Production of Cellulases by Rhizopus Stolonifer from Glucose-Containing

J. Microbiol. Biotechnol. (2017), 27(3), 514–523 https://doi.org/10.4014/jmb.1608.08048 Research Article Review jmb

Production of Cellulases by Rhizopus stolonifer from Glucose-Containing Media Based on the Regulation of Transcriptional Regulator CRE Yingying Zhang1, Bin Tang1,2*, and Guocheng Du1

1School of Biotechnology, Jiangnan University, Wuxi 214000, P.R. China 2College of Biochemical Engineering, Anhui Polytechnic University, Wuhu 241000, P.R. China

Received: August 24, 2016 Revised: October 25, 2016 Carbon catabolite repression is a crucial regulation mechanism in microorganisms, but its Accepted: November 16, 2016 characteristic in Rhizopus is still unclear. We extracted a carbon regulation gene, cre, that encoded a carbon catabolite repressor protein (CRE) from Rhizopus stolonifer TP-02, and studied the regulation of CRE by real-time qPCR. CRE responded to glucose in a certain range,

First published online where it could significantly regulate part of the cellulase genes (eg, bg, and cbh2) without cbh1. November 23, 2016 In the comparison of the response of cre and four cellulase genes to carboxymethylcellulose

*Corresponding author sodium and a simple carbon source (lactose), the effect of CRE was only related to the Phone: +86-553-2871210; concentration of reducing sugars. By regulating the reducing sugars to range from 0.4% to Fax: +86-553-2871091; 0.6%, a glucose-containing medium with lactose as the inducer could effectively induce E-mail: [email protected] cellulases without the repression of CRE. This regulation method could potentially reduce the cost of enzymes produced in industries and provide a possible solution to achieve the large- pISSN 1017-7825, eISSN 1738-8872 scale synthesis of cellulases.

Introduction of cells, of which the prerequisite is to overcome the carbon metabolism repression. Cellulases are composed of endoglucanases (E.C. 3.2.1.4), Carbon catabolite repression is a crucial regulation cellobiohydrolases (E.C. 3.2.1.91; E.C. 3.2.1.176), and β- mechanism in microorganisms, preventing the expression glucosidases (E.C. 3.2.1.21) [1, 2]. They are widely applied of enzymes required for the utilization of complex carbon in textile processing, printing and dyeing, food and brewery sources when simple carbon sources like glucose are production, detergent production, and biorefinery [2, 3]. present in the medium [9]. The transcription factor However, a low yield with a poor specific activity is a responsible for the repression of glucose-regulated genes bottleneck in the application of cellulases. Generally, has been found in the filamentous fungi; namely, cre1/creA, industrial cellulase production relies on cellulosic substrates which was highly conserved [10-12]. CRE1 can repress the that induce the secretion of cellulases from filamentous transcription of cellulases-encoding genes by binding to the fungi, the disadvantage of which is the long production CCCCAC region in the promoter fragment of those genes cycle with lower substrate utilization [4]. Much of the [13]. Specifically, CRE1 indirectly regulates the expression research has examined that cellulase biosynthesis is mainly of cbh2 by adjusting another transcription factor, XYR1 [13]. adjusted by the induction and the repression of degradation In addition, transport of the inducer sophorose could be products. Cellulose, cellobiose, sophorose, lactose, and suppressed owing to the presence of glucose [14]. However, derivative cellulose have been shown to be effective in the characteristic of carbon metabolism repression that inducing the formation of Trichoderma cellulases [5-8]. regulates cellulases synthesis in Rhizopus has not been Thus, the bottleneck can be broken if simple carbon sources investigated. like monosaccharide or disaccharides could be utilized to In this paper, we studied the regulation of CRE from activate the synthesis of cellulases with a rapid development Rhizopus stolonifer TP-02, and compared it with the transcription

