DOCSLIB.ORG

Production of Cellulases by Rhizopus Stolonifer from Glucose-Containing

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Production of Cellulases by Rhizopus Stolonifer from Glucose-Containing J. Microbiol. Biotechnol. (2017), 27(3), 514–523 https://doi.org/10.4014/jmb.1608.08048 Research Article Review jmb Production of Cellulases by Rhizopus stolonifer from Glucose-Containing Media Based on the Regulation of Transcriptional Regulator CRE Yingying Zhang1, Bin Tang1,2*, and Guocheng Du1 1School of Biotechnology, Jiangnan University, Wuxi 214000, P.R. China 2College of Biochemical Engineering, Anhui Polytechnic University, Wuhu 241000, P.R. China Received: August 24, 2016 Revised: October 25, 2016 Carbon catabolite repression is a crucial regulation mechanism in microorganisms, but its Accepted: November 16, 2016 characteristic in Rhizopus is still unclear. We extracted a carbon regulation gene, cre, that encoded a carbon catabolite repressor protein (CRE) from Rhizopus stolonifer TP-02, and studied the regulation of CRE by real-time qPCR. CRE responded to glucose in a certain range, First published online where it could significantly regulate part of the cellulase genes (eg, bg, and cbh2) without cbh1. November 23, 2016 In the comparison of the response of cre and four cellulase genes to carboxymethylcellulose *Corresponding author sodium and a simple carbon source (lactose), the effect of CRE was only related to the Phone: +86-553-2871210; concentration of reducing sugars. By regulating the reducing sugars to range from 0.4% to Fax: +86-553-2871091; 0.6%, a glucose-containing medium with lactose as the inducer could effectively induce E-mail: [email protected] cellulases without the repression of CRE. This regulation method could potentially reduce the cost of enzymes produced in industries and provide a possible solution to achieve the large- pISSN 1017-7825, eISSN 1738-8872 scale synthesis of cellulases. Copyright© 2017 by The Korean Society for Microbiology Keywords: Cellulases, carbon catabolite repressor, transcriptional regulation, Rhizopus stolonifer and Biotechnology Introduction of cells, of which the prerequisite is to overcome the carbon metabolism repression. Cellulases are composed of endoglucanases (E.C. 3.2.1.4), Carbon catabolite repression is a crucial regulation cellobiohydrolases (E.C. 3.2.1.91; E.C. 3.2.1.176), and β- mechanism in microorganisms, preventing the expression glucosidases (E.C. 3.2.1.21) [1, 2]. They are widely applied of enzymes required for the utilization of complex carbon in textile processing, printing and dyeing, food and brewery sources when simple carbon sources like glucose are production, detergent production, and biorefinery [2, 3]. present in the medium [9]. The transcription factor However, a low yield with a poor specific activity is a responsible for the repression of glucose-regulated genes bottleneck in the application of cellulases. Generally, has been found in the filamentous fungi; namely, cre1/creA, industrial cellulase production relies on cellulosic substrates which was highly conserved [10-12]. CRE1 can repress the that induce the secretion of cellulases from filamentous transcription of cellulases-encoding genes by binding to the fungi, the disadvantage of which is the long production CCCCAC region in the promoter fragment of those genes cycle with lower substrate utilization [4]. Much of the [13]. Specifically, CRE1 indirectly regulates the expression research has examined that cellulase biosynthesis is mainly of cbh2 by adjusting another transcription factor, XYR1 [13]. adjusted by the induction and the repression of degradation In addition, transport of the inducer sophorose could be products. Cellulose, cellobiose, sophorose, lactose, and suppressed owing to the presence of glucose [14]. However, derivative cellulose have been shown to be effective in the characteristic of carbon metabolism repression that inducing the formation of Trichoderma cellulases [5-8]. regulates cellulases synthesis in Rhizopus has not been Thus, the bottleneck can be broken if simple carbon sources investigated. like monosaccharide or disaccharides could be utilized to In this paper, we studied the regulation of CRE from activate the synthesis of cellulases with a rapid development Rhizopus stolonifer TP-02, and compared it with the transcription J. Microbiol. Biotechnol. Cellulase Production Based on Regulation of CRE 515 of four cellulase genes (eg, bg, cbh1, and cbh2) responding to on ice for 10 min before being shifted into the pole cup. After the cellulosic carbon source carboxymethylcellulose sodium shocking at 1,500 V, the solution was immediately added into 1 ml (CMC) and a simple carbon source (glucose and lactose). of pre-cooled PDA on ice for 20 min, and then cultured at 30°C, Based on the characters of transcriptional regulator CRE, 100 rpm for 90 min. Then, it was coated to hygromycin plates we produced cellulases from R. stolonifer by a glucose- (160 μg/ml) and incubated at 30°C. The positive clones were screened and identified by amplifying cre and hyg from genomic containing medium without the repression of CRE. Moreover, DNA. For preparation of the germinated spores, the spores were we discuss the synthesis and regulation mechanism of rinsed with sterile water, filtrated by two layers of gauze, inoculated cellulases, which could enrich the knowledge of related into PDA liquid medium, and cultured at 30°C at 180 rpm for 8 h fields and provide some basis to engineering and biological until spore germination. Scanning electron microscopy (SEM) was process designs. used to determine the spore germination time. Materials and Methods Real-Time qPCR Freeze-dried mycelia were rapidly grinded in a prechilled Strains and Reagents mortar (180°C, dried 6 h to destroy RNAase) [17, 18]. Total RNA R. stolonifer TP-02 was isolated in our laboratory and stored in was extracted by kit, which eliminated the genomic DNA for the China General Microbiological Culture Collection Center synthesis of single-strand cDNA as a template by the reverse (CGMCC No. 11119). The PCR product purification kit and transcription kit. Primers of qPCR were designed according to the plasmid extraction kit were purchased from Sangon Biotech Co., cellulase genes obtained previously (Table 1). The cDNA solution Ltd. (China); the RNA extraction kit, cDNA reverse transcription was diluted 20-fold as a template to amplify the target strip with kit, fluorescence quantitative PCR kit, Pfu DNA polymerase, and the fluorescent dye SYBR. The reaction system contained cDNA T4 DNA ligase were purchased from Takara Biotechnology Co., 2 μl, SYBR premix Ex TaqII 10 μl, Primer mix 2 μl, and ddH2O 6 μl. Ltd. (China). The reaction conditions were pre-incubation at 95°C for 30 sec, 2- step amplification for 45 cycles (95°C for 10 sec, 58°C for 30 sec), Identification of Carbon Catabolite Repressor Protein-Encoding and melting (95°C for 10 sec, 65°C for 60 sec, 97°C for 1 sec). The Genes seed cultured in PDA liquid medium and shaken for 24 h at 30°C R. stolonifer TP-02 was cultured in PDA liquid medium and (200 rpm) was the reference condition used for comparison as a shaken for 24 h at 30°C (200 rpm). The mycelia were harvested fold-change = 1. 18S rRNA was used as the reference gene. Data and freeze-dried. Standard protocols for extraction of the genomic analysis was carried out using LightCycler 96 and the mRNA DNA from the straw enrichment using the CTAB method were levels were calculated using the 2-ΔΔCT method [19]. used [15]. Amplification of the DNA fragment encoding CRE was done by using the primers P1: 5’-CCGGAATTCATGAAGTTT Production of Cellulases by a Glucose-Containing Medium ATTACTATTACGTC-3’ and P2: 5’-ATAAGAATGCGGCCGCTT Both the R. stolonifer parent and Δcre strains were grown on TATTTTCTTGAACAACCT GTC-3’. The amplification protocol included 30 cycles, and each cycle consisted of an initial pre- Table 1. The sequences of primers for