-modeling we investigated the server occupancy SWISS-MODEL and functional [26 rel-], andevance the of N-glycosylationN-glycosylation sites sites in werePrV gB. mapped To this end, into all the predicted structure N-glycosylation (Figure1C). Forsites furtherwere in- analysis,activated either the N singly codon or in of combination each sequon by the was introduction replaced byof conservative a glutamine mutations codon (N(NQ)Q). The via site-directedresulting proteins mutagenesis were tested offor the expression, gB expression fusion activity plasmid. in cell–cell Theresulting fusion assays gB and expression comple- plasmidsmentation wereof a gB-deficient used for in PrV vitro mutant.expression, Our results transient-transfection-based indicate that all six sites are fusion indeed assays modified. and trans-complementationHowever, while glycosylation studies. at most sites was dispensable for gB expression and fusogenicity, inactivationThe occupancy of N154 and of theN700 individual affected gB N-glycosylation processing by furin sites cleavage and processing and surface of the localization. different gBAlthough mutants all single was investigated mutants were by functional Western in blot cell– analysescell fusion of and cell viral lysates entry, from simultaneous rabbit kidney inacti- (RK13)vation of cells all six transfected N-glycosylation with expressionsites severely plasmids impaired for fusion gB wild-type activity an (WT)d viral and entry, the suggesting different N-glycosylationa critical role of N-glycans site mutants. for maintaining Fully glycosylated gB structure PrV and gB function. is an approx. 120-kDa polypeptide that undergoes proteolytic processing by cellular furin in the Golgi apparatus [45,46]. The 501 505 Citation: Vallbracht, M.; Klupp, proteaseKeywords: recognizes herpesvirus; the pseudorabies basic sequence virus; RRARRglycoprotein, located B; membrane in a ﬂexible fusion; loop N-linked that connectsglycosyl- B.G.; Mettenleiter, T.C. Influence of gBation; DII virus and entry DIII (Figure1). Cleavage after R505 generates two subunits, gBb (~69-kDa) and N-glycosylation on Expression and gBc (~58-kDa), which remain linked by disulﬁde bonds. To visualize PrV gB in Western Function of Pseudorabies Virus blot analyses two monoclonal antibodies (mAb) (c15-b1 and A20-c26) were used that detect Glycoprotein gB. Pathogens 2021, 10, either the N-terminal (gBb, c15-b1) or the C-terminal subunit (gBc, A20-c26), respectively x. https://doi.org/10.3390/xxxxx (Figure1. Introduction2)[18,47]. As expected, two bands were observed for PrV WT gB, corresponding to the un- Received: 14 December 2020 cleavedHerpesviruses gB precursor are (gBa) large-enveloped and the N-terminal double-stranded subunit (gBb) DNA when viruses mAb that c15-b1 include was many used Accepted: 7 January 2021 (Figureimportant2A, humanupper panel),and animal or the pathogens. C-terminal Members subunit (gBc)of the when Alphaherpesvirinae blots were probed subfamily with Published: 12 January 2021 A20-c26have the (Figure broadest2A, host lower range, panel). are The neurotropic mutants revealedand can persist WT-like in behavior the infected in processing hosts for bylife furin[1]. In with addition the exception to the human of gB-N154Q herpes andsimplex gB-N700Q viruses (Figure 1 and2 2A). (HSV-1, These variants-2) and Varicella showed Publisher’s Note: MDPI stays onlyzoster low virus levels (VZV), of the furin-cleavedthis subfamily subunits contains and many a more economically abundant signal important for the veterinary uncleaved neutral with regard to jurisdictional gBpathogens precursor such indicating as the Varicellovirus that N154Q Pseudorabies and N700Q affected virus (PrV, furin-cleavage Suid alphaherpesvirus(Figure2). 1Inacti-). PrV claims in published maps and vationis the causative of the N-glycosylation agent of Aujeszky’s sites at disease N264 and in swine N444 and resulted is capable in a shift of causing of the N-terminal lethal dis- institutional affiliations. subunitease in a (gBb)variety to of a othe lowerr mammalian molecular mass, species indicating [2,3]. that both sites are occupied. Dif- ferencesInfectious in the molecularentry and spread weight of between herpesviruse gBb ofs therequire two the single fusion mutants of the gB-N264Q viral envelope and gB-N444Qwith the host suggested cell membrane. differences Whereas in the many added enveloped N-glycans viruses (Figure encode2A, upper a single panel). but mul- For Copyright: © 2021 by the authors. N519Qtifunctional or N636Q, glycoprotein which (g) are for located host–cell in thereceptor-binding C-terminal subunit, and membrane higher electrophoretic fusion [4], her- Submitted for possible open access mobilitypesviruses of utilize the respective a multiprotein gBc could machinery be observed to mediate when compared these processes. to WT gB The (Figure so-called2A, publication under the terms and lower“core-fusion panel). machinery” These results which indicate is conserved that gB positions in all herpesviruses N264, N444, is N519 formed and by N636 gB, arethe conditions of the Creative Commons occupiedbona fide byfusion N-glycans. protein, Mutation and the heterodi of the N-glycosylationmeric complex site of the N700Q membrane-bound and, to a lesser gH extent, and Attribution (CC BY) license N154Qanchorless had gL an (gH/gL) impact on[5]. gB In processingaddition to bythe cellular core-fusion furin. machinery, herpesviruses require (http://creativecommons.org/licenses the assistanceIn addition, of nonconserved a gB variant was subgroup-specific generated in which receptor-binding all six N-glycosylation proteins such sites as gD were of /by/4.0/). inactivatedthe Alphaherpesvirinae simultaneously for entry (gB-N6xQ). [6–8]. Cell lysates of gB-N6xQ expressing RK13 cells were treated with peptide-N-glycosidase F (PNGase F), which removes all N-linked carbohydrates. Similar to the single mutant gB-N700Q, only the uncleaved gB precursor could be observed for gB-N6xQ. However, unlike PrV gB WT, gB-N6xQ was not sensitive to PNGase F treatment and revealed a similar apparent molecular mass as gBa of PNGase F gB WT

Pathogens 2021, 10, x. https://doi.org/10.3390/xxxxx www.mdpi.com/journal/pathogens Pathogens 2021, 10, x FOR PEER REVIEW 5 of 15 Pathogens 2021, 10, 61 5 of 15

Western blot analyses two monoclonal antibodies (mAb) (c15-b1 and A20-c26) were used that detect (Figureeither the2B). N-terminal Overall, these (gBb, results c15-b1 show) or thatthe allC-terminal predicted subunit N-glycosylation (gBc, A20-c26), sites on PrV WT respectivelygB (Figure are used 2) [18,47]. and that they are inactivated in gB-N6xQ.