J. Microbiol. Biotechnol. Cellulase Production Based on Regulation of CRE 515

of four cellulase genes (eg, bg, cbh1, and cbh2) responding to on ice for 10 min before being shifted into the pole cup. After the cellulosic carbon source carboxymethylcellulose sodium shocking at 1,500 V, the solution was immediately added into 1 ml (CMC) and a simple carbon source (glucose and lactose). of pre-cooled PDA on ice for 20 min, and then cultured at 30°C, Based on the characters of transcriptional regulator CRE, 100 rpm for 90 min. Then, it was coated to hygromycin plates we produced cellulases from R. stolonifer by a glucose- (160 μg/ml) and incubated at 30°C. The positive clones were screened and identified by amplifying cre and hyg from genomic containing medium without the repression of CRE. Moreover, DNA. For preparation of the germinated spores, the spores were we discuss the synthesis and regulation mechanism of rinsed with sterile water, filtrated by two layers of gauze, inoculated cellulases, which could enrich the knowledge of related into PDA liquid medium, and cultured at 30°C at 180 rpm for 8 h fields and provide some basis to engineering and biological until spore germination. Scanning electron microscopy (SEM) was process designs. used to determine the spore germination time.

Materials and Methods Real-Time qPCR Freeze-dried mycelia were rapidly grinded in a prechilled Strains and Reagents mortar (180°C, dried 6 h to destroy RNAase) [17, 18]. Total RNA R. stolonifer TP-02 was isolated in our laboratory and stored in was extracted by kit, which eliminated the genomic DNA for the China General Microbiological Culture Collection Center synthesis of single-strand cDNA as a template by the reverse (CGMCC No. 11119). The PCR product purification kit and transcription kit. Primers of qPCR were designed according to the plasmid extraction kit were purchased from Sangon Biotech Co., cellulase genes obtained previously (Table 1). The cDNA solution Ltd. (China); the RNA extraction kit, cDNA reverse transcription was diluted 20-fold as a template to amplify the target strip with kit, fluorescence quantitative PCR kit, Pfu DNA polymerase, and the fluorescent dye SYBR. The reaction system contained cDNA

T4 DNA ligase were purchased from Takara Biotechnology Co., 2 μl, SYBR premix Ex TaqII 10 μl, Primer mix 2 μl, and ddH2O 6 μl. Ltd. (China). The reaction conditions were pre-incubation at 95°C for 30 sec, 2- step amplification for 45 cycles (95°C for 10 sec, 58°C for 30 sec), Identification of Carbon Catabolite Repressor Protein-Encoding and melting (95°C for 10 sec, 65°C for 60 sec, 97°C for 1 sec). The Genes seed cultured in PDA liquid medium and shaken for 24 h at 30°C R. stolonifer TP-02 was cultured in PDA liquid medium and (200 rpm) was the reference condition used for comparison as a shaken for 24 h at 30°C (200 rpm). The mycelia were harvested fold-change = 1. 18S rRNA was used as the reference gene. Data and freeze-dried. Standard protocols for extraction of the genomic analysis was carried out using LightCycler 96 and the mRNA DNA from the straw enrichment using the CTAB method were levels were calculated using the 2-ΔΔCT method [19]. used [15]. Amplification of the DNA fragment encoding CRE was done by using the primers P1: 5’-CCGGAATTCATGAAGTTT Production of Cellulases by a Glucose-Containing Medium ATTACTATTACGTC-3’ and P2: 5’-ATAAGAATGCGGCCGCTT Both the R. stolonifer parent and Δcre strains were grown on TATTTTCTTGAACAACCT GTC-3’. The amplification protocol included 30 cycles, and each cycle consisted of an initial pre- Table 1. The sequences of primers for qPCR. degeneration cycle of 5 min at 95°C followed by a 30 sec denaturing Size step at 94°C, a 45 sec annealing step at 54°C, and finally a 50 sec Gene Primers Sequences (5’-3’) (bp) polymerization cycle at 72°C. The amplification was then switched 18S RNA 18S-F GTAGTCATATGCTTGTCTC 19 to a 10 min polymerization at 72°C. The PCR product was purified 18S-R ATTCCCCGTTACCCGTTG 18 by kit and sequenced by Sangon Biotech Co., Ltd. (China). Homology alignment of the primary structure between CRE and eg EG2-F TTATTGGGTTTGTTGTCAGGC 21 other enzymes was carried out in the GenBank database using the EG2-R GTGCTTTGAATTGATTGCTCC 21 BLAST program, together with the MegAlign program and bg BG3-F CGAGGACATTGCCTTGCTGA 20 ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). BG3-R GTTTGTGGAGGGAATAGTGGG 21 cbh1 CBH1-F CTTATTGTGGAGGCGGTTGC 20 Construction of R. stolonifer Δcre CBH1-R CAGGTGGTATCGGTGGAGC 19 The full-length hygromycin resistance gene hyg was inserted cbh2 CBH2-F CCTGGCTATCCCATCCCTC 19 into cre by overlapping PCR [16]. This constructed gene was CBH2-R CGTTCTGGGCTTTGATGTCG 20 connected with the pUCm-T carrier (purchased from Sangon xyr1 XYR1-F CGTCAGCTCCTACAGCGAC 19 Biotech Co., Ltd.) and transformed into E. coli DH5α. The positive XYR1-R CTACGAATCTCCGCATGAG 19 clones were screened and identified by sequencing the plasmid cre CRE-R CCACTTCCACTATGGCTTCG 20 extracted by kit. This plasmid was added into the pretreatment CRE-F GTGCGGATATGTCTCGTTTGG 21 spore suspension of R. stolonifer (germinated for 8 h), and placed

