Fonsecaea Nubica Sp

UvA-DARE (Digital Academic Repository)

Biodiversity, pathogenicity, antifungal susceptibility and rapid identification of Fonsecaea and relatives

Najafzadeh, M.J.

Publication date 2011 Document Version Final published version

Link to publication

Citation for published version (APA): Najafzadeh, M. J. (2011). Biodiversity, pathogenicity, antifungal susceptibility and rapid identification of Fonsecaea and relatives. Ponsen&Looijen b.v.

General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).

Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.

UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)

Download date:04 Oct 2021 Biodiversity, pathogenicity, antifungal susceptibility and rapid identiﬁ

Biodiversity, pathogenicity, antifungal susceptibility and rapid identiﬁ cation of Fonsecaea and relatives cation of Fonsecaea and relatives Mohammad Javad Najafzadeh

Mohammad Javad Najafzadeh

2011 Biodiversity, pathogenicity, antifungal susceptibility and rapid identification ofFonsecaea and relatives

Mohammad Javad Najafzadeh ISBN 9789070351007 © Mohammad Javad Najafzadeh, 2011

Cover: Fonsecaea monophora Layout: K.F. Luijsterburg

Printed at Ponsen & Looijen bv, Ede, The Netherlands Biodiversity, pathogenicity, antifungal susceptibility and rapid identification ofFonsecaea and relatives

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. Dr. D.C. van den Boom ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Agnietenkapel op woensdag 14 september 2011, te 10.00 uur

door

Mohammad Javad Najafzadeh geboren te Mashhad, Iran Promotiecommissie

Promotores: Prof. dr. G.S. de Hoog Prof. dr. S.B.J. Menken

Overige leden: Prof. dr. P.H. van Tienderen Prof. dr. M.J. Teixeira de Mattos Prof. dr. G. Haase dr. W. van de Sande dr. J.F.G.M. Meis

Faculteit der Natuurwetenschappen, Wiskunde en Informatica. Contents

Chapter 1 General introduction: Fonsecaea and the black yeasts 7

Chapter 2 Genetic diversity and species delimitation in the opportunistic genus Fonsecaea 19

Chapter 3 Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data 33

Chapter 4 Fonsecaea multimorphosa sp. nov, a new opportunistic species of Chaetothyriales isolated from feline cerebral abscess 45

Chapter 5 Molecular epidemiology of Fonsecaea species 63

Chapter 6 Rapid detection of pathogenic fungi using loop-mediated isothermal amplification exemplified by Fonsecaea agents of chromoblastomycosis 77

Chapter 7 Rapid detection and identification of fungal pathogens by rolling circle amplification (RCA) using Fonsecaea as a model 89

Chapter 8 In vitro activities of eight antifungal drugs against 55 clinical isolates of Fonsecaea species 99

Chapter 9 Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora 105

Chapter 10 Summary and discussion 111 Dedicated to Maryam and Sadra and my dear parents Chapter I

General introduction: Fonsecaea and the black yeasts

7 Chapter 1

Fonsecaea and the black yeasts Black yeasts are classically defined as anamorphic fungi potentially able to produce melanized budding cell at least a part of their life cycle. This condition is known in phylogenetically highly diverse fungi, namely in some basidiomycetes and in members of the ascomycete orders Chaetothyriales, Capnodiales and Dothideales (de Hoog et al. 2000). Today, fungi are classified according to their phylogeny. Fonsecaea is a member of the order Chaetothyriales, which also contains the black yeast genus Exophiala. Cladophialophora, Cyphellophora, Fonsecaea, Phialophora and Rhinocladiella are related but do not produce yeast-like cells. The order Chaetothyriales is remarkable in the fungal Kingdom, for two reasons. First, a large number of the infections are observed in individuals without known immune disorder. Of the about 77 species confirmed to belong to the order by sequence data (Barr 1990; Gueidan et al. 2008), about 40 of them have been encountered as etiologic agents of infections in vertebrates (Badali et al. 2008; de Hoog et al. 2000; Zeng et al. 2007). This high percentage of species with an infective potential is only matched by the order Onygenales containing the dermatophytes and classical systemic fungi. Second, the diversity in clinical pictures caused by members of the Chaetothyriales is bewildering. Species of Onygenales are very consistent in their pathology, displaying a similar clinical course by members causing cutaneous or systemic infections, whereas those of Chaetothyriales encompass a wide diversity of diseases, which are nevertheless more or less characteristic within a single species (de Hoog et al. 2000). This pathogenic potential is particularly observed in the more derived parts of the order, comprising the ascomycete family Herpotrichiellaceae (Untereiner 2000). Several other, recurrent ecological trends in the Chaetothyriales are known; one of these is extremotolerance. Many species are found on exposed surfaces, having a competitive advantage at high temperature, dryness (Sterflinger 1998), or low nutrient availability (Satow et al. 2008). Phylogenetic trees published by Lutzoni et al. (2001) and Gueidan et al. (2008) indicate that some deep branches among the pathogenic black yeasts have a shared evolution with rock-inhabiting fungi, suggesting that this life style might be an ancestral condition. A meristematic growth form, morphologically similar to the muriform cells found in tissue of patients with chromoblastomycosis, in nature is expressed under adverse environmental conditions of nutrient depletion, high temperature and dryness. This suggests a functional change in the course of evolution, from an ancestral rock-inhabiting lifestyle to a derived strategy in which ultimately pathogenicity to vertebrate hosts enhances the fitness of species. Human associated black yeast and relatives have been known since the end of the 19th century as a taxonomically quite heterogeneous group, sharing melanized cell walls and the formation of daughter cells by polar budding, but they still are among the most difficult fungal groups to identify and therefore the knowledge of this group is still only fragmentary (de Hoog et al. 2000). The diagnostic confusion in the past is not surprising, since the taxonomy of black yeast is now known to be much more complicated than was anticipated. With the application of molecular methods great number of undescribed species is encountered. Knowledge of natural habitats and evolution is essential for a better understanding of

8 Introduction

pathogenicity and opportunism. Members of different fungal orders and families tend to be Chapter differentially involved in human mycoses. Natural habitats are dead plants materials, wood, I biofiters, soil polluted with toxic hydrocarbons, rock and inter surface (Badali et al. 2008). For recovery of black yeast like fungi selective isolation methods are required, e.g., the use of high temperature (Sudhadham et al. 2008), a mouse vector (Gezuele et al. 1972), extraction via mineral oil (Vicente et al. 2008) or enrichment on volatile aromatic hydrocarbons (Zhao et al. 2010). The success of the latter method, enabling isolation of black yeasts where direct plating previously had failed, has supported the hypothesis that herpotrichiellaceous black yeasts are potent degraders of aromatic hydrocarbons. Previously, the alkylbenzene enrichment technique has been applied in the biofiltration of air polluted with volatile aromatic compounds (Cox et al. 1997; Kennes and Veiga 2004; Weber et al. 1995).

Chromoblastomycosis Chromoblastomycosis is one of the most frequent diseases caused by melanized fungi. It concerns a chronic cutaneous and subcutaneous infection, characterized by slowly expanding skin lesions which eventually leads to emerging, cauliflower-like eruptions. The muriform cells are the invasive form of the fungus, provoking a granulomatous immune response at the site of a preceding transcutaneous trauma (Najafzadeh et al. 2009; Queiroz- Telles et al. 2009). Chromoblastomycosis is found worldwide, but most clinical reports are from tropical and subtropical climates (de Hoog et al. 2007; Najafzadeh et al. 2009). Infection occurs in immunocompetent individuals. To date seven species have been proven as recurrent causative agents of the disease, i.e., Fonsecaea pedrosoi (Lopez Martinez & Mendez Tovar 2007), F. monophora (de Hoog et al. 2004), F. nubica (Najafzadeh et al. 2010), Cladophialophora carrionii (Badali et al. 2008), C. samoensis (Badali et al. 2008), Phialophora verrucosa (Gugnani et al. 1978; Hofmann et al. 2005) and Rhinocladiella aquaspersa (Arango et al. 1998; Marques et al. 2004). Several Exophiala species have been reported as occasional agents of the disease (Padhye et al. 1996; Tomson et al. 2006). The etiologic agents are supposed to gain entrance through the skin by traumatic implantation of contaminated materials. The majority of lesions are observed on extremities of outdoor workers (de Hoog et al. 2007; Queiroz-Telles et al. 2009). Chromoblastomycosis is currently classified into six clinical types: nodular, tumorous, verrucose, cicatricial, plague and lymphatic (Carrion 1950; Queiroz-Telles et al. 2009). In addition, lesions can be graded according to their severity, as mild, moderate or severe (Queiroz-Telles et al. 2009). In advanced cases more than one type of lesion can be observed in the same patient. As yet it is unknown whether these types are associated with specific etiologic agents or are dependent on host responses. Treatment of chromoblastomycosis may be difficult because of the presence of the therapy-refractory muriform cells and because of differential susceptibilities between taxonomically closely related groups (Bonifaz et al. 2001). There is no drug of choice for treatment of the disorder and results may depend on the size and severity of the lesions (Queiroz-Telles et al. 2009), etiologic agent, patient status and clinical localization (Bonifaz et al. 2001). For that reason, in-depth study of the various agents and their virulence is mandatory.

9 Chapter 1

Fonsecaea Fonsecaea is defined by absence of budding cells, sympodial conidiogenesis and conidia arranged in short chains. Cladophialophora is different by having very long conidial chains, but some species show intermediate morphology and are difficult to attribute to either one of the genera on morphological groups. A phialidic synanamorph may be produced on nutritionally poor media. Fonsecaea pedrosoi was first isolated in 1913 as an etiological agent of chromoblastomycosis by Pedroso and later described and named by Brumpt (1922) and Negroni (1936). On the basis of ribosomal DNA internal transcribed spacer (ITS) sequence data, two species were recently recognized within the genus, i.e., F. pedrosoi and F. monophora (de Hoog et al. 2004; Xi et al. 2009). Traditionally the genus included a third species, F. compacta (Carrión 1950). This taxon is now known to be one of the morphological mutants occurring in Fonsecaea species, but another, molecular sibling of F. pedrosoi, Fonsecaea nubica, was discovered in the course of our study. We also analyzed a Fonsecaea-like strain reported previously (Shinwari et al. 1985) as Cladophialophora bantiana from the left occipital lobe of the cerebrum of an 18-month-old spayed female cat in Australia (Najafzadeh et al. 2011).

The study of biodiversity The first step in any biodiversity study is the establishment of species borderlines. Morphology in the Chaetothyriales is essential for the ecology and survival for the organism, but is often less significant to classify species. Therefore the development of a molecular species concept is necessary. This concept is primarily based on genealogical concordance of several gene trees made for the set of species under investigation. The result is then compared for consistency with other data sets, such as AFLP and morphology. Subsequently the geographic distribution of species is investigated, for which particularly AFLP is suitable. We then wish to develop rapid diagnostic techniques; to this aim we tested LAMP and RCA as novel approaches in species recognition.

Sequencing In fungi, species previously diagnosed by morphological species recognition (MSR) frequently appear to be composed of more than one species when applying phylogenetic species recognition (PSR) (Taylor et al. 2000). In PSR, individuals are grouped objectively, but the decision on the exact delimitation of species remains arbitrary. To avoid the subjectivity of determining the limits of a species, Taylor and his coworkers applied multilocus sequence typing to recognize fungal species to establish the principle of GCPSR, genealogical concordance phylogenetic species recognition. The strength of GCPSR lies in a comparison of the congruency between several gene genealogies enabling the detection of recombination events (Taylor & Fisher 2003). Using GCPSR, multilocus sequence typing (MLST) schemes have been developed to investigate species delimitation in human or animal pathogenic fungi. In this thesis distinction of species is determined by morphological and multilocus sequences of the ribosomal internal transcribed spacers (ITS) and partial sequences of the

10 Introduction

β-tubulin (BT2), actin (ACT1), and cell division cycle (cdc42) genes. Chapter A subsequent step is the identification of strains and their attribution to the species I defined above. We used novel methods for detection and identification of isolates such as AFLP, LAMP and RCA.

AFLP The distribution of species defined by sequencing and phenetic characters can be studied by AFLP (Amplified Fragment Length Polymorphism), a relatively new technique which has a high discriminatory power and high reproducibility that makes it suitable for species identification as well as for strain typing (Savelkoul et al. 1999; Vos et al. 1995). The technique has emerged as a major epidemiological tool with broad application in ecology, population genetics, pathotyping, DNA fingerprinting and quantitative trait loci (QTL) mapping (Mueller & Wolfenbarger 1999). AFLP fingerprinting has been shown to be useful for the molecular characterization of microorganisms with relatively large genomes including various fungal species (Ball et al. 2004; Boekhout et al. 2001; Gupta et al. 2004; Theelen et al. 2001; Warris et al. 2003). The AFLP protocol includes four steps: 1) the digestion of genomic DNA with two restriction endonucleases, 2) the ligation of digested DNA to double-stranded nucleotide adaptors, 3) pre-selective amplification of genomic fragments containing an adaptor at each end, and 4) selective amplification using primers with selective base extensions (Fig. 1). Only those fragments with complementary nucleotides extending beyond the restriction site will be amplified by the selective primers under stringent annealing conditions. This reduces the complexity of the mixture (Groenewald 2009). The number of fragments that will be generated can be modulated by extending the amplification primer(s) at the 3´ site with one or more selective nucleotides.

LAMP Loop-mediated Isothermal Amplification (LAMP) is a powerful innovative gene amplification technique for early detection and identification of microbial diseases (Abliz et al. 2008). It was firstly described and initially evaluated for detection of hepatitis B virus DNA (Notomi et al. 2000) and was further developed by Eiken Chemical Co. (http://loopamp.eiken.co.jp). Nucleic acid amplification takes place with high specificity, efficiency and rapidity under isothermal conditions. It is characterized by the use of four specially designed primers that recognize a total of six distinct sequences on the target DNA. An inner primer containing sequences of the sense and anti sense strands of the target DNA initiates LAMP. Strand displacement DNA synthesis is primed by an outer primer releasing single-stranded DNA. This serves as template for DNA synthesis primed by the second inner and outer primers that hybridize to the other end of the target, which produces a stem–loop DNA structure. In subsequent LAMP cycling one inner primer hybridizes to the loop on the product and initiates displacement DNA synthesis, yielding the original stem–loop DNA and a new

11 Chapter 1 stem–loop DNA with a stem twice as long (Notomi et al. 2000; Tomita et al. 2008) (Fig. 2). Amplification and detection of genes can be completed in a single step, by incubating the mixture of samples, primers, DNA polymerase with strand displacement activity and substrates at a constant temperature (about 65°C). It provides high amplification efficiency, with DNA being amplified 109–1010 times in less than an hour. The amplification products can be easily detected by visual assessment of turbidity, electrophoresis or by the naked eye.

RCA Rolling circle amplification (RCA) is a sensitive, specific and reproducible isothermal DNA amplification technique for rapid molecular identification of microorganisms, the process discovered in the mid 1990s (Fire & Xu 1995; Liu 1996). RCA-based diagnostics are characterized by good reproducibility, with less amplification errors compared to PCR

Fig. 1. Flowchart of steps required for an AFLP assay (www.biocompare.com).

12 Introduction Chapter I

Fig. 2. Primer design of the LAMP reaction. For ease of explanation, six distinct regions are designated on the target DNA, labeled F3, F2, F1, B1c, B2c and B3 from the 5´ end. As c represents a complementary sequence, the F1c sequence is complementary to the F1 sequence. Two inner primers (FIP and BIP) and outer primers (F3 and B3) are used in the LAMP method. FIP (BIP) is a hybrid primer consisting of the F1c (B1c) sequence and the F2 (B2) sequence. (b) Starting structure producing step. DNA synthesis initiated from FIP proceeds as follows. The F2 region anneals to the F2c region on the target DNA and initiates the elongation. DNA amplification proceeds with BIP in a similar manner. The F3 primer anneals to the F3c region on the target DNA, and strand displacement DNA synthesis takes place. The DNA strand elongated from FIP is replaced and released. The released single strand forms a loop structure at its 3´ end (structure 3). DNA synthesis proceeds with the single-strand DNA as the template, and BIP and B3 primer, in the same manner as described earlier, to generate structure 5, which possesses the loop structure at both ends (dumbbell-like structure). (c) Cycling amplification step. Using self- structure as the template, self-primed DNA synthesis is initiated from the 3´ end F1 region, and the elongation starts from FIP annealing to the single strand of the F2c region in the loop structure. Passing through several steps, structure 7 is generated, which is complementary to structure 5, and structure 5 is produced from structure 8 in a reaction similar to that which led from structures 5–7. Structures 9 and 10 are produced from structures 6 and 8, respectively, and more elongated structures (11, 12) are also produced. (Nature Protocols 3: 877–882, 2008).

13 Chapter 1

Fig. 3. (A) Typical design of a circularizable padlock probe as exemplifi ed by the Fonsecaea pedrosoi specifi c (FOP) probe. The probe comprises (i) a 5´-phosphorylated end, (ii) a “backbone” containing binding sites for the RCA primers (RCA primers 1 and 2, respectively; designated by bold uppercase letters) as well as the nonspecifi c linker regions (designated by bold lowercase letters), and (iii) a 3´end. The 5´ and 3´ ends of the probe are complementary to the 5´and 3´ termini of the target sequence in reverse, in this example to the F. pedrosoi sequence. Abbreviations: 5´-P, 5´-phosphorylated binding arm; 3´, 3´ binding arm. (B) Pictorial representation of the RCA method. Step 1, hybridization. Hybridization of padlock probe, containing target- complementary segments, to a target DNA sequence. Step 2, ligation. The probe is circularized by DNA ligase. Step 3, RCA and primer extension I. Ligated probe and binding of RCA primer 1 for RCA. Tandem repeat sequences complementary to the circular probe are generated by RCA. The reverse primer (RCA primer 2) binds to each tandem repeat generated by the rolling circle. Step 4, RCA and primer extension II. As the original RCA strand elongates, further priming events are initiated by primer 2, generating displaced DNA strands. As a result, new priming sites for the fi rst primer (primer 1) are generated. The two primers thus function to generate a self-propagating pattern of DNA fragment release events. Step 5, detection of amplifi ed product. RCA may be monitored using real-time PCR or agarose gel electrophoresis. ssDNA, single-stranded DNA (Zhou et al. 2008; Najafzadeh et al. 2011).

14 Introduction

(Demidov 2002). The method uses a padlock probe, a circularizable oligonucleotide consisting Chapter of two segments complementary to the 3´ and 5´ ends of the target and a linker sequence I (Nilsson et al. 1994). When the 3´ and 5´ terminal regions of the oligonucleotide probes are juxtaposed to the sequence of interest, the probe ends can be joined by a DNA ligase to form a circular DNA molecule that can be amplified by RCA (Fig. 3).

Antifungal susceptibility testing Much has been written on the emerging incidence of fungal infections during the last decades related to the growing number of patients at risk, such as persons with AIDS, recipients of solid organ or hematopoietic stem cell transplants, persons with hematological malignancies, and other individuals receiving immunosuppressive treatment. Chromoblastomycosis, however, is a disease that occurs in otherwise healthy individuals, and its incidence is related to social conditions of the humans populating endemic area, for example profession, hygiene, and access to medical care. Therefore its incidence is not likely to increase. However, the disease is regionally very common, and difficult to treat due to the therapy-refractory nature of the invasive form, the muriform cell, and the frequent relapses. With growing economic standards a mutilating disease as chromoblastomycosis will no longer be accepted, and we thus have to develop timely, effective and low-cost therapy. With orphan diseases like chromoblastomycosis there is still a long way to go. The problem may be aggravated by the advent of resistance to antifungal agents. Determination of an efficient strategy for treatment of the disease is an important issue in clinical mycology (Clark & Hajjeh 2002; Najafzadeh et al. 2009). Therapy for chromoblastomycosis is challenging because there is no consensus regarding the treatment of choice. Several treatment options have been applied, but these tend to result in protracted disease, low cure rates, and frequent relapses (Bonifaz et al. 2004; Esterre & Queiroz-Telles 2006; Garnica et al. 2009; Queiroz-Telles et al. 2009). The therapeutic outcomes are variable and are allegedly dependent on the site of infection, lesion size, and the patient´s general condition (Bonifaz et al. 2001), and perhaps also on the etiological agent. In order to improve antifungal therapy, we first need to acquire more information on the in vitro antifungal susceptibility of Fonsecaea species against various antifungal agents. These are determined according to the Clinical and Laboratory Standards Institute (CLSI) Reference method for broth dilution antifungal susceptibility testing of filamentous fungi (CLSI 2008). In this method, isolates are cultured on potato dextrose agar (35°C) for up to 7 days, and inocula are prepared by gently scraping the surface of the fungal colonies with sterile cotton swab moistened with sterile physiological saline containing 0.05% Tween 40. Large particles in the cell suspensions were allowed to settle for 3 to 5 min at room temperature, and then the concentration of spores in the supernatant is adjusted spectrophotometrically at 530 nm to a percent transmission in the range 68 to 71, corresponding to 1.5 × 104 to 4 × 104 CFU/ml, as controlled by quantitative colony counts on SGA. Antifungal drugs are obtained as reagent- grade powders and dissolved as prescribed by CLSI; stock solutions are prepared in DMSO

15 Chapter 1 or water. Antimycotics are diluted in RPMI 1640 medium, buffered to pH 7.0 with 0.165 morpholinepropanesulfonic acid and dispensed into 96-well microdilution trays at different concentration ranges (dependent on the drugs used) and stored at –70°C prior to use. After inoculation of conidial suspensions to microdilution trays, they are incubated at 35°C for 72 h. Minimum inhibitory concentrations (MICs) are determined visually by comparison of the growth in the wells containing the drug with the drug-free control. Minimum effective concentrations (MECs) are determined microscopically as the lowest concentration of drug promoting the growth of small, round, compact hyphae relative to the appearance of the filamentous forms seen in the control wells.

Aim of the thesis The research presented in this thesis provides taxonomic, morphological and ecological aspects of the genus Fonsecaea. A multilocus DNA sequence data set is established to study the biodiversity and phylogenetic relationship among the Fonsecaea species. A first aim is to redefine taxonomic entities on the basis of molecular data and compare these with classical taxonomy. With newly defined entities, the molecular epidemiology of Fonsecaea species is to be analyzed by AFLP. In addition we aim to develop a sensitive, specific and rapid method for the detection of members of the genus Fonsecaea, in the laboratory as well as on non- sterile adhesive tape widely used for environmental screening. We also describe a rapid and sensitive assay for identification of Fonsecaea species without sequencing using rolling circle amplification (RCA) by designing three specific padlock probes using informative nucleotide polymorphisms in the Fonsecaea ITS database. Additionally we provide the data for appropriate antifungal therapy of chromoblastomycosis that is caused by Fonsecaea. These data will help defining treatment recommendations and establishing guidelines for antifungal therapy. Because of the presence of therapy-refractory muriform cells and differential susceptibilities between taxonomically closely related groups, cure rate is low and there is frequent relapse. In Chapter 9 we report an example with a case of chromoblastomycosis that relapsed after treatment with itraconazole for 4 months.