qPCR. degeneration cycle of 5 min at 95°C followed by a 30 sec denaturing Size step at 94°C, a 45 sec annealing step at 54°C, and finally a 50 sec Gene Primers Sequences (5’-3’) (bp) polymerization cycle at 72°C. The amplification was then switched 18S RNA 18S-F GTAGTCATATGCTTGTCTC 19 to a 10 min polymerization at 72°C. The PCR product was purified 18S-R ATTCCCCGTTACCCGTTG 18 by kit and sequenced by Sangon Biotech Co., Ltd. (China). Homology alignment of the primary structure between CRE and eg EG2-F TTATTGGGTTTGTTGTCAGGC 21 other enzymes was carried out in the GenBank database using the EG2-R GTGCTTTGAATTGATTGCTCC 21 BLAST program, together with the MegAlign program and bg BG3-F CGAGGACATTGCCTTGCTGA 20 ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). BG3-R GTTTGTGGAGGGAATAGTGGG 21 cbh1 CBH1-F CTTATTGTGGAGGCGGTTGC 20 Construction of R. stolonifer Δcre CBH1-R CAGGTGGTATCGGTGGAGC 19 The full-length hygromycin resistance gene hyg was inserted cbh2 CBH2-F CCTGGCTATCCCATCCCTC 19 into cre by overlapping PCR [16]. This constructed gene was CBH2-R CGTTCTGGGCTTTGATGTCG 20 connected with the pUCm-T carrier (purchased from Sangon xyr1 XYR1-F CGTCAGCTCCTACAGCGAC 19 Biotech Co., Ltd.) and transformed into E. coli DH5α. The positive XYR1-R CTACGAATCTCCGCATGAG 19 clones were screened and identified by sequencing the plasmid cre CRE-R CCACTTCCACTATGGCTTCG 20 extracted by kit. This plasmid was added into the pretreatment CRE-F GTGCGGATATGTCTCGTTTGG 21 spore suspension of R. stolonifer (germinated for 8 h), and placed March 2017 ⎪ Vol. 27⎪ No. 3 516 Zhang et al. Fig. 1. Results of the multiple alignments of CRE and its similar sequences from other filamentous fungi (GenBank No. O94166, EHA22819, and GAA82303, respectively). J. Microbiol. Biotechnol. Cellulase Production Based on Regulation of CRE 517 PDA plates. The spores of these two strains were inoculated on multiple functional domains in CRE, in which the main the fermentation medium in 3 L fermenters and cultured under structure was the zinc finger from Thr68 to Pro327 that the same conditions. By sampling every 6-12 h, the concentration could bind to DNA. of reducing sugars was recorded and the FPA activity of the To study the response characters of CRE, the transcription cellulases was measured by the DNS method described previously level of cre was measured after cultivating the cells in [20].
Load more

Recommended publications
  • Fungi-Chapter 31 Refer to the Images of Life Cycles of Rhizopus, Morchella and Mushroom in Your Text Book and Lab Manual
    Fungi-Chapter 31 Refer to the images of life cycles of Rhizopus, Morchella and Mushroom in your text book and lab manual. Chytrids Chytrids (phylum Chytridiomycota) are found in terrestrial, freshwater, and marine habitats including hydrothermal vents They can be decomposers, parasites, or mutualists Molecular evidence supports the hypothesis that chytrids diverged early in fungal evolution Chytrids are unique among fungi in having flagellated spores, called zoospores Zygomycetes The zygomycetes (phylum Zygomycota) exhibit great diversity of life histories They include fast-growing molds, parasites, and commensal symbionts The life cycle of black bread mold (Rhizopus stolonifer) is fairly typical of the phylum Its hyphae are coenocytic Asexual sporangia produce haploid spores The zygomycetes are named for their sexually produced zygosporangia Zygosporangia are the site of karyogamy and then meiosis Zygosporangia, which are resistant to freezing and drying, can survive unfavorable conditions Some zygomycetes, such as Pilobolus, can actually “aim” and shoot their sporangia toward bright light Glomeromycetes The glomeromycetes (phylum Glomeromycota) were once considered zygomycetes They are now classified in a separate clade Glomeromycetes form arbuscular mycorrhizae by growing into root cells but covered by host cell membrane. Ascomycetes Ascomycetes (phylum Ascomycota) live in marine, freshwater, and terrestrial habitats Ascomycetes produce sexual spores in saclike asci contained in fruiting bodies called ascocarps Ascomycetes are commonly