Figure 2. ExpressionFigure and 2. Expression glycosylation and analysis glycosylation of PrV analysis gB N-glycosylation of PrV gB N-glycosylation mutants. (A) Lysates mutants. of RK13(A) Lysates cells transfected of with expressionRK13 plasmids cells fortransfected the indicated with gBexpression variants plasmids were separated for the byindicated SDS–PAGE gB variants under reducing were separated conditions. by Lysates of cells transfectedSDS–PAGE with empty under vector reducing pcDNA-3 conditions. served Lysates as a negative of cells controltransfected (Mock). with Blots empty were vector either pcDNA-3 probed with the monoclonal antibodyserved (mAb) as a negative c15-b1, directedcontrol (Mock). against theBlots N-terminal were either subunit probed (gBb) with of the furin-cleaved monoclonal gB antibody (upper panel), or with mAb A20-c26 (lower(mAb) panel) c15-b1, recognizing directed against the C-terminal the N-terminal gB subunit subunit (gBc). (gBb) Signals of furin-cleaved of uncleaved gB gB(upper (gBa) panel), or furin-cleaved or with mAb A20-c26 (lower panel) recognizing the C-terminal gB subunit (gBc). Signals of un- gB subunits (gBb and gBc) are labeled by arrowheads and braces. The molecular masses of marker proteins are indicated. cleaved gB (gBa) or furin-cleaved gB subunits (gBb and gBc) are labeled by arrowheads and Representative blots from three independent experiments are shown. (B) Analysis of N-linked carbohydrates in gB. Lysates braces. The molecular masses of marker proteins are indicated. Representative blots from three of RK13 cells expressingindependent PrV experiments wild-type (WT) are shown. gB or gB-N6xQ(B) Analysis were of eitherN-linked left carbohydrates untreated (U) in or gB. treated Lysates (T) withof PNGase F. Samples wereRK13 separated cells expressing by SDS–PAGE PrV wild-type under reducing (WT) gB conditions, or gB-N6xQ and were blots either were left probed untreated with a (U) monospeciﬁc or treated rabbit antiserum against(T) PrV.with Three PNGase independent F. Samples experiments were separated were by performed, SDS–PAGE and under one representativereducing conditions, blot is shown.and blots were probed with a monospecific rabbit antiserum against PrV. Three independent experiments were performed, andTo investigateone representative the expression blot is shown. and subcellular localization of the different mutants, indirect immunoﬂuorescence analyses of transfected RK13 cells using the polyclonal anti- As expected,gB serum two [48 bands] without were or observed after permeabilization for PrV WT gB, were corresponding performed (Figure to the 3un-). Low levels cleaved gB ofprecursor surface (gBa) localization and the could N-termin be observedal subunit for (gBb) PrV when WT gB, mAb which c15-b1 is in was line used with previous (Figure 2A,results upper [18panel),]. Fluorescence-activated or the C-terminal subunit cell sorting (gBc) (FACS) when blots analysis were revealed probed that with only around A20-c26 (Figure4% of 2A, PrV lower WT gB panel). is presented The mutants at the revealed plasma membraneWT-like behavior (data not in shown),processing complicating by furin withrobust the quantitation.exception of gB-N154Q Surface localization and gB-N700Q of gB-N264Q, (Figure 2A). -N444Q, These -N519Q variants and -N636Q showed onlywas low similar levels to of WT the gB.furin-cleaved However, nosubunits staining and could a more be detectedabundant without signal for permeabilization the uncleaved gBfor precursor mutants gB-N154Q,indicating that gB-N700Q N154Q and or gB-N6xQ,N700Q affected indicating furin-cleavage that gB N-glycosylation (Figure at 2). InactivationN154 of and the N700N-glycosylation is not only sites important at N264 forand processing N444 resulted by cellular in a shift furin of the but N- also for gB terminal subunitsurface (gBb) localization. to a lower molecular mass, indicating that both sites are occupied. Differences in the molecular weight between gBb of the two single mutants gB-N264Q 2.2. In Vitro Fusion Activity of gB N-Glycosylation Mutants and gB-N444Q suggested differences in the added N-glycans (Figure 2A, upper panel). For N519Q or N636Q,To investigate which are the located role of the in the six N-glycosylationC-terminal subunit, sites higher for gB functionelectrophoretic during membrane mobility offusion, the respective the different gBc could mutants be wereobserved tested when in a compared transient transfection to WT gB (Figure based cell–cell2A, fusion lower panel).assay These [44 ].results This assay indicate exploits that gB the positions ability of N264, the herpesvirus N444, N519 entry and glycoproteins N636 are oc- gB, gH/gL cupied by N-glycans.and gD to Mutation mediate cell–cellof the N-glycosylation fusion in the absencesite N700Q of otherand, to viral a lesser components, extent, thereby allowing for more direct analysis of gB function during fusion than in the viral context N154Q had an impact on gB processing by cellular furin. (Figure4). In addition, a gB variant was generated in which all six N-glycosylation sites were inactivated simultaneously (gB-N6xQ). Cell lysates of gB-N6xQ expressing RK13 cells were treated with peptide-N-glycosidase F (PNGase F), which removes all N-linked carbohydrates. Similar to the single mutant gB-N700Q, only the uncleaved gB precursor could be observed for gB-N6xQ. However, unlike PrV gB WT, gB-N6xQ was not sensitive to PNGase F treatment and revealed a similar apparent molecular mass as gBa of PNGase

Pathogens 2021, 10, x FOR PEER REVIEW 6 of 15

F gB WT (Figure 2B). Overall, these results show that all predicted N-glycosylation sites on PrV WT gB are used and that they are inactivated in gB-N6xQ. To investigate the expression and subcellular localization of the different mutants, indirect immunofluorescence analyses of transfected RK13 cells using the polyclonal anti- gB serum [48] without or after permeabilization were performed (Figure 3). Low levels of surface localization could be observed for PrV WT gB, which is in line with previous results [18]. Fluorescence-activated cell sorting (FACS) analysis revealed that only around 4% of PrV WT gB is presented at the plasma membrane (data not shown), complicating robust quantitation. Surface localization of gB-N264Q, -N444Q, -N519Q and -N636Q was similar to WT gB. However, no staining could be detected without permeabilization for Pathogens 2021, 10, 61 mutants gB-N154Q, gB-N700Q or gB-N6xQ, indicating that gB N-glycosylation at 6N154 of 15 and N700 is not only important for processing by cellular furin but also for gB surface localization.

Figure 3. SubcellularSubcellular and and surface surface expres expressionsion of of the the PrV PrV gB gB N-glycosylation N-glycosylation mutants. mutants. RK13 RK13 cells cells were transfected with expression plasmids for wild-type (WT) gB or the indicated gB mutants. were transfected with expression plasmids for wild-type (WT) gB or the indicated gB mutants. One One day after transfection, cells were fixed and either permeabilized or not. gB was detected using day after transfection, cells were fixed and either permeabilized or not. gB was detected using a gB- a gB-specific rabbit antiserum and Alexa Fluor 488-conjugated secondary antibodies. Nuclei were specificstained rabbitwith Hoechst. antiserum Total and and Alexa cell Fluor surface 488-conjugated expression of secondary gB was analyzed antibodies. by fluorescence Nuclei were stainedmi- withcroscopy Hoechst. (Nikon Total Eclipse and Ti-S). cell surface Scale bars: expression 100 µm. of Representative gB was analyzed images by fluorescencefrom three independent microscopy (Nikonexperiments Eclipse are Ti-S). shown. Scale bars: 100 µm. Representative images from three independent experiments are shown. 2.2. In Vitro Fusion Activity of gB N-Glycosylation Mutants. Fusion activities of the different gB mutants in combination with gH/gL and gD To investigate the role of the six N-glycosylation sites for gB function during mem- were determined 24 h after cotransfection of RK13 cells with the respective expression brane fusion, the different mutants were tested in a transient transfection based cell–cell plasmids and enhanced green fluorescent protein (EGFP), which was used as a marker to visualize syncytia formation. The area and number of syncytia within 10 fields of view (5.5 mm2 each) were determined, and the mean syncytia area was multiplied by the number of syncytia to obtain the absolute fusion activity. Fusion activity of the four wild-type proteins served as positive control and was set as 100%, while empty vector pcDNA-3 was substituted for the gB expression plasmid and used as a negative control. Although inactivation of N154 or N700 affected furin-cleavage and surface localization of gB as evident from Western blot analyses and immunofluorescence analyses (Figures2A and3), all mutants revealed wild-type like fusion activities (Figure4). In contrast, simultaneous inactivation of all N-glycosylation sites severely affected gB fusogenicity. Fusion activity of gB-N6xQ was almost reduced to background levels (Figure4), suggesting that N-glycans may be important for the overall gB structure and/or stability of the protein. Pathogens 2021, 10, x FOR PEER REVIEW 7 of 15

fusion assay [44]. This assay exploits the ability of the herpesvirus entry glycoproteins gB, gH/gL and gD to mediate cell–cell fusion in the absence of other viral components, thereby Pathogens 2021, 10, 61 7 of 15 allowing for more direct analysis of gB function during fusion than in the viral context (Figure 4).