References Ajello L, Hay, R. J., 1988. Topley & Wilson´s microbiology and microbial infections. Volume 4: Medical mycology., 9 ed. Georgina Bentliff. CSLI, 2008 Approved Standard M38-A2 C, Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Arango M, Jaramillo C, Cortes A, Restrepo A, 1998. Auricular chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 36, 43-45. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits van den Ende AHG, de Hoog GS, 2008. Biodiversity of the genus Cladophialophora. Stud Mycol 61, 175-191. Ball LM, Bes MA, Theelen B, Boekhout T, Egeler RM, Kuijper EJ, 2004. Significance of amplified fragment length polymorphism in identification and epidemiological examination of Candida species colonization in children undergoing allogeneic stem cell transplantation. J Clin Microbiol 42, 1673-1679. Barr M, 1990. Prodromus to nonlichenized, pyrenomycetous members of class Hymenoascomycetes. Mycotaxon 39,

16 Introduction

43-184. Chapter Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, Abeln EC, Dromer F, Meyer W, 2001. Hybrid genotypes in the

pathogenic yeast Cryptococcus neoformans. Microbiology 147, 891-907. I Bonifaz A, Carrasco-Gerard E, Saul A, 2001. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 44, 1-7. Bonifaz A, Paredes-Solis V, Saul A, 2004. Treating chromoblastomycosis with systemic antifungals. Expert Opin Pharmacother 5, 247-254. Carrión AL, 1950. Chromoblastomycosis. Ann N Y Acad Sci 50, 1255-1282. Clark TA, Hajjeh RA, 2002. Recent trends in the epidemiology of invasive mycoses. Curr Opin Infect Dis 15, 569-574. Cox HH, Moerman RE, van Baalen S, van Heiningen WN, Doddema HJ, Harder W, 1997. Performance of a styrene- degrading biofilter containing the yeast Exophiala jeanselmei. Biotechnol Bioeng 53, 259-266. de Hoog GS, Attili-Angelis D, Vicente VA, Gerrits van den Ende AHG, Queiroz-Telles F, 2004. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 42, 405-416. de Hoog GS, Nishikaku AS, Fernandez-Zeppenfeldt G, Padin-Gonzalez C, Burger E, Badali H, Richard-Yegres N, Gerrits van den Ende AHG, 2007. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol 58, 219-234. de Hoog GS, Guarro J, Gené J, Figueras MJ., 2000. Atlas of clinical fungi, 2nd edn ed. Centraalbureau voor Schimmelcultures, Universitat Rovira i Virgilli., Utrecht. de Hoog GS, Queiroz-Telles F, Haase G, Fernandez-Zeppenfeldt G, Attili Angelis D, Gerrits Gerrits van den Ende AHG, Matos T, Peltroche-Llacsahuanga H, Pizzirani-Kleiner AA, Rainer J, Richard-Yegres N, Vicente V, Yegres F, 2000. Black fungi: clinical and pathogenic approaches. Med Mycol 38 Suppl 1, 243-250. Demidov VV, 2002. Rolling-circle amplification in DNA diagnostics: the power of simplicity. Expert Rev Mol Diagn 2, 542-548. Esterre P, Queiroz-Telles F, 2006. Management of chromoblastomycosis: novel perspectives. Curr Opin Infect Dis 19, 148-152. Fire A, Xu SQ, 1995. Rolling replication of short DNA circles. Proc Natl Acad Sci U S A 92, 4641-4645. Garnica M, Nucci M, Queiroz-Telles F, 2009. Difficult mycoses of the skin: advances in the epidemiology and management of eumycetoma, phaeohyphomycosis and chromoblastomycosis. Curr Opin Infect Dis 22, 559-563. Gezuele E, Mackinnon JE, Conti-Diaz IA, 1972. The frequent isolation of Phialophora verrucosa and Phialophora pedrosoi from natural sources. Sabouraudia 10, 266-273. Gueidan C, Villasenor CR, de Hoog GS, Gorbushina AA, Untereiner WA, Lutzoni F, 2008. A rock-inhabiting ancestor for mutualistic and pathogen-rich fungal lineages. Stud Mycol 61, 111-119. Gugnani HC, Egere JU, Suseelan AV, Okoro AN, Onuigbo WI, 1978. Chromomycosis caused by Philaphora pedrosoi in eastern Nigeria. J Trop Med Hyg 81, 208-210. Gupta AK, Boekhout T, Theelen B, Summerbell R, Batra R, 2004. Identification and typing of Malassezia species by amplified fragment length polymorphism and sequence analyses of the internal transcribed spacer and large- subunit regions of ribosomal DNA. J, Clin Microbiol 42, 4253-4260. Hofmann H, Choi SM, Wilsmann-Theis D, Horré R, de Hoog GS, Bieber T, 2005. Invasive chromoblastomycosis and sinusitis due to Phialophora verrucosa in a child from northern Africa. Mycoses 48, 456-461. Kennes C, Veiga MC, 2004. Fungal biocatalysts in the biofiltration of VOC-polluted air. J Biotechnol 113, 305-319. Liu D, Daubendiek SL, Zillman, MA, Ryan, K, Kool, ET, 1996. Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases. J. Am. Chem. Soc. 118, 1587-1594. Lopez Martinez R, Mendez Tovar LJ, 2007. Chromoblastomycosis. Clin Dermatol 25, 188-194. Lutzoni F, Pagel M, Reeb V, 2001. Major fungal lineages are derived from lichen symbiotic ancestors. Nature 411, 937-940. Marques SG, Pedrozo Silva CM, Resende MA, Andreata LS, Costa JM, 2004. Chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 42, 261-265. Mueller UG, Wolfenbarger LL, 1999. AFLP genotyping and fingerprinting. Trends Ecol Evol 14, 389-394. Najafzadeh MJ, Falahati M, Pooshanga Bagheri K, Fata A. Fateh R, 2009. Flow cytometry susceptibility testing for conventional antifungal drugs and Comparison with the NCCLS Broth Macrodilution Test. DARU 17, 94-98. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS, 2009. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 47, 17-25. Najafzadeh MJ, Sun J, Vicente V, Xi L, Gerrits van den Ende AHG, de Hoog GS, 2010. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med Mycol 48, 800-806. Najafzadeh MJ Vicente V, Sun J, Meis JF, de Hoog GS., 2011. Fonsecaea multimorphosa sp. nov, a new species of Chaetothyriales isolated from feline cerebral abscess. Fungal Biology In press. Nilsson M, Malmgren H, Samiotaki M, Kwiatkowski M, Chowdhary BP, Landegren U, 1994. Padlock probes: circularizing oligonucleotides for localized DNA detection. Science 265, 2085-2088. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T, 2000. Loop-mediated isothermal

17 amplification of DNA. Nucleic Acids Res 28, E63. Padhye AA, Hampton AA, Hampton MT, Hutton NW, Prevost-Smith E, Davis MS, 1996. Chromoblastomycosis caused by Exophiala spinifera. Clin Infect Dis 22, 331-335. Parida M, Sannarangaiah S, Dash PK, Rao PV, Morita K, 2008. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev Med Virol 18, 407-421. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A, 2009. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 47, 3-15. Savelkoul PH, Aarts HJ, de Haas J, Dijkshoorn L, Duim B, Otsen M, Rademaker JL, Schouls L, Lenstra JA, 1999. Amplified-fragment length polymorphism analysis: the state of an art. J Clin Microbiol 37, 3083-3091. Shinwari MW, Thomas AD, Orr JS, 1985. Feline cerebral phaeohyphomycosis associated with Cladosporium bantianum. Aust Vet J 62, 383-384. Sterflinger K, 1998. Temperature and NaCl-tolerance of rock-inhabiting meristematic fungi. Antonie Van Leeuwenhoek 74, 271-281. Sudhadham M, Prakitsin S, Sivichai S, Chaiyarat R, Dorrestein GM, Menken SB, de Hoog GS, 2008. The neurotropic black yeast Exophiala dermatitidis has a possible origin in the tropical rain forest. Stud Mycol 61, 145-155. Taylor JW, Fisher MC, 2003. Fungal multilocus sequence typing-it´s not just for bacteria. Curr Opin Microbiol 6, 351-356. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC, 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol 31, 21-32. Theelen B, Silvestri M, Guého E, van Belkum A, Boekhout T, 2001. Identification and typing of Malassezia yeasts using amplified fragment length polymorphism (AFLP), random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE). FEMS Yeast Res 1, 79-86. Tomita N, Mori Y, Kanda H, Notomi T, 2008. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc 3, 877-882. Tomson N, Abdullah A, Maheshwari MB, 2006. Chromomycosis caused by Exophiala spinifera. Clin Exp Dermatol 31, 239-241. Untereiner W, 2000. Capronia and its anamorphs: exploring the value of morphological and molecular characters in the systematics of the Herpotrichiellaceae. Studies in Mycology 45, 141-149. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, de Hoog GS, Zhao J, Pizzirani- Kleiner A, 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 61, 137-144. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, et al. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23, 4407-4414. Warris A, Klaassen CH, Meis JF, de Ruiter MT, de Valk HA, Abrahamsen TG, Gaustad P, Verweij PE, 2003. Molecular epidemiology of Aspergillus fumigatus isolates recovered from water, air, and patients shows two clusters of genetically distinct strains. J Clin Microbiol 41, 4101-4106. Weber FJ, Hage KC, de Bont JA, 1995. Growth of the fungus Cladosporium sphaerospermum with toluene as the sole carbon and energy source. Appl Environ Microbiol 61, 3562-3566. Xi L, Lu C, Sun J, Li X, Liu H, Zhang J, Xie Z, de Hoog GS, 2009. Chromoblastomycosis caused by a meristematic mutant of Fonsecaea monophora. Med Mycol 47, 77-80. Zeng JS, Sutton DA, Fothergill AW, Rinaldi MG, Harrak MJ, de Hoog GS, 2007. Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol 45, 3713-3720. Zhao J, Zeng J, de Hoog GS, Attili-Angelis D, Prenafeta-Boldú FX, 2010. Isolation and identification of black yeasts by enrichment on atmospheres of monoaromatic hydrocarbons. Microb Ecol 60, 149-156.

18 Chapter 2

Genetic diversity and species delimitation in the opportunistic genus Fonsecaea

M. J. Najafzadeh1,2,3, C. Gueidan1, H. Badali1,2, A. H. G. Gerrits van den Ende1, Lian Xi4 & G. S. de Hoog1,2*

1Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, The Netherlands; 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands; 3Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran; 4Department of Dermatology, The Second Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China

*Correspondence: G. S. de Hoog, Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, P. O. Box 85167, NL-3508 AD Utrecht, The Netherlands. Tel.: +31 30 2122 663; fax: +31 30 251 2097; E-mail: de.hoog@cbs. knaw.nl.

Published in: Med Mycol. 2009;47 (special issue): 17-25

19 Chapter 2

Abstract Genetic diversity and species delimitation were investigated among 39 isolates recovered from clinical and environmental sources in Central and South America, Africa, East Asia and Europe. All had been morphologically identified as Fonsecaea spp. Molecular analyses were based on sequences of the ribosomal internal transcribed spacers (ITS), β-tubulin (BT2) and actin (ACT1) regions. A phylogenetic approach using haplotype networks was used to evaluate species delimitation and genetic diversity. The presence and the modes of reproductive isolation were tested by measuring the index of differentiation (ID) and the index of association (IA). Based on the sequence data, 39 Fonsecaea strains were classified into three major entities: (i) a group representing Fonsecaea pedrosoi, (ii) a second composed of F. monophora, and (iii) a third group including mostly strains from South America. The two major, clinically relevant Fonsecaea species, F. monophora and F. pedrosoi, also differed in the pathological symptoms found in patients. Moreover, F. pedrosoi is mostly recovered in clinical settings, whereas F. monophora is commonly isolated from the environment. One environmental strain with Fonsecaea-like appearance was shown to belong to a different species, only distantly related to the core-group of Fonsecaea.

Keywords: Chromoblastomycosis, Fonsecaea pedrosoi, Fonsecaea monophora, molecular phylogenetics.

Introduction Human chromoblastomycosis is a chronic cutaneous and subcutaneous infection caused by melanized moulds and characterized by verrucose skin lesions which eventually lead to emerging, cauliflower like eruptions that consist of muriform cells. The latter are produced in human skin and represent the supposed pathogenic invasive form of the fungi causing the disease. Chromoblastomycosis is found worldwide, but most clinical reports are from tropical and subtropical climates [1-4]. Proven causative agents include Fonsecaea pedrosoi [5], F. monophora [6-8], Cladophialophora carrionii [5], Phialophora verrucosa [9,10] and Rhinocladiella aquaspersa [11,12]. All these fungi are anamorphs of ascomycetes that belong to the family Herpotrichiellaceae (order Chaetothyriales). Cases of chromoblastomycosis caused by species outside the Chaetothyriales, such as Chaetomium funicola reported from western Panama in Central America [13] and Catenulostroma chromoblastomycosum from Zaire in Africa [14] have to be re-evaluated due to the fact that the characteristic muriform cells and host response with acanthosis were not conclusively established. The current hypothesis of infections caused by Fonsecaea species is that patients suffering from chromoblastomycosis are mainly rural workers that acquire the infection after being pricked by contaminated thorns or wood splinters. Recently, with the development of molecular tools for species identification, doubt has arisen about the correctness of this supposed route of infection [3]. The genus Fonsecaea is currently composed of two species, F. pedrosoi and F. monophora, based on the analysis of the ITS rDNA region. Morphologically, these species are very similar, but their pathology may be somewhat different from each other. F.

20 Genetic diversity and species delimitation in Fonsecaea pedrosoi is strictly associated with chromoblastomycosis, while F. monophora may also cause other types of infections [7]. Previously, an additional species was recognized, F. compacta, which was also described as an agent of chromoblastomycosis. This species is now, on the basis of sequence data, regarded to be a dysplastic mutant of F. pedrosoi [7], illustrating

the limitations of traditional morphological species recognition (MSR). Biological species Chapter recognition (BSR) is widely applied to sexually reproducing organisms, including animals 2 and plants, but cannot be used with Fonsecaea species because they seem to lack a sexual stage. In fungi, species previously diagnosed by MSR frequently appear to be composed of more than one species when applying phylogenetic species recognition (PSR) [15]. In PSR, individuals are grouped objectively, but the decision on the exact delimitation of species remains arbitrary. To avoid the subjectivity of determining the limits of a species, Taylor and his coworkers applied multilocus sequence typing to recognize fungal species to establish the priniciple of GCPSR, genealogical concordance phylogenetic species recognition [15,16]. The strength of GCPSR lies in a comparison of the congruency between several gene genealogies enabling the detection of recombination events [15]. Using GCPSR, multilocus sequence typing (MLST) schemes have been developed to investigate species delimitation in human or animal pathogenic fungi, such as Coccidioides immitis [17,18], Coccidioides posadasii [19], Histoplasma capsulatum [20], Cryptococcus neoformans [21], Candida albicans [22] and Candida glabrata [23], as well as in plant pathogenic fungi such as Fusarium graminearum [24,25] and Mycosphaerella graminicola [26]. In this study, we evaluate the genetic diversity and species delimitation in the genus Fonsecaea on the basis of three loci and temperature tests.

Material and methods

Fungal strains Strains studied are listed in Table 1, which includes reference strains from the CBS collection as well as fresh isolates recovered from patients and environmental samples. Stock cultures were maintained on slants of 2% malt extract agar (MEA) and oatmeal agar (OA) at 24°C.

Physiology Cardinal growth temperatures of all strains were determined on 2% MEA. Plates were incubated in the dark for 3 weeks at temperatures ranging at 3°C intervals from 21–36°C. In addition, growth was also recorded at 37°C and at 40°C.

DNA extraction Approximately 1 cm2 of 14 to 21-day-old cultures was transferred to a 2 ml Eppendorf tube containing 400 ml TEx buffer (pH 9.0) and glass beads (Sigma G9143). The fungal material was homogenized with MoBio vortex for 1 min. Subsequently 120 ml SDS 10% and 10 ml proteinase K were added and incubated for 30 min at 55°C, the mixture was vortexed for 3 min. After addition of 120 ml of 5M NaCl and 1/10 vol CTAB 10% (cetyltrimethylammoniumbromide) solution, the material was incubated for 60 min at 55°C.

21 Chapter 2 Argentina Brazil Venezuela Venezuela Libiya Brazil Venezuela Venezuela South America China (Shanghai) China (Shanghai) China (Nanjing) South America Netherlands (zoo) UK USA USA Brazil Brazil Brazil South America Brazil Brazil USA Brazil Brazil Geography Human Human Soil Soil gazelle Human Soil Soil Human Human Human Human Man Seabear Human Human Human Human Human Human Human Soil Plant Human Human Human Host Chromoblastomycosis Chromoblastomycosis Mouse passage Mouse passage Auditory canal Chromoblastomycosis Mouse passage Mouse passage Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Lymphnode, aspiration-biopsy Brain Brain, biopsy Brain abscess Chromoblastomycosis Chromoblastomycosis Brain Chromoblastomycosis Soil Decaying vegetable cover Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Source strains investigated. Fonsecaea AY366920, EU938567, EU938621 AY366919, EU938566, EU938620 AY366916, EU938565, EU938619 EU938588, EU938564, EU938618 AY366913, EU938563, EU938617 AY366918, EU938562, EU938616 EU938587, EU938561, EU938615 EU938586, EU938560, EU938614 AY366914, EU938559, EU938613 EU285268, EU938558, EU938612 EU285270, EU938557, EU938611 EU285273, EU938556, EU938610 EU938585, EU938555, EU938609 AY366925, EU938554, EU938608 AB240949, EU938553, EU938607 EU938584, EU938552, EU938606 AB240948, EU938551, EU938605 AY366926, EU938550, EU938604 EU938583, EU938549, EU938603 EU938582, EU938548, EU938602 AY366906, EU938547, EU938601 AY366927, EU938546, EU938600 EU938581, EU938545, EU938599 EU938580, EU938544, EU938598 AY366928, EU938543, EU938597 EU938579, EU938542, EU938596 GenBank ITS, BT2 , ACT1 dH 16142 dH 11612=FP77II dH 15663 dH 16157 dH 15523 dH 11610=FP63I dH 15665 dH 16159 dH 15659 SUMS0322 SUMS0324 SUMS0300 dH 15828 dH 15691 dH 13130=UTHSC-R3486 dH 14523=Marty 2005226 dH 15330=UTHSC 04-2904 dH 11613 dH 11606=FP26III dH 12978 dH 12659= Bonifaz 150-89 dH 11602=1PLE dH 11590=8DPIRA dH 15331=UTHSC 04-2631 dH 11611 dH 11607=FP31I Other reference(s) 659.76 * 102247 273,66 670,66 201,31 102245 274,66 671,66 271,37 397,48 289,93 117238 117542 117236 102248 102242 115830 269,37 102238 102229 117237 102246 102243 CBS number (A) F. pedrosoi (B) F. monophora Name Table 1 . Isolate and GenBank numbers specimen information for the

22 Genetic diversity and species delimitation in Fonsecaea Chapter Japan Germany Brazil USA Surinam Cameroon Brazil South America Brazil Unknown Puerto Rico Mexico Uruguay Mexico Venezuela Puerto Rico Netherlands Geography 2 Plant Human Plant Human Human Human Plant Human Human Unknown Human Human Human Human Human Human Human Host Tracheal abscess Decaying wood Brain abscess Decaying cover vegetable Chromoblastomycosis Chromoblastomycosis Wood, Grevillea Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis, foot Chromoblastomycosis Chromoblastomycosis, foot Chromoblastomycosis, hand Chromoblastomycosis Chromoblastomycosis Source AY251087 AY366929 EU938593, EU938576, EU938630 AY366931, EU938575, EU938629 EU938592, EU938574, EU938628 EU938595 AB114127, EU938578, EU938632 EU938594, EU938577, EU938631 EU938591, EU938573, EU938627 EU938590, EU938572, EU938626 AY366921, EU938571, EU938625 EU938589, EU938570, EU938624 AY366915, EU938569, EU938623 AY366912, EU938568, EU938622 GenBank ITS, BT2 , ACT1 dH 16013=ATCC 52853 dH 11601 ATCC 28174 dH 15886 dH 15656 dH 11584 ATCC 18658=IMI 134458 dH 15668 dH 15680 dH 18430=Bonifaz 002200 dH 15620 dH 18431=Bonifaz 02300 dH 14477=UNEFM-0002-04 dH 15773 dH 15549 Other reference(s) 306,94 173,52 Outgroup 556,83 102237 557,76 444,62 269,64 102224 271,33 277,29 285.47 * 122740 253,49 122741 342,34 212.77 * CBS number Cladophialophora (C) F. species Name Table 1 . (Continued)

23 Chapter 2

Then the mixture was vortexed for 3 min. Subsequently 700 ml SEVAG (24:1, chloroform: isoamylalcohol) was mixed carefully by hand and centrifuged for 5 min at 4°C at 20400 g force value. The supernatant was transferred to a new Eppendorf tube with 225 ml 5 M NH4- acetate, mixed carefully by inverting, incubated for 30 min on ice water, and centrifuged again for 5 min at 4°C at 20400 g force value. The supernatant was then transferred to another Eppendorf tube with 0.55 vol isopropanol and centrifuged for 5 min at 20400 g force value. Finally, the pellet was washed with 1000 mL ice cold 70% ethanol. After drying at room temperature, it was re-suspended in 100 mL TE buffer (Tris 0.12% w/v, Na-EDTA 0.04% w/v). For some strains, DNA was prepared with Ultra CleanTM Microbial DNA Isolation Kit (MoBio Laboratories).

DNA amplification and sequencing Three gene regions were chosen for the multilocus sequence typing, i.e., rDNA Internal Transcribed Spacers (ITS), partial genes and introns of actin (ACT1) and ß-tubulin (BT2) genes (primers are listed in Table 2). PCR was performed in a 25 ml volume of a reaction mixture containing 7 ml GoTaq Green master mix (Promega) containing dNTPs, MgCl2, reaction buffer, 1 ml of each primer (10 pmol) and 1 ml rDNA. If no amplicons were obtained, other primer combinations were tried. Amplification was performed in an ABI PRISM 2720 (Applied Biosystems, Foster City, USA) thermocycler as follows: 95°C for 4 min, followed by 35 cycles consisting of 95°C for 45 sec, 52°C for 30 sec and 72°C for 2 min, and a delay at 72°C for 7 min. Annealing temperature was changed to 58°C for the BT2 gene. Amplicons were cleaned with GFX PCR DNA and Gel Band Purification kit (GE Healthcare, Buckinghamshire, U.K.). Concentrations of amplicons were estimated on gel, photographed and analyzed by the Gel Doc XR system (Biorad), with SmartLadder (Eurogentec, Seraing, Belgium) as size and concentration marker. Amplicons were then subjected to direct sequencing using ABI prism BigDyeTM terminator cycle sequencing kit (Applied Biosystems, Foster City, USA) and analysed on an ABI Prism 3730XL Sequencer.

Alignment and phylogenetic reconstruction Sequences were edited using Seq Man II in the Lasergene software (DNASTAR, Wisconsin, USA). Iterative alignment was performed by hand with MacClade 4.01. A phylogenetic Table 2. List of the various primers used for amplification and sequencing. locus Primer Primer sequence (5´->3´) Reference

ITS ITS1 TCCGTAGGTGAACCTGCGG [27]

ITS4 TCCTCCGCTTATTGATATGC [27]

ITS5 GGAAGTAAAAGTCGTAACAAGG [27]

V9G TTACGTCCCTGCCCTTTGTA [28]

LS266 GCATTCCCAAACAACTCGACTC [29]

BT2 BT-2a GGTAACCAAATCGGTGCTGCTT [30]

T2 TAGTGACCCTTGGCCCAGTTG [31]

ACT1 Esp ACT fw CACGTTGTCCCCATCTAC [32]

Esp ACT bw ATGAAGGTCAAGATTATC (T) GC [32]

24 Genetic diversity and species delimitation in Fonsecaea approach was used to investigate relationships among the 39 strains of Fonsecaea and two related species of Cladophialophora (C. bantiana and C. immunda). For this approach, the three genes ITS, BT2 and ACT1 were first analyzed separately. Conflicts were estimated using the partition homogeneity test [33] and by comparing topologies. As the three gene partitions

were congruent (no supported conflicts), they were combined and analyzed using maximum Chapter parsimony (MP) as implemented in PAUP* v.4.0b10 [33]. A tree search of 100 random addition 2 sequences (RAS) and a bootstrap analysis of 1000 replicates and two RAS were conducted after assessing congruence between the three genes. Two species of Cladophialophora (C. arxii and C. minourae) were chosen as members of an outgroup. Haplotype networks were also reconstructed for each gene in order to assess genetic variation within Fonsecaea. The networks were obtained using MP (tree search and bootstrap analysis as described above), and drawn by hand in PowerPoint. To detect recombination in each population, the index of association (IA, measure of multilocus linkage disequilibrium) was calculated with Multilocus 1.2.2 (http://www.bio.ic.ac.uk). The null hypothesis for this analysis is complete panmixia (rejected when P<0.05). To investigate population differentiation, an index of differentiation (ID: θ) was calculated using the same software. The null hypothesis for this analysis is no population differentiation (rejected when P<0.05).