    [Show full text]
  • Isolation of Mucorales from Biological Environment and Identification of Rhizopus Among the Isolates Using PCR- RFLP
    Journal of Shahrekord University of Medical Sciences doi:10.34172/jsums.2019.17 2019;21(2):98-103 http://j.skums.ac.ir Original Article Isolation of Mucorales from biological environment and identification of Rhizopus among the isolates using PCR- RFLP Mahboobeh Madani1* ID , Mohammadali Zia2 ID 1Department of Microbiology, Falavarjan Branch, Islamic Azad University, Isfahan, Iran 2Department of Basic Science, (Khorasgan) Isfahan Branch, Islamic Azad University, Isfahan, Iran *Corresponding Author: Mahboobeh Madani, Tel: + 989134097629, Email: [email protected] Abstract Background and aims: Mucorales are fungi belonging to the category of Zygomycetes, found much in nature. Culture-based methods for clinical samples are often negative, difficult and time-consuming and mainly identify isolates to the genus level, and sometimes only as Mucorales. Therefore, applying fast and accurate diagnosis methods such as molecular approaches seems necessary. This study aims at isolating Mucorales for determination of Rhizopus genus between the isolates using molecular methods. Methods: In this descriptive observational study, a total of 500 samples were collected from air and different surfaces and inoculated on Sabouraud Dextrose Agar supplemented with chloramphenicol. Then, the fungi belonging to Mucorales were identified and their pure culture was provided. DNA extraction was done using extraction kit and the chloroform method. After amplification, the samples belonging to Mucorales were identified by observing 830 bp bands. For enzymatic digestion, enzyme BmgB1 was applied for identification of Rhizopus species by formation of 593 and 235 bp segments. Results: One hundred pure colonies belonging to Mucorales were identified using molecular methods and after enzymatic digestion, 21 isolates were determined as Rhizopus species.
    [Show full text]
  • First Record of Rhizopus Oryzae from Stored Apple Fruits in Saudi Arabia
    Plant Pathology & Quarantine 8(2): 116–121 (2018) ISSN 2229-2217 www.ppqjournal.org Article Doi 10.5943/ppq/8/2/2 Copyright ©Agriculture College, Guizhou University First record of Rhizopus oryzae from stored apple fruits in Saudi Arabia Al-Dhabaan FA Department of Biology, Science and Humanities College Alquwayiyah, Shaqra University, Saudi Arabia Al-Dhabaan FA 2018 – First record of Rhizopus oryzae from stored apple fruits in Saudi Arabia. Plant Pathology & Quarantine 8(2), 116–121, Doi 10.5943/ppq/8/2/2 Abstract During spring 2017, red delicious and Granny Smith apples with soft rot symptoms were collected from commercial markets in Saudi Arabia. The causal agent was isolated from infected fruits and its pathogenicity was confirmed by inoculation assays. To confirm the identity, total genomic DNA was extracted and multi-locus sequence data targeting two gene markers (ITS, ACT) was sequenced. Phylogenetic analysis confirmed the presence of two distinct clades; Saudi isolate was placed within a clade comprising Rhizopus oryzae and R. delemar reference isolates. Based on morphological characteristics, molecular identification and pathogenicity test, the fungus was identified as Rhizopus oryzae. This is the first report of Rhizopus soft rot caused by R. oryzae from stored apple fruits in Saudi Arabia. Key words – Rhizopus soft rot – phylogeny – pathogenicity – morphological characters – sequence data Introduction Rhizopus soft rot caused by Rhizopus oryzae occurs worldwide and reduces the quantity and quality of harvested vegetables and ornamental crops during storage, transit, and marketing (Amadioha 1996, 2001, Agrios 2005). Rhizopus soft rot is one of the most important postharvest diseases of apple, banana, watermelon, sweet potato and other hosts in Korea (Kwon et al.