FigureFigure 4.4.Cell–cell Cell–cell fusionfusion activityactivity ofof gB gB N-glycosylation N-glycosylation site site mutants. mutants. RK13 RK13 cells cells were were cotransfected cotrans- withfected 200 with ng of200 the ng expression of the expression plasmids plasmids for enhanced for enhanced green fluorescent green fluorescent protein protein (EGFP), (EGFP), PrV gH, PrV gL, gD,gH, gB gL, wild-type gD, gB wild-type (WT) or the(WT) indicated or the indicated gB glycosylation gB glycosylation site mutant. site mutant. Cells transfected Cells transfected with EGFP with EGFP and empty vector pcDNA-3 served as a mock control. 24 h post-transfection, syncytia and empty vector pcDNA-3 served as a mock control. 24 h post-transfection, syncytia formation was formation was assessed. The number of syncytia in 10 fields of view was multiplied by the corre- assessed. The number of syncytia in 10 fields of view was multiplied by the corresponding mean sponding mean syncytia area to obtain the total fusion activity. Fusion activities were normalized syncytiato activities area obtained to obtain with the total the fusionfour wild-type activity. Fusion glycoproteins. activities Mean were normalizedrelative values to activities from four obtained inde- withpendent the four experiments wild-type and glycoproteins. corresponding Mean standard relative deviations values from are four shown. independent experiments and corresponding standard deviations are shown. Fusion activities of the different gB mutants in combination with gH/gL and gD were 2.3. Impact of gB N-Glycosylation Site Mutations on Virus Entry determined 24 h after cotransfection of RK13 cells with the respective expression plasmids and Theenhanced ability green of the fluorescent gB mutants protein to function (EGFP) in, viruswhich entry was wasused investigated as a marker byto visualize comple- Article mentationsyncytia formation. of a PrV mutant The area lacking and number the gB geneof syncytia UL27 (PrV- within∆gB) 10 [fields47]. To of this view end, (5.5 RK13 mm2 Influence of N-glycosylationcellseach) were were transfected determined, on Expression with and expression the mean plasmids syncytia and forarea Function either was multiplied WT gB, the ofby different the number gB mutants of syn- orcytia with to theobtain empty the vectorabsolute pcDNA-3, fusion activity. which Fusion served activity as a negative of the control.four wild-type One day proteins post- transfection,served as positive cells were control infected and was with set trans-complemented as 100%, while empty PrV- vector∆gB atpcDNA-3 an MOI was of 3. substi- After Pseudorabies Virus Glycoprotein24 h, cells and supernatants gB were harvested, and progeny virus titers were determined tuted for the gB expression plasmid and used as a negative control. Although inactivation on RK13 cells stably expressing PrV gB WT (RK13-gB) [47]. In line with the results from of N154 or N700 affected furin-cleavage and surface localization of gB as evident from Melina Vallbracht, Barbara G. Klupp andcell–cell Thomas fusion C. Mettenleiter assays, all gB * mutants with a single inactivated N-glycosylation site were Western blot analyses and immunofluorescence analyses (Figures 2A and 3), all mutants able to efficiently complement the gB-deficient PrV mutant to titers comparable to WT gB revealed wild-type like fusion activities (Figure 4). In contrast, simultaneous inactivation Institute of Molecular(Figure 5Virology). In contrast, and Cell Biology, complementation Friedrich-Loeffler-Institut, by gB-N6xQ 17493 resulted Greifswald-Insel in severely Riems, reduced titers of all N-glycosylation sites severely affected gB fusogenicity. Fusion activity of gB-N6xQ Germany; [email protected] only approximately (M.V.); 5 [email protected]× 102 PFU/ml. However,(B.G.K.) although very low, titers of gB-N6xQ was almost reduced to background levels (Figure 4), suggesting that N-glycans may be * Correspondence:complemented [email protected]; PrV-∆gB were Tel.: still +49-383-517-1250 above background levels (Figure5), indicating a residual important for the overall gB structure and/or stability of the protein. level of gB fusion activity even in the absence of all N-linked glycans. Abstract: Envelope glycoprotein (g)B is conserved throughout the Herpesviridae and mediates fusion of the viral envelope3.2.3. Discussion Impact with of cellular gB N-Glycosylation membranes for Site infectious Mutations entry on and Virus spread. Entry Like all viral envelope fusion proteins, gBHost-cell-derivedThe is modifiedability of by the asparagine N-linkedgB mutants (N glycans)-linked to function on glycosylation. viral in envelopevirus entryGlycans proteins was can investigated contribute can influence to by proteincomple- protein function,foldingmentation intracellular and of stability, a PrV tran mutant transport,sport, trafficking, lack viraling entrythe structure gB and gene spread,and UL27 immune and (PrV- immuneevasion.ΔgB) [47]. evasiongB of To the this [ 49al-]. end, Recently, RK13 phaherpesviruswecells investigated pseudorabies were transfected the viru functionals with(PrV) expression contains relevance six plasmids consensus of N-linked for sites either glycosylation for N-linkedWT gB, theglycosylation, in different PrV gH [gB30 ].mutants In the but their functionalpresentor with relevance study,the empty we is extendedunknown. vector pcDNA-3, ourHere, analyses we investigated which to N-linked served the occupancyas glycans a negative onand PrV functionalcontrol. gB. To One rel- this day end, post- the evance of N-glycosylationsixtransfection, predicted N-glycosylationcellssites inwere PrV infected gB. To sites this with end, in trans-complemented PrV all predicted gB (N154, N-glycosylation N264, PrV- N444,ΔgBN519, sites at anwere N636 MOI in- and of 3. N700) After activated either(Figure24 h, singly cells1) wereor and in combination systematicallysupernatants by were the inactivated introduction harvested, by of conservative and conservative progeny mutation mutationsvirus titers (N (N wereQ). determinedThe The resulting on resulting proteinssingleRK13 were mutantscells testedstably and for expressing a expression, gB mutant PrV fusion with gB WT activity inactivation (RK13-gB) in cell–cell of [47]. all fusion six In predictedline assays with and the sites comple- results were testedfrom cell– for mentation ofpropercell a gB-deficient fusion expression, assays, PrV processing,mutant.all gB mutants Our andresults with function indicate a single in that cell–cell inactivated all six fusionsites N-glycosylationare and indeed viral modified. entry. site were able However, while Comparativeglycosylation at sequence most sites analyses was dispensable reveal that for threegB expression out of six and sites fusogenicity, in PrV gB, namely inactivationN154, of N154 N444 and and N700 N700, affected are conservedgB processing among by furin alphaherpesvirus cleavage and surface gBs, N519localization. is not present in Although allBoHV-1, single mutants N636 iswere conserved functional in in members cell–cell fusion of the and Varicellovirus viral entry, simultaneous genus, and N264inacti- has only a vation of allcounterpart six N-glycosylation in VZV sites (Figure severely6). impaired fusion activity and viral entry, suggesting

a critical role of N-glycans for maintaining gB structure and function.

Citation: Vallbracht, M.; Klupp, Keywords: herpesvirus; pseudorabies virus; glycoprotein B; membrane fusion; N-linked glycosyl- B.G.; Mettenleiter, T.C. Influence of ation; virus entry N-glycosylation on Expression and Function of Pseudorabies Virus Glycoprotein gB. Pathogens 2021, 10, x. https://doi.org/10.3390/xxxxx 1. Introduction

Received: 14 December 2020 Herpesviruses are large-enveloped double-stranded DNA viruses that include many Accepted: 7 January 2021 important human and animal pathogens. Members of the Alphaherpesvirinae subfamily Published: 12 January 2021 have the broadest host range, are neurotropic and can persist in the infected hosts for life [1]. In addition to the human herpes simplex viruses 1 and 2 (HSV-1, -2) and Varicella Publisher’s Note: MDPI stays zoster virus (VZV), this subfamily contains many economically important veterinary neutral with regard to jurisdictional pathogens such as the Varicellovirus Pseudorabies virus (PrV, Suid alphaherpesvirus 1). PrV claims in published maps and is the causative agent of Aujeszky’s disease in swine and is capable of causing lethal dis- institutional affiliations. ease in a variety of other mammalian species [2,3]. Infectious entry and spread of herpesviruses require the fusion of the viral envelope

with the host cell membrane. Whereas many enveloped viruses encode a single but mul- Copyright: © 2021 by the authors. tifunctional glycoprotein (g) for host–cell receptor-binding and membrane fusion [4], her- Submitted for possible open access pesviruses utilize a multiprotein machinery to mediate these processes. The so-called publication under the terms and “core-fusion machinery” which is conserved in all herpesviruses is formed by gB, the conditions of the Creative Commons bona fide fusion protein, and the heterodimeric complex of the membrane-bound gH and Attribution (CC BY) license anchorless gL (gH/gL) [5]. In addition to the core-fusion machinery, herpesviruses require (http://creativecommons.org/licenses the assistance of nonconserved subgroup-specific receptor-binding proteins such as gD of /by/4.0/). the Alphaherpesvirinae for entry [6–8].