March 2017 ⎪ Vol. 27⎪ No. 3 516 Zhang et al.

Fig. 1. Results of the multiple alignments of CRE and its similar sequences from other filamentous fungi (GenBank No. O94166, EHA22819, and GAA82303, respectively).

J. Microbiol. Biotechnol. Cellulase Production Based on Regulation of CRE 517

PDA plates. The spores of these two strains were inoculated on multiple functional domains in CRE, in which the main the fermentation medium in 3 L fermenters and cultured under structure was the zinc finger from Thr68 to Pro327 that the same conditions. By sampling every 6-12 h, the concentration could bind to DNA. of reducing sugars was recorded and the FPA activity of the To study the response characters of CRE, the transcription cellulases was measured by the DNS method described previously level of cre was measured after cultivating the cells in [20]. A unit of enzyme activity was defined as the amount of different concentrations of glucose that ranged from 0.2% enzyme releasing 1 μmol of glucose equivalents per minute. The to 1%. The results showed that transcription levels of cre in concentration of total proteins was determined by the Bradford all the samples peaked at 4 h (Fig. 2A), which was selected method with the kit purchased from Sangon Biotech Co., Ltd. The fermentation medium consisted of 1% glucose, 1% inducer (CMC as the sampling point for the following research. In order to build a complete response curve of CRE, the sugar or lactose), 0.5% NH4Cl, 0.5% KH2PO4, 0.4% MgSO4.7H2O, 0.4% concentration was expanded to 4%. The relative mRNA CaCl2, 0.025% PEG4000, trace element solution, Tween-80, 1.2% methionine, and 0.6% yeast extract. expression of CRE peaked in 0.8% glucose and decreased gradually as the concentration of sugars increased to 2% Results (Fig. 2B). Unexpectedly, the transcription of cre began to level off when the concentration of glucose was above 2%. Characteristics of CRE Response to Glucose It indicated that a higher glucose concentration does not The transcription factor CreA contains two zinc finger lead to a higher level of expression of cre, only if the domains and is the main regulator responsible for carbon concentration was less than 0.8%. repression in filamentous fungi [21, 22]. Previous studies of the zinc finger protein have emphasized its crucial role in Effect of CRE on the Transcription Level of Cellulase the transcriptional regulation of eukaryotes [23]. In this Genes study, the carbon repressor gene cre was cloned from It has been confirmed that CRE participates in the R. stolonifer (GenBank No. KP702729). The gene is 1,284 bp regulation of expression of cellulase-coding genes. In this long, and encodes a 428-amino-acid protein, CRE. The paper, we intended to study the regulation of CRE on ClustalW2 alignment showed that CRE contains two cellulase genes responding to the concentration of glucose. analogous C2H2 zinc finger domains that are similar to The transcription levels of four cellulase genes (eg, bg, cbh1, the CREA (GenBank No. O94166) in Aspergillus aculeatus and cbh2) were measured after cultivating the cells in (Fig. 1A). The percent identity (calculated by MegAlign) different concentrations of sugars for 4 h as described between CRE and CREA was 88.9% (Fig. 1B). Analysis of before. The results showed that the regulation of CRE was the PROSITE and CDD engine indicated that there were phased: When the concentration was lower than 0.6%, the

Fig. 2. Response characteristics of CRE to glucose. (A) Time axis of the relative transcription levels of cre. The dotted line corresponds to the secondary ordinate. (B) Complete response curve of CRE.