Results

Physiology Cardinal growth temperatures of voucher strains showed optimal development at 27-33°C (Fig. 1), while growth was observed in the entire range between 21-37°C. The maximum

Fig. 1 Colony diameters at various temperatures with 38C increments ranging from 21- 40°C, measured after 3 weeks on 2% MEA were calculated for Fonsecaea pedrosoi, F. monophora and Fonsecaea spp.

25 Chapter 2 growth temperature of all strains analyzed was found to be 37°C. No growth was observed at 40°C, but when plates precultured at 40°C were returned to 30°C, some strains showed notable growth (viz., CBS 671.66, dH 13277, CBS 277.29, CBS 274.66, CBS 271.37, CBS 270.37, CBS 102245, CBS 397.48 and CBS 269.37). Thus, 40°C is fungistatic for some Fonsecaea strains and fungicidic for others. These data were, however, not consistent with the molecular groupings.

Phylogenetic approach PHT did not detect conflict between loci. Topologies of trees from all three genes were concordant when occasional paralogues in BT2 were excluded from the analysis. Three clades corresponding to F. monophora, F. pedrosoi and group C showed strong support in the BT2 tree (data not shown). High support was also obtained for F. pedrosoi with ITS, and for group C with ACT1. Because the three markers used did not yield enough parsimony informative characters to resolve relationships within each of the three inferred clades, the GCPSR was not applicable. The genes (ITS, BT2, ACT1) were therefore combined in order to investigate species delimitation using PSR. The resulting data set included 43 taxa and 1,368 characters, among which 181 were parsimony informative. The tree search yield 40 most parsimonious trees of 500 steps. Fig. 1 presents one of these trees with branch lengths and bootstrap values. Except for one strain (CBS 102224), which was here shown to be only distantly related to Fonsecaea, all isolates of Fonsecaea could be grouped into three major clades: (i) the well supported group A (100% bootstrap), representing F. pedrosoi, (ii) the moderately supported group B (71% bootstrap), representing F. monophora, and (iii) the well-supported group C (100% bootstrap). The isolates within group C could not be assigned to either F. pedrosoi or F. monophora because the relationship between group C and F. monophora was not supported. When the three loci were analyzed separately, the relationships among the three clades changed, and never obtained significant support. This lack of support was not caused by problematic taxa with incongruent gene trees. A study of the synapomorphies showed that, among each gene, there were some variable sites that supported the relationship F. monophora/group C, and some others that supported the relationship F. pedrosoi-group C (Table 3). For the three genes, these incongruent sites seemed to be randomly distributed along the locus, and they seemed to account for the low bootstrap value obtained for the relationship F. monophora-group C in our analyses.

Haplotype networks Results of the analyses are presented in Table 4. One of the most parsimonious reconstructions (MPRs) was selected to draw the haplotype networks of ITS (Fig. 3A) and BT2 (Fig. 3B). For ACT1, the MPR was used to draw the haplotype network (Fig. 3C). These networks support the existence of three genetically differentiated groups: F. pedrosoi, F. monophora and group C.

Reproductive isolation

Index of association (IA) showed that grouping was based on clonal evolution rather than

26 Genetic diversity and species delimitation in Fonsecaea 558 T C C 551 T/- - G/T 517 G G G/A 516 T T C Chapter 493 T C C 2 491 T A A 468 A A G/A 427 A A A/G 419 G G A 368 G A A 418 C C T 365 - A - 391 T C T 361 C G C 205 A A/- A 346 T T T/C 158 C C/T C 329 C C/T C 155 T T/C T 287 T T C ACT1 starting from CCCATA in exon 5, and introns 4 5 of 148 A C A 239 C C/T C 142 T T C/T 227 C C C/T 120 A G G 221 C T T 116 T T C 183 C C T 112 C C/T C 166 G A A 111 G A G 159 A A C 496 T/G T T 107 T T T/C 157 T T/C T 467 C T C 106 C C T 136 T C C 460 - T T 95 T C T 86 C C/G C 453 T C T 86 T T G/T 80 G G/A G 430 C G C 76 C C C/T 77 A G G 422 A G A 69 C/T C C 68 A C C 380 C T T ACT1 and BT2 in members of Groups A, C B; number mutations given relative to length the sequence are 54 A A A/T 49 C T C 299 C/G C C 48 C T T 37 T C/T T 275 G G A 23 - - C/- 28 T C T 242 A/C A A 22 C T T 19 G G/A G 224 A G G F. pedrosoi F. pedrosoi F. pedrosoi ITS (30/569) A = C = F. sp. B = F. monophora BT2 (22/370) A = C = F. sp. B = F. monophora ACT1 (11/560) A = C = F. sp. B = F. monophora in brackets. Positions of ITS1 and 2 are counted after ATCATTA (SSU), intron 5 BT2 starting from GCAGAT in exon 4. Table 3. Informative sites in ITS,

27 Chapter 2

Fig. 2. Maximum parsimony tree based on the combined data of ITS and partial BT2 and ACT1 genes of 38 members of Fonsecaea, and three members of Cladophialophora constructed with PAUP v.4.0b10, with 100 bootstrap replications (values > 70 are shown at the branches in bold). CBS 306.96, CBS 556.83 are taken as outgroup (CI = 0.8040, HI = 0.1960, RI = 0.8722) (* = Environmental samples).

Table 4. Molecular data and result of the phylogenetic analyses for the haplotype networks.

Loci Total number of sites Number of variable sites Number of parsimony Number of MPRs Tree length informative sites (steps)

ITS 533 57 30 78 68

BT2 361 36 22 (inc. 9 in intron) 12 39

ACT1 525 12 11 (inc. 5 in intron) 1 12

28 Genetic diversity and species delimitation in Fonsecaea

F. pedrosoi N=1 N=1 N=1 N=1 N=1 F. sp. N=1 N=1 N=1 F. sp. N=1 N=1 N=1 N=1 N=8 N=1 N=1 N=11 N=3 N=1 N=2 N=1 Chapter N=1 N=1 N=1

F. pedrosoi 2 N=1 N=1 N=10 N=2 N=1 N=1 N=6 N=2 A. ITS N=1 N=2 B. BT2 N=1 N=1 N=1 F. monophora N=1 N=1 N=1 F. monophora

F. sp. F. pedrosoi N=3 N=5

N=5 N=2

N=1

N=6 N=16

C. ACT1 F. monophora

Fig. 3. Haplotype networks for Fonsecaea isolates. Each branch represents one mutation, and each hash mark signifies one additional mutation. Circle sizes and the numbers (N) reported next to or within the circles indicate the total numberFig. of3. times an allele was sampled. Bootstrap support values of 70% or greater for particular nodes are indicated by bolding of the internode. on recombination (IA = 0.8249 and P = 0.01) and ID (θ) showed that there was population differentiation between clades (θ = 0.91 and P < 0.01).

Discussion In the present study, we investigate the genetic diversity and species delimitation of Fonsecaea and discuss the implications of a comparison of 39 clinical and environmental isolates. Based on the sequences of ITS, BT2 and ACT1 genes, we classified strains of Fonsecaea into three major clades, which were supported by high bootstrap values (Fig. 2), i.e., Group A, which contains the ex-type strain of F. pedrosoi; Group B, which contains the ex-type strain of F. monophora; and Group C, which did not include any type strain, and might correspond to a new species. In temperature tests no difference could be detected between these three groups, that is the shape of the growth curves at different temperatures are identical (Fig. 1). However, the two described Fonsecaea species seem to be ecologically different from each other in that F. pedrosoi in humans consistently causes chromoblastomycosis, while F. monophora is a more general opportunist [7, 34]. Although in most regions F. pedrosoi is the

29 Chapter 2 prevalent agent of chromoblastomycosis, F. monophora or other Fonsecaea-like species are generally recovered from environmental source [35]. Environmental strains of F. pedrosoi thus far have only been isolated by the use of living mouse baits [36]. These clinical and ecological differences support the separation of these two groups at the species level. The environment, still only fragmentarily sampled, harbors more species that are morphologically Fonsecaea- like but have only occasionally, if ever been encountered as agents of human disease [36]. One such a species was included in our study (Fig. 2, CBS 102224) and proved to be significantly different from F. pedrosoi, F. monophora and group C. The morphological concept of Fonsecaea vs. Cladophialophora, i.e. short versus long conidial chains, is therefore not supported by molecular phylogeny [37]. Based on Index of Association (IA), no recombination was detected among the three inferred groups. This touches on the problem of species concepts in black yeasts and relatives. Fonsecaea seems to exhibit high degrees of clonality, similar to some pathogenic and opportunistic chaetothyrialean anamorphs [32]. For Exophiala jeanselmei for example [32], in the apparent absence of sexuality, each branch is concordantly separated from any other one, and thus could be regarded as a separate molecular species. In this case, delimiting species based on GCPSR is therefore unpractical. Geographical data suggest a broad distribution for both F. pedrosoi and F. monophora. However, the origin of some strains (e.g., CBS 212.77 from the Netherlands, and CBS 117238 from the UK) is doubtful, as patients might have acquired their infections while traveling abroad. Although the infraspecific relationships are poorly resolved, some geographical structure can be observed in some cases. The three Chinese isolates of F. monophora cluster together, as do two strains from Puerto Rico and two strains of F. pedrosoi from Mexico, and two strains from Surinam in group C. This is suggestive of a low dispersal pace, and - given the small genetic distances between these geographical clusters - indicates that they are likely to represent populations of a single species. Although group C has 12 unique positions in three investigated genes, it shares 9 positions with F. pedrosoi and 15 with F. monophora (Table 3). Due to conflicting synapomorphies, the bootstrap value is low for the relationship F. monophora/group C in the combined analysis. These nearly equal distances between all three groups might indicate that they have evolved in a relatively simultaneous way from a common ancestor. In these three species, ancestral polymorphic sites may have become fixed in different ways according to the site, resulting in these conflicting synapomorphies. In our data set, ITS and BT2 are significantly more variable than ACT1 introns (Table 3). In other fungal orders, some authors, e.g., Hirata et al. [38] and Banke et al. [26] have shown that ITS and BT2 are insufficient to resolve the relationships among closely related taxa, while ACT1 tends to be more variable and thus more sensitive at this taxonomic level. We found the opposite, suggesting that the molecular clock in comparable partial genes is not always consistent between groups of organisms.

30 Genetic diversity and species delimitation in Fonsecaea

Acknowledgements We thank S. B. J. Menken, H. Breeuwer and D. Henk for useful suggestions. We also thank A. Bonifaz for providing some isolates. The work of Mohammad Javad Najafzadeh was financially supported by the Ministry of Health and Medical Education of Iran and the Faculty of Medicine, Mashhad University of medical sciences, Mashhad, Iran. Chapter 2 Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.

References 1. Schell WA. Dematiaceous Hyphomycetes. In: Howard DH. Pathogenic Fungi in Humans and Animals, 2nd edn. New York: Marcel Dekker Inc, 2002: 565-636 2. Salgado CG, Da Silva JP, Diniz JAP, et al. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Revta Inst Med Trop Sao Paulo 2004; 46: 33–36. 3. de Hoog GS, Nishikaku AS, Fernández-Zeppenfeldt G, et al. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species, Stud Mycol 2007; 58: 219–234. 4. de Hoog GS, Guarro J, Gené J, Figueras MJ. Atlas of Clinical Fungi, 2nd edn. Utrecht: Centraalbureau voor Schimmelcultures, 2000. 5. Kwon-Chung KJ, Bennett J. Chromoblastomycosis. In: Medical Mycology. Philadelphia: Lea & Febiger, 1992: 337–355. 6. Surash S, Tyagi A, de Hoog GS, et al. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 2000; 43: 465–472. 7. de Hoog GS, Attili-Angelis D, Vicente VA, Gerrits Gerrits van den Ende AHGG, Queiroz-Telles F. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 2004; 42: 405–416. 8. Yaguchi T, Tanaka R, Nishimura K, Udagawa S. Molecular phylogenetics of strains morphologically identified as Fonsecaea pedrosoi from clinical specimens. Mycoses 2007; 50: 255–260. 9. Hofmann H, Choi SM, Wilsmann-Theis D, et al. Invasive chromoblastomycosis and sinusitis due to Phialophora verrucosa in a child from northern Africa. Mycoses 2005; 48: 456–461. 10. Gugnani HC, Egere JU, Suseelan AV, et al. Chromomycosis caused by Phialophora pedrosoi in eastern Nigeria. J Trop Med Hyg 1978; 81: 208–210. 11. Arango M, Jaramillo C, Cortes A, Restrepo A. Auricular chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 1998; 36: 43–45. 12. Marques SG, Pedrozo Silva CM, Resende MA, Andreata LS, Costa JM. Chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 2004; 42: 261–265. 13. Piepenbring M, Cáceres Mendez OA, Espino Espinoza A, Kirschner R, Schöfer H. Chromoblastomycosis caused by Chaetomium funicola: a case report from Western Panama. Brit J Derm 2007; 157: 1025–1029. 14. Crous PW, Braun U, Groenewald JZ. Mycosphaerella is polyphyletic. Stud Mycol 2007; 58: 1–32. 15. Taylor JW, Jacobson DJ, Kroken S, et al. Phylogenetic species recognition and species concepts in fungi. Fung Genet Biol 2000; 31: 21–32. 16. Taylor JW, Fisher MC. Fungal multilocus sequence typing – it´s not just for bacteria. Curr Opin Microbiol. 2003; 6: 351–356. 17. Koufopanou V, Burt A, Szaro T, Taylor JW. Gene genealogies, cryptic species, and molecular evolution in the human pathogen Coccidioides immitis and relatives (Ascomycota, Onygenales). Mol Biol Evol 2001; 18: 1246–1258. 18. Koufopanou V, Burt A, Taylor JW. Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis, Proc Natl Acad Sci USA 1997; 94: 5478–5482. 19. Fisher MC, Koenig GL, White TJ, Taylor JW. Molecular and phenotypic description of Coccidioides posadasii sp. nov., previously recognized as the non-California population of Coccidioides immitis. Mycologia 2002; 94: 73–84. 20. Kasuga T, White TJ, Koenig G, et al. Phylogeography of the fungal pathogen Histoplasma capsulatum. Mol Ecol 2003; 12: 3383–3401. 21. Xu J, Vilgalys R, Mitchell TG. Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Molec Ecol 2000; 9: 1471–1481. 22. Bougnoux ME, Tavanti A, Bouchier C, et al. Collaborative consensus for optimized multilocus sequence typing of Candida albicans. J Clin Microbiol 2003; 41: 5265–5266. 23. Dodgson AR, Pujol C, Denning DW, Soll DR, Fox AJ. Multilocus sequence typing of Candida glabrata reveals

31 geographically enriched clades. J Clin Microbiol 2003; 41: 5709–5717. 24. O´Donnell K, Ward TJ, Geiser DM, Kistler HC, Aoki T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fung Genet Biol. 2004; 41: 600–623. 25. O´Donnell K, Kistler, HC, Tacke BK, Casper HH. Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc Natl Acad Sci USA 2000; 97: 7905–7910. 26. Banke S, Peschon A, McDonald BA. Phylogenetic analysis of globally distributed Mycosphaerella graminicola populations based on three DNA sequence loci. Fungal Genet Biol 2004; 41: 226–238. 27. White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky J, White TJ, eds. PCR Protocols: A guide to methods and applications. USA: Academic, 1990: 315–322. 28. de Hoog GS, Gerrits Gerrits van den Ende AHGG. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 1998; 41: 183–189. 29. Masclaux F, Guého E, de Hoog GS, Christen R. Phylogenetic relationships of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J Med Vet Mycol 1995; 33: 327–338. 30. Glass NL, Donaldson G. Development of primer sets designed for use with PCR to amplify conserved genes from filamentous ascomycetes. Appl Environm Microbiol 1995; 61: 1323–1330. 31. O´Donnell K, Cigelnik E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol 1997; 7: 103–116. 32. Zeng JS, Harrak MJ, Gerrits Gerrits van den Ende AHGG, de Hoog GS. Phylogeny of the Exophiala spinifera clade using multilocus sequence data and exploring phylogenetic species concept. Stud Mycol. (in press). 33. Swofford DL 1999. PAUP*. Phylogenetic Analysis using parsimony (*and other methods) v4.0b10. Sinauer Associates. 34. Surash S, Tyagi A, de Hoog GS, et al. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 2005; 43: 465–472. 35. Vicente VA, Attili-Angelis D, Pie MR, et al. Environmental isolation provides evidence for relative virulence in black yeast-like fungi. Stud Mycol 2008 (in press). 36. Conti-Diaz IA, Mackinnon JE, Civila E. Isolation and identification of black yeasts from the external environment in Uruguay. Pan Am Health Organ Sci Publ 1977; 356: 109-114. 37. Badali H, Najafzadeh MJ, Gueidan C, Bonifaz A, Gerrits Gerrits van den Ende AHGG, de Hoog GS. Ecological, morphological and molecular diversity of Cladophialophora. Stud Mycol 2008 (in press). 38. Hirata K, Kusaba M, Chuma I, et al. Speciation in Pyricularia inferred from multilocus phylogenetic analysis. Mycol Res 2007; 111: 799–808.

32 Chapter 3

Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data

M. J. Najafzadeh 1,2,3, J. Sun4, V. A. Vicente5, L. Xi4, A. H. G. Gerrits van den Ende1 & G. S. de Hoog1,2,6*

1CBS–KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands, 3Department of Parasitology and Mycology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4Department of Dermatology, The Second Affiliated Hospital, Sun Yat–Sen University, Guangzhou, Guangdong, China, 5Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil and 6Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China

Publiced in: Med Mycol. 2010; 48: 800-806

33 Chapter 3

Abstract A new species of Fonsecaea, Fonsecaea nubica, morphologically similar to F. pedrosoi and F. monophora, is described using multilocus molecular data including AFLP profiles, sequences of the ribosomal internal transcribed spacers (ITS), and partial sequences of the cell division cycle (cdc42), β-tubulin (BT2) and actin (ACT1) genes. A phylogenetic approach was used to evaluate species delimitation. Topologies of the trees were concordant. Fonsecaea strains could be classified into three major entities, i.e., one representing Fonsecaea pedrosoi isolates, another consisting of strains of F. monophora, and a third, unnamed group comprising isolates mostly recovered from cases of chromoblastomycosis in South America and China. F. nubica is part of this latter group. Based on strains analyzed thus far, we have found that the pathologies of these three Fonsecaea species are somewhat different in that F. pedrosoi and F. nubica are preponderantly associated with chromoblastomycosis, while F. monophora may also act as a systemic opportunist in cases involving brain infections. The latter species is also the most frequently recovered of the three from environmental samples.

Keywords: Chromoblastomycosis, Fonsecaea, molecular phylogeny, taxonomy.

Abbreviations used ITS: rDNA internal transcribed spacer; cdc42: cell division cycle gene; BT2: β-tubulin; ACT1: S actin; Ia : standardized index of association; PHT: partition homogeneity test

Introduction Fonsecaea pedrosoi was isolated in 1913 as an etiological agent of chromoblastomycosis by Pedroso and named and described by Brumpt (1922) and Negroni (1936) [1]. The taxonomy of the genus Fonsecaea has been reviewed by de Hoog et al. [2] and Najafzadeh et al. [3]. On the basis of ribosomal DNA internal transcribed spacer (ITS) sequence data, two species were recognized within the genus, i.e., F. pedrosoi and F. monophora. Traditionally the genus Fonsecaea included another species, F. compacta, described by Carrión [4] from a case in Puerto Rico. This taxon is now known to be one of the morphological mutants occurring in F. pedrosoi [3] and F. monophora [5,6]. Fonsecaea is an anamorph member of the Chaetothyriales, an ascomycete order that also comprises the black yeast genus Exophiala and filamentous, opportunistic pathogen relatives such as Cladophialophora, Cyphellophora, Phialophora and Rhinocladiella [5,7–9]. It is one of the prevalent genera containing etiologic agents of human chromoblastomycosis [10–13], a chronic, cutaneous and subcutaneous infection characterized by slowly expanding skin lesions with muriform cells in tissue, provoking a granulomatous immune response [2,14]. The disease is found worldwide, but most reports are from tropical and subtropical climates. Patients are supposed to acquire their infection after having been pricked by contaminated thorns or wood splinters [15]. In this paper we describe a new species of Fonsecaea on the basis of molecular data.

34 Fonsecaea nubica sp. nov.

Material and methods

Fungal strains A total of 47 strains consisting of reference strains from the Centraalbureau voor Schimmelcultures (CBS), Utrecht, The Netherlands, as well as fresh isolates from patients and the environment (Table 1). Stock cultures were maintained on slants of 2% malt extract agar (MEA) and oatmeal agar (OA) at 24°C. For morphological studies of Fonsecaea nubica strains, MEA slide cultures were prepared and mounted in aniline blue. Chapter Physiology 3 Cardinal growth temperatures of F. nubica were determined on 2% MEA plates that were incubated in the dark for 3 weeks at temperatures of 21–36°C at intervals of 3°C In addition, growth was recorded at 37°C and at 40°C.

DNA extraction Approximately 1 cm2 of 14–21-day-old cultures was transferred to a 2 ml Eppendorf tube containing 400 μl TEx buffer (pH 9.0) and glass beads (Sigma G9143). The fungal material was homogenized with MoBio vortex for 1 min. Subsequently 120 μl SDS 10% and 10 μl proteinase K were added and incubated for 30 min at 55°C, the mixture was vortexed for 3 min. After the addition of 120 μl of 5 M NaCl and 1/10 vol CTAB 10% (cetyltrimethylammonium bromide) buffer, the material was incubated for 60 min at 55°C. Then the mixture was vortexed for 3 min. Subsequently 700 μl SEVAG (24:1, chloroform: isoamylalcohol) was mixed carefully by hand and centrifuged for 5 min at 4°C at 20,400 g. The supernatant was transferred to a new Eppendorf tube with 225 μl 5 M NH4-acetate, mixed carefully by inverting, incubated for 30 min on ice water, and centrifuged again for 5 min at 4°C at 20,400 g . The supernatant was then transferred to another Eppendorf tube with 0.55 vol isopropanol and centrifuged for 5 min at 20,400 g . Finally, the pellet was washed with 1000 μl ice cold 70% ethanol. After drying at room temperature, it was re-suspended in 100 μl TE buffer (Tris 0.12% w/v, Na-EDTA 0.04% w/v).