Pathogens 2021, 10, x. https://doi.org/10.3390/xxxxx www.mdpi.com/journal/pathogens Pathogens 2021, 10, x FOR PEER REVIEW 8 of 15

to efficiently complement the gB-deficient PrV mutant to titers comparable to WT gB (Fig- ure 5). In contrast, complementation by gB-N6xQ resulted in severely reduced titers of only approximately 5 × 102 PFU/ml. However, although very low, titers of gB-N6xQ complemented PrV-ΔgB were still above background levels (Figure 5), indicating a residual level of gB fusion activity even in the absence of all N-linked glycans.

Pathogens 2021, 10, x FOR PEER REVIEW 8 of 15

to efficiently complement the gB-deficient PrV mutant to titers comparable to WT gB (Fig- ure 5). In contrast, complementation by gB-N6xQ resulted in severely reduced titers of only approximately 5 × 102 PFU/ml. However, although very low, titers of gB-N6xQ com- Pathogens 2021, 10, 61 8 of 15 plemented PrV-ΔgB were still above background levels (Figure 5), indicating a residual level of gB fusion activity even in the absence of all N-linked glycans.

Figure 5. Virus entry mediated by the gB N-glycosylation site mutants. RK13 cells were transfected with expression plasmids encoding WT or mutant gB. Cells transfected with an empty vector served as a negative control (Mock). 24 h later, the cells were infected with PrV-ΔgB at an MOI of 3. Progeny virus titers were determined on gB-expressing RK13 cells and are given in plaque- forming units (PFU)/ml. Shown are the mean values from four independent experiments and corresponding standard deviations.

3. Discussion Host-cell-derived N-linked glycans on viral envelope proteins can influence protein folding and stability, transport, viral entry and spread, and immune evasion [49]. Re- cently, we investigated the functional relevance of N-linked glycosylation in PrV gH [30]. In the present study, we extended our analyses to N-linked glycans on PrV gB. To this end, the six predicted N-glycosylation sites in PrV gB (N154, N264, N444, N519, N636 and N700) (FigureFigure 1) were 5. Virus systematically entryentry mediatedmediated inactivated byby thethe gBgB N-glycosylationN-glycosyl by conservativeation sitesite mutants.mutationmutants. RK13RK13 (N cellscellsQ). wereThewere transfectedtrans- resulting singlewithfected expressionmutants with expression and plasmids a gB plasmids encodingmutant encoding with WT or inactivationmutant WT or mutant gB. Cellsof allgB. transfected six Cells predicted transfected with ansites emptywith were an vector empty served vec- tested for properastor a served negative expression, as controla negative processing, (Mock). control 24 h(Mock). later,and fu the 24nction cellsh later, were in thecell–cell infected cells were fusion with infected PrV- and∆gB viralwith at an PrV-entry. MOIΔgB of at 3. an Progeny MOI Comparativevirusof 3. Progeny titers sequence were virus determined analysestiters were reveal on determined gB-expressing that three on gB-expressing RK13out of cells six andsites RK are13 in cells given PrV and gB, in are plaque-forming namely given in plaque- units forming units (PFU)/ml. Shown are the mean values from four independent experiments and cor- N154, N444(PFU)/ml. and N700, Shown are conserved are the mean among values alph fromaherpesvirus four independent gBs, N519 experiments is not present and correspondingin responding standard deviations. BoHV-1, N636standard is conserved deviations. in members of the Varicellovirus genus, and N264 has only a counterpart in VZV (Figure 6). 3. Discussion Host-cell-derived N-linked glycans on viral envelope proteins can influence protein folding and stability, transport, viral entry and spread, and immune evasion [49]. Re- cently, we investigated the functional relevance of N-linked glycosylation in PrV gH [30]. In the present study, we extended our analyses to N-linked glycans on PrV gB. To this end, the six predicted N-glycosylation sites in PrV gB (N154, N264, N444, N519, N636 and N700) (Figure 1) were systematically inactivated by conservative mutation (NQ). The resulting single mutants and a gB mutant with inactivation of all six predicted sites were tested for proper expression, processing, and function in cell–cell fusion and viral entry. Comparative sequence analyses reveal that three out of six sites in PrV gB, namely N154, N444 and N700, are conserved among alphaherpesvirus gBs, N519 is not present in Figure 6. N-glycosylationFigure 6. N-glycosylation sites in alphaherpesvirus sites in alphaherpesvirus gB. Schematic representation gB. Schematic of representation the PrV gB open of readingthe PrV framegB colored BoHV-1, N636 is conserved in members of the Varicellovirus genus, and N264 has only a and labeled as inopen Figure reading1A. N-linked frame colored glycosylation and labeled sites N154,as in Fi N264,gure 1A. N444, N-linked N519, N636glycosylation and N700 sites in PrV N154, gB areN264, indicated, N444, N519, counterpartN636 and N700 in VZVin PrV (Figure gB are indica 6). ted, and corresponding sequence alignment of and corresponding sequence alignment of the N-X-S/T sequons of gB of pseudorabies virus (PrV; EM64049.1), varicella- the N-X-S/T sequons of gB of pseudorabies virus (PrV; EM64049.1), varicella-zoster virus (VZV; zoster virus (VZV; AH010537.2), bovine alphaherpesvirus 1 (BoHV-1; KU198480), human alphaherpesvirus 1 (HSV-1, strain F; ADD59998.1), human alphaherpesvirus 2 (HSV-2, strain 333; ABU45421.1) are shown below. The N-X-S/T sequons are shown in boldface on gray background. The sequence alignment was generated using ClustalW (Geneious Prime 2019.2.3).

N154 is the most N-terminally located N-linked glycosylation site in PrV gB and maps to a ﬂexible region connecting domains II and III (Figures1 and6). Western blot analyses showed that inactivation of this site affected the processing of gB by cellular furin, as evident by low levels of the two furin-cleaved subunits gBb and gBc and a more abundant signal for the uncleaved gB for this mutant (Figure2A). Early studies revealed that gB cleavage occurs in the Golgi apparatus after gB oligomerization in the ER [45]. Herpesvirus gBFigure is believed 6. N-glycosylation to undergo sites extensive in alphaherpesvirus conformational gB. Schematic changes representation for fusion and of isthe reported PrV gB to transitopen reading from aframe (predicted) colored trimericand labeled pre- as to in a Fi trimericgure 1A. post-fusion N-linked glycosylation form [5]. Only sites recently,N154, N264, the pre-fusionN444, N519, structure N636 and of N700 HSV-1 in PrV gB wasgB are reported indicated, [24 and]. Here, corresponding the HSV-1 sequence pre-fusion alignment gB structure of wasthe N-X-S/T used as sequons a template of gB to of generate pseudorabies a model viru fors (PrV; pre-fusion EM64049.1), PrV gBvaricella-zoster (Figure1C). Invirus contrast (VZV; to the location of aa N154 in the post-fusion conformation (Figure1B), in the PrV gB pre-fusion model, N154 is positioned in close proximity to the furin-cleavage site (Figure1C). Thus, it is conceivable that inactivation of this site resulting in the absence of the carbohydrate moiety at N154 may have an inﬂuence on the surrounding protein structure, which affects the accessibility for or recognition by furin and results in the observed defect in the cleavage. Pathogens 2021, 10, 61 9 of 15