March 2017 ⎪ Vol. 27⎪ No. 3 518 Zhang et al.

response of CRE was weak (Fig. 2B) and thus all the was named the control delayed period. When the cellulase genes were transcribed normally (Fig. 3), which concentration ranged from 0.6% to 1%, CRE regulated the

Fig. 3. Relative transcription levels of four cellulase genes (eg, bg, cbh1, and cbh2) and xyr1 in cells cultivated in different concentrations of sugars for 4 h. All the tested genes, except cbh1, were repressed when the concentration of glucose was above 0.6%.

J. Microbiol. Biotechnol. Cellulase Production Based on Regulation of CRE 519

Fig. 4. Construction and characterization of Rhizopus stolonifer Δcre. (A) SEM photographs show that the spore morphology began to change in 8 h and hyphae were formed in 9 h. (B) Agarose gel electrophoresis of cre and hyg amplified from R. stolonifer Δcre (Lines 1 and 2) and parent TP-02 (Lines 3 and 4). (C) Relative mRNA expression levels of CRE and cellulases produced by R. stolonifer parent and Δcre strains. expression of cellulase genes (eg, bg, and cbh2) with an glucose content was higher than 0.6%. In particular, the obvious linear relationship, which was named the control transcription of xyr1 was most sensitive to CRE. In linear period. Once the concentration was higher than addition, the expression of cbh1 was reported to be strictly 1.2%, the regulation of CRE displayed stability control. It controlled by the carbon source, which could be increased means that CRE could effectively regulate the expression by above 1,000 times when cellulose was present in the of cellulases from R. stolonifer, except cbh1, when the medium, and could be completely inhibited under the concentration of glucose was higher than 0.6%. To confirm condition of glucose [14]. However, there was no obvious the indirect regulation of CRE on the expression of cbh2 correlation between the transcription level of cre and cbh1 by adjusting xyr1, the transcription level of xyr1 was from R. stolonifer. The tendency of the transcription level determined. Results in Figs. 3C and 3D show that there was that cbh1 displayed was different from the other tested a significant correlation between xyr1 and cbh2 when the genes, with an irregular fluctuation (Fig. 3E). However, it

March 2017 ⎪ Vol. 27⎪ No. 3 520 Zhang et al.

seems positively related with the concentration of sugars, mRNA expression of cre could be maximized. Transcription which indicated that the carbon catabolite repression has a levels of cellulases produced by R. stolonifer parent and weak regulation on cbh1. Consequently, there might be Δcre strains were assayed by qPCR. As shown in Fig. 4C, another regulation approach of cbh1 present in the R. all the tested genes, except cbh1, were significantly stolonifer unlike with other filamentous fungi. downregulated in R. stolonifer parent. The transcription CreA can participate in the regulation of the transcription levels of eg, bg, cbh1, cbh2, and xyr1 were repressed by CRE and translation processes by binding to regulatory elements by 67.1%, 75.2%, 15.2%, 71.6%, and 71.8%, respectively. in the promoters of target genes [23, 24]. Previous studies These results indicated that CRE plays a key role in the suggested that CRE1 was partially involved in the negative production of cellulases from R. stolonifer. regulation of cellulase and hemicellulase genes from Trichoderma. For cbh2, xyn2, and bgl1 gene expression, no Features of the CRE Response to Different Substrates such direct regulatory effect caused by CRE1 could be Lactose has been widely utilized to induce the production observed [25]. In order to further confirm the regulation of of cellulases in industry, which can also be digested into CRE, we destroyed cre by inserting the full-length gene of glucose and galactose by the β-glucosidases [5]. Compared hygromycin, hyg, using overlapping PCR, and constructed with lactose, CMC is an artificial cellulose derivative with a the R. stolonifer Δcre by homologous recombination using simple composition, which is used instead of complex and R. stolonifer TP-02 as the parent strain. To obtain higher insoluble celluloses such as microcrystalline cellulose, rice transformation efficiency, the spore germination time was straw, and straw to study the induction of cellulose optimized. The SEM photographs revealed that the substrates on the cellulases. The relative mRNA expression optimum germination time of spores was 8 h (Fig. 4A). The of CRE and cellulases was assayed in MA medium containing end fragments of cre and hyg were used as probes to extract 1% CMC or 1% lactose as the inducer, respectively. The target genes from the R. stolonifer TP-02 and Δcre strains, results showed that the relative mRNA expression of respectively. The length of the gene extracted from Δcre by cellulases under the CMC condition was generally higher the cre probe was 2,358 bp, which contained the hyg than under lactose, with a longer induction period (Fig. 5). sequence (1,074 bp). Moreover, the full length of hyg has The concentration of reducing sugars was determined, been cloned from the genomic DNA of strain Δcre instead which maintained at a lower level when CMC was used as of the parent strain. These results showed that cre has been an inducer, resulting in a weak transcription of cre (Fig. 5A). successfully destroyed by inserting hyg (Fig. 4B). Both In contrast, the transcription of cre was stronger at the R. stolonifer parent and Δcre strains were grown on the 0.8% initial induction stage of lactose, of which the relevant glucose-containing media for 4 h, in which the relative reducing sugars was also higher than that of CMC (Fig. 5B).