DNA amplification and sequencing Small subunit (SSU) rDNA amplicons were generated with primers NS1 and NS24 and were sequenced with primers BF83, Oli1, Oli9, BF951, BF963, BF1438, Oli3 and BF1419 [16]. Four gene regions were chosen for species delimitation, i.e., rDNA Internal Transcribed Spacers (ITS), partial cell division cycle gene ( cdc42 ), partial genes and introns of actin (ACT1) and β-tubulin (BT2) genes. ITS amplicons were generated with primers V9G and LS266 [17,18] and were sequenced with primers ITS1 and ITS4. cdc42 amplification and sequencing was generated with CDC42fw and CDC42w [unpublished data]. ACT1 amplification and sequencing was generated with Esp ACTfw and Esp ACTbw. BT2 amplification and sequencing was generated with BT-2a and T2 [3]. PCR was performed in a 25 μl volume of a reaction mixture containing 7 μl Go Taq master mix (Promega) containing dNTPs, MgCl2, reaction

35 Chapter 3 South China South China South China South China South China South China Puerto Rico Puerto Rico Mexico Venezuela Venezuela Mexico Uruguay Argentina Venezuela Netherlands Venezuela Brazil Venezuela South America Brazil, Parana state Brazil Libiya, Cyrenaica Brazil Mexico Mexico Mexico, Mexico City Origin Human Human Human Human Human Human Human Human Human Human Soil Human Human Human Soil Human Soil Wood decomposition Soil Human Human Human Gazelle Wood decomposition Human Human Human Host Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Mouse passage Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Mouse passage Chromoblastomycosis Mouse passage Environment Mouse passage Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Auditory canal Environment Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Source BT2, ACT1,cdc42 …….……., …….….…, …….…..., GU197509 …….……., ….…….…, …….…..., GU197508 …….……., …….….…, …….…..., GU197507 ….………., ….…….…, …….…..., GU197506 …….……., …….….…, …….…..., GU197505 …….……., …….….…, …….…..., GU197504 AY366915, EU938569, EU938623, GU197503 EU938591, EU938573, EU938627, GU197502 EU938590, EU938572, EU938626, GU197501 …….……., …….….…, …….…..., GU197500 AY366916, EU938565, EU938619, GU197499 EU938589, EU938570, EU938624, GU197498 AY366921, EU938571, EU938625, GU197497 AY366920, EU938567, EU938621, ……...… EU938587, EU938561, EU938615, GU197496 AY366912, EU938568, EU938622, GU197495 EU938586, EU938560, EU938614, GU197494 ……….…., …….….…, ………...., GU197493 EU938588, EU938564, EU938618, GU197492 AY366914, EU938559, EU938613, GU197491 AY366919, EU938566, EU938620, GU197490 ……….…., …….….…, …….…..., GU197489 AY366913, EU938563, EU938617, GU197488 ……….…., …….….…, ………...., GU197487 ……….…., …….….…, …….…..., GU197486 ……….…., …….….…, …….…..., GU197485 Gene Bank ITS, …….……., …….….…, …….…..., GU197484 dH 18405, SUMS 0190 dH 18402, SUMS 0200 dH 20417, SUMS 0295 dH 18399, SUMS 0246 dH 20419, SUMS 0335 dH 20420, SUMS 0376 dH 15773 dH 15680 dH 18430, Bonifaz 002200 dH 14477 dH 15663 dH 18431, Bonifaz 02300 dH 15620 dH 16142 dH 15665 dH 15549 dH 16159 dH 20500 dH 16157 dH 15659 dH 11612 dH 15661 dH 15523 dH 20488 dH 18914, Bonifaz 121-06 dH 18902, Bonifaz 474-03 Other References dH 18897, Bonifaz 251-96 121727 121724 125195 121721 125196 125197 342,34 285,47 122740 117910 273,66 122741 253,49 659,76 274,66 212,77 671,66 ……. 670,66 271.37* 102247 272,37 201,31 …….. 122345 122849 CBS 122736 F. monophora F. monophora F. monophora F. monophora F. monophora F. monophora F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi F. pedrosoi Name F. pedrosoi Table 1 . Isolate and GenBank numbers specimen information for strains investigated.

36 Fonsecaea nubica sp. nov. Germany South China South China South China South China West Cameroon Surinam France Brazil Unknown USA Brazil, Parana state Brazil, Parana state South America Brazil, Parana state Brazil South America Brazil, Parana state South China South China Origin Chapter 3 Human Human Human Human Human Human Human Unknown Human Unknown Human Plant Soil Human Human Human Human Human Human Human Host Tracheal abscess Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Unknown Chromoblastomycosis Unknown Brain abscess Decaying vegetable cover Soil Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Chromoblastomycosis Source BT2, ACT1,cdc42 EU103986,…….….…..,…………., GU197529 …….……., …….….…, …….…..., GU197528 …….……., ….…….…, …….…..., GU197527 …….……., …….….…, …….…..., GU197526 …….……., …….….…, …….…..., GU197525 EU938592, EU938574, EU938628, GU197524 AY366931, EU938575, EU938629, GU197523 …….……., …….….…, …….…..., GU197522 EU938594, EU938577, EU938631, GU197521 EU938593, EU938576, EU938630, GU197520 AB240948, EU938551, EU938605, GU197519 EU938581, EU938545, EU938599, GU197518 AY366927, EU938546, EU938600, GU197517 AY366906, EU938547, EU938601, GU197516 AY366928, EU938543, EU938597, GU197515 EU938579, EU938542, EU938596, GU197514 EU938585, EU938555, EU938609, GU197513 AY366926, EU938550, EU938604, GU197512 …….……., …….….…, …….…..., GU197511 Gene Bank ITS, ….………., ….…….…, …….…..., GU197510 dH 20418, SUMS 0330 dH 18411, SUMS0011 dH 18398, SUMS0251 dH 18412, SUMS0255 dH 15656 dH 15886 dH 15657 dH 15668 ATCC 28174 dH 15330, UTHSC 04-2904 dH 11590 dH 11602 dH 12659 dH 11611 dH 11607 dH 15828 dH 11613 dH 20422, SUMS 0378 Other References dH 20421, SUMS 0377 306,94 125198 121733 121720 121734 269.64* 444,62 270,37 277,29 557,76 117236 102229 102238 269.37* 102246 102243 397,48 102248 125190 CBS 125189 C. arxii F. nubica F. nubica F. nubica F. nubica F. nubica F. nubica F. nubica F. nubica F. nubica F. monophora F. monophora F. monophora F. monophora F. monophora F. monophora F. monophora F. monophora F. monophora Name F. monophora Table 1 . (Continued) Abbrevations used: ATCC = American Type Culture Collection, Manassas, U.S.A.; CBS = Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, The Netherlands; dH = G.S. de Hoog working collection; IMI = International Mycological Institute, London, U.K; UTHSC = Fungus Testing Laboratory, Department of Pathology, University of Texas Health Science Center at San Antonio, U.S.A. *= type strain

37 Chapter 3 buffer, 1 μl of each primer (10 pmol) and 1 μl rDNA. Amplification was performed in an ABI PRISM 2720 (Applied Biosystems, Foster City, USA) thermocycler as follows: 95°C for 4 min, followed by 35 cycles consisting of 95°C for 45 sec, 52°C for 30 sec and 72°C for 2 min, and a delay at 72°C for 7 min. The annealing temperature was changed to 58°C and 49°C for BT2 and cdc42, respectively. Amplicons were cleaned with GFX PCR DNA and Gel Band Purification kit (GE Healthcare, Buckinghamshire, UK). Concentrations of amplicons were estimated on gel, photographed and analyzed by the Gel Doc XR system (Biorad), with SmartLadder (Eurogentec, Seraing, Belgium) as size and concentration marker. Amplicons were subjected to direct sequencing, with PCR as follows: 95°C for 1 min followed by 30 cycles consisting of 95°C for 10 sec, 50°C for 5 s and 60°C for 2 min. Reactions were purified with Sephadex G-50 fine (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). Sequencing was done using ABI prism BigDye TM terminator cycle sequencing kit (Applied Biosystems, Foster City, USA) and sequences was analyzed on an ABI Prism 3730XL Sequencer. AFLP data were taken from Najafzadeh et al. [unpublished data].

Alignment and phylogenetic reconstruction Sequences were edited using SEQMAN in the Lasergene software (DNASTAR, Wisconsin, U.S.A). Iterative alignment was performed by hand with Bionumerics version 4.61 (Applied Maths, Kortrijk, Belgium). A phylogenetic approach was used to investigate relationships between 46 strains of Fonsecaea and one related species of Cladophialophora (C. arxii) as outgroup. For this approach, the four genes ITS, cdc42, BT2 and ACT1 were fi rst analyzed separately. Conflicts were estimated using the partition homogeneity test [19] available in PAUP* v. 4.Ob10 [20]. As the four gene partitions were incongruent (supported conflicts), they were not combinable, and four trees for four genes were constructed using the Tree Finder Algorithm (v. June 2007, by Gangolf Jobb) with 100 bootstrap replicates and edited with Mega 4 software [21]. Bootstrap values equal to or greater than 70% were considered significant [22]. To detect recombination in each population the standardized S index of association (IA , measure of multi-locus linkage disequilibrium) was calculated with MULTILOCUS V.1.2.2 (http://www.bio.ic.ac.uk). The null hypothesis for this analysis is complete panmixia (rejected when P< 0.05).

Results Using the slowly evolving marker nucSSU rDNA and a dataset of Chaetothyriales available at CBS, Fonsecaea nubica (GU197483) were located in a clade that also contained F. pedrosoi, F. monophora, Cladophialophora saturnica, C. arxii, C. bantiana, C. emmonsii and C. minourae (tree not shown). All members of this clade except C. minourae are known to be potentially able to cause disease in humans. Species of the clade were analyzed in more detail in a multilocus study using ITS, BT2, cdc42 and ACT1 . Three clades corresponding to F. monophora, F. pedrosoi and an unnamed group showed strong support in the BT2 tree (bootstrap = 91%, 93% and 74%, respectively). High support was also obtained for F. pedrosoi with ITS and cdc42

38 Fonsecaea nubica sp. nov.

(bootstrap = 99% and 100%, respectively), F. monophora with ITS, cdc42 and ACT1 (bootstrap = 78%, 91% and 75.5%, respectively) and for F. nubica with cdc42 and BT2(bootstrap = 86% and 74%, respectively). Partition-homogeneity test with heuristic search of four genes with 100 replicates and 167 parsimony-informative characters of 2254 total characters revealed conflict (significant heterogeneity) among the four genes ( P = 0.01). The trees (ITS, cdc42, BT2 and ACT1 ) were therefore not combined and are shown separately in Fig. 1. The isolates grouped into three major clades (Fig. 1) are as follows; group A representing F. pedrosoi, group B representing F. monophora, and an unnamed group C. Some variable sites supported a relationship A/B, while others supported A/C. Synapomorphy study showed that group C had Chapter 23 unique positions in the four genes investigated. Standardized index of association showed S 3 that the groups did not recombine (IA = 0.3397, P < 0.01). When the four loci were analyzed for the three groups separately, the phylogenetic structure proved to be robust, but the index S of association (IA ) to establish the degree of clonality could not be applied because of the small sample size of each population. An AFLP analysis of the same strains of Fonsecaea as

Fig. 1. Consensus trees of Fonsecaea based on I. ITS ribosomal DNA, II. cdc42, III. ACT1 and IV. BT2 of 47 strains, constructed with the Tree Finder algorithm (v. June 2007) and 100 bootstrap replicates, edited with MEGA4 (values>70 are shown at the branches in bold). CBS 306.94 was taken as outgroup (A = F. pedrosoi, B = F. monophora, C = F. nubica).

39 Chapter 3

Fig. 3. Colony diameters at various temperatures with 3°C increments ranging from 21 to 40°C, measured after 3 weeks on 2% MEA were calculated for F. nubica strains.

Fig. 2. Clustering of AFLP banding pattern of isolates of Fonsecaea by unweighted pair group method with arithmetic means (UPGMA). (A = F. pedrosoi, B = F. monophora, C = F. nubica). noted above showed a division into three main groups that were congruent with groups A, B and C above in that A and B represented F. pedrosoi and F. monophora, respectively, and group C was the unnamed group (Fig. 2). Cardinal growth temperatures of F. nubica voucher strains showed optimal development at 27−33°C (Fig. 3), while growth was observed over the entire range between 21 – 37°C. The maximum growth temperature of all strains analyzed was found to be 37°C, with no growth observed at 40°C. Strains analyzed and attributed to either groups A, B or C (CBS data, n =103) showed differential predilection to the mammal host. Strains of groups A (n = 46) and C (n= 14) were mainly isolated from humans, occasionally from warm-blooded animals (n = 1), or from the environment using a rodent bait (n= 4). Isolates from the environment in the Americas using direct isolation oil flotation technique according to Satow et al . [23], yielded F. monophora (n = 4) more often than F. pedrosoi, while, in contrast F. pedrosoi was significantly more frequently isolated from chromoblastomycosis [11]. Given the consistent separation of cluster C, and its distance to A and B, we propose to recognize it as a new species with the following description: Fonsecaea nubica Najafzadeh, Sun, Vicente, Gerrits van den Ende & de Hoog, sp. nov . Figs 4 and 5. Mycobank MB 515151 - CBS 269.64. Etym.: named after the dull appearance of lesions on the body. Coloniae fere lente crescentes, olivaceo-brunneum, reversum olivaceo-nigrum. Cellulae gemmantes absentes. Hyphae leves, hyalinae vel pallide brunneae, 2.0–2.5 μm latae, 10–25 μm septata. Conidiophora semi-macronemata, septata, lateralia vel terminalia; stipites et ramoconidia denticulata. Conidia holoblastica, dilute olivacea, late clavata, unicellularia, levia, catenas brevias ramosas cohaerentes formantia, cicatricibus dilute brunneis, 3–4 × 2–3 μm.

40 Fonsecaea nubica sp. nov.

Phialidae absentes. Synanamorphe non vista. Chlamydosporae absentes. Teleomorphosis ignota. Temperatura maxima 370C. Holotypus: CBS-H 20321 in herbariorum CBS. Colonies on PDA at 30 0C, slowly growing, flat to heaped, velvety to downy, olivaceous Chapter 3

Fig. 4. Macroscopic and microscopic morphology of Fonsecaea nubica (A, B, F, G, H and I) Type strain CBS 269.64, (C and D) CBS 125198, (E) CBS 444.62. Scale bar = 10 µm.

41 Chapter 3

Fig. 5. Line drawing of microscopic morphology of Fonsecaea nubica, strain CBS 125198, slide culture on MEA after 14 days. brown; reverse olivaceous black. Germinating cells absent. Hyphae smooth-walled, pale olivaceous brown, 2.0–2.5 μm wide, regularly septate every 10–25 μm. Conidiophores slightly differentiated, olivaceous brown, branched or unbranched, terminal or intercalary; conidiogenous cells pale olivaceous with prominent denticles and dark scars. Conidia pale olivaceous, broadly clavate, in short chains containing 1–3(−4) conidia, with brown scars, about 3–4 × 2–3 μm. Phialides absent. Chlamydospores absent. Teleomorph unknown. Optimal growth at 27–330C, scant growth at 37 0C, no growth at 400C. Holotype: dried culture in CBS-H 20321; ex-type strain CBS 269.64.

Discussion In the present study we document the existence of an undescribed species of Fonsecaea, based on AFLP profiles and on sequences of ITS, cdc42, BT2 and ACT1 genes. Morphologically the genus Fonsecaea is defined by poorly differentiated, melanized conidiophores with clusters of cylindrical denticles bearing initially non-catenate conidia that eventually produce 1–2 smaller conidia [7]. In all partitions analyzed, Fonsecaea contained the following three major clades, which were supported by high bootstrap values (Fig. 1): group A, which contains the ex-type strain of F. pedrosoi, group B, which contains the ex-type strain of F. monophora, and group C, which did not include any type strain and was introduced as a new species s of Fonsecaea, F. nubica. Based on standardized index of association (IA ), no recombination was detected between the three inferred groups and hence they were interpreted to be individual species. Teleomorphs are unknown in the Fonsecaea clade. Morphological distinction of Fonsecaea species is difficult, but their separation on the basis of multilocus data is unambiguous. Groups A–C were recognized in four genes, and also in AFLP patterns

42 Fonsecaea nubica sp. nov.

[unpublished data]. Clinically their distinction is relevant, since the species differ in pathology and virulence, despite absence of differences in the temperature relations between F. nubica and the remaining species (our data and those of Najafzadeh et al. [3]). Fonsecaea pedrosoi and F. nubica thus far are strictly associated with chromoblastomycosis, whereas F. monophora, in addition to causing chromoblastomycosis, also affects other organs such as brain, bile and cervical lymph nodes [2, 24–26]. Out of 103 Fonsecaea strains available in the CBS culture collection and confirmed by sequencing, all clinical isolates of F. pedrosoi and F. nubica originated from chromoblastomycosis. However, 81.4% of F. monophora isolates came from chromoblastomycosis, while 9.3% were involved in brain infection and Chapter 9.3% were isolated from the environment without the use of a mammal bait. Environmental strains, when isolated without mammal bait, were more often F. monophora . Geographical 3 distribution patterns also differ between species with 47.8% of F. pedrosoi originating from Central America, 47.8% from South America and 4.3% from other countries. In contrast, 27.9% of the isolates of F. monophora came from South America, 58.1% from China and 13.9% from other countries. Finally, 21.4% of the strains of F. nubica originated from South America, 57.1% from China and 21.4% from other countries. The origins of some strains (e.g., CBS 212.77 from the Netherlands, CBS 117236 from the USA and CBS 270.37 from France) are doubtful, as patients might have been infected while traveling abroad. Fonsecaea pedrosoi has never been proven to occur in China and is prevalent in Central and South America. Efforts to isolate environmental strains by direct methods (i.e., without rodent vector) have mainly been performed in South America [23,27]. Strains isolated (n = 4) were more often F. monophora or hitherto undescribed sibling Fonsecaea- or Cladophialophora-like species [19,23], rather than F. pedrosoi which is significantly more frequently isolated from humans in the same region. This result does not match with expectations on the basis of the ratio of environmental/clinical strains (1/21.5; Table 1 and supplementary data from CBS collection). Chromoblastomycosis may be caused by traumatic inoculation of fungi from the environment, but not all species are equally efficient in causing disease. Similar differences in virulence and predilection were noted elsewhere in Chaetothyriales, e.g., in Cladophialophora [15] and Exophiala [28].

Acknowledgements We thank S. B. J. Menken for useful suggestions. We also thank A. Bonifaz for providing some isolates. The work of Mohammad Javad Najafzadeh was financially supported by the Ministry of Health and Medical Education of Iran and faculty of medicine, Mashhad University of medical sciences, Mashhad, Iran and the work of Vania A. Vicente was supported by Brazilian Government fellowship from Coordenação de Pessoal de Nível Superior (CAPES).

Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.

43 References 1. Ajello L, Hay, R. J. Agent of chromoblastomycosis and sporotrichosis. In: Topley & Wilson´s microbiology and microbial infections, Vol 4 Medical Mycology. Ninth edn. New York; Georgina Bentliff, 1988: 315-336 2. de Hoog GS, Attili-Angelis D, Vicente VA, et al. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 2004; 42(5): 405-16. 3. Najafzadeh MJ, Gueidan C, Badali H, et al. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 2009; 47(1): 17-25. 4. Carrión A. Preliminary report on a new clinical type of the disease caused by Hormodendrum compactum, nov. sp. Puerto Rico J Publ Health Trop Med 1935; 10: 543-5. 5. Xi L, Sun J, Lu C, et al. Molecular diversity of Fonsecaea (Chaetothyriales) causing chromoblastomycosis in southern China. Med Mycol 2009; 47(1): 27-33. 6. Xi L, Lu C, Sun J, et al. Chromoblastomycosis caused by a meristematic mutant of Fonsecaea monophora. Med Mycol 2009; 47(1): 77-80. 7. de Hoog GS, Guarro J, Gené J, Figueras MJ. Atlas of Clinical Fungi, 2nd edn. Centraalbureau voor Schimmelcultures/Universitat Rovira i Virgili, Utrecht/Reus; 2000. 8. Badali H, Najafzadeh MJ, Van Esbroeck M, et al. The clinical spectrum of Exophiala jeanselmei, with a case report and in vitro antifungal susceptibility of the species. Med Mycol 2009. Med Mycol 2010; 48(2):318-27 9. Badali H, Gueidan C, Najafzadeh MJ, et al. Biodiversity of the genus Cladophialophora. Stud Mycol 2008; 61: 175-91. 10. Lopez Martinez R, Mendez Tovar LJ. Chromoblastomycosis. Clin Dermatol 2007; 25(2): 188-94. 11. Queiroz-Telles F, Esterre P, Perez-Blanco M, et al. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 2009; 47(1): 3-15. 12. Kawasaki M, Aoki M, Ishizaki H, et al. Molecular epidemiology of Fonsecaea pedrosoi using mitochondrial DNA analysis. Med Mycol 1999; 37(6): 435-40. 13. Tanabe H, Kawasaki M, Mochizuki T, et al. Species identification and strain typing of Fonsecaea pedrosoi using ribosomal RNA gene internal transcribed spacer regions. Nippon Ishinkin Gakkai Zasshi 2004; 45(2): 105-12. 14. Bonifaz A, Carrasco-Gerard E, Saul A. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 2001; 44(1-2): 1-7. 15. de Hoog GS, Nishikaku AS, Fernández-Zeppenfeldt G, et al. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol 2007; 58: 219-34. 16. de Hoog GS, Göttlich E, Platas G, et al. Evolution, taxonomy and ecology of the genus Thelebolus in Antarctica. Stud Mycol 2005; 51: 33-76. 17. de Hoog GS, Gerrits Gerrits van den Ende AHG. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 1998; 41(5-6): 183-9. 18. Masclaux F, Guého E, de Hoog GS, Christen R. Phylogenetic relationships of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J Med Vet Mycol 1995; 33(5): 327-38. 19. Farris JS, Källersjö M, Kluge AG, Bult C. Testing the significance of incongruence. Cladistics 1994; 10: 315-319. 20. Swofford D. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods) v 4.Ob10. Sunderlan MA, U.S.A.; Sinauer Associates, 2002. 21. Tamura K, Dudley J, Nei M, et al. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24(8): 1596-9. 22. Hillis DM, Bull JJ. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. System Biol 1993; 42: 182-192. 23. Satow MM, Attili-Angelis D, de Hoog GS, et al. Selective factors involved in oil flotation isolation of black yeasts from the environment. Stud Mycol 2008; 61: 157-63. 24. Najafzadeh MJ, Rezusta A, Cameo MI, et al. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol 2009. Med Mycol 2010; 48(2):39-3 25. Surash S, Tyagi A, de Hoog GS, et al. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 2005; 43(5): 465-72. 26. Yaguchi T, Tanaka R, Nishimura K, et al. Molecular phylogenetics of strains morphologically identified as Fonsecaea pedrosoi from clinical specimens. Mycoses 2007; 50(4): 255-60. 27. Vicente VA, Attili-Angelis D, Pie MR, et al. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 2008; 61: 137- 144. 28. Sudhadham M, de Hoog GS, Menken SBJ, et al. Rapid screening for genotypes as possible markers of virulence in the neurotropic black yeast Exophiala dermatitidis using PCR-RFLP. J Microbiol Meth 2010; 80(2);138-42.

44 Chapter 4

Fonsecaea multimorphosa sp. nov, a new opportunistic species of Chaetothyriales isolated from a feline cerebral abscess

M. J. Najafzadeh1,2,3, V. A. Vicente4, J. Sun5, J. F. Meis6 & G. S. de Hoog1,2,7*

1CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands, 3Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil, 5Department of Dermatology, The Second Affiliated Hospital, Sun Yat- Sen University, Guangzhou, Guangdong, China, 6Department of Medical Microbiology and Infectious Diseases, Canisius Wilhelmina Hospital, Nijmegen, The Netherlands, 7Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China.

In press in: Fungal biology (2011)

45 Chapter 4

Abstract A novel fungal species is described originating from the left occipital lobe of the cerebrum of an 18-month-old spayed female cat in Australia. Neurological disorder of the animal became apparent by circling movements and uncoordinated behavior. Sequencing of the SSU rRNA gene reveals this strain as belonging to the genus Fonsecaea in Chaetothyriales. This orders includes many black yeasts and relatives known as etiologic agents of disease in humans and animals, including several neurotropic species. Novelty of the species was corroborated by morphology and by multilocus sequencing of the ribosomal internal transcribed spacers (ITS) and partial sequences of the β-tubulin (BT2) and elongation factor (TEF1) genes. The strain is very similar to several strains recovered by a selective isolation technique from the natural environment in Brazil.