Despite impaired cleavage and cell surface localization (Figure2A), gB-N154Q was still able to mediate efficient in vitro cell–cell fusion to levels comparable to WT gB (Figure4). Moreover, this mutant was able to rescue the entry defect of a gB-deficient PrV mutant (PrV-∆gB) reaching titers similar to WT gB complemented PrV-∆gB (Figure5). Although proteolytic cleavage is a prerequisite for fusion activity of several viral fusion proteins such as influenza hemagglutinin, paramyxovirus F or retrovirus Env, protease cleavage is not required for fusion activation of PrV gB [18,50], which is also true for other class III fusion proteins [51,52]. Thus, our results parallel previous findings that proteolytic cleavage is not required for PrV gB function [18]. Moreover, the data confirm earlier studies showing that in vitro fusion activity and surface expression of gB do not correlate [47,53]. Interestingly, mutation of N133 in HSV-2, which corresponds to PrV gB N154, was similarly shown to affect protein maturation and intracellular trafficking, suggesting a conserved function of this site [29]. Similar to site N154, N700, which is the most C-terminally located gB N-glycosylation site and maps to DV, was found to be important for proper processing by furin and cell surface localization (Figures2A and3). Interestingly, site N700 is also conserved in alphaherpesvirus gBs and corresponds to N668 in HSV-2 gB (Figure6). As observed for N700 in this study, inactivation of glycosylation at N668 impaired processing of HSV-2 gB [29]. However, in contrast to PrV gB in which sites N154 and N700 are apparently dispensable for in vitro fusion (Figure4) and viral entry (Figure5), inactivation of the glycosylation sites at N133 or N668 significantly inhibited in vitro fusion and viral entry mediated by HSV-2 gB [29]. These findings highlight similarities but also intriguing differences between gB of the two viruses. Differences in the requirements for gB fusion activity exist [5] and early swapping experiments have shown that PrV gB could complement the lethal defect of a gB-negative HSV-1 mutant, but not vice versa [54]. Moreover, whereas HSV-1 gB induced only very low levels of in vitro cell–cell fusion when coexpressed with PrV gH/gL and gD, fusion activity observed for PrV gB with the HSV-1 glycoproteins was significantly higher [55]. These experiments indicate that fusion mediated by PrV gB is more robust and may require fewer specific interactions than gB of HSV, further suggesting that PrV gB may be more tolerant of local structural changes. Two other N-linked glycosylation sites in HSV-2 gB, N390 and N483, have been found to be important for in vitro cell–cell fusion activity and viral entry [29]. However, the site at N390 is conserved only in the simplex viruses, and PrV gB N519, corresponding to N483 in HSV-2 gB (Figure6), was found to be dispensable for in vitro fusion activity and viral entry of PrV gB (Figures4 and5), indicating different roles of this site in gB of the two viruses. When the study by Luo et al. was conducted [29], the pre-fusion structure of HSV-1 gB was not available. However, in the HSV-1 pre-fusion structure and in the pre-fusion PrV gB model, aa N483 (HSV-2 gB) and N519 (PrV gB) are exposed on the very top of the molecule (Figure1C). Due to this position, it is tempting to speculate that a glycan attached to this site could play a role in immune evasion. Western blot analyses indicated that sites N264, N444, N519 and N636 are all occupied by N-glycans since the respective N-terminal (gBb), or C-terminal (gBc) subunits migrated faster compared to the respective WT gB fragments (Figure2A). Although these sites are apparently all modified by N-glycans in PrV gB, their presence is not required for proper gB processing, surface localization (Figure3), function during cell–cell fusion (Figure4), or viral entry (Figure5). Nevertheless, they may perform different biological functions in vivo. Interestingly, the three single mutants gB-N154Q, gB-N264Q and gB-N444Q exhibited differences in their respective molecular weights when compared to each other (Figure2A, upper panel). In particular, gB-N444Q migrated faster than gB-N154Q and gB-N264Q. It is well established that glycoproteins can be heterogeneous in their content of complex N-glycans, whereby the N-glycan diversity may be caused by the aa sequence and/or the local structure influencing substrate availability for Golgi glycosidases or Pathogens 2021, 10, 61 10 of 15

glycosyltransferases [56]. Thus, the observed differences in molecular weight may be due to the heterogeneous composition of carbohydrates attached to N444, N154 and N264 [57]. N636 is located in gB DIV and is part of an NXS/T sequon that is conserved among members of the varicelloviruses VZV and BoHV-1 but not in the simplex viruses HSV-1 and 2 (Figure6). N620 of VZV gB, which corresponds to PrV N636, lies within a conserved beta-strand in DIV, which was recently reported to be part of an epitope recognized by a neutralizing human mAb (93k) directed against VZV gB [21]. Although inactivation of N636 had no effect on PrV gB function during cell–cell fusion or viral entry, the relevance of this N-glycosylation site in vivo remains to be determined. In this context, it is well documented that N-glycans of viral surface proteins, e.g., of HIV-1 Env, can interfere with the host antibody response by serving as a “shield” to cover essential epitopes, thereby protecting the virus from antibody-mediated neutralization [58]. At present, we cannot exclude that N-glycans on PrV gB could serve to obscure epitopes, which could be targeted by neutralizing antibodies. In addition to the single mutants, a gB variant was generated in which all N-glycosylation sites were inactivated simultaneously. Glycosylation analysis revealed that this gB variant is not sensitive to PNGase F digestion (Figure2B), and gBa bands of PNGase digested and non-treated gB-N6xQ migrated comparable to PNGase F-treated WT gB, indicating that all sites were indeed inactivated in gB-N6xQ (Figure2B). Western blot (Figure2B) and indirect immunofluorescence analyses (Figure3) revealed that gB-N6xQ is neither processed by furin nor detectable on the surface of transfected RK13 cells. Although all single mutants were able to promote WT-like in vitro cell–cell fusion and viral entry, gB- N6xQ was incapable of mediating efficient cell–cell fusion, and fusion activity was reduced to almost background levels (Figure4). In good correlation with these results, gB-N6xQ complemented gB-deficient PrV to only very low titers of 5 × 102 PFU/mL (Figure5). For other components of the herpesvirus fusion machinery, such as HSV-1 gD, it was shown that the absence of N-glycans influences the overall protein structure. However, these structural changes did not affect gD function during infection in cell culture [59–61]. With respect to this, it is conceivable that the individual mutations in PrV gB led to minor structural changes that have no major impact on gB structure and subsequently gB functionality. In gB-N6xQ, however, the structural changes may have an additive adverse effect on gB structure, leading to impaired processing and loss of function. In summary, our results show that all six predicted N-glycosylation sites in PrV gB are modified in vitro by N-glycans. We demonstrate that the individual N-glycosylation sites play a modulatory but dispensable role for gB function, whereas simultaneous inactivation of all sites severely affects gB function in fusion, highlighting an important role of these glycans for correct folding, structure and/or stability of gB. Although mutation of most of the sites had no notable effect on gB processing and function during in vitro fusion and entry, which is largely congruent to our results on the role of N-glycans on PrV gH [30], we found that N-glycosylation of PrV gB at the highly conserved positions N154 and N700 is important for proper processing of gB by cellular furin. Taken together, this study expands our knowledge on the role of N-linked glycans on the herpesvirus fusion protein gB. Which role gB N-glycosylation plays in vivo and whether removal of certain sites can affect virus-specific antibody responses remains to be determined.

4. Materials and Methods 4.1. Cells and Viruses Rabbit kidney (RK13) and RK13-gB cells [47] were grown in Dulbecco0s modiﬁed Eagle0s minimum essential medium (MEM) supplemented with 10% fetal calf serum at 37 ◦C. Viruses used in this study were derived from PrV strain Kaplan (PrV-WT) [62]. The PrV mutant lacking the gB gene has been described previously [47]. Pathogens 2021, 10, 61 11 of 15

4.2. Expression Plasmids and Generation of PrV gB N-Glycosylation Mutants Generation of expression plasmids for PrV-WT gB, gD, gH, and gL has been described previously [63]. The expression plasmid encoding PrV gB WT was used for site-directed mutagenesis (QuikChange II XL kit, Agilent, CA Santa Clara, USA). PrV gB residues are numbered according to GenBank accession number AEM6404.1 [64]. The oligonucleotide primers used for gB mutagenesis leading to inactivation of the potential N-glycosylation sites are listed in Table1. Correct mutagenesis was veriﬁed by sequencing using the standard primers T7 and SP6 as well as the gB-speciﬁc primers 130 and 134 listed in Table1, the BigDye Terminator v1.1 cycle sequencing kit, and a 3130 genetic analyzer (Applied Biosystems, CA Foster City, USA).

Table 1. Oligonucleotides used for mutagenesis and sequence analyses.

Primer Name Sequence (50 →30) gB Ka N154Q F CTCGCAGGGGCGCCAGTTCACGGAGGGG gB Ka N264Q F CGGCTGGCACACCACCCAGGACACCTACACC gB Ka N444Q F CGGCGGCGCTACCAGAACACGCACGTGCTGG gB Ka N519Q F CGCCGGCCGTCCAGGGCACGGGGCACC gB Ka N636Q F CACCTTCGAGCACCAGGGCACGGGCGTG gB Ka N700Q F CGCGGGTGACCCTGCAGCTGACGCTGCTGG 130 CGTGCCCGTCCCCGTGCAGGAGATC 134 CCATCTACCGGCGGCGCTACAACAG Only forward strand mutagenesis primers (F) are listed. The corresponding reverse strand primers are ex- actly complementary. PrV gB residues are numbered according to GenBank accession number EM64049.1 [64]. Nonmatching nucleotides are shown in boldface.