Fig. 5. Relative mRNA expression levels of CRE and cellulases induced by CMC (A) and lactose (B). The change of transcription level of cre was strongly correlated with the reducing sugar content. In addition, the transcription level of cellulase genes peaked in 0.4%-0.6% reducing sugar content with lower repression by CRE.

J. Microbiol. Biotechnol. Cellulase Production Based on Regulation of CRE 521

The reducing sugars released from CMC are glucose and similar effect of CMC on the induction of eg. The presence cellobiose, whereas that released from lactose are glucose of reducing sugars at a high level greatly inhibited the and galactose. The change of transcription level of cre transcription of cellulase genes owing to the negative has strong correlation with the reducing sugar content. regulation of CRE and the substrate inhibition. However, Furthermore, the relative mRNA expression of cre in this inhibition might be overcome if the concentration of different reducing sugar contents was similar to the results reducing sugars could be maintained at the range from measured under the condition of glucose (Fig. 2B). These 0.4% to 0.6%. indicated that the transcription of cre was only related with the concentration of reducing sugars, no matter which Production of Cellulases on Glucose-Containing Media substrate was selected. Because the fermentation time is generally long and the In addition, the transcription of cbh1 displayed a sensitivity production costs are high owing to the characteristics of the of the reducing sugars; namely, the reducing end was likely strains and the factors of culture conditions, filamentous to stimulate the transcription of cbh1. Moreover, there was fungi currently used in cellulase production are hardly a significant effect of lactose on the induction of bg, and a fast and efficient [26]. To produce more cellulases from

Fig. 6. Production of cellulases on glucose-containing media in 3 L fermenters. (A) Non-cellulosic substrates also could induce cellulases in low levels. (B) Cellulase production in Rhizopus stolonifer by regulating the concentration of glucose at around 0.5% after 30 h (TP-02-Regulate 1). R. stolonifer TP-02 cultured without regulating the glucose content acted as a control group; the reducing sugars were determined as RS-Normal. (C) Regulating the glucose content at around 1% after 30 h (TP-02-Regulate 2) or throughout the fermentation period (TP-02-Regulate 3). (D) The protein content was determined with the Bradford method.

March 2017 ⎪ Vol. 27⎪ No. 3 522 Zhang et al.

R. stolonifer in a relatively short time, a glucose-containing cellulases from filamentous fungi. For the first time reported, medium was utilized. Although the traditional substrates we characterized the regulation of CRE on cellulase- for producing cellulases is cellulosic substrates, the non- encoding genes responding to cellulosic substrates (CMC) cellulosic substrates containing glucose, disaccharides, and and simple carbon (glucose and lactose), which indicated oligosaccharides usually attract the attention of the carbon that the effect of CRE was only related to the concentration metabolic repression they caused, thereby ignoring the low of reducing sugars. CRE could effectively regulate the expression levels of cellulases under these conditions expression of cellulases from R. stolonifer, except cbh1, (Fig. 6A) [27]. Based on the characteristics of CRE described when the concentration of glucose was higher than 0.6%. above, lactose was selected as the inducer of the glucose- Based on the characteristics of CRE, we effectively produced containing medium. Spores of R. stolonifer parent and Δcre cellulases by a glucose-containing medium with lactose as strains were inoculated on the medium mentioned before the inducer, by regulating the reducing sugar to range from in 3 L fermenters and cultured under the same conditions. 0.4% to 0.6% without the repression of CRE. With further According to the change of reducing sugar concentration, improvements, this regulation method could potentially additional glucose was added into the fermenter of reduce the cost of enzymes produced in industries and R. stolonifer TP-02 at 30 h for keeping the concentration of provide a possible solution to achieve large-scale synthesis reducing sugars at around 0.5% (group TP-02-Regulate 1). of cellulases, since a simple carbon source can be utilized to The R. stolonifer in normal fermentation without additional activate the synthesis of cellulases with a rapid development feeding was appointed as the control group. The activity of of cells. cellulases produced by the R. stolonifer parent and Δcbs strains was assayed. As shown in Fig. 6B, the FPA activity Acknowledgments of cellulases produced by R. stolonifer that was regulated by additional glucose (3.75 IU/ml) feeding was significantly This work was financially supported by the National higher than the one without additional feeding (1.96 IU/ml). Natural Science Foundation of China (No. 31270135). Moreover, the maximum activity of the samples that were regulated was close to the value of Δcbs (4.16 IU/ml). References To study the cellulase production at higher glucose content, two additional control groups were carried out (Fig. 6C). 1. Kuhad RC, Deswal D, Sharma S, Bhattacharya A, Jain KK, One group was regulated to 1% glucose content at the same Kaur A, et al. 2016. Revisiting cellulase production and time as group TP-02-Regulate 1 (TP-02-Regulate 2). The redefining current strategies based on major challenges. other was regulated throughout the fermentation period to Renew. Sustain. Energy Rev. 55: 249-272. maintain a 1% glucose content (TP-02-Regulate 3). The FPA 2. Payne CM, Knott BC, Mayes HB, Hansson H, Himmel ME, Sandgren M, et al. 2015. Fungal cellulases. Chem. Rev. 115: activity of cellulases produced by group TP-02-Regulate 2 1308-1448. (1.96 IU/ml) was significantly higher than that of TP-02- 3. Juturu V, Wu JC. 2014. Microbial cellulases: engineering, Regulate 3 (0.72 IU/ml). However, the cellulase production production and applications. Renew. Sustain. Energy Rev. 33: of group TP-02-Regulate 2 was similar to the control group 188-203. and lower than group TP-02-Regulate 1. Moreover, according 4. Hidenoa A, Inouea H, Tsukahara K, Yanoa S, Fang X, Endo to the protein content (Fig. 6D), feeding fermentation could T, et al. 2011. Production and characterization of cellulases obtain more total proteins. Besides this, it indicated that a and hemicellulases by Acremonium cellulolyticus using rice higher glucose level cannot achieve higher cellulase straw subjected to various pretreatments as the carbon production. These results suggested that a simple carbon source. Enzyme Microb. Technol. 48: 162-168. source could be used to effectively produce cellulases from 5. Bischof R, Fourtis L, Limbeck A, Gamauf C, Seiboth B, filamentous fungi without the repression of CRE, by Kubicek CP. 2013. Comparative analysis of the Trichoderma regulating the concentration of reducing sugar range at reesei transcriptome during growth on the cellulase inducing substrates wheat straw and lactose. Biotechnol. Biofuels 6: 127. 0.4%-0.6%. 6. Chen S, Wayman M. 1992. Novel inducers derived from starch for cellulase production by Trichoderma reesei. Process Discussion Biochem. 27: 327-334. 7. Mandels M, Parrish FW, Reese ET. 1962. Sophorose as an Overcoming the carbon catabolite repression mechanism inducer of cellulase in Trichoderma viride. J. Bacteriol. 83: 400- is critical for utilizing simple carbon sources to produce 408.

J. Microbiol. Biotechnol. Cellulase Production Based on Regulation of CRE 523

8. Nogueira KMV, Costa MN, de Paula RG, Mendonça- polymerase chain resction. Gene 77: 51-59. Natividade FC, Ricci-Azevedo R, Silva RN. 2015. Evidence 17. Damsteegt EL, McHugh N, Lokman PM. 2016. Storage by of cAMP involvement in cellobiohydrolase expression and lyophilization - resulting RNA quality is tissue dependent. secretion by Trichoderma reesei in presence of the inducer Anal. Biochem. 511: 92-96. sophorose. BMC Microbiol. 15: 195. 18. Pearson G, Lago-Leston A, Valente M, Serrão E. 2006. 9. Ronne H. 1995. Glucose repression in fungi. Trends Genet. Simple and rapid RNA extraction from freeze dried tissue 11: 12-17. of brown algae and seagrasses. Eur. J. Phycol. 41: 97-104. 10. Drysdale MR, Kolze SE, Kelly JM. 1993. The Aspergillus niger 19. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene carbon catabolite repressor encoding gene, creA. Gene 130: expression data using real-time quantitative PCR and the 241-245. 2-ΔΔCT method. Methods 25: 402-408. 11. Lorito M, Mach RL, Sposato P, Strauss J, Peterbauer CK, 20. Miller GL, Blum R, Glennon WE, Burton AL. 1960. Measurement Kubicek CP. 1996. Mycoparasitic interaction relieves binding of carboxymethylcellulase activity. Anal. Biochem. 1: 127-132. of the Cre1 carbon catabolite repressor protein to promoter 21. Cubero B, Scazzocchio C. 1994. Two different, adjacent and sequences of the ech42 (endochitinase-encoding) gene in divergent zinc finger binding sites are necessary for CREA- Trichoderma harzianum. Proc. Natl. Acad. Sci. USA 93: 14868- mediated carbon catabolite repression in the proline gene 14872. cluster of Aspergillu nidulans. EMBO J. 13: 407-415. 12. Strauss J, Mach RL, Zeilinger S, Hartler G, Stöffler G, 22. Ruijter GJG, Visser J. 1997. Carbon repression in aspergilli. Wolschek M, et al. 1995. Cre1, the carbon catabolite FEMS Microbiol. Lett. 151: 103-114. repressor protein from Trichoderma reesei. FEBS Lett. 376: 23.MacPherson S, Larochelle M, Turcotte B. 2006. A fungal 103-107. family of transcriptional regulators: the zinc cluster proteins. 13. Mach-Aigner AR, Pucher ME, Steiger MG, Bauer GE, Preis Microbiol. Mol. Biol. Rev. 70: 583-604. SJ, Mach RL. 2008. Transcriptional regulation of xyr1, 24. Yang F, Gong Y, Liu G, Zhao S, Wang J. 2015. Enhancing encoding the main regulator of the xylanolytic and cellulase production in thermophilic fungus Myceliophthora cellulolytic enzyme system in Hypocrea jecorina. Appl. thermophila ATCC42464 by RNA interference of cre1 gene Environ. Microbiol. 74: 6554-6562. expression. J. Microbiol. Biotechnol. 25: 1101-1107. 14. Ries L, Belshaw NJ, Ilmén M, Penttilä ME, Alapuranen M, 25. Mach RL, Zeilinger S. 2003. Regulation of gene expression Archer DB. 2014. The role of CRE1 in nucleosome in industrial fungi: Trichoderma. Appl. Microbiol. Biotechnol. positioning within the cbh1 promoter and coding regions of 60: 515-522. Trichoderma reesei. Appl. Microbiol. Biotechnol. 98: 749-762. 26. Berka RM, Grigoriev IV, Otillar R, Salamov A, Grimwood J, 15. Lipp M, Brodmann P, Pietsch K, Pauwels J, Anklam E. 1999. Reid I, et al. 2011. Comparative genomic analysis of the IUPAC collaborative trial study of a method to detect thermophilic biomass-degrading fungi Myceliophthora thermophila genetically modified soy beans & maize in dried powder. J. and Thielavia terrestris. Nat. Biotechnol. 29: 922-929. AOAC Int. 82: 923-928. 27. Hsieh CC, Cannella D, Jørgensen H, Felby C, Thygesen LG. 16. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. 2014. Cellulase inhibition by high concentrations of Site-directed mutagenesis by overlap extension using the monosaccharides. J. Agric. Food Chem. 62: 3800-3805.

March 2017 ⎪ Vol. 27⎪ No. 3