    [Show full text]
  • Structure and Life Cycle of Rhyzopus Taxonomic Position of Rhizopus Mycota Eumycotina Zygomycetes Mucorales Mucoraceae Rhizopus
    COURSE: B.Sc Botany SEMESTER: II PAPER: Mycology and Phytopathology / BOT CC 203 TOPIC: Structure and life cycle of Rhyzopus FACULTY: Dr. Urvashi Sinha Email id: [email protected] Taxonomic position of Rhizopus Mycota Eumycotina Zygomycetes Mucorales Mucoraceae Rhizopus stolinifer General characters: 1. Common fungi growing on stale bread, therefore, also called Bread mould. 2. Lives as a saprophytes 3. Grows on damp decaying fruit, vegetables, pickles etc. 4. Under certain conditions it lives as facultative parasite on strawberry fruit causing leak and soft rot disease 5. This widespread genus includes at least eight species. Structure of thallus: 1. The vegetative plant body is eucarpic and consists of white cottony, much branched mycelium. 2. The mycelial plant body is differentiated into nodes and internodes 3. The internodal region is the aerial and arching hyphae, known as stolon, which when touches the substratum forms the nodal region. 4. The nodal region bears much branched rhizoid grows downward, inside the substratum for anchorage and absorption of food. 5. The hyphal wall is microfibrillar and consists mainly of chitin-chitosan. In addition to chitin- chitosan, other substances like proteins, lipids, purines and salts like calcium and magnesium are also present in the hyphal wall. 6. Inner to the cell wall, cell membrane is present which covers the protoplast. The protoplast contains many nuclei, mitochondria, endoplasmic reticulum, ribosome, oil droplets, vacuoles and other substances. The size of the vacuole enlarges with age by coalescence of smaller vacuoles. Reproduction in Rhizopus: Rhizopus Stolonifer reproduces by vegetative, asexual and sexual mode. 1. Vegetative reproduction: It takes by fragmentation.
    [Show full text]
  • Antagonistic Yeasts: a Promising Alternative to Chemical Fungicides for Controlling Postharvest Decay of Fruit
    Journal of Fungi Review Antagonistic Yeasts: A Promising Alternative to Chemical Fungicides for Controlling Postharvest Decay of Fruit 1,2, 1, 1 1 Xiaokang Zhang y , Boqiang Li y , Zhanquan Zhang , Yong Chen and Shiping Tian 1,2,* 1 Key Laboratory of Plant Resources, Institute of Botany, Innovative Academy of Seed Design, Chinese Academy of Sciences, Beijing 100093, China; [email protected] (X.Z.); [email protected] (B.L.); [email protected] (Z.Z.); [email protected] (Y.C.) 2 College of Life Sciences, University of Chinese Academy of Sciences, Beijing 100049, China * Correspondence: [email protected]; Tel.: +86-10-62836559 These authors contributed equally to this work. y Received: 12 July 2020; Accepted: 28 August 2020; Published: 31 August 2020 Abstract: Fruit plays an important role in human diet. Whereas, fungal pathogens cause huge losses of fruit during storage and transportation, abuse of chemical fungicides leads to serious environmental pollution and endangers human health. Antagonistic yeasts (also known as biocontrol yeasts) are promising substitutes for chemical fungicides in the control of postharvest decay owing to their widespread distribution, antagonistic ability, environmentally friendly nature, and safety for humans. Over the past few decades, the biocontrol mechanisms of antagonistic yeasts have been extensively studied, such as nutrition and space competition, mycoparasitism, and induction of host resistance. Moreover, combination of antagonistic yeasts with other agents or treatments were developed to improve the biocontrol efficacy. Several antagonistic yeasts are used commercially. In this review, the application of antagonistic yeasts for postharvest decay control is summarized, including the antagonistic yeast species and sources, antagonistic mechanisms, commercial applications, and efficacy improvement.