4.3. Western Blot Analyses RK13 cells were harvested 24 h after transfection with 600 ng of the expression plasmids encoding wild-type gB or the different N-glycosylation mutants using lipofectamine 2000 (Thermo Fisher Scientiﬁc, Darmstadt, Germany). Cells were lysed, and protein samples were separated by discontinuous sodium dodecyl sulfate-polyacrylamide gel elec- trophoresis (SDS–PAGE) and transferred to nitrocellulose membranes. Membranes were incubated with monoclonal PrV gB antibodies (c15-b1 or A20-c26 at 1:10 dilution) [18,47] and peroxidase-conjugated secondary antibody (Dianova, Hamburg, Germany). Clarity Western ECL substrate (Bio-Rad Laboratories, Feldkirchen, Germany) and a VersaDoc 4000 MP imager (Bio-Rad Laboratories, Feldkirchen, Germany) were used for detection.

4.4. PNGase F Digestion for Glycosylation Analysis Lysates of RK13 cells transfected with expression plasmids for WT gB or gB-N6xQ were treated with 500 U of peptide-N-glycosidase F (PNGase) for 2 h at 37 ◦C under buffer conditions according to manufacturer0s instructions to remove all N-linked glycans. After digestion, samples were separated by SDS–PAGE as described above.

4.5. In Vitro Cell–Cell Fusion Assays Fusion activity of the gB N-glycosylation site mutants was determined using a transient transfection-based cell–cell fusion assay [44]. Briefly, approximately 1.8 × 105 RK13 cells per well were seeded into 24-well cell culture plates and transfected with 200 ng each of the expression plasmids for EGFP (pEGFP-N1; Clontech), PrV gH, gL, gD and WT gB or the different N-glycosylation site gB mutants in 100 µL of Opti-MEM using 1 µL of lipofectamine 2000 (Thermo Fisher Scientific, Düsseldorf, Germany). Twenty-four hours post-transfection, cells were fixed with 3% paraformaldehyde, and syncytium formation was assessed using an Eclipse Ti-S fluorescence microscope and NIS-Elements imaging software (Nikon, Düsseldorf, Germany). Total fusion activity was determined by multi- plication of the number of syncytia with three or more nuclei by the mean syncytia area within 10 fields of view (5.5 mm2 each). Mean values and standard deviations from four independent assays were determined. Pathogens 2021, 10, 61 12 of 15

4.6. Trans-Complementation Assay The ability of the different gB mutants to function in virus entry was determined by trans-complementation of PrV-∆gB [47] as described previously [18]. Brieﬂy, approximately 1.8 × 105 RK13 cells per well were seeded into 24-well cell culture plates. On the following day, cells were transfected with 400 ng of the expression plasmid for WT or mutant gB using 1 µL lipofectamine 2000. Twenty-four hours post-transfection, the cells were infected with phenotypically gB-complemented PrV-∆gB at a multiplicity of infection (MOI) of 3 on ice and consecutively incubated 1 h on ice and at 37 ◦C for 1 h. Subsequently, the inoculum was removed, and the non-penetrated virus was inactivated by low-pH treatment [65]. Cells were washed with PBS, and 1 mL fresh prewarmed medium was added to the monolayer. After twenty-four hours at 37 ◦C, the cells were harvested together with the supernatants and lysed by freeze-thawing (−80 ◦C and 37 ◦C). Progeny virus titers were determined on RK13-gB cells. The experiment was repeated four times, and mean values and corresponding standard deviations were calculated.

4.7. Comparative Indirect Immunofluorescence Analysis To visualize total and surface localization of the gB mutants, comparative indirect immunofluorescence analyses of transfected and permeabilized or non-permeabilized RK13 cells were done. RK13 cell monolayers in 24 well cell culture dishes were transfected with 400 ng of the corresponding gB expression plasmids as described above (lipofectamine 2000; Thermo Fisher Scientific, Darmstadt, Germany). Twenty-four hours post-transfection, cells were fixed with 3% PFA in PBS for 20 min. Optionally, cells were permeabilized in PBS containing 0.1% Triton X-100 for 10 min at room temperature. Subsequently, all cells were washed with PBS and blocked with 0.25% skimmed milk in PBS before they were incubated with the rabbit antiserum specific for PrV gB at a dilution of 1:1000 in PBS [48]. After 1 h at room temperature, bound antibody was detected with Alexa 488- or 633-conjugated goat anti-rabbit antibodies (Thermo Fisher Scientific, Darmstadt, Germany) at a dilution of 1:1000 in PBS. Nuclei were stained with Hoechst (33,342 staining dye solution; Abcam, Berlin, Germany) at a dilution of 1:20,000 in PBS for 10 min at room temperature. Representative images were taken with a Leica DMi8 fluorescence microscope (Leica Microsystems, Wetzlar, Germany).

Author Contributions: Conceptualization, M.V., B.G.K. and T.C.M.; formal analysis, M.V.; funding acquisition, B.G.K. and T.C.M.; investigation, M.V.; methodology, M.V.; supervision, B.G.K. and T.C.M.; writing–original draft, M.V.; writing–review and editing, M.V., B.G.K. and T.C.M. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the Deutsche Forschungsgemeinschaft, DFG grant number Me 854/11-2. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Data are contained within the article. Acknowledgments: The technical assistance of K. Müller is greatly appreciated. Conﬂicts of Interest: The authors declare no conﬂict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References 1. Davison, A.J. Herpesvirus Systematics. Vet. Microbiol. 2010, 143, 52–69. [CrossRef] 2. Mettenleiter, T.C. Pseudorabies Virus. In Encyclopedia of Virology; Mahy, B.W.J., Van Regenmortel, M.H.V., Eds.; Elsevier: Oxford, UK, 2008; pp. 341–351. 3. Sehl, J.; Teifke, J.P. Comparative Pathology of Pseudorabies in Different Naturally and Experimentally Infected Species-a Review. Pathogens 2020, 9, 633. [CrossRef] 4. Harrison, S.C. Viral Membrane Fusion. Virology 2015, 479–480, 498–507. [CrossRef] Pathogens 2021, 10, 61 13 of 15