Key words: neurotropic fungi, black yeasts, feline infection

Introduction Central nervous system infection by filamentous fungi is a very rare condition in humans and animals, but attention is growing because of its high mortality and a poor prognosis (Dixon et al. 1989; Li & de Hoog 2009; Horré& de Hoog 1999; Revankar et al. 2004). If the infection occurs in an otherwise apparently healthy individual, mostly a member of the ascomycete order Chaetothyriales is concerned; this order comprises the black yeasts and relatives (de Hoog et al. 2000). The dark pigmentation in hyphal elements in tissue results from the melanin in the cell wall; this compound offers protection against oxygenic action of phagocytes and is therefore regarded as one of the factors responsible for virulence and pathogenic potential in these fungi (Revankar et al. 2004). The main neurotropic agents in the Chaetothyriales are Cladophialophora bantiana (Abramo et al. 2002; Elies et al. 2003), Exophiala dermatitidis (Chang et al. 2000), Rhinocladiella mackenziei (Al-Abdely et al. 2000; Campbell et al. 1993; Sutton et al. 1998) and Fonsecaea monophora (Surash et al. 2005). The great majority of these cases were reported from humans, while reports from other mammals are extremely rare. In contrast, Ochroconis gallopava, a neurotrope with unknown phylogenetic affiliation, is nearly exclusively found in warm-blooded animals such as birds, poultry, dogs and cats, while the rare human cases by this species are limited to patients with severe underlying disease (Blalock et al. 1973; Shoham et al. 2008; Singh et al. 2006; Wong et al. 2010). Cerebral phaeohyphomycosis by black yeast-like fungi ultimately may lead to black, necrotic brain tissue, pus and sometimes black cerebrospinal fluid with numerous olive-brown, septate fungal hyphae (Li & de Hoog 2009). The exact origin of the disorder is unknown; it has been supposed that pathogens may gain access to the brain via the bloodstream or lymphatic fluid. First symptoms of the disease are therefore of neurological nature, and for this reason Horré & de Hoog (1999) described this disease as ‘primary cerebral abscess´. Secondary cerebral infections are mostly caused by members of Pleosporales comprising

46 Fonsecaea multimorphosa sp. nov agents of brain infections which extend from a pre-existing, chronic sinusitis. The genus Fonsecaea presently contains three species, which all are potential etiologic agents of human chromoblastomycosis (Najafzadeh et al. 2009, 2010b). Fonsecaea monophora is a recurrent agent of cerebritis, with five cases reported to data (Koo et al. 2010; Najafzadeh et al. 2009, 2010b; Surash et al. 2005; Takei et al. 2007). In the present study we describe a fungus from a feline brain infection, which was reported more than 25 years ago as Cladophialophora bantiana (Shinwari et al. 1985). The strain had been deposited in the CBS culture collection as CBS 980.96. On the basis of multilocus sequence data it was concluded that a novel species was concerned, phylogenetically close to Fonsecaea. Several environmental strains from soil and rotten wood in Brazil, isolated in the framework of a search for the natural habitat of Fonsecaea pedrosoi, proved to be genetically similar. The feline strain is introduced here as a novel species, and compared with environmental and clinical Fonsecaea-like isolates. Chapter Material and methods 4

Fungal strains Strains used in this study comprised 63 reference isolates from the Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, Utrecht, The Netherlands (Table 1). Stock cultures were maintained on slants of 2% malt extract agar (MEA) and oatmeal agar (OA) at 24°C. For morphological studies, MEA and potato dextrose agar (PDA) slide cultures were prepared and mounted in aniline blue. Environmental strains were isolated from plant debris, and decaying wood and soil samples in southern Brazil. Approximately 20 g from each sample were processed for fungal isolation, with 10 replicates per sample. Each sample was incubated at room temperature for 30 min in 100 mL sterile saline solution containing 200 U penicillin, 200 µg/L streptomycin, 200 µg/L chloramphenicol and 500 µg/L cycloheximide. After initial incubation, 20 mL sterile mineral oil was added to the solution, followed by vigorous 5 min shaking and the flasks were left to settle for 20 min. The oil-water interphase was carefully collected, inoculated onto Mycosel agar (Difco) and incubated for 4 wks at 36°C (Dixon et al. 1980; Vicente et al. 2008). The dark colonies appearing on the plates were isolated on Mycosel agar.

Physiology Cardinal growth temperatures of test strains (CBS 980.96, CBS 102240, CBS 102224, CBS 102235, CBS 102253 and CBS126716) were determined on 2% MEA plates that were incubated in the dark for 3 weeks at temperatures of 9–36°C at intervals of 3°C. In addition, growth was recorded at 37°C and at 40°C.

DNA extraction DNA extraction and quality tests were performed using glass beads (Sigma G9143) according to protocols described previously (Najafzadeh et al. 2009).

47 Chapter 4 Geography Australia Australia Australia Australia Canada, Canada New Zealand Unknown USA unknown Germany Brazil Brazil Brazil USA Brazil Brazil Uruguay Germany USA Japan Japan Suriname China Cameroon Host Human Animal Animal Animal Human Human Human Human Human Human Human Eutypa, stroma Vitis (Vitaceae), fruit Dacrydium cupressinum wood Sub cutaneous ulcer Sub cutaneous phaeohyphomycosis Gasstation Crab Crab Crab Vegetable cover/soil Brain abscess Chromoblastomycosis Source Apple juice Sports drink Sports drink Sports drink Unknown Mycotic granuloma Skin Neotandia membranacea, trunk, recently cut tree Tracheal abscess Decaying wood Rotting wood Chromoblastomycosis Chromoblastomycosis Gene Bank ITS, TEF1a, BT2 DQ008141 EU035410 EU035409 EU035402 AF050241 EU103985, EU140595 EU103984, EU140602 FJ385270 EU103986, EU140593 AY251087, EU140598 EU103988, EU140599 AY366931, …, EU938575 EU938592, …, EU938574 Other references CPC 11048 = FRR3318 CPC 1375 = FRR 4947 CPC 1376 = FRR 4946 FRR 3318 = CPC 1377 dH16062 = DAOM 208453= WUC 29 WUC 64 ATCC 76482 = G.J.S. 74-59 WUC 94 ATCC 56428 CDC B-5680 = CBS H-20115 …. dH 11474 dH 16818 dH 17407 dH 17406 ATCC 56280 = CDC 82-030890 dH 12939 dH 11589 dH 12335 = IHM 1733 … dH 11524, CDC B-5887 ATCC 52853; IMI 298056 IFM 4701 = UAMH 5022 dH 15886 dH20423 dH 15656 CBS 115144 114772 112222 112793 603,96 609,96 618,96 …. 834.96 (T) 123977 109797 119710 120419 120418 147.84 (T) 118724 102228 109630 306.94 (T) 102461 556,83 987,96 444,62 125191 269.64 (T) Isolate and Genbank numbers species information for the strains investigated. Cladophialophora potulentorum Cladophialophora potulentorum Cladophialophora potulentorum Cladophialophora australiensis Capronia pilosella capronia pulcherrima Capronia acutiseta Capronia acutiseta Cladophialophora immunda Cladophialophora immunda Cladophialophora immunda Cladophialophora devriesii Cladophialophora devriesii Cladophialophora devriesii Cladophialophora devriesii Cladophialophora saturnica Cladophialophora saturnica Cladophialophora saturnica Cladophialophora arxii Cladophialophora arxii Cladophialophora minourae Cladophialophora minourae Fonsecaea nubica Fonsecaea nubica Fonsecaea nubica Name Table 1.

48 Fonsecaea multimorphosa sp. nov Brazil unknown USA? USA USA USA South Africa Canada Netherlands USA Barbados USA South Africa South Africa Belgium Thailand Brazil USA South America UK USA Brazil Africa USA Geography South America Brazil Cat … Human Human Human Human Human Dog Cat Dog Human Human Dog Human Human Human Cat Human Human Human Human Human Human Host Human Human Chapter 4 Decaying wood Subcutaneous lesion Ulcer of left hand Brain abscess Brain abscess liver Brain abscess Brain abscess lesion on leg Brain abscess Skin infection Brain abscess Brain Subcutaneous lesion Brain abscess Liver Disseminated infection Skin lesion in cat Chromoblastomycosis Brain abscess Brain abscess Brain abscess Brain abscess Brain abscess Source Chromoblastomycosis Chromoblastomycosis EU103995, EU140584 AY857518, EU140582 EU103996, EU140583 EU103989, U140585 EU103993, EU140587 EU103994, EU140591 EU103992, U140592 AY366906, …, EU938547 AB240949, …, EU938553 EU938584, …, EU938552 EU938582, …, EU938548 AB240948, …, EU938551 Gene Bank ITS, TEF1a, BT2 AY366914, …, EU938559 AY366918, …, EU938562 dH 11585 dH 13029 = UTHSC 03-70 dH16329 dH 11918 = CDC B-5420 ATCC 10958= CDC B-1940 J-1872 UAMH 6501= PLM 1951 CDC B-3394 Ajello B-2283b UAMH 3830 ATCC 46715= NIH 4018 W 262 …. CDC B-3393 dH 14515 dH 11331 CDC B-3658 = UAMH 4992 dH 12659 dH 13130, UTHSC R-3486 dH 14523 = Marty 2005226 dH 12978 = dH 15137 dH 15330 = UTHSC 04-2904 Other references dH 15659 dH11610 = FP63I 102225 640.96 (T) … 979,96 102594 173.52(T) 984,96 981,96 328,65 364,8 648,96 564,82 649,96 444,96 155,53 119719 102586 678,79 269.37 (T) 117238 117542 115830 100430 117236 CBS 271.37 (T) 102245

Cladophialophora emmonsii Cladophialophora emmonsii Cladophialophora emmonsii Cladophialophora emmonsii Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Fonsecaea monophora Fonsecaea monophora Fonsecaea monophora Fonsecaea monophora Fonsecaea monophora Fonsecaea monophora Fonsecaea pedrosoi Fonsecaea pedrosoi Fonsecaea monophora Name Table 1. (continued)

49 Chapter 4 Geography unknown Venezuela Japan Australia Brazil Brazil Brazil Brazil Brazil Brazil unknown unknown Host Human Human Human Cat Environment Environment Environment Environment Environment Environment unknown unknown Brain abscess Chromoblastomycosis Disseminated Brain abscess Soil cover Wood Decaying trunk Decaying vegetable Babassu coconut Source Grevillia robusta, wood unknown unknown Gene Bank ITS, TEF1a, BT2 EU938595 FJ385276 EU137293, EU137235, EU137176 Other references ATCC 24928 dH 14476 IFM 4819 UAMH 7249 dH 11604 dH 11584 dH 11597 dH 11587 dH 11618 dH 20510 dH 18906 dH 15898 CBS 100429 117890 645,96 980.96 (T) 102240 102224 102235 102226 102253 126716 122637 454,82 Cladophialophora bantiana Cladophialophora bantiana Cladophialophora bantiana Fonsecaea multimorphosa Fonsecaea multimorphosa Fonsecaea multimorphosa Fonsecaea multimorphosa Fonsecaea multimorphosa Fonsecaea multimorphosa Fonsecaea multimorphosa Cladophialophora mycetomatis Cladophialophora mycetomatis Name Table 1.(continued) Abbreviations: ATCC = American Type Culture Collection, Netherlands; dH = Manassas, G.S. de Hoog working collection, Utrecht, The Netherlands; U.S.A.; CDC = Centers for Disease Control and Prevention, CBS Atlanta, U.S.A.; UAMH = The University = Centraalbureau voor Schimmelcultures of Alberta Microfungus Collection and Herbarium, Edmonton, Canada; UTHSC = The University of Texas Health Science Center collection, U.S.A.; IFM = Research Center Fungal Biodiversity Centre, Utrecht, The for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan. T = ex-type culture.

50 Fonsecaea multimorphosa sp. nov

DNA amplification and sequencing Three gene regions were chosen for the phylogenetic analysis, i.e. rDNA internal transcribed spacers (ITS), partial translation elongation factor 1-α (TEF1) and partial β-tubulin (BT2). ITS amplicons were generated with primers V9G and LS266 and were sequenced with primers ITS1 and ITS4 (de Hoog & Gerrits van den Ende 1998; Masclaux et al. 1995). TEF1 amplification and sequencing was done with EF-728F and EF1-986R (Carbone & Kohn 1999), BT2 amplification and sequencing with BT2a and BT2b (Glass & Donaldson 1995). PCR was performed in a 25 μl volume reaction mixture with 7 μl Go Taq master mix

(Promega) containing dNTPs, MgCl2, reaction buffer, 1 μl of each primer (10 pmol) and 1 μl DNA. Amplification was performed in an ABI PRISM 2720 (Applied Biosystems, Foster City, U.S.A.) thermocycler as follows: 95°C for 4 min, followed by 35 cycles consisting of 95°C for 45 sec, 52°C for 30 sec and 72°C for 2 min, with a delay at 72°C for 7 min. The annealing temperature was changed to 58°C for BT2. Amplicons were subjected to direct sequencing, Chapter with PCR regimen as follows: 95°C for 1 min followed by 30 cycles consisting of 95°C for 10 sec, 50°C for 5 sec and 60°C for 2 min. Reactions were purified with Sephadex G-50 fine 4 (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). Sequencing was done using ABI PRISM BigDyeTM terminator cycle sequencing kit (Applied Biosystems) and amplicons were analyzed on an ABI PRISM 3730XL Sequencer.

Alignment and phylogenetic reconstruction Sequences were edited using SeqMan in the Lasergene software (DNASTAR, Wisconsin, U.S.A.). Iterative alignment was performed automatically with manual adjustment in Bionumerics v. 4.61 (Applied Maths, Kortrijk, Belgium). A phylogenetic approach was used to investigate relationships between 61 strains of Cladophialophora and Fonsecaea, with Cladophialophora mycetomatis as outgroup. The genes ITS, BT2 and TEF1 were first analyzed separately. Conflicts were estimated using the partition homogeneity test available in PAUP* v. 4.Ob10 (Swofford 2003). Trees were constructed using the Maximum Likelihood implemented in RAxML version 7.0.4 with 100 bootstrap replicates and edited with MEGA 4 software (Tamura et al. 2007). Bootstrap values equal to or greater than 70% were considered significant (Hillis 1993). Alignments are available upon request.

Antifungal susceptibility testing Minimal inhibitory concentrations (MICs) and minimum effective concentrations (MECs) for the cerebral and environmental isolates of the unknown species towards nine antifungal agents were determined according to Clinical and Laboratory Standards Institute guidelines M38-A2. Methods for sporulation and preparation of suspensions were according to Najafzadeh et al. (2010a). Amphotericin B (Bristol-Myers-Squib, Woerden, The Netherlands), fluconazole (Pfizer Central Research, Sandwich, U.K.), itraconazole (Janssen Research Foundation, Beerse, Belgium), voriconazole (Pfizer), posaconazole (Schering- Plough, Kenilworth, U.S.A.), isavuconazole (Basilea Pharmaceutica, Basel, Switzerland), caspofungin (Merck Sharp & Dohme, Haarlem, The Netherlands), micafungin (Astellas

51 Chapter 4

Pharma) and terbinafin (Novartis Pharmaceuticals) were obtained as reagent-grade powders from their respective manufacturers. Antifungal agents were dissolved as prescribed by the CLSI; stock solutions of the experimental triazole isavuconazole were prepared in DMSO. Antimycotics were diluted in RPMI 1640 medium (GIBCO BRL, Life Technologies, Woerden, The Netherlands) buffered to pH 7.0 with 0.165 M morpholinepropanesulfonic acid (MOPS) (Sigma-Aldrich, Steinheim, Germany) and dispensed into 96-well microdilution trays at the following concentration ranges: amphotericin B, itraconazole, voriconazole, posaconazole, isavuconazole: 0.016−16 μg/ml; terbinafin 0.004−4 μg/ml; fluconazole: 0.063−64 μg/ml; caspofungin, micafungin: 0.008−8 μg/ml. Microdilution trays were stored at −80°C prior to use. Conidial suspensions in physiological saline containing Tween 20 (0.05%) were adjusted spectrophotometrically (530 nm) to optical densities in the range between 0.15−0.17, then diluted 1:50 in buffered RPMI 1640 medium; final inoculum suspensions contained 0.5 × 104 4 × 104 CFU/ml, as verified by colony counts on Sabouraud´s glucose agar (SGA). Microtiter plates inoculated with the fungus under study were incubated at 25°C. After 96−192 h the plates were examined visually and MICs and MECs determined. Candida parapsilosis (ATCC 22019), Candida krusei (ATCC 6258) and Paecilomyces variotii (ATCC 22319) were used for quality controls.

Results Histological appearance of the brain lesion of the cat was characterized by massive hyphal invasion, inflammatory cells, reactive neuroglial cells and liquefactive necrosis (Shinwari et al. 1985). In a section stained by haematoxylin and eosin (HE) the fungus appeared with septate hyphae, sparsely branched at almost right angles, with thick dark brown to olive walls. Some budding yeast like cells with occasional hyphal extensions were also evident. Examination of potassium hydroxide mounts from the lesion revealed brownish hyphae. In culture the fungus exhibited yellow-brown, septate and freely branched conidiophores bearing long chains of yellow-brown, ovoidal to ellipsoidal conidia. PCR amplification of SSU rDNA yielded products of about 1700 bp with strains CBS 980.96 and CBS 102240. Using an SSU data set available at CBS, strain CBS 980.96 was located close to Fonsecaea pedrosoi, F. monophora, F. nubica, Cladophialophora bantiana, C. arxii, C. saturnica, C. emmonsii, C. minourae and C. eucalypti, though with low bootstrap support (data not shown). The majority of the species mentioned above have been reported from disorders in human and animals, with the exception of C. minourae and C. eucalypti which are strictly environmental. The Fonsecaea / Cladophialophora group was analyzed in detail with ITS, and a selection was studied with ITS, TEF1 and BT2. The rDNA ITS region was sequenced for 7 strains of the species under study, and 56 related strains in Cladophialophora and Fonsecaea as well as two Capronia isolates (Fig. 1). Trees were constructed using maximum likelihood implemented in RAxML v. 7.0.4, using GAMMA model of rate heterogeneity and GTR substitution matrix. Empirical base frequencies were pi(A): 0.223180, pi(C): 0.284699, pi(G): 0.241841, pi(T): 0.250280). A clade consisting of strains CBS 980.96, CBS 126716, 102253, 102226, 102235,

52 Fonsecaea multimorphosa sp. nov Chapter 4

Fig. 1. Consensus tree of Fonsecaea multimorphosa and allied black fungi based on Internal Transcribed Spacer (ITS) ribosomal DNA of 63 strains, constructed using Maximum Parsimony Implemented in RAxML version 7.0.4 with 100 bootstrap replicates and edited with Mega 4 software (values > 70 are shown at the branches in bold). Cladophialophora mycetomatis was selected as outgroup.

53 Chapter 4

102224 and 102240 was well supported (99% bootstrap). Topologies of the trees generated with all three genes (ITS, BT2 and TEF1) were concordant. Result of Partition Homogeneity Test (PHT = 0.97) did not detect conflict between loci, and therefore three genes were combined to investigate species delimitation using PSR (Fig. 2). In RAxML v. 7.0.4 the GAMMA model of rate heterogeneity and GTR substitution matrix were used. Empirical base frequencies: pi(A): 0.232609, pi(C): 0.282307, pi(G): 0.231842, pi(T): 0.253242). The clade with seven strains above was supported with 96% bootstrap, but showed significant internal heterogeneity (Fig. 2). Cardinal temperatures of CBS 980.96 showed optimal development at 33ºC and a maximum at 40ºC (Fig. 3). The environmental strains had an optimum at 30°C and reached a maximum at 36ºC (Fig. 3). Growth velocity at 30°C of CBS 980.96 was significantly slower than environmental strains: 0.7 and 1.5 mm/day , respectively.

Fonsecaea multimorphosa Najafzadeh, Vicente, Sun, Meis & de Hoog, sp. nov. Figs 4 and 5. Mycobank MB 519043.

Coloniae in agaro tuberosum lente crescentes, velutinae, olivaceae vel griseo-brunneae; reversum olivaceo-nigrum et pigmentum brunneum exudens. Cellulae zymoideae adsunt. Conidium (1) sympodialiter producta, brunnea, ellipsoidea 1.9−2.5 × 3.0−5.2 µm, cellulae conidiogenae denticulatae. (2) Conidiorum catenae, conidia plerumque limoniforma vel fusiforma. (3) Chlamydospora globosa lateralia praesens. Temperatura maxima crescentiae 40°C. Teleomorphe ignota. Holotypus CBS-H 20464. Etymology: the name refers to the occurrence of synanamorphs in the ex-type strain. Description of CBS 980.96 after 3 week incubation on MEA and PDA at 25°C. Colonies restricted, compact, circular, olivaceous to brownish grey, velvety. Reverse olivaceous black. A brownish pigment is exuded into the agar. Conidium production of various types: (1) Sympodial conidiophores mainly on PDA, conidia produced apically or intercalarily on short rachids or in small clusters on small denticles with dark scars; conidia broadly ellipsoidal 1.9−2.5 × 3.0−5.2 µm, liberating reluctantly. (2) Long, branched chains of fusiform conidia mainly on MEA; conidia lemon-shaped to fusiform. (3) Chlamydospore-like cells sometimes present on both media. Cardinal temperatures: optimum 33°C, scant growth at 40°C. Holotype: dried culture in herbarium CBS-H 20464; ex-type strain CBS 980.96, isolated from brain of a cat, Australia, 1985 (Shinwari et al. 1985). MICs range for the strains of F. multimorphosa (n = 7) towards nine antifungal drugs surveyed were as follows: amphotericin B 0.25−1 μg/ml, fluconazole 16−64 μg/ml, itraconazole 0.016−0.063 μg/ml, posaconazole 0.016−0.031 μg/ml, isavuconazole 0.016−0.5 μg/ml, voriconazole 0.063−0.250 μg/ml, caspofungin 0.031−1 μg/ml, micafungin 0.008−0.125 μg/ ml, terbinafin 0.125−0.5 μg/ml. Posaconazole and itraconazole were the most active drugs, followed by micafungin, isavuconazole, voriconazole and amphotericin B.

54 Fonsecaea multimorphosa sp. nov Chapter 4

Fig. 2. Maximum Likelihood tree based on the combined data of ITS and partial BT2 and TEF1 genes of 63 members of Fonsecaea multimorphosa and allied black fungi with RAxML version 7.0.4 with 100 bootstrap replicates and edited with Mega 4 software (values > 70 are shown at the branches in bold). Cladophialophora mycetomatis was selected as outgroup.

55 Chapter 4

Fig. 3. Colony diameters at various temperatures with 3ºC increments ranging from 9-36 ºC in addition 37 ºC and 40 ºC, measured after 3 weeks on 2% MEA were calculated for Fonsecaea multimorphosa from cat (CBS 980.96) (rhomboid) and Fonsecaea multimorphosa from environment (CBS 102240, CBS 102224, CBS 102235, CBS 102253 and CBS126716) (rectangular).

Discussion In the present study we document a new species of Fonsecaea isolated from the left occipital lobe of the cerebrum of an 18-month-old Australian spayed female cat that showed circling and incoordination. The etiologic agent had originally been identified as ‘Cladosporium bantianum´ by morphology. However, the voucher strain CBS 980.96 showed 12% ITS difference with type strain of C. bantiana, CBS 173.52 and thus clearly belongs to another taxon. On the basis of morphology and sequences the strain did not match with any known species. Several strains similar to CBS 980.96 had been recovered from the natural environment in Brazil by a selective isolation method using mineral oil. Locations of isolation were chosen on the basis of known records of chromoblastomycosis in the state of Paraná in Brazil (Vicente et al. 2008). The set of environmental strains showed slight deviation from CBS 980.96 in ITS, BT2 and TEF1 genes (Fig. 2). The clinical vs. environmental strains were also different in growth velocity. The neurotropic strain CBS 980.96 grew consistently slower on all media, and had a different profile of cardinal temperatures, being able to grow at 37oC and 40oC (Fig. 3). However, further subdivision of the clade comprising environmental and veterinary strains was not statistically supported. Differences in growth velocities an thermotolerance between isolates may be the result of prolonged stress of the veterinary strain living under non-optimal conditions. Variable expression of synanamorphs is a common feature in Chaetothyriales (e.g. de Hoog et al. 1994). For these reasons the environmental strains were preliminarily treated as being conspecific with CBS 980.96. Fonsecaea multimorphosa thus

56 Fonsecaea multimorphosa sp. nov Chapter 4

Fig. 4. Macroscopic and microscopic morphology of Fonsecaea multimorphosa, ex-type strain CBS 980.96. a. Culture on MEA; b, c. Cladophialophora synanamorph and chlamydospores; d, e, l. Cladophialophora synanamorph; f−j, m. Fonsecaea synanamorph. Scale bar = 10 μm.

57 Chapter 4

Fig. 5. Line drawing of microscopic morphology of Fonsecaea multimorphosa, ex-type strain CBS 980.96, slide cultures on MEA and PDA after 14 days.