    [Show full text]
  • Biological Control of Postharvest Diseases of Fruits and Vegetables – Davide Spadaro
    AGRICULTURAL SCIENCES – Biological Control of Postharvest Diseases of Fruits and Vegetables – Davide Spadaro BIOLOGICAL CONTROL OF POSTHARVEST DISEASES OF FRUITS AND VEGETABLES Davide Spadaro AGROINNOVA Centre of Competence for the Innovation in the Agro-environmental Sector and Di.Va.P.R.A. – Plant Pathology, University of Torino, Grugliasco (TO), Italy Keywords: antibiosis, bacteria, biocontrol agents, biofungicide, biomass, competition, formulation, fruits, fungi, integrated disease management, parasitism, plant pathogens, postharvest, preharvest, resistance, vegetables, yeast Contents 1. Introduction 2. Postharvest diseases 3. Postharvest disease management 4. Biological control 5. The postharvest environment 6. Isolation of antagonists 7. Selection of antagonists 8. Mechanisms of action 9. Molecular characterization 10. Biomass production 11. Stabilization 12. Formulation 13. Enhancement of biocontrol 14. Extension of use of antagonists 15. Commercial development 16. Biofungicide products 17. Conclusions Acknowledgements Glossary Bibliography Biographical Sketch Summary Biological control using antagonists has emerged as one of the most promising alternatives to chemicals to control postharvest diseases. Since the 1990s, several biocontrol agents (BCAs) have been widely investigated against different pathogens and fruit crops. Many biocontrol mechanisms have been suggested to operate on fruit including competition, biofilm formation, production of diffusible and volatile antibiotics, parasitism, induction of host resistance, through
    [Show full text]
  • Rhizopus Oryzae Lipase, a Promising Industrial Enzyme: Biochemical Characteristics, Production and Biocatalytic Applications
    catalysts Review Rhizopus oryzae Lipase, a Promising Industrial Enzyme: Biochemical Characteristics, Production and Biocatalytic Applications Josu López-Fernández, Maria Dolors Benaiges and Francisco Valero * Department of Chemical, Biological and Environmental Engineering, School of Engineering, Universitat Autònoma de Barcelona, Bellaterra, 08193 Barcelona, Spain; [email protected] (J.L.-F.); [email protected] (M.D.B.) * Correspondence: [email protected]; Tel.: +34-93-581-1809 Received: 13 October 2020; Accepted: 30 October 2020; Published: 3 November 2020 Abstract: Lipases are biocatalysts with a significant potential to enable a shift from current pollutant manufacturing processes to environmentally sustainable approaches. The main reason of this prospect is their catalytic versatility as they carry out several industrially relevant reactions as hydrolysis of fats in water/lipid interface and synthesis reactions in solvent-free or non-aqueous media such as transesterification, interesterification and esterification. Because of the outstanding traits of Rhizopus oryzae lipase (ROL), 1,3-specificity, high enantioselectivity and stability in organic media, its application in energy, food and pharmaceutical industrial sector has been widely studied. Significant advances have been made in the biochemical characterisation of ROL particularly in how its activity and stability are affected by the presence of its prosequence. In addition, native and heterologous production of ROL, the latter in cell factories like Escherichia coli, Saccharomyces cerevisiae and Komagataella phaffii (Pichia pastoris), have been thoroughly described. Therefore, in this review, we summarise the current knowledge about R. oryzae lipase (i) biochemical characteristics, (ii) production strategies and (iii) potential industrial applications. Keywords: Rhizopus oryzae lipase; Pichia pastoris; biodiesel; structured lipids; flavour; ester; bioprocess engineering; operational strategy; racemic resolution 1.
    [Show full text]
  • A Monograph of Rhizopus
    ©Verlag Ferdinand Berger & Söhne Ges.m.b.H., Horn, Austria, download unter www.biologiezentrum.at A monograph of Rhizopus Ru-yong Zheng1, Gui-qing Chen1, He Huang2 & Xiao-yong Liu3 1, 2, 3 Key Laboratory of Systematic Mycology and Lichenology, Institute of Microbiology Chinese Academy of Sciences, Beijing 100080, China Zheng R. Y., Chen G. Q., Huang H. & Liu X. Y. (2007) A monograph of Rhi- zopus. ± Sydowia 59 (2): 273±372. A total of 312 Rhizopus strains comprising 187 strains isolated in China and 125 strains fromforeign countries have been studied, which include possibly all of the cultures derived fromtypes available now. The morphologyof the sporangial and zygosporic states, maximum growth temperature, mating compatibility, and molecular systematics were used as important reference for the classification of the genus. Seventeen taxa, ten species and seven varieties, are recognized in the genus Rhizopus in this study. These include: R. americanus, R. arrhizus var. arrhizus, R. arrhizus var. delemar, R. arrhizus var. tonkinensis, R. caespitosus, R. homo- thallicus, R. microsporus var. microsporus, R. microsporus var. azygosporus, R. microsporus var. chinensis, R. microsporus var. oligosporus, R. microsporus var. rhizopodiformis, R. microsporus var. tuberosus, R. niveus, R. reflexus, R. schip- perae, R. sexualis, and R. stolonifer. Seventy-two names of Rhizopus are treated as synonyms. Twenty-five species, eight varieties and one form are thought to be doubtful, and nine species and four varieties are excluded fromthe genus. Neo- types are designated for R. microsporus var. microsporus, R. microsporus var. oli- gosporus, R. microsporus var. rhizopodiformis, and R. stolonifer. In the taxa accepted, zygospores are found and studied in all the three homothallic species and five heterothallic species or varieties; while azygospores are found in two species and one variety.
    [Show full text]
  • No. 38 List of Plant Diseases in American Samoa 2002
    Land Grant Technical Report No. 38 List of Plant Diseases in American Samoa 2002 Fred Brooks, Plant Pathologist Land Grant Technical Report No. 44, American Samoa Community College Land Grant Program, Aug. 2002. This work was funded in part by Hatch grants SAM-015 and -020, United States Department of Agriculture, Cooperative State Research, Extension, and Education Service (CSREES) and administered by American Samoa Community College. The author bears full responsibility for its content. The author wishes to acknowledge O.C. Steele for his assistance in plant identifications, the Land Grant Forestry crew for their work on the brown root rot survey, and M.A. Schmaedick for his continued support. For more information on this publication, please contact: Fred Brooks, Plant Pathologist American Samoa Community College Land Grant Program Pago Pago, AS 96799 Tel. (684) 699-1394-1575 Fax (684) 699-5011 e-mail <[email protected]> Title page: cordana leaf spot of banana caused by Cordana musae. TABLE OF CONTENTS Page Introduction ............................................................................................................................................... iv About this text ........................................................................................................................................... vi Host-pathogen index .................................................................................................................................. 1 Pathogen-host index .................................................................................................................................
    [Show full text]
  • Daffodil Diseases and Pests, T.E. Snazelle
    CONTENTS Chapter Title Page 1 Some Basic Concepts 1 2 Fungi and Fungal Diseases - Basal Rot 5 3 Fungi and Fungal Diseases - Scorch, 14 Smoulder, Fire, and Some Others 4 Viruses and Vint , I /i,,voses 22 5 NemillIgles and Nenial( x le Diseases 33 fi Bull) Flies mid Mites 44 7 Nonitilectious Diseases 52 DISCLAIMER Mention of a trademark or proprietary product does not constitute a guarantee or warranty of the product by the author, Mississippi College, or the American Daffodil Society, ( nor does it imply approval to the exclusion of other products that may also be suitable. el DAFFODIL DISEASES AND PESTS DAFFODIL DISEASES AND PESTS by DEDICATION Theodore E. Snazelle, Ph.D. Mississippi College For his many years of service to the American Daffodil Society, Clinton, MS including a stint as Chairman of the Health and Culture Committee, I dedicate this booklet to Mr. Willis H. Wheeler. © 1986 Dr, Thedore E. Snazelle, Ph.D. Published and Distributed by Middle Tennessee Daffodil Society Nashville, Tennessee Chapter 1 SOME BASIC CONCEPTS PREFACE "We see ... our plants wither without being able to render them assistance, lacking as we do understanding The compilation of my seven articles on daffodil diseases and pests of their condition." Fabricius (1774) into one booklet is the idea of my long-time friends, Dick and Kitty Frank. Perhaps the quotation from Fabricius is the only reason that I need to To them, I express gratitude for taking on this project. begin this first article of a series on daffodil diseases and pests. Or My original intention for writing these seven articles was for the perhaps, it was the comment of a daffodil enthusiast who said to me, purpose of facilitating the transfer of information from the limited scientific 'Don't take too long in giving the program (on basal rot) as it is too depressing!" that makes me feel compelled to write.
    [Show full text]
  • Updates on the Taxonomy of Mucorales with an Emphasis on Clinically Important Taxa
    Journal of Fungi Review Updates on the Taxonomy of Mucorales with an Emphasis on Clinically Important Taxa Grit Walther 1,*, Lysett Wagner 1 and Oliver Kurzai 1,2 1 German National Reference Center for Invasive Fungal Infections, Leibniz Institute for Natural Product Research and Infection Biology – Hans Knöll Institute, 07745 Jena, Germany; [email protected] (L.W.); [email protected] (O.K.) 2 Institute for Hygiene and Microbiology, University of Würzburg, 97080 Würzburg, Germany * Correspondence: [email protected]; Tel.: +49-3641-5321038 Received: 17 September 2019; Accepted: 11 November 2019; Published: 14 November 2019 Abstract: Fungi of the order Mucorales colonize all kinds of wet, organic materials and represent a permanent part of the human environment. They are economically important as fermenting agents of soybean products and producers of enzymes, but also as plant parasites and spoilage organisms. Several taxa cause life-threatening infections, predominantly in patients with impaired immunity. The order Mucorales has now been assigned to the phylum Mucoromycota and is comprised of 261 species in 55 genera. Of these accepted species, 38 have been reported to cause infections in humans, as a clinical entity known as mucormycosis. Due to molecular phylogenetic studies, the taxonomy of the order has changed widely during the last years. Characteristics such as homothallism, the shape of the suspensors, or the formation of sporangiola are shown to be not taxonomically relevant. Several genera including Absidia, Backusella, Circinella, Mucor, and Rhizomucor have been amended and their revisions are summarized in this review. Medically important species that have been affected by recent changes include Lichtheimia corymbifera, Mucor circinelloides, and Rhizopus microsporus.
    [Show full text]
  • Biological Control of Rhizopus Soft Rot on Apple, Pear and Peach by Trichoderma Harzianum
    An-Najah National University Faculty of Graduate Studies Biological Control of Rhizopus Soft Rot on Apple, Pear and Peach by Trichoderma harzianum By Manar Ahmad Mahmoud Salman Supervized by Dr. Yacoub Batta Submitted in Partial Fulfillment of the Requirements for the Degree of Master in Environmental Sciences, Faculty of Graduate Studies, at An- Najah National University, Nablus, Palestine. 2005 III Dedication IV Acknowledgments All praise to Allah for this accomplishment. Thanks to Dr. Yacoub Batta for his guidance, encouragements and supervision during the study and dissertation preparation. I would like to record my special thanks to my father, my mother for their efforts in all steps of my life and combine harvesting. Thanks to my brothers. At the end, my thanks to the many other people who helped in this work. V List of Contents Dedication III Acknowledgment IV List of Contents V List of Tables VIII List of Figures IX List of Abbreviations X list of Appendices XI Abstract XII Chapter One: Introduction 1 1. Objectives of the Study 3 Chapter Two: Literature Review 4 1. Rhizopus soft rot 5 1.1 Description 5 1.1.1 Identification and Classification 5 1.1.2 Macroscopic Features 6 1.1.3 Microscopic Features 6 1.2 Distribution 6 1.3 Host Range 7 1.4 Symptoms of Rhizopus soft rot on Fruits 7 1.5 Factors Influencing the Growth of Rhizopus stolonoifer 8 1.5.1 Preharvest Factors Influence Postharvest Decay 8 1.5.2 Postharvest Factors Influence Decay 9 1.6 Biology and Life Cycle 9 1.7 Effects of Infected Fruits by R.
    [Show full text]