5. Vallbracht, M.; Backovic, M.; Klupp, B.G.; Rey, F.A.; Mettenleiter, T.C. Common Characteristics and Unique Features: A Comparison of the Fusion Machinery of the Alphaherpesviruses Pseudorabies Virus and Herpes Simplex Virus. Adv. Virus Res. 2019, 104, 225–281. 6. Spear, P.G.; Longnecker, R. Herpesvirus Entry: An Update. J. Virol. 2003, 77, 10179–10185. [CrossRef] 7. Connolly, S.A.; Jackson, J.O.; Jardetzky, T.S.; Longnecker, R. Fusing Structure and Function: A Structural View of the Herpesvirus Entry Machinery. Nat. Rev. Microbiol. 2011, 9, 369–381. [CrossRef] 8. Krummenacher, C.; Carfi, A.; Eisenberg, R.J.; Cohen, G.H. Entry of Herpesviruses into Cells: The Enigma Variations. Adv. Exp. Med. Biol. 2013, 790, 178–195. 9. Atanasiu, D.; Saw, W.T.; Cohen, G.H.; Eisenberg, R.J. Cascade of Events Governing Cell-Cell Fusion Induced by Herpes Simplex Virus Glycoproteins Gd, Gh/Gl, and Gb. J. Virol. 2010, 84, 12292–12299. [CrossRef] 10. Atanasiu, D.; Whitbeck, J.C.; Cairns, T.M.; Reilly, B.; Cohen, G.H.; Eisenberg, R.J. Bimolecular Complementation Reveals That Glycoproteins Gb and Gh/Gl of Herpes Simplex Virus Interact with Each Other During Cell Fusion. Proc. Natl. Acad. Sci. USA 2007, 104, 18718–18723. [CrossRef] 11. Stampfer, S.D.; Heldwein, E.E. Stuck in the Middle: Structural Insights into the Role of the Gh/Gl Heterodimer in Herpesvirus Entry. Curr. Opin Virol. 2013, 3, 13–19. [CrossRef] 12. Geraghty, R.J.; Krummenacher, C.; Cohen, G.H.; Eisenberg, R.J.; Spear, P.G. Entry of Alphaherpesviruses Mediated by Poliovirus Receptor-Related Protein 1 and Poliovirus Receptor. Science 1998, 280, 1618–1620. [CrossRef][PubMed] 13. Montgomery, R.I.; Warner, M.S.; Lum, B.J.; Spear, P.G. Herpes Simplex Virus-1 Entry into Cells Mediated by a Novel Member of the Tnf/Ngf Receptor Family. Cell 1996, 87, 427–436. [CrossRef] 14. Cairns, T.M.; Atanasiu, D.; Saw, W.T.; Lou, H.; Whitbeck, J.C.; Ditto, N.T.; Bruun, B.; Browne, H.; Bennett, L.; Wu, C.; et al. Localization of the Interaction Site of Herpes Simplex Virus Glycoprotein D (Gd) on the Membrane Fusion Regulator, Gh/Gl. J. Virol. 2020, 94, e00983-20. [CrossRef][PubMed] 15. Eisenberg, R.J.; Atanasiu, D.; Cairns, T.M.; Gallagher, J.R.; Krummenacher, C.; Cohen, G.H. Herpes Virus Fusion and Entry: A Story with Many Characters. Viruses 2012, 4, 800–832. [CrossRef] 16. Atanasiu, D.; Whitbeck, J.C.; de Leon, M.P.; Lou, H.; Hannah, B.P.; Cohen, G.H.; Eisenberg, R.J. Bimolecular Complementation Defines Functional Regions of Herpes Simplex Virus Gb That Are Involved with Gh/Gl as a Necessary Step Leading to Cell Fusion. J. Virol. 2010, 84, 3825–3834. [CrossRef] 17. Rogalin, H.B.; Heldwein, E.E. Interplay between the Herpes Simplex Virus 1 Gb Cytodomain and the Gh Cytotail During Cell-Cell Fusion. J. Virol. 2015, 89, 12262–12272. [CrossRef] 18. Vallbracht, M.; Brun, D.; Tassinari, M.; Vaney, M.C.; Pehau-Arnaudet, G.; Guardado-Calvo, P.; Haouz, A.; Klupp, B.G.; Mettenleiter, T.C.; Rey, F.A.; et al. Structure-Function Dissection of the Pseudorabies Virus Glycoprotein B Fusion Loops. J. Virol. 2018, 92, e01203-17. [CrossRef] 19. Li, X.; Yang, F.; Hu, X.; Tan, F.; Qi, J.; Peng, R.; Wang, M.; Chai, Y.; Hao, L.; Deng, J.; et al. Two Classes of Protective Antibodies against Pseudorabies Virus Variant Glycoprotein B: Implications for Vaccine Design. PLoS Pathog. 2017, 13, e1006777. [CrossRef] 20. Heldwein, E.E.; Lou, H.; Bender, F.C.; Cohen, G.H.; Eisenberg, R.J.; Harrison, S.C. Crystal Structure of Glycoprotein B from Herpes Simplex Virus 1. Science 2006, 313, 217–220. [CrossRef] 21. Oliver, S.L.; Xing, Y.; Chen, D.H.; Roh, S.H.; Pintilie, G.D.; Bushnell, D.A.; Sommer, M.H.; Yang, E.; Carfi, A.; Chiu, W.; et al. A Glycoprotein B-Neutralizing Antibody Structure at 2.8 a Uncovers a Critical Domain for Herpesvirus Fusion Initiation. Nat. Commun. 2020, 11, 4141. [CrossRef] 22. Backovic, M.; Jardetzky, T.S. Class Iii Viral Membrane Fusion Proteins. Adv. Exp. Med. Biol. 2011, 714, 91–101. [PubMed] 23. Fontana, J.; Atanasiu, D.; Saw, W.T.; Gallagher, J.R.; Cox, R.G.; Whitbeck, J.C.; Brown, L.M.; Eisenberg, R.J.; Cohen, G.H. The Fusion Loops of the Initial Prefusion Conformation of Herpes Simplex Virus 1 Fusion Protein Point toward the Membrane. MBio 2017, 8, e01268-17. [CrossRef][PubMed] 24. Vollmer, B.; Prazak, V.; Vasishtan, D.; Jefferys, E.E.; Hernandez-Duran, A.; Vallbracht, M.; Klupp, B.G.; Mettenleiter, T.C.; Backovic, M.; Rey, F.A.; et al. The Prefusion Structure of Herpes Simplex Virus Glycoprotein B. Sci. Adv. 2020, 6, eabc1726. [CrossRef] [PubMed] 25. Si, Z.; Zhang, J.; Shivakoti, S.; Atanasov, I.; Tao, C.L.; Hui, W.H.; Zhou, K.; Yu, X.; Li, W.; Luo, M.; et al. Different Functional States of Fusion Protein Gb Revealed on Human Cytomegalovirus by Cryo Electron Tomography with Volta Phase Plate. PLoS Pathog. 2018, 14, e1007452. [CrossRef] 26. Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. Swiss-Model: Homology Modelling of Protein Structures and Complexes. Nucleic Acids Res. 2018, 46, W296–W303. [CrossRef] 27. Goddard, T.D.; Huang, C.C.; Meng, E.C.; Pettersen, E.F.; Couch, G.S.; Morris, J.H.; Ferrin, T.E. Ucsf Chimerax: Meeting Modern Challenges in Visualization and Analysis. Protein. Sci. 2018, 27, 14–25. [CrossRef] 28. Watanabe, Y.; Bowden, T.A.; Wilson, I.A.; Crispin, M. Exploitation of Glycosylation in Enveloped Virus Pathobiology. Biochim. Biophys. Acta Gen. Subj. 2019, 1863, 1480–1497. [CrossRef] 29. Luo, S.; Hu, K.; He, S.; Wang, P.; Zhang, M.; Huang, X.; Du, T.; Zheng, C.; Liu, Y.; Hu, Q. Contribution of N-Linked Glycans on Hsv-2 Gb to Cell-Cell Fusion and Viral Entry. Virology 2015, 483, 72–82. [CrossRef] Pathogens 2021, 10, 61 14 of 15

30. Vallbracht, M.; Rehwaldt, S.; Klupp, B.G.; Mettenleiter, T.C.; Fuchs, W. Functional Role of N-Linked Glycosylation in Pseudorabies Virus Glycoprotein Gh. J. Virol. 2018, 92, e00084-18. [CrossRef] 31. Kornfeld, R.; Kornfeld, S. Assembly of Asparagine-Linked Oligosaccharides. Annu. Rev. Biochem. 1985, 54, 631–664. [CrossRef] 32. Helenius, A.; Aebi, M. Roles of N-Linked Glycans in the Endoplasmic Reticulum. Annu. Rev. Biochem. 2004, 73, 1019–1049. [CrossRef][PubMed] 33. Lee, P.S.; Ohshima, N.; Stanfield, R.L.; Yu, W.; Iba, Y.; Okuno, Y.; Kurosawa, Y.; Wilson, I.A. Receptor Mimicry by Antibody F045-092 Facilitates Universal Binding to the H3 Subtype of Influenza Virus. Nat. Commun. 2014, 5, 3614. [CrossRef][PubMed] 34. Kobayashi, Y.; Suzuki, Y. Evidence for N-Glycan Shielding of Antigenic Sites During Evolution of Human Influenza a Virus Hemagglutinin. J. Virol. 2012, 86, 3446–3451. [CrossRef] 35. Grant, O.C.; Montgomery, D.; Ito, K.; Woods, R.J. Analysis of the Sars-Cov-2 Spike Protein Glycan Shield Reveals Implications for Immune Recognition. Sci. Rep. 2020, 10, 14991. [CrossRef][PubMed] 36. Watanabe, Y.; Allen, J.D.; Wrapp, D.; McLellan, J.S.; Crispin, M. Site-Specific Glycan Analysis of the Sars-Cov-2 Spike. Science 2020, 369, 330–333. [CrossRef][PubMed] 37. Walls, A.C.; Tortorici, M.A.; Frenz, B.; Snijder, J.; Li, W.; Rey, F.A.; DiMaio, F.; Bosch, B.J.; Veesler, D. Glycan Shield and Epitope Masking of a Coronavirus Spike Protein Observed by Cryo-Electron Microscopy. Nat. Struct. Mol. Biol. 2016, 23, 899–905. [CrossRef] 38. Xiong, X.; Tortorici, M.A.; Snijder, J.; Yoshioka, C.; Walls, A.C.; Li, W.; McGuire, A.T.; Rey, F.A.; Bosch, B.J.; Veesler, D. Glycan Shield and Fusion Activation of a Deltacoronavirus Spike Glycoprotein Fine-Tuned for Enteric Infections. J. Virol. 2018, 92, JVI.01628-17. [CrossRef] 39. Wang, B.; Wang, Y.; Frabutt, D.A.; Zhang, X.; Yao, X.; Hu, D.; Zhang, Z.; Liu, C.; Zheng, S.; Xiang, S.H.; et al. Mechanistic Understanding of N-Glycosylation in Ebola Virus Glycoprotein Maturation and Function. J. Biol. Chem. 2017, 292, 5860–5870. [CrossRef] 40. Panico, M.; Bouche, L.; Binet, D.; O’Connor, M.J.; Rahman, D.; Pang, P.C.; Canis, K.; North, S.J.; Desrosiers, R.C.; Chertova, E.; et al. Mapping the Complete Glycoproteome of Virion-Derived Hiv-1 Gp120 Provides Insights into Broadly Neutralizing Antibody Binding. Sci. Rep. 2016, 6, 32956. [CrossRef] 41. Cao, L.; Pauthner, M.; Andrabi, R.; Rantalainen, K.; Berndsen, Z.; Diedrich, J.K.; Menis, S.; Sok, D.; Bastidas, R.; Park, S.R.; et al. Differential Processing of Hiv Envelope Glycans on the Virus and Soluble Recombinant Trimer. Nat. Commun. 2018, 9, 3693. [CrossRef] 42. Fontes-Garfias, C.R.; Shan, C.; Luo, H.; Muruato, A.E.; Medeiros, D.B.A.; Mays, E.; Xie, X.; Zou, J.; Roundy, C.M.; Wakamiya, M.; et al. Functional Analysis of Glycosylation of Zika Virus Envelope Protein. Cell Rep. 2017, 21, 1180–1190. [CrossRef][PubMed] 43. Mondotte, J.A.; Lozach, P.Y.; Amara, A.; Gamarnik, A.V. Essential Role of Dengue Virus Envelope Protein N Glycosylation at Asparagine-67 During Viral Propagation. J. Virol. 2007, 81, 7136–7148. [CrossRef] 44. Vallbracht, M.; Schröter, C.; Klupp, B.G.; Mettenleiter, T.C. Transient Transfection-Based Fusion Assay for Viral Proteins. Bio- Protocol 2017, 7, e2162. [CrossRef] 45. Whealy, M.E.; Robbins, A.K.; Enquist, L.W. The Export Pathway of the Pseudorabies Virus Gb Homolog Gii Involves Oligomer Formation in the Endoplasmic Reticulum and Protease Processing in the Golgi Apparatus. J. Virol. 1990, 64, 1946–1955. [CrossRef] 46. Wolfer, U.; Kruft, V.; Sawitzky, D.; Hampl, H.; Wittmann-Liebold, B.; Habermehl, K.O. Processing of Pseudorabies Virus Glycoprotein Gii. J. Virol. 1990, 64, 3122–3125. [CrossRef][PubMed] 47. Nixdorf, R.; Klupp, B.G.; Karger, A.; Mettenleiter, T.C. Effects of Truncation of the Carboxy Terminus of Pseudorabies Virus Glycoprotein B on Infectivity. J. Virol. 2000, 74, 7137–7145. [CrossRef][PubMed] 48. Kopp, M.; Granzow, H.; Fuchs, W.; Klupp, B.G.; Mundt, E.; Karger, A.; Mettenleiter, T.C. The Pseudorabies Virus Ul11 Protein Is a Virion Component Involved in Secondary Envelopment in the Cytoplasm. J. Virol. 2003, 77, 5339–5351. [CrossRef] 49. Bagdonaite, I.; Wandall, H.H. Global Aspects of Viral Glycosylation. Glycobiology 2018, 28, 443–467. [CrossRef] 50. Okazaki, K. Proteolytic Cleavage of Glycoprotein B Is Dispensable for in Vitro Replication, but Required for Syncytium Formation of Pseudorabies Virus. J. Gen. Virol. 2007, 88, 1859–1865. [CrossRef] 51. Dong, S.; Blissard, G.W. Functional Analysis of the Autographa Californica Multiple Nucleopolyhedrovirus Gp64 Terminal Fusion Loops and Interactions with Membranes. J. Virol. 2012, 86, 9617–9628. [CrossRef] 52. Strive, T.; Borst, E.; Messerle, M.; Radsak, K. Proteolytic Processing of Human Cytomegalovirus Glycoprotein B Is Dispensable for Viral Growth in Culture. J. Virol. 2002, 76, 1252–1264. [CrossRef] 53. Fan, Z.; Grantham, M.L.; Smith, M.S.; Anderson, E.S.; Cardelli, J.A.; Muggeridge, M.I. Truncation of Herpes Simplex Virus Type 2 Glycoprotein B Increases Its Cell Surface Expression and Activity in Cell-Cell Fusion, but These Properties Are Unrelated. J. Virol. 2002, 76, 9271–9283. [CrossRef] 54. Mettenleiter, T.C.; Spear, P.G. Glycoprotein Gb (Gii) of Pseudorabies Virus Can Functionally Substitute for Glycoprotein Gb in Herpes Simplex Virus Type 1. J. Virol. 1994, 68, 500–504. [CrossRef] 55. Böhm, S.W.; Backovic, M.; Klupp, B.G.; Rey, F.A.; Mettenleiter, T.C.; Fuchs, W. Functional Characterization of Glycoprotein H Chimeras Composed of Conserved Domains of the Pseudorabies Virus and Herpes Simplex Virus 1 Homologs. J. Virol. 2016, 90, 421–432. [CrossRef] 56. Stanley, P.; Schachter, H.; Taniguchi, N. N-Glycans. In Essentials of Glycobiology; Cold Spring Harbor: Suffolk County, NY, USA, 2009. Pathogens 2021, 10, 61 15 of 15

57. Bieberich, E. Synthesis, Processing, and Function of N-Glycans in N-Glycoproteins. Adv. Neurobiol. 2014, 9, 47–70. 58. Berndsen, Z.T.; Chakraborty, S.; Wang, X.; Cottrell, C.A.; Torres, J.L.; Diedrich, J.K.; Lopez, C.A.; Yates, J.R., 3rd; van Gils, M.J.; Paulson, J.C.; et al. Visualization of the Hiv-1 Env Glycan Shield across Scales. Proc. Natl. Acad. Sci. USA 2020, 117, 28014–28025. [CrossRef] 59. Sodora, D.L.; Cohen, G.H.; Eisenberg, R.J. Inﬂuence of Asparagine-Linked Oligosaccharides on Antigenicity, Processing, and Cell Surface Expression of Herpes Simplex Virus Type 1 Glycoprotein D. J. Virol. 1989, 63, 5184–5193. [CrossRef] 60. Sodora, D.L.; Cohen, G.H.; Muggeridge, M.I.; Eisenberg, R.J. Absence of Asparagine-Linked Oligosaccharides from Glycoprotein D of Herpes Simplex Virus Type 1 Results in a Structurally Altered but Biologically Active Protein. J. Virol. 1991, 65, 4424–4431. [CrossRef] 61. Sodora, D.L.; Eisenberg, R.J.; Cohen, G.H. Characterization of a Recombinant Herpes Simplex Virus Which Expresses a Glycopro- tein D Lacking Asparagine-Linked Oligosaccharides. J. Virol. 1991, 65, 4432–4441. [CrossRef] 62. Kaplan, A.S.; Vatter, A.E. A Comparison of Herpes Simplex and Pseudorabies Viruses. Virology 1959, 7, 394–407. [CrossRef] 63. Klupp, B.G.; Nixdorf, R.; Mettenleiter, T.C. Pseudorabies Virus Glycoprotein M Inhibits Membrane Fusion. J. Virol. 2000, 74, 6760–6768. [CrossRef] 64. Szpara, M.L.; Tafuri, Y.R.; Parsons, L.; Shamim, S.R.; Verstrepen, K.J.; Legendre, M.; Enquist, L.W. A Wide Extent of Inter-Strain Diversity in Virulent and Vaccine Strains of Alphaherpesviruses. PLoS Pathog. 2011, 7, e1002282. [CrossRef] 65. Mettenleiter, T.C. Glycoprotein Giii Deletion Mutants of Pseudorabies Virus Are Impaired in Virus Entry. Virology 1989, 171, 623–625. [CrossRef]