58 Fonsecaea multimorphosa sp. nov should be regarded as an environmental, opportunistic species. The infected cat received corticosteroid therapy after an arthroplastic surgery. Although a large share patients with primary cerebral phaeohyphomycosis are otherwise healthy individuals (Li & de Hoog 2009), the present cat´s chronic immunosuppression may have enhanced the infection. Infection in hosts where the body temperature is close to the maximum growth temperature of the etiologic agent is not uncommon in Chaetothyriales (e.g., Surash et al. 2005). The fungi treated in this paper have melanin in their cell walls. Although little is known about the pathogenic mechanism of these fungi, especially in immunocompetent hosts, the production of melanin is regarded to be a virulence factor (e.g. Ajello et al. 1974; Taborda et al. 2008). Melanins are pigments of high molecular weight formed by oxidative polymerization of phenolic compounds. Fungal melanins are supposed to function in virulence by protecting fungal cells against antimicrobial oxidants, by impairing the development of cell-mediated Chapter responses and by interfering with complement activation. They may also reduce susceptibility to antifungal agents (Badali et al. 2008; Jacobson 2000). Jacobson (2000) showed that 4 laboratory-derived strains of Cryptococcus neoformans that lacked melanin had markedly reduced virulence in a mouse model of infection. Another putative virulence factor is thermotolerance. Cladophialophora species have different maximum growth temperatures and particularly species that cause systemic infection are able to grow at 40oC (de Hoog et al. 2000). In the present study the clinical strain of F. multimorphosa had an optimum development at 33oC and was still able to growth at 40oC, but environmental strains did not grow at 40oC. The number of isolates available is too limited to describe the specific borderline with certainty. The results of MIC testing was almost identical for clinical and environmental strains. Although melanized agents of central nervous system infections are susceptible to most antifungal agents in vitro, treatment is difficult because frequent relapses are observed (Revankar et al. 2004). The diagnosis of systemic mycosis of the brain is difficult because cerebral masses are usually thought to be neoplasms or abscesses of bacterial etiology. Hyphal elements should be visualized in biopsy specimens (Li & de Hoog 2009). Interpretation of colony and microscopic morphology is insufficient for specific identification, but reliable species identification in black fungi is generally achieved by sequencing the ITS region (Zeng et al. 2007). Recently loop-assisted isothermal amplification (LAMP) (Sun et al. 2009) and rolling circle amplification (RCA) (Najafzadeh et al. 2011) were introduced for rapid and specific identification of Fonsecaea species. These techniques could be extended to this present Fonsecaea species.

Acknowledgements The work of Mohammad Javad Najafzadeh was financially supported by the Ministry of Health and Medical Education of Iran and the Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran.

59 Chapter 4

Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.

References Abramo F, Bastelli F, Nardoni S, Mancianti F, 2002. Feline cutaneous phaeohyphomycosis due to Cladophialophora bantiana. J Feline Med Surg 4: 157‒163. Ajello L, Georg LK, Steigbigel RT, Wang CJ, 1974. A case of phaeohyphomycosis caused by a new species of Phialophora. Mycologia 66: 490‒498. Al-Abdely HM, Najvar L, Bocanegra R, Fothergill A, Loebenberg D, Rinaldi MG, Graybill JR, 2000. SCH 56592, amphotericin B, or itraconazole therapy of experimental murine cerebral phaeohyphomycosis due to Ramichloridium obovoideum (“Ramichloridium mackenziei”). Antimicrob Agents Chemother 44: 1159‒1162. Anor S, Sturges BK, Lafranco L, Jang SS, Higgins RJ, Koblik PD, LeCouteur RA, 2001. Systemic phaeohyphomycosis (Cladophialophora bantiana) in a dog -- clinical diagnosis with stereotactic computed tomographic-guided brain biopsy. J Vet Intern Med 15: 257‒261. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits Gerrits van den Ende AHGG, de Hoog GS, 2008. Biodiversity of the genus Cladophialophora. Stud Mycol 61: 175‒191. Blalock HG, Georg LK, Derieux WT, 1973. Encephalitis in turkey poults due to Dactylaria (Diplorhinotrichum) gallopava ‒ a case report and its experimental reproduction. Avian Dis 17: 197‒204. Bouljihad M, Lindeman CJ, Hayden DW, 2002. Pyogranulomatous meningoencephalitis associated with dematiaceous fungal (Cladophialophora bantiana) infection in a domestic cat. J Vet Diagn Invest 14: 70‒72. Campbell CK Al-Hedaithy S, 1993. Phaeohyphomycosis of the brain caused by Ramichloridium mackenziei sp nov in Middle Eastern countries. J Med Vet Mycol 31: 325‒332. Carbone I, Kohn LM, 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553‒556. de Hoog GS, Gerrits Gerrits van den Ende AHGG, 1998. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41: 183‒189. Dixon DM, Shadomy HJ, Shadomy S, 1980. Dematiaceous fungal pathogens isolated from nature. Mycopathologia 70: 153-161. Dixon DM, Walsh TJ, Merz WG, McGinnis MR, 1989. Infections due to Xylohypha bantiana (Cladosporium trichoides). Rev Infect Dis 11: 515‒525. Elies L, Balandraud V, Boulouha L, Crespeau F, Guillot J, 2003. Fatal systemic phaeohyphomycosis in a cat due to Cladophialophora bantiana. J Vet Med A Physiol Pathol Clin Med 50: 50‒53. Fondati A, Gallo MG, Romano E, Fondevila D, 2001. A case of feline phaeohyphomycosis due to Fonsecaea pedrosoi. Vet Dermatol 12: 297‒301. de Hoog GS, Guarro J, Gené J, Figueras MJ, 2000. Atlas of clinical fungi, 2nd edn ed. Centraalbureau voor Schimmelcultures, Utrecht / Universitat Rovira i Virgili, Reus. Giri DK, Sims WP, Sura R, Cooper JJ, Gavrilov BK, Mansell JE, 2010. Cerebral and renal phaeohyphomycosis in a dog infected with Bipolaris species. Vet Pathol, inpress. Glass NL, Donaldson GC, 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61: 1323‒1330. Hillis DM Bull JJ, 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. System Biol 42: 182‒192. Horré R de Hoog GS, 1999. Primary cerebral infections by melanized fungi: a review. Stud Mycol 43: 176-193. Jacobson ES, 2000. Pathogenic roles for fungal melanins. Clin Microbiol Rev 13: 708‒717. Koo S, Klompas M, Marty FM, 2010. Fonsecaea monophora cerebral phaeohyphomycosis: case report of successful surgical excision and voriconazole treatment and review. Med Mycol 48: 769-774. Li DM, de Hoog GS, 2009. Cerebral phaeohyphomycosis ‒ a cure at what lengths? Lancet Infect Dis 9: 376‒383. Maeda H, Shibuya H, Yamaguchi Y, Miyoshi T, Irie M, Sato T, 2008. Feline digital phaeohyphomycosis due to Exophiala jeanselmei. J Vet Med Sci 70: 1395‒1397. Mariani CL, Platt SR, Scase TJ, Howerth EW, Chrisman CL, Clemmons RM, 2002. Cerebral phaeohyphomycosis caused by Cladosporium spp. in two domestic shorthair cats. J Am Anim Hosp Assoc 38: 225‒230. Masclaux F, Guého E, de Hoog GS, Christen R, 1995. Phylogenetic relationships of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J Med Vet Mycol 33: 327-338. Najafzadeh MJ, Badali H, Illnait-Zaragozi MT, de Hoog GS, Meis JF, 2010a. In vitro activities of eight antifungal drugs against 55 clinical isolates of Fonsecaea spp. Antimicrob Agents Chemother 54: 1636‒1638.

60 Fonsecaea multimorphosa sp. nov

Najafzadeh MJ, Gueidan C, Badali H, Gerits Gerrits van den Ende AHGG, Xi L, de Hoog GS, 2009. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 47: 17‒25. Najafzadeh MJ, Sun J, Vicente VA, de Hoog GS, 2011. Rapid identification of fungal pathogens by rolling circle amplification (RCA) using Fonsecaea as a model.Mycoses, in press. Najafzadeh MJ, Rezusta A, Cameo MI, Zubiri ML, Yus MC, Badali H, Revillo MJ, de Hoog GS, 2010b. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol 48: 390‒393. Najafzadeh MJ, Sun J, Vicente VA, Xi L, Gerrits Gerrits van den Ende AHGG, de Hoog GS, 2010b. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med Mycol 48: 800‒806. Revankar SG, Patterson JE, Sutton DA, Pullen R, Rinaldi MG, 2002. Disseminated phaeohyphomycosis: review of an emerging mycosis. Clin Infect Dis 34: 467‒476. Revankar SG, Sutton DA, Rinaldi MG, 2004. Primary central nervous system phaeohyphomycosis: a review of 101 cases. Clin Infect Dis 38: 206‒216. Shinwari MW, Thomas AD, Orr JS, 1985. Feline cerebral phaeohyphomycosis associated with Cladosporium bantianum. Aust Vet J 62: 383‒384. Shoham S, Pic-Aluas L, Taylor J, Cortez K, Rinaldi MG, Shea Y, Walsh TJ, 2008. Transplant-associated Ochroconis gallopava infections. Transpl Infect Dis 10: 442‒448. Singh K, Flood J, Welsh RD, Wyckoff JH, Snider TA, Sutton DA, 2006. Fatal systemic phaeohyphomycosis caused by

Ochroconis gallopavum in a dog (Canis familaris). Vet Pathol 43: 988‒992. Chapter Sun J, Najafzadeh MJ, Vicente VA, Xi L, de Hoog GS, 2009. Rapid detection of pathogenic fungi using loop-mediated

isothermal amplification, exemplified by Fonsecaea agents of chromoblastomycosis. J Microbiol Methods 80: 4 19‒24. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP, 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 43: 465‒472. Sutton DA, Slifkin M, Yakulis R, Rinaldi MG, 1998. U.S. case report of cerebral phaeohyphomycosis caused by Ramichloridium obovoideum (R. mackenziei): criteria for identification, therapy, and review of other known dematiaceous neurotropic taxa. J Clin Microbiol 36: 708‒715. Swofford D, 2003. PAUP*. Phylogenetic Analysis using parsimony. Sinauer Associates. Takei H, Goodman JC, Powell SZ, 2007. Cerebral phaeohyphomycosis caused by Cladophialophora bantiana and Fonsecaea monophora: report of three cases. Clin Neuropathol 26: 21‒27. Tamura K, Dudley J, Nei M, Kumar S, 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596‒1599. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, de Hoog GS, Zhao J, Pizzirani- Kleiner A, 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 61: 137‒144. Wong JS, Schousboe MI, Metcalf SS, Endre ZH, Hegarty JM, Maze MJ, Keith ER, Seaward LM, Podmore RG, 2010. Ochroconis gallopava peritonitis in a cardiac transplant patient on continuous ambulatory peritoneal dialysis. Transpl Infect Dis, 21(5):455-8. Zeng JS, Sutton DA, Fothergill AW, Rinaldi MG, Harrak MJ, de Hoog GS, 2007. Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol 45: 3713-3720.

61 62 Chapter 5

Molecular epidemiology of Fonsecaea species

M. J. Najafzadeh1,2,3, J. Sun4, V. A. Vicente5, C. H. W. Klaassen6, A. Bonifaz7, A. H. G. Gerrits van den Ende1, S. B. J. Menken2, & G. S. de Hoog1,2,8

1CBS–KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands, 3Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4Department of Dermatology, The Second Affiliated Hospital, Sun Yat–Sen University, Guangzhou, Guangdong, China, 5Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil, 6Canisius Wilhelmina Hospital, Nijmegen, the Netherlands, 7Hospital General de México, Narvarte, Mexico and 8Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China

Published in: Emerg Infect Dis, 2011 mar;17(3): 464-9

63 Chapter 5

Abstract To assess population diversities among 81 strains of fungi in the genus Fonsecaea that had been identified down to species level, we applied amplified fragmentlength polymorphism (AFLP) technology and sequenced the internal transcribed spacer regions and the partial cell division cycle, β-tubulin, and actin genes. Many species of the genus Fonsecaea cause human chromoblastomycosis. Strains originated from a global sampling of clinical and environmental sources in the Western Hemisphere, Asia, Africa, and Europe. According to AFLP fingerprinting, Fonsecaea isolates clustered in 5 groups corresponding with F. pedrosoi, F. monophora, and F. nubica: the latter 2 species each comprised 2 groups, and F. pedrosoi appeared to be of monophyletic origin. F. pedrosoi was found nearly exclusively in Central and South America. F. monophora and F. nubica were distributed worldwide, but both showed substantial geographic structuring. Clinical cases outside areas where Fonsecaea is endemic were probably distributed by human migration.

Keywords: Chromoblastomycosis, Fonsecaea, AFLP.

Introduction The genus Fonsecaea comprises etiologic fungal agents of human chromoblastomycosis (1–3), a chronic cutaneous and subcutaneous infection characterized by slowly expanding nodules that eventually lead to emerging, cauliflower-like, mutilating and disfiguring eruptions. Infection proceeds with muriform cells in tissue provoking a granulomatous immune response. In areas where it is endemic, disease incidence is high. Yegres et al. (4) and Yëgues-Rodriguez et al. (5) noted a frequency of 16 cases/1,000 population under arid climatic conditions in rural communities of Venezuela; chromoblastomycosis in that region is caused mainly by Cladophialophora carrionii. In contrast, Fonsecaea spp. are prevalent in humid tropical climates. Esterre et al. (6) reported 1,343 cases of chromoblastomycosis from Madagascar, 61.8% of which were caused by Fonsecaea spp. Kombila et al.(7) reported 64 cases in Gabon (equatorial Africa), all caused by Fonsecaea spp., and Silva et al. (8) cited 325 cases in the Amazon region of Brazil, 98% of which had Fonsecaea spp. as the etiologic agent. In Sri Lanka, 94% of 71 chromoblastomycosis cases were caused by Fonsecaea spp. (9). Fonsecaea contains anamorphic ascomycetes belonging to the family Herpotrichiellaceae (order Chaetothyriales), which includes black yeasts and relatives (10–12). The genus comprises 3 sibling species: F. pedrosoi, F. monophora, and F. nubica, each of which has pathogenic potential (10,13,14). Infection process and routes of dispersal are insufficiently clarified. Humans presumably acquire the infection after being pricked by contaminated thorns or wood splinters, but some agents are substantially more clinically prevalent than their predominantly (hitherto unnamed) environmental counterparts (15), which indicates that infection is not a random process. In many published case reports, etiologic agents were referred to as Phialophora pedrosoi or identified with the obsolete name F. compacta, now known to be a mutant F. pedrosoi (9,13,16). Strains are no longer accessible for molecular verification. Hence, no data are available on the epidemiology of the species as defined by

64 Molecular Epidemiology of Fonsecaea Species sequence data. Phylogenetically, Fonsecaea spp. agents of chromoblastomycosis are flanked by nonpathogenic species (10) growing on plant debris. Discovery of natural habitat and source of infection by entities emerging on the human host is essential for understanding the evolution of pathogenicity. We present an amplified fragment-length polymorphism (AFLP) DNA fingerprinting study of a worldwide collection of clinical isolates that were identified as Fonsecaea spp. by state-of-the-art sequencing methods, supplemented with environmental isolates of the same species. The AFLP technique is a powerful method for discrimination between fungal species and for providing high-resolution fingerprinting data within species (17–19).

Materials and methods

Fungal strains and culture conditions We studied 81 isolates representing the 3 currently recognized Fonsecaea spp. Geographic origins and hosts of the strains are listed in Table 1; the set include reference strains from the Centraalbureau voor Schimmelcultures (CBS-KNAW Fungal Biodiversity Centre, Utrecht, Chapter the Netherlands) and fresh isolates from patients and from the environment. Stock cultures 5 were maintained on slants of 2% malt extract agar and oatmeal agar at 24°C.

DNA extraction and identification Approximately 1 cm2 of 14- to 21-day-old cultures were transferred to 2 mL Eppendorf tubes containing 400 μL TEx buffer (Sigma-Aldrich, Zwijndrecht, the Netherlands), pH 9.0 (100 mmol Tris, 40 mmol Na-EDTA) and glass beads (Sigma G9143, Sigma-Aldrich). The fungal material was homogenized with a MoBio vortex (Bohemia, New York, USA) for 1 min. Subsequently, 120 μL of a 10% sodium dodecyl sulfate solution and 10 μL proteinase K (10 mg/mL, Sigma-Aldrich) were added and incubated for 30 min at 55°C; the mixture was vortexed for 3 min. After addition of 120 μL of 5M NaCl and 1/10 vol 10% cetyltrimethylammonium bromide solution (Sigma-Aldrich), the material was incubated for 60 min at 55°C. Then the mixture was vortexed for 3 min. Subsequently, 700 μL SEVAG (24:1, chloroform: isoamyl alcohol) was added, mixed carefully, and centrifuged for 5 min at 4°C at 20,400 × g. The supernatant was transferred to a new Eppendorf tube with 225

μL 5M NH4 acetate (Sigma-Aldrich), mixed carefully by inverting, incubated for 30 min on ice water, and centrifuged again for 5 min at 4°C at 20,400 × g. The supernatant was then transferred to another Eppendorf tube with 0.55 vol isopropanol and centrifuged for 5 min at 20,400 × g. Finally, the pellet was washed with 1 mL ice cold 70% ethanol. After drying at room temperature, it was resuspended in 48.5 μL TE buffer (Sigma-Aldrich) (Tris 0.12% wt/vol, Na-EDTA 0.04% wt/vol) and 1.5 μL of RNase (Sigma-Aldrich) and incubated in 37°C for 20–30 min. Quality of genomic DNA was verified on agarose gel. Species were identified on the basis of internal transcribed spacer (ITS), partial cell division cycle (cdc42), β-tubulin (BT2), and ACT sequences (10–14).

65 Chapter 5

correspondedTable 1. Fonsecaea with spp.species isolates borderlines used for establishedamplified fragment-length recently by Najafzadeh polymorphism et al. analyses (10,14) on Name CBS number Other reference(s) Origin Host Location Pop

F. nubica CBS 121733 dH 18411, SUMS Chromoblastomycosis Human, male China, 1 0011 Guangdong

F. nubica CBS 125199 dH 20427 Chromoblastomycosis Human, China, 1 female Guangdong

F. nubica CBS 125186 dH 20429 Chromoblastomycosis Human, male China, 1 Guangdong

F. nubica CBS 125200 dH 20425 Chromoblastomycosis Human, male China, 1 Guangdong

F. nubica CBS 121720 dH 18398, SUMS Chromoblastomycosis Human, male China, 1 0251 Guangdong

F. nubica CBS 125198 dH 20418 Chromoblastomycosis Human, male China, 1 Guangdong

F. nubica CBS 121734 dH 18412, SUMS Chromoblastomycosis Human, male China, 1 0255 Guangdong

F. nubica CBS 271.33 dH 15659, ATCC Chromoblastomycosis Human, male South 2 18658, IMI 134458 America

F. nubica CBS 557.76 ATCC 28174 Unknown Unknown Unknown 2

F. nubica CBS 270.37 dH 15657 Unknown Unknown France 2

F. nubica CBS 277.29 dH 15668 Chromoblastomycosis Human, male Brazil 2

F. monophora CBS 102243 dH 11607 Chromoblastomycosis Human, male Brazil, Parana, 3 Ibituva

F. monophora CBS 117236 dH 15330, UTHSC Brain Human, male USA 3 04-2904

F. monophora CBS 102246 dH 11611 Chromoblastomycosis Human, male Brazil, Parana, 3 Campo Largo

F. monophora CBS 102242 dH 11606 Chromoblastomycosis Human, male Brazil, 3 Sta Cat., Curitibanos

F. monophora CSB 102225 dH 11585 Decaying wood Plant Brazil, Parana, 3 Colombo

F. monophora CSB 269.37 dH 12659 Chromoblastomycosis Human South 3 America

F. monophora CSB 102238 dH 11602 Soil Soil Brazil, Parana, 3 Tibagi River

F. monophora CBS 117237 dH 15331, UTHSC Chromoblastomycosis Human, male USA 3 04-2631

F. monophora CBS 102229 dH 11590 Decaying vegetable Plant Brazil, Parana, 3 cover Piraquara

F. monophora CBS 397.48 dH 15828, ATCC Chromoblastomycosis Human, male South 3 9475 America

F. monophora CBS 115830 dH 12978 Brain Human, male Brazil 3

F. monophora CBS125189 dH 20421 Chromoblastomycosis Human, male China, Haikou 3

F. monophora CBS 100430 ATCC 32280 Brain Human, male Africa 3

F. monophora CBS 123849 dH 20215 Chromoblastomycosis Human, Africa, Guinea 3 female

F. monophora CBS 102248 dH 11613 Chromoblastomycosis Human, male Brazil, Parana, 3 Piraquara

F. monophora CBS 121725 dH 18403, SUMS Chromoblastomycosis Human, male China, 4 0250 Guangdong

F. monophora CBS 121728 dH 18406, SUMS Chromoblastomycosis Human, male China, 4 0158 Guangdong

F. monophora CBS 121726 dH 18404, SUMS Chromoblastomycosis Human, male China, 4 0192 Guangdong

66 Molecular Epidemiology of Fonsecaea Species

Table 1. (continued) Name CBS number Other reference(s) Origin Host Location Pop

F. monophora CBS 121727 dH 18405, SUMS Chromoblastomycosis Human, male China, 4 0190 Guangdong

F. monophora CBS 121721 dH 18399, SUMS Chromoblastomycosis Human, male China, 4 0246 Guangdong

F. monophora CBS 125193 dH 20426 Chromoblastomycosis Human, male China, 4 Guangdong

F. monophora CBS 125195 dH 20417 Chromoblastomycosis Human, male China, 4 Guangdong

F. monophora CBS 125196 dH 20419 Chromoblastomycosis Human, male China, 4 Guangdong

F. monophora CBS 125197 dH 20420 Chromoblastomycosis Human, male China, 4 Guangdong

F. monophora CBS 121732 dH 18410, SUMS Chromoblastomycosis Human, male China, 4 0012 Guangdong

F. monophora CBS 125190 dH 20422 Chromoblastomycosis Human, male China, 4 Guangdong

F. monophora CBS 125192 dH 20424 Chromoblastomycosis Human, male China, 4 Guangdong

F. monophora CBS 117238 dH 13130, UTHSC Brain Human U.K 4 R-3486

F. monophora CBS 121731 dH 18409, SUMS Chromoblastomycosis Human, male China, 4

0013 Guangdong Chapter

F. monophora CBS 121730 dH 18408, SUMS Chromoblastomycosis Human, male China, 4 0014 Guangdong 5

F. monophora CBS 121722 dH 18400, SUMS Chromoblastomycosis Human, male China, 4 0247 Guangdong

F. monophora CBS 122742 dH 19251, SUMS Chromoblastomycosis Human China, 4 0147 Shandong

F. monophora CBS 121724 dH 18402, SUMS Chromoblastomycosis Human, male China, 4 0200 Guangdong

F. pedrosoi CBS 273.66 dH 15663 Mouse passage Soil Venezuela 5

F. pedrosoi CBS 271.37 dH 15659, ATCC Chromoblastomycosis Human, male South 5 18658, IMI 134458 America

F. pedrosoi CBS 671.66 dH 16159 Mouse passage Soil Venezuela 5

F. pedrosoi CBS 274.66 dH 15665 Mouse passage Soil Venezuela 5

F. pedrosoi CBS 102245 dH 11610 Chromoblastomycosis Human, male Brazil, Parana, 5 Ampere

F. pedrosoi CBS 659.76 dH 16142, ATCC Chromoblastomycosis Human, male Argentina 5 28303

F. pedrosoi CBS 102247 dH 11612 Chromoblastomycosis Human, male Brazil, Parana 5

F. pedrosoi CBS 122740 dH 18430, Bonifaz Chromoblastomycosis Human, male Mexico, 5 002200 Mexico City

F. pedrosoi CBS 122737 dH 18896 Chromoblastomycosis Human, male Mexico, 5a Mexico City

F. pedrosoi CBS 122735 dH 18898 Chromoblastomycosis Human, male Mexico, 5a Mexico City

F. pedrosoi CBS 122736 dH 18897 Chromoblastomycosis Human, male Mexico, 5a Mexico City

F. pedrosoi CBS 122739 dH 18894 Chromoblastomycosis Human, male Mexico, 5a Mexico City

F. pedrosoi CBS 122732 dH 18901 Chromoblastomycosis Human, male Mexico, 5 Mexico City

F. pedrosoi CSB 122733 dH 18900 Chromoblastomycosis Human, male Mexico, 5 Mexico City

67 Chapter 5

Table 1. (continued) Name CBS number Other reference(s) Origin Host Location Pop

F. pedrosoi CBS 122849 dH 18902 Chromoblastomycosis Human, male Mexico, 5b Mexico City

F. pedrosoi CBS 122738 dH 18895 Chromoblastomycosis Human, male Mexico, 5b Mexico City

F. pedrosoi CBS 122731 dH 18903 Chromoblastomycosis Human, male Mexico, 5b Mexico City

F. pedrosoi CBS 122734 dH 18899 Chromoblastomycosis Human, male Mexico, 5b Mexico City

F. pedrosoi CBS 102244 dH 11608 Chromoblastomycosis Human, male Brazil, Parana, 5 Ipora

F. pedrosoi CBS 122729 dH 18905 Chromoblastomycosis Human, male Mexico, 5 Mexico City

F. pedrosoi CBS 122730 dH 18904 Chromoblastomycosis Human, male Mexico, 5 Mexico City

F. pedrosoi CBS 285.47 dH 15680, ATCC Chromoblastomycosis Human, male Puerto Rico 5 10222

F. pedrosoi CBS 342.34 dH 15773 Chromoblastomycosis Human, male Puerto Rico 5

F. pedrosoi CBS 670.66 dH 16157 Mouse passage Soil Venezuela 5

F. pedrosoi CBS 122741 dH 18431, Bonifaz Chromoblastomycosis Human, male Mexico, 5 02300 Mexico City

F. pedrosoi CBS 122729 dH 18905 Chromoblastomycosis Human Mexico, 5 Mexico City

F. pedrosoi CBS 212.77 dH 15549 Chromoblastomycosis Human, male Netherlands, 5 Amsterdam

F. pedrosoi CBS 117910 dH 14477 Chromoblastomycosis Human, male Venezuela, 5 Coro, Falcón State

F. pedrosoi CBS 272.37 dH 15661 Chromoblastomycosis Human Brazil 5

F. pedrosoi CBS 122345 dH 18914, Bonifaz Chromoblastomycosis Human, male Mexico, 5c 121-06 Mexico City

F. pedrosoi CBS 122343 dH 18916, Bonifaz Chromoblastomycosis Human, male Mexico, 5c 122-07 Mexico City

F. pedrosoi CBS 122341 dH 18918, Bonifaz Chromoblastomycosis Human, male Mexico, 5c 345-07 Mexico City

F. pedrosoi CBS 122349 dH 18910, Bonifaz Chromoblastomycosis Human, male Mexico, 5c 234-04 Mexico City

F. pedrosoi CBS 122347 dH 18912, Bonifaz Chromoblastomycosis Human, male Mexico, 5c 0257-05 Mexico City

F. pedrosoi CBS 122346 dH 18913, Bonifaz Chromoblastomycosis Human, male Mexico, 5c 333-05 Mexico City

F. pedrosoi CBS 253.49 dH 15620 Chromoblastomycosis Human Uruguay, 5 Montevideo

F. pedrosoi CBS 201.31 dH 15523 Gazelle, ear Animal Libya, 5 Cyrenaica, Derna

*ATCC, American Type Culture Collection, Manassas, VA, USA; CBS, Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands; dH, G.S. de Hoog working collection; SUMS, Sun Yat-Sen University Medical Science, Guangzhou, People´s Republic of China; IMI, International Mycological Institute, London, UK; UTHSC, Fungus Testing Laboratory, Department of Pathology, University of Texas Health Science Center at San Antonio, San Antonio, TX, USA

68 Molecular Epidemiology of Fonsecaea Species

AFLP fingerprinting We followed a protocol provided by the manufacturer (Applied Biosystems, Nieuwerkerk aan de IJssel, the Netherlands), with some minor modifications (20–23). Analyses were performed with 100–200 ng DNA.

Restriction and ligation of adaptors Two μL of DNA (100 ng/μL) was added to 9 μL restriction and ligation mixture (1.1 μL T4 DNA ligase buffer [Applied Biosystems]), 1.1 μL M NaCl, 2 U MseI endonuclease, 10 U EcoRI endonuclease (New England Biolabs, Ipswich, UK), 30 U T4 DNA ligase, 1 μL MseI-adaptor,

1 μL EcoRI-adaptor, and 3 μL dH20 and incubated at 37°C for 2.5 h. Subsequently, each restriction/ligation reaction was diluted ≈3× by adding 25 μL demineralized water.

Preselective and selective PCR In preselective PCR, 2 μL of diluted restriction/ligation product was added to 7.5 μL of AFLP core mix (Applied Biosystems), 0.25 μL of the EcoRI core sequence (5´- GAC TGC GTA CCA ATTC-3´), and 0.25 μL of the MseI core sequence (5´-GAT GAG TCC TGA GTAA-3´). The mixture was amplified in an iCycler (Bio-Rad, Hercules, CA, USA) under the following conditions: 2 min at 72°C, followed by 20 cycles of 20 s at 94°C, 30 s at 56°C, and 2 min at Chapter 5 72°C. Each preselective PCR was diluted 2× by adding 10 μL of dH2O. In selective PCR, 1.5 μL of diluted preselective PCR products was mixed with 8.5 selective PCR mix containing 0.5 μL EcoRI-AC (labeled with FAM [6-carboxy fluorescein]), 0.5 μL MseI-A, and 7.5 μL AFLP core mix (Applied Biosystems). The selective PCR conditions were cycling for 2 min at 94°C, followed by 10 cycles of 20 s at 94°C and 30 s at 66°C (decreasing 1°C with each subsequent cycle), and a final extension of 2 min at 72°C. This sequence was followed by 25 cycles of 20 s at 94°C, 30 s at 56°C, and 2 min at 72°C, and a final incubation of 30 min at 60°C.

AFLP analysis FAM-labeled products were prepared for analysis in an ABI PRISM 377 Genetic Analyzer (Applied Biosystems) as follows: the selective PCR products were cleaned with Sephadex G-50, and selective PCR products were mixed with LIZ 500 in the new plate by several times pipetting (first by preparing master mix [8.7 μL demineralized water plus 0.3 μL Liz 500], then mixing this with 1.0 μL of selective PCR product by pipetting). The total volume was adjusted to 10 μL with dH2O. Denaturation was done at 95°C for 5 min, and then the reaction was snap-cooled on ice water. The LIZ 500 internal size standard in each sample was used for normalization of the fingerprint pattern according to the instruction manual. The densitometric curves were analyzed with BioNumerics software package (version 4.61, Applied Maths, Kortrijk, Belgium), by using the cosine similarity coefficient and the unweighted pair group method with arithmetic means cluster analysis. Statistical reliability of the cluster was investigated by using a cophenetic value, which calculates the correlation between the calculated and the dendrogram-derived similarity. Subdivisions in clusters were checked visually if they were supported by the banding patterns.

69 Chapter 5

Results Profiles of 81 strains were generated with the EcoRI AC + MseI-A PCR adaptors. Fingerprints contained ≈60–70 bands in a 50–500-bp range. Another selective PCR with EcoRI core sequence+C and MseI core sequence+A primer combination used elsewhere in related fungi (24) resulted in nonscorable fingerprints because of amplification of too many or only faint bands. Dendrograms derived from the AFLP banding patterns of Fonsecaea spp. were generated by using the unweighted pair group method with arithmetic means cluster analysis (Fig. 1). At ≥62.5% similarity, 3 main clusters were found that matched with existing species on the basis of multilocus sequence analysis (ITS, cdc42, BT2, and ACT1), i.e., F. pedrosoi, F. monophora, and F. nubica. At an automatic cutoff value option set at <62.5% similarity, the F. monophora and F. nubica clusters were subdivided in 2 evident groups each, leading to a total of 5 clusters (1–5) interpreted as populations. Clusters 1 and 2 matched with F. nubica, clusters 3 and 4 with F. monophora, and cluster 5 with F. pedrosoi. Individual bands varied within the profiles, but further subclustering was limited, e.g., in a slightly deviating derived subclade in population 5. The groups defined above by AFLP analysis are interpreted as populations (1–5) in the text below. In population 5, some strains were nearly 100% identical, e.g., CBS 122341, 122343, 122345, and 122349, all originating from patients with chromoblastomycosis in Mexico City, Mexico (Fig. 1). We determined the geographic distributions of the 5 main populations of Fonsecaea strains (Fig. 2). Areas endemic for Fonsecaea, judging from the literature, are in tropical and subtropical climate zones. Population 1 comprised a cluster of F. nubica strains originating from humans with chromoblastomycosis in Guangdong, People´s Republic of China. Population 2 of the same species comprised 4 strains, 2 of which originated from humans with chromoblastomycosis in South America, 1 from France, and 1 with unknown origin. The profiles were too different to trace to any clonal identity. Population 3 (F. monophora) comprised 15 strains, most of which were isolated from humans with chromoblastomycosis in South America; 1 originated from the United States, and 1 originated from Haikou in southern China. Two strains were isolated from decaying plants in Brazil, and the second US strain was derived from a human with a brain infection. Two other strains from human brain infections in Brazil and in Africa had unique profiles that could not be unambiguously linked to any other isolate. Another African strain, from a patient with chromoblastomycosis who lived in Spain and had acquired the infection 36 years earlier in Guinea (25), also had a unique profile. Population 4 of F. monophora comprised 16 strains from Guangdong in southern China, and 1 came from Shandong, ≈1,850 km distant. All had derived from humans with chromoblastomycosis. A single sample originated from a patient with a brain infection who lived in the United Kingdom (26); whether the patient had visited southern China could not be established. In population 5 (F. pedrosoi), most strains originated from chromoblastomycosis patients in Central and South America. Some geographic clustering was visible, i.e., the derived group of strains from South America (uppermost clade of population 5 Fig.1) was segregated from those from Central America. Several of the strains from South American originated from soil

70 Molecular Epidemiology of Fonsecaea Species Chapter 5

Fig. 1. Clustering of amplifi ed fragment-length polymorphism banding pattern of isolates of Fonsecaea spp. analyzed by using unweighted pair group method with arithmetic means. Bars indicate clonal dispersal. Clusters 1 and 2 are F. nubica, clusters 3 and 4 are F. monophora, and cluster 5 is F. pedrosoi.

71 Chapter 5

Fig. 2. Geographic distribution of Fonsecaea spp. samples analyzed by using amplifi ed fragment-length polymorphism. Shading indicates zone of clinical Fonsecaea spp. endemicity, according to published case reports. Sizes of pies and numbers reported within the pies denote the number of strains examined; colors represent Fonsecaea spp. populations: (a), F. nubica population 1; (b), F. nubica population 2; (c), F. monophora population 3; (d), F. monophora population 4; (e), F. pedrosoi population 5. and were isolated through mouse passage. One strain from an ear of a gazelle in Libya and 1 from a human with chromoblastomycosis in the Netherlands could not directly be linked to any other strain.

Discussion AFLP typing is comparable to use of other DNA markers, such as random amplified polymorphic DNA, restriction fragment-length polymorphism, or microsatellites, in terms of time and cost efficiency, reproducibility, and resolution (27). The technique has emerged as a major epidemiologic tool with broad application in ecology, population genetics, pathotyping, DNA fingerprinting, and quantitative trait loci mapping (28). AFLP fingerprinting is useful for the molecular characterization of microorganisms with relatively large genomes, including various fungal species (18,19,21–23,29,30). In a preliminary experiment that used different primer combinations, the combination EcoRI-AC + MseI-A adaptors gave excellent results, yielding readable profiles with well-separated bands. The degree of variation in Fonsecaea appeared to differ between species. The major 5 clusters were separated at <62.5% similarity, with significant differences in the presence of major fragments, several of which were unique to individual isolates or subpopulations. Populations 1 and 2, 3 and 4, and 5

72 Molecular Epidemiology of Fonsecaea Species the basis of multilocus sequencing with ITS, cdc42, BT2, and ACT1. Population 5 (F. pedrosoi) varied least at >71.7% similarity, with limited reproducible substructure being discernable. Nearly all isolates of this species originated from South and Central America (Venezuela, Brazil, Mexico, Argentina, Puerto Rico, and Uruguay). One isolate from a human with chromoblastomycosis in the Netherlands was likely to have been imported (13). One isolate from a gazelle ear in Libya, northern Africa, was the only geographic exception that could not be explained. Clusters of strains that could be grouped as being visually identical and with similarities >71.7% (Fig. 1, Table 1) were mostly collected at close geographic distance from each other. This finding suggests that vectors of dispersal for Fonsecaea spp. are slow, leading to detectable regional diversification. The relatively low degree of variation of F. pedrosoi and confinement to Central and South America indicate a founder effect, the species being the most recently emerged taxon in Fonsecaea. F. monophora and F. nubica were distributed worldwide but were geographically diverse in that population 4 of F. monophora was nearly confined to China, with highly similar profiles (Fig. 1). One strain of this population 4, CBS 117238, originated from a brain infection in a human in the United Kingdom; whether this patient had emigrated from China could not be determined from the original publication (25). F. monophora population 3 was found mainly in the Western Hemisphere, particularly Chapter in Brazil. Judging from the near identity of profiles of strains isolated in 1937 (CBS 271.37) and in 1999 (CBS 102245) (Fig. 1), we can conclude that clones are maintained locally over 5 decades. The 2 US strains presumably derived from immigrants from South America or Central America. Population 3 was also found in Africa and in Haikou in China, 600 km from Guangdong, where population 4 of F. monophora is prevalent. Strains of F. nubica show a similar bipartition over Asia and the Western Hemisphere, with a prevalently Chinese (population 1) and a prevalently Brazilian (population 2) population, and a presumed infected immigrant in France. Kawasaki et al. (31,32) provided similar data on the basis of restriction fragmentlength polymorphism of mitochondrial DNA, showing that Fonsecaea spp. from Japan and China iffered consistently from isolates from Central and South America. Nearly all Fonsecaea spp. isolates available in culture collections originate from mammals, mostly humans with chromoblastomycosis, and were rarely recovered from the environment of symptomatic patients despite several attempts (33). Occasionally, F. pedrosoi was isolated from mice that were euthanized for isolation of black yeasts after they had been inoculated with environmental samples (34). This information suggests that Fonsecaea spp., particularly F. pedrosoi, have a competitive advantage by using this enrichment source. Mouse passage proved to be more efficient for environmental isolation of etiologic agents of chromoblastomycosis than general methods such as oil flotation (35). The latter technique mostly isolates other environmental Fonsecaea spp. that are not known to be pathogenic to humans (33). In humans with chromoblastomycosis, the male:female ratio of patients is 63:2. This male preponderance of 97% cannot be explained by different exposition rates. Distinct male preponderance is also noted in the neurotropic relative, Cladophialophora bantiana (G.S. de Hoog, unpub. data). Population 3 of F. monophora has a wider clinical

73 Chapter 5

spectrum than the remaining groups, comprising, in addition to chromoblastomycosis, several isolates from human brain infection. This population also comprised some isolates from soil and plant debris acquired without use of mammal baits. Coexistence of closely interrelated entities differing in pathogenicity and virulence seems likely in Fonsecaea spp., as was also suggested for black yeasts (A.H.G. Gerrits van den Ende et al. unpub. data). Our data demonstrate that AFLP fingerprinting is a tool that produces highly reproducible results for molecular epidemiology. The use of AFLP showed that local Fonsecaea agents of chromoblastomycosis seem able to be maintained over 70 years, and therefore epidemiologic profiles take the structure of expanding clones. By locality, patients are infected by only a limited number of genotypes. The fungi disperse slowly, leading to appreciable geographic structuring, which ultimately may lead to allopatric speciation (diversification resulting from geographic barriers). Few environmental strains have been recovered during repeated isolation experiments, whereas Fonsecaea spp. accumulates substantially in the human host. The mechanisms behind their pathology remain unexplained.

Acknowledgments We are grateful to Liyan Xi and Flavio Queiroz-Telles for providing Fonsecaea spp. strains. M.J.N. was supported by the Ministry of Health and Medical Education of Iran and Mashhad University of Medical Sciences, Mashhad, Iran. J.S. was partly supported by International Program of Project 985, Sun Yat-Sen University, China. V.A.V. was supported by Coordenação de Aperfeiçoamento Pessoal de Nivel Superior/Brazil.

References 1. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol. 2009;47:3–15. 2. López Martínez R, Méndez Tovar LJ. Chromoblastomycosis. Clin Dermatol. 2007;25:188–94. 3. Bonifaz A, Carrasco-Gerard E, Saul A. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses. 2001;44:1–7. 4. Yegres FR-YN, Medina-Ruiz E, González-Vivas R. Cromomicosis por Cladosporium carrionii en criadores de caprinos del estado Falcon. Investigación Clinica. 1985;26:235–46. 5. Yegüez-Rodriguez J R-YN, Yegres F, Rodríguez Larralde A. Cromomicosis: susceptibilidad genética en grupos familiares de la zona endémica en Venezuela. Acta Científica Venezuelana 1992;43:98– 102 6. Esterre P, Andriantsimahavandy A, Ramarcel ER, Pecarrere JL. Forty years of chromoblastomycosis in Madagascar: a review. Am J Trop Med Hyg. 1996;55:45–7. 7. Kombila M, Gomez de Diaz M, Richard-Lenoble D, Renders A, Walter P, Billiault X, et al. Chromoblastomycosis in Gabon. Study of 64 cases [in French]. Sante. 1995;5:235–44. 8. Silva JP, de Souza W, Rozental S. Chromoblastomycosis: a retrospective study of 325 cases on Amazonic Region (Brazil). Mycopathologia. 1998–1999;143:171–5. 9. Attapattu MC. Chromoblastomycosis—a clinical and mycological study of 71 cases from Sri Lanka. Mycopathologia. 1997;137:145– 51. 10. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol. 2009;47:17–25. 11. Xi L, Sun J, Lu C, Liu H, Xie Z, Fukushima K, et al. Molecular diversity of Fonsecaea (Chaetothyriales) causing chromoblastomycosis in southern China. Med Mycol. 2009;47:27–33. 12. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits van den Ende AHGG, de Hoog GS. Biodiversity of the genus Cladophialophora. Stud Mycol. 2008;61:175–91. 13. de Hoog GS, Attili-Angelis D, Vicente VA, Gerrits Gerrits van den Ende AHGG, Queiroz-Telles F. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol. 2004;42:405–16.

74 Molecular Epidemiology of Fonsecaea Species

14. Najafzadeh MJ, Sun J, Vicente V, Xi L, Gerrits van den Ende AHG, de Hoog GS. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med Mycol. 2010;48:800–6. 15. de Hoog GS, Nishikaku AS, Fernandez-Zeppenfeldt G, Padin-Gonzalez C, Burger E, Badali H, et al. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol. 2007;58:219–34. 16. Nishimoto K. Chromomycosis in Japan. Ann Soc Belg Med Trop. 1981;61:405–12. 17. Klaassen CHW, Osherov N. Aspergillus strain typing in the genomics era. Stud Mycol. 2007;59:47–51. 18. Borst A, Theelen B, Reinders E, Boekhout T, Fluit AC, Savelkoul PH. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis. J Clin Microbiol. 2003;41:1357–62. 19. Warris A, Klaassen CH, Meis JF, De Ruiter MT, De Valk HA, Abrahamsen TG, et al. Molecular epidemiology of Aspergillus fumigates isolates recovered from water, air, and patients shows two clusters of genetically distinct strains. J Clin Microbiol. 2003;41:4101–6. 20. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, Abeln EC, et al. Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology. 2001;147:891–907. 21. Theelen B, Silvestri M, Gueho E, van Belkum A, Boekhout T. Identification and typing of Malassezia yeasts using amplifi ed fragment length polymorphism (AFLP), random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE). FEM Yeast Res. 2001;1:79–86. 22. Ball LM, Bes MA, Theelen B, Boekhout T, Egeler RM, Kuijper EJ. Significance of amplified fragment length polymorphism in identification and epidemiological examination of Candida species colonization in children undergoing allogeneic stem cell transplantation. J Clin Microbiol. 2004;42:1673–9. 23. Gupta AK, Boekhout T, Theelen B, Summerbell R, Batra R. Identification and typing of Malassezia species by amplifi ed fragment length polymorphism and sequence analyses of the internal transcribed spacer and large- subunit regions of ribosomal DNA. J Clin Microbiol. 2004;42:4253–60.

24. Sudhadham M, de Hoog GS, Menken SBJ, Gerrits Gerrits van den Ende AHGG, Sihanonth P. Elucidation of Chapter distribution patterns and possible infection routes of the neutropic black yeast Exophiala dermatitidis using AFLP. Fungal Biol. 2011. In press. 5 25. Najafzadeh MJ, Rezusta A, Cameo MI, Zubiri ML, Yus MC, Badali H, et al. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol. 2010;48:390–3. 26. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP. Cerebral phaeohyphomycosis caused by Fonsecaea monophora.Med Mycol. 2005;43:465–72. 27. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, et al. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 1995;23:4407–14. 28. Mueller UG, Wolfenbarger LL. AFLP genotyping and fingerprinting. Trends Ecol Evol. 1999;14:389–94. 29. Neyra E, Fonteyne PA, Swinne D, Fauche F, Bustamante B, Nolard N. Epidemiology of human sporotrichosis investigated by amplified fragment length polymorphism. J Clin Microbiol. 2005;43:1348–52. 30. Savelkoul PH, Aarts HJ, de Haas J, Dijkshoorn L, Duim B, Otsen M, et al. Amplified-fragment length polymorphism analysis: the state of an art. J Clin Microbiol. 1999;37:3083–91. 31. Kawasaki M, Aoki M, Ishizaki H, Miyaji M, Nishimura K, Nishimoto K, et al. Molecular epidemiology of Fonsecaea pedrosoi using mitochondrial DNA analysis. Med Mycol. 1999;37:435–40. 32. Kawasaki M. Typing and molecular epidemiology of some black fungi based on analysis of the restriction fragment length polymorphism in the mitochondrial DNA. Jpn J Med Mycol. 1996;37:129– 33. 33. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, et al. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol. 2008;61:137–44. 34. Gezuele E, Mackinnon JE, Conti-Diaz IA. The frequent isolation of Phialophora verrucosa and Phialophora pedrosoi from natural sources. Sabouraudia. 1972;10:266–73. 35. Satow MM, Attili-Angelis D, de Hoog GS, Angelis DF, Vicente VA. Selective factors involved in oil fl otation isolation of black yeasts from the environment. Stud Mycol. 2008;61:157–63.

75 76 Chapter 6

Rapid detection of pathogenic fungi using loop-mediated isothermal amplification, exemplified by Fonsecaea agents of chromoblastomycosis

J. Sun1, M. J. Najafzadeh2, 3, 4, V.A. Vicente5, Liyan Xi1 & G. S. de Hoog1, 2, 6*

1Department of Dermatology, The Second Affiliated Hospital, Sun Yat–Sen University, Guangzhou, China, 2CBS– KNAW Fungal Biodiversity Centre, Utrecht, The Netherland, 3Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands, 4Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 5Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil, 6Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China

Published in: J Microbiol Methods. 2010 Jan; 80(1): 19-24.

77 Chapter 6

Abstract Loop-mediated isothermal amplification (LAMP) was developed for rapid detection of pathogenic or allergenic fungal in the environment. Primers applied were derived from the rDNA Internal Transcribed Spacer and the 5.8S rRNA gene. The assay enabled amplification of target fungi at the level of genus or closely related species using pure cultures after 1 h reaction at 65°C in a water bath. No cross-reactivity to related species was observed. The DNA detection limit was 0.2 fg. The method also proved to work well with fungi on non-sterile adhesive tape. Amplification products were detected by visual inspection using SYBR Green I as well as by electrophoresis on agarose gels. As a model organism we selected Fonsecaea, a fungal genus containing etiologic agents of chromoblastomycosis, a widely distributed tropical and subtropical skin disease in otherwise healthy patients and supposed to be acquired by environmental inoculation. It is suggested that LAMP can also be used for rapid clinical diagnosis, for environmental detection, and for retrospective studies in archived clinical samples.

Key words: Chromoblastomycosis, Fonsecaea, diagnosis, LAMP

Introduction Environmental detection of detrimental fungi is of major significance for understanding a wide diversity of problems related to public health. For example, fungi may contribute to allergic responses of patients due to overabundance of moulds in indoor environments (Beezhold et al. 2008). Locating the source of mycotoxin-producing Stachybotrys species occurring in moist homes is urgent (Kuhn & Ghannoum, 2003). Hygienic questions also arise with dermatophyte contamination of public bathing facilities such as swimming pools (Hilmarsdottir et al. 2005). Preventive measures against fungal opportunists require understanding of routes of infection, for which extensive studies on natural habitats and methods of dispersal are undertaken (Sudhadham et al. 2008). Numerous investigations have been carried out to locate the ecological niche of pathogens such as Cryptococcus gattii (Datta et al. 2009) and Penicillium marneffei (Chariyalertsak et al. 1997). Quite often, the fungi in question grow in culture only with difficulty or are unculturable (Bougoure and Cairney, 2005). In view of these problems, isolation and culturing may be far from optimal (Elliott et al. 2006), for which reason molecular detection is recommended. In the present article, we apply a recently proposed method, loop-mediated isothermal amplification (LAMP), which is rapid and allows only minute amounts of DNA, to detection of a group of pathogenic fungi. The method is demonstrated here using potential agents of a skin disease, chromoblastomycosis, a relatively frequent disorder in (sub) tropical climate zones (Queiroz- Telles et al. 2009). The spectrum of species causing this disease is very limited: in addition to Fonsecaea species, mainly Cladophialophora carrionii (Badali et al. 2008), Phialophora verrucosa (Guerriero et al. 1998), Rhinocladiella aquaspersa (Badali et al. in press) and some scattered cases of Exophiala (Barba- Gomez et al. 1992; De Hoog et al. 2000, Fader and McGinnis,

78 LAMP screening of pathogens

1988; Padhye et al. 1996) are involved. The genus Fonsecaea comprises two sibling species, F. pedrosoi and F. monophora (de Hoog et al. 2004; Najafzadeh et al. 2009a), while recently a third one was proposed (Najafzadeh et al. 2010). Fonsecaea monophora has repeatedly been found, in addition to causing chromoblastomycosis, as an agent of brain infection (Najafzadeh et al. in press-a,b; Surash et al. 2005). Laboratory diagnosis of chromoblastomycosis is based on microscopy of the muriform cells in tissue and skin scrapings. Morphologic characteristics and antigen detection have also been developed for the identification of F. pedrosoi (Carrión and Silva-Hutner, 1971; da Silva et al. 2002; Iwatsu et al. 1982; Vidal et al. 2004), but these methods are time-consuming and have low specificity. Polymerase chain reaction has been developed for rapid detection of several dematiaceous fungi including members of Fonsecaea (Abliz et al. 2003a,b, 2004a; Caligiorne et al. 1999; De Andrade et al. 2007; Karuppayil et al. 1996). The disease is supposed to be acquired by traumatic inoculation of contaminated material into the skin (Rubin et al. 1991). Origins have been supposed to be prickly plant spines such as cactus (Fernández-Zeppenfeldt et al. 1994) or Mimosa (Salgado et al. 2004). However, several authors (de Hoog et al. 2007; Vicente et al. 2008) report that most fungi isolated from nature concern less virulent siblings of the pathogenic species concerned, rather than the pathogens themselves. Detection of the true agents of disease in the environment thus remains overdue. Loop-mediated isothermal amplification (LAMP) was firstly described and initially evaluated for detection of hepatitis B virus DNA by Notomi et al. (2000). This novel nucleic acid mplification method can amplify DNA with high specificity, efficiency and rapidity Chapter under isothermal conditions. The cycling reactions result in the accumulation of 109 to 1010- fold copies of target in less than an hour. The amplification products can be easily detected 6 by visual assessment of turbidity, electrophoresis or by the naked eye. The sensitivity of LAMP appears not to be affected by the presence of non-target DNA in samples, neither by known PCR inhibitors such as blood, serum, plasma, or heparin (Enosawa et al. 2003; Notomi et al. 2000; Poon et al. 2005). For this reason the method is very promising as a tool for environmental detection of microorganisms. LAMP assays have been used for diagnostics of bacteria (Aoi et al. 2006; Iwamoto et al. 2003; Yoshida et al. 2005), virus (Cai et al. 2008; Hagiwara et al. 2007) and parasites (Ikadai et al. 2004; Iseki et al. 2007), but only rarely for fungi (Endo et al. 2004; Inacio et al. 2008; Ohori et al. 2006). In the present study, we developed a sensitive, specific and rapid method for the detection of members of the genus Fonsecaea by LAMP, in the laboratory as well as on non-sterile adhesive tape widely used for environmental screening.

Material and methods

Strains and culture conditions Twelve strains of Fonsecaea pedrosoi, 27 of F.monophora, 8 of F. nubica and 61 reference strains of 36 related melanized fungi (Table 1) were obtained from the reference collection

79 Chapter 6 of the Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre and grown on Malt Extract Agar (MEA) at 25°C for 14 days.

DNA extraction and quality test Approximately 0.5 g mycelium of 14-d-old cultures was transferred to a 2 ml Eppendorf tube containing 400 μl TEx buffer pH 9.0 (100 mM Tris, 40 mM Na-EDTA) and glass beads (Sigma G9143). The fungal material was homogenized with MoBio vortex (Bohemia, New York, U.S.A.) for 1 min. Subsequently 120 μl SDS 10% and 10 μl proteinase K (10 mg/ml) were added and incubated for 30 min at 55°C; the mixture was vortexed for 3 min. After addition of 120 μl of 5 M NaCl and 1/10 vol CTAB 10% (cetyltrimethylammoniumbromide) solution, the material was incubated for 60 min at 55°C. Then the mixture was vortexed for 3 min. Subsequently 700 μl SEVAG (24:1, chloroform:isoamylalcohol) was added, mixed carefully by hand and centrifuged for 5 min at 4°C at 20,400g force value. The supernatant was transferred to a new Eppendorf tube with 225 μl 5 M NH4- acetate, incubated for 30 min on ice water, and spun for 5 min at 4°C at 20,400 g force value. The supernatant was then transferred to another Eppendorf tube with 0.55 vol isopropanol and centrifuged for 5 min at 20,400 g force value. Finally, the pellet was washed with 1000 μl ice cold 70% ethanol. After drying at room temperature, it was re-suspended in 48.5 μl TE buffer (Tris 0.12% w/v, Na- EDTA 0.04% w/v). The DNA concentration was detected with nano-drop DNA concentration detector at 260 nm (Thermo Scientific, U.S.A.). Identities of strains were verified by ITS sequencing as described (Najafzadeh et al. 2009a, in press-a) using the database validated by type-material, followed by BLAST analysis in GenBank (www.blast.ncbi.nlm.nih.gov). Seven- day-old colonies of F. monophora CBS 269.37, F. pedrosoi CBS 271.37, F. nubica CBS 121733 and Exophiala dermatitidis CBS 537.73 were used for in situ fungal detection. About 1 cm2 non-sterile adhesive tape was used to collect minute amounts of fungal cells. The colony was gently touched with adhesive tape, and then the tape was transferred into a 2 ml Eppendorf tube containing 300 μl TES buffer to extract DNA, procedures were identical to those of DNA extraction from pure cultures. To test the presence of trace DNA, the internally transcribed spacer (ITS) region of samples was amplified by nested PCR with primer V9G and LS266 in the first run, while primers ITS1 and ITS4 were used in the second run. Amplification conditions were described previously (Najafzadeh et al. 2009a).

Primer design and LAMP reaction For primer design, the Internally Transcribed Spacer and 5.8S rDNA gene of 39 species were aligned using Bionumerics software v. 4.6 (Applied Maths, Kortrijk, Belgium). One set of LAMP primers was selected for F. pedrosoi CBS 271.37 using PrimerExplorer v. 4 (http:// primerexplorer.jp), as follows: forward outer primer (F3): 5´ACATTGCGCCCTTTGGTAT3´, reverse outer (B3): 5´GCACCCTTCATCCGATACG3´, forward inner primer (FIP): 5´CAACACCAAGCACAGGGGCTTTTTCGAAGGGCATGCCTGTTC3´, reverse inner primer (BIP): 5´TGGTGGAGCGAGTTCACACTTTTTTTAAAGAAGCTCAGTGTACCGG3´. LAMP was performed in a 25 μl reaction volume containing 0.25 μM each of F3 and B3, 1.0 μM each of

80 LAMP screening of pathogens

FIP and BIP, 1.0 mM dNTPs, 1 M betaine (Sigma, U.S.A.), 20 mM Tris–HCl (pH 8.8), 10 mM

KCl, 10 mM (NH4)2SO4, 4 mM MgSO4, 0.1% Triton X-100, 8 U of the Bst DNA polymerase large fragment (New England Biolabs, U.S.A.), and 2 μl crude DNA extract as template. The reaction mixture except Bst DNA polymerase was denatured at 95°C for 5 min and cooled on ice, then 1 μl Bst DNA polymerase was added and incubated at 65°C for 60 min, and finally heated at 85°C for 2 min to terminate the reaction.

Sensitivity and specificity assay DNAs of 12 F. pedrosoi, 27 F. monophora, 8 F. nubica and 61 reference strains were used as templates; DNA of F. pedrosoi CBS 271.37 and a reaction mixture without DNA were used as controls. Sensitivity was tested by a 10-fold DNA dilution series of CBS 271.37 from 2 ng to 0.002 fg with conditions identical to those of the specificity assay. To evaluate the inhibition of non-target DNA, each of the 2 μl crude extract DNA of F. pedrosoi was added to the LAMP negative samples, and tested again by LAMP.

Observation of LAMP products The LAMP reaction products were detected by adding 2.0 μl of 10-fold diluted original SYBR Green I (Cambrex Bio Science Workingham, U.K.) to the reaction tube separately. Change of the solution color was observed directly by naked eye or using a UV transilluminator. Amplified products were also analyzed by electrophoresis on 1% agarose gels, followed by ethidium bromide staining and photography. Smart DNA ladder (Eurogentec, Seraing,

Belgium) was used as a molecular weight standard. Chapter 6 Results The LAMP assay could be performed within 1 h at 65°C in a water bath. LAMP products were visualized directly by the naked eye or under UV trans-illumination after adding SYBR Green I dye, positive reactions showing bright green fluorescence, while a negative reaction remained light orange (Fig. 1). Prior to the addition of SYBR Green I, white turbidity of the reaction mixture by magnesium pyrophosphate (by-product of LAMP) was also observed (data not shown). The products of LAMP reaction could also be detected by electrophoresis on 1% agarose gels, and showed ladder-like patterns (Fig. 2). Positive results were obtained with F. pedrosoi (lane 1), F. monophora (lane 2) and F. nubica (lane 3), while all reactions with fungi included for comparison (Table 1) remained negative, with a response identical to the negative control. The specificity assay thus showed that positive amplification is obtained with the genus Fonsecaea but not in any other member of Chaetothyriales (black yeasts and relatives) (Table 1). The detection limit was found to be 0.2 fg (Fig. 3). The inhibition test showed that all LAMP-negative samples turned positive after the addition of 2 μl crude DNA solution of F. pedrosoi or F. monophora, LAMP reaction was not inhibited by other fungal DNA. To evaluate the potential application of this LAMP assay in screening possible pathogens in environmental samples, minute amounts of fungal cells were adhered to non-sterile adhesive tape by gently pressing a fungal colony; subsequently the DNA was extracted successfully.

81 Chapter 6

Fig 1. Visual appearance of LAMP reactions from isolates after addition of SYBR Green I. Panel A: Fonsecaea pedrosoi (tube 1), F. monophora (tube 2), F. nubica (tube 3), negative control (tube 4) and tube without DNA templates (tube 5). Panel B: under UV transillumination, F. pedrosoi (tube 6), F. monophora tube 7), F. nubica (tube 8), negative control (tube 9) and tube without DNA templates (tube 10). Table 1. Isolates used in this study with resultsof ITS amplification and LAMP test Species CBS Number ITS- LAMP Species CBS Number ITS- LAMP PCR PCR

F. pedrosoi CBS122741 + + CBS 121724 + +

CBS 122740 + + CBS 121725 + +

CBS 671.66 + + CBS 121726 + +

CBS 274.66 + + CBS 121727 + +

CBS 273.66 + + CBS 121728 + +

CBS 253.49 + + CBS 121729 + +

CBS 212.77 + + CBS 121730 + +

CBS 102247 + + CBS 121731 + +

CBS 102245 + + CBS 121732 + +

CBS 201.31 + + CBS 117236 + +

CBS 670.66 + + CBS 102229 + +

CBS 271.37b(T) + + F. nubica CBS121733(T) + +

F. monophora CBS 102238 + + CBS121734 + +

CBS 102242 + + CBS121720 + +

CBS 102246 + + CBS444.62 + +

CBS 102248 + + CBS269.64 + +

CBS 117238 + + CBS277.29 + +

CBS 269.37(T) + + CBS117910 + +

CBS 289.93 + + CBS271.33 + +

CBS 397.48 + + Cladophialophora CBS117900 + - carrionii CBS 117542 + + CBS160.54 + - CBS 117237 + + CBS 160.82 (T) + - CBS 122742 + + CBS101252 + - CBS 122845 + + C. bantiana CBS100429 + - CBS 123849 + + CBS328.65 + - CBS 121721 + + CBS444.96 + - CBS 121722 + + CBS173.52 (T) + - CBS 121723 + +

82 LAMP screening of pathogens

Table 1.(continued) Species CBS Number ITS- LAMP Species CBS Number ITS- LAMP PCR PCR

C. emmonsii CBS678.79 + - CBS 292.49 + -

CBS 979.96 (T) + - CBS 100341 + -

C. minourae CBS556.83 (T) + - CBS 709.95 + -

C. mycetomatis CBS454.82 + - E. moniliae CBS 520.76 + -

CBS122637(T) + - E. alcalophila CBS 520.82 + -

C. yegresii CBS114405 + - E .leacnii-comi CBS 232.39 + -

CBS 114406 + - E. prototropha CBS 534.94 + -

C. satumica CBS 114326 + - Capronia moravica CBS 602.96 + -

CBS 109628 + - CBS 552.79 + -

C. immuda CBS 834.96 (T) + - Cap. coronata CBS 617.96 + -

CBS 110551 + - Cap.epimyces CBS 606.96 + -

CBS 102227 + - Cap. munkii CBS 615.96 + -

Exophiala pisciphila CBS 661.76 + - Cap. acutisela CBS 618.96 + -

CBS 537.73 + - Cap. villosa CBS 616.96 + -

CBS 660.76 + - Cap.fungicola CBS 614.96 + -

E .spinifera CBS 899.68 + - Cap .pulcherrima CBS 609.96 + -

CBS 668.76 + - Cap.dactylotricha CBS 604.96 + -

CBS 101538 + - Rhinocladiella CBS 650.93(T) + - mackenziei E. jeanselmei CBS 507.90(T) + - Phaeococcomyces CBS 650.76 + - E. heteromorpha CBS 579.76 + - catenats E. castellanii CBS 525.76 + -

Phialophora CBS 840.69(T) + - Chapter americana CBS 526.76 + -

CBS 102233 + - 6 E. nigra CBS 546.82 + - CBS 273.37 + - E . oligosperma CBS 725.88(T) + - P. verrucosa CBS 102234 + - E . salmonis CBS 587.66 + - CBS 839.69 + - E . dopicola CBS 537.94 + - Exophiala CBS 131.88 + - E . dermatitidis CBS 207.35 + - phaeomuriformis CBS 120440 + - Positive ITS-PCR was used as criterion for DNA quality of the sample. Abbreviations used: CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; T, ex-type strain.

This direct trace DNA test on in situ environmental samples showed that the fungal DNA from members of the genus Fonsecaea could be detected by nested PCR but not by direct PCR (Table 2). The LAMP in situ Fonsecaea assay remained negative for Exophiala dermatitis.

Discussion LAMP is a powerful innovative gene amplification technique emerging as a simple and rapid diagnostic tool for early detection and identification of microbial agents of disease. The echnique was firstly described and initially evaluated for detection of hepatitis B virus DNA by Notomi et al. (2000) and depends on the Bst DNA polymerase performing autocycling strand displacement DNA synthesis. A set of four or six specific primers recognize six or

83 Chapter 6

Table 2. Results of detection of minute amounts of fungal DNA in non-sterile adhesive tape samples by nested-PCR and LAMP. Species Strain Nested-PCR LAMP

First run Second run

F. monophora CBS 269.37 (T) - + +

F. pedrosoi CBS 271.37 (T) - + +

F . nubica CBS 121733 (T) - + +

E. dermatidis CBS 537.73 (T) - + -

Abbreviation used: CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; T, ex-type strain. eight distinct sequences of the target DNA. The cycling reactions result in billions of copies of target gene within an hour at isothermal conditions. With recent improvements (Boehme et al. 2007) and combination with hybridization (Nagamine et al. 2002), ELISA (Lee et al. 2009) and rolling circle amplification (Marciniak et al. 2008) the value of the method as a potential technique for the detection minute quantities of DNA and protein has increased. We used the fungal genus Fonsecaea as a set of model organisms, because it is relatively homogeneous in its ecological and clinical preferences and taxonomically well-demarcated containing three species only. Cladistic analysis of the genes coding for small-subunit rRNA (SSU rDNA) supported a close relationship of Fonsecaea with other dematiaceous hyphomycetes of the order Chaetothyriales in the form-genera Exophiala, Phialophora, and Rhinocladiella (Spatafora et al. 1995). Sequence analysis of total-SSU and of the D1/D2 domains of LSU ribosomal DNA showed that between some of the close relatives of black yeast-like fungi the diversity may be extremely small: as few as 0 changes were detected between species of Fonsecaea, some Exophiala species, and Cladophialophora bantiana, while two mutations were observed with P. verrucosa (Abliz et al. 2004b). SSU and LSU obviously are insufficiently variable for the identification of pathogenic melanized fungi and relevant species in sequencing analysis. Zeng & de Hoog (2008) demonstrated that in melanized pathogens the rDNA ITS region is much more useful as a specific marker. This domain has been used to identify anamorphs of Chaetothyriales including the genus Fonsecaea (Abliz et al. 2003b; Chen et al. 2001; da Silva et al. 2002; de Andrade et al. 2007; Iwen et al. 2002;

Fig 2. Agarose gel electrophoresis of LAMP products from tested strains obtained after application of the primer set designed in this work. Left to right: lane “M” Smart DNA marker; lane 1, negative control without DNA; lane 2, F. pedrosoi; lane 3, F. monophora; lane 4, F. nubica; lanes 5–40, Cladophialophora carrionii, C. bantiana, C. emmonsii, C. minourae, C. mycetomatis, C. yegresii, C. satumica, C. immuda, Exophiala pisciphila, E. spinifera, E. jeanselmei, E. heteromorpha, E. castellanii, E. nigra, E. oligosperma, E. salmonis, E. dopicola, E. dermatitidis, E. moniliae, E. alcalophila, E. lecanii-corni, E. prototropha, Capronia moravica, Cap. coronata, Cap. epimyces, Cap. munkii, Cap. acutisela, Cap. villosa, Cap. fungicola, Cap. pulcherrima, Cap. dactylotricha, Rhinocladiella mackenziei, Phaeococcomyces catenatus, Phialophora americana, P. verrucosa, Exophiala phaeomuriformis.

84 LAMP screening of pathogens

Fig 3. Analytical sensitivity of LAMP for detection of the ITS rDNA gene. Left to right: Lane “M”, Smart DNA ladder; lanes 1–10, 2 ng, 200 pg, 20 pg, 2 pg, 200 fg, 20 fg, 2 fg, 0.2 fg, 0.02 fg, 0.002 fg/tube, respectively.

Najafzadeh et al. 2009a). In this study, we proved that the LAMP technique successfully amplified DNA of the genus Fonsecaea but not of related fungi, such as C. carrionii, C. bantiana and P. verrucosa. In addition, it was not inhibited by the presence of other fungal DNA. The LAMP assay can be performed within 1 h at 65°C in a water bath, heating block or PCR machine, and the reaction products can easily be observed by electrophoresis or directly by the naked eye. The detection limit was found to be 0.2 fg. Moreover, our results proved that it could be used to detect minute amounts of fungi adhering to adhesive tapes applied to non-sterile surfaces with fungal colonization. Given its specificity, sensitivity, easy handing and cost-efficiency, the LAMP assay is judged to be suitable for a wide range of applications. In this paper it has been used for the detection of Fonsecaea, a pathogenic fungus that due to its simple morphology is difficult to identify by microscopic methods (de Hoog et al. Chapter

2004, Xi et al. 2009). In addition, in retrospective studies LAMP provides an accurate and 6 specific procedure for the detection of the pathogen in archived samples. The limited need for equipment and techniques makes the LAMP assay suitable for diagnosis in a routine clinical laboratory.

Acknowledgements This work was supported by the International Program of Project 985, Sun Yat-Sen University and a Public Health Project Funded by the Ministry of Health of the People´s Republic of China (no. 200802026). EU support to GSdH (contract No. 017626) is gratefully acknowledged.

References Abliz, P., Fukushima, K., Takizawa, K., Miyaji, M., Nishimura, K., 2003a. Specific oligonucleotide primers for identification of Hortaea werneckii, a causative agent of tinea nigra. Diagn. Microbiol. Infect. Dis. 46, 89–93. Abliz, P., Fukushima, K., Takizawa, K., Nieda, N., Miyaji, M., Nishimura, K., 2003b. Rapid identification of the genus Fonsecaea by PCR with specific oligonucleotide primers. J. Clin. Microbiol. 41, 873–876. Abliz, P., Fukushima, K., Takizawa, K., Nishimura, K., 2004a. Specific oligonucleotide primers for identification of Cladophialophora carrionii, a causative agent of chromoblastomycosis. J. Clin. Microbiol. 42, 404–407. Abliz, P., Fukushima, K., Takizawa, K., Nishimura, K., 2004b. Identification of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol. Med. Microbiol. 40, 41–49. Aoi, Y., Hosogai, M., Tsuneda, S., 2006. Real-time quantitative LAMP (loop-mediated isothermal amplification of

85 Chapter 6

DNA) as a simple method for monitoring ammoniaoxidizing bacteria. J. Biotechnol. 125, 484–491. Badali, H., Gueidan, C., Najafzadeh, M.J., Bonifaz, A., Gerrits van den Ende, A.H.G., de Hoog, G.S., 2008. Biodiversity of the genus Cladophialophora. Stud. Mycol. 61, 175–191. Badali, H.B., A. Barrón-Tapia, T. Vázquez-González, D. Estrada-Aguilar, L. de Hoog, G. S., 2010. Rhinocladiella aquaspersa, a proven agent of human chromoblastomycosis and phaeohyphomycosis with novel clinical type. Med.Mycol. (in press) Barba-Gomez, J.F., Mayorga, J., McGinnis, M.R., Gonzalez-Mendoza, A., 1992. Chromoblastomycosis caused by Exophiala spinifera. J. Am. Acad. Dermatol. 26, 367–370. Beezhold, D.H., Green, B.J., Blachere, F.M., Schmechel, D., Weissman, D.N., Velickoff, D.,Hogan, M.B., Wilson, N.W., 2008. Prevalence of allergic sensitization to indoor fungi in West Virginia. Allergy Asthma. Proc. 29, 29–34. Boehme, C.C., Nabeta, P., Henostroza, G., Raqib, R., Rahim, Z., Gerhardt, M., Sanga, E., Hoelscher, M., Notomi, T., Hase, T., Perkins, M.D., 2007. Operational feasibility of using loop-mediated isothermal amplification for diagnosis of pulmonary tuberculosis in microscopy centers of developing countries. J. Clin. Microbiol. 45, 1936–1940. Bougoure, D.S., Cairney, J.W., 2005. Fungi associated with hair roots of Rhododendron lochiae (Ericaceae) in an Australian tropical cloud forest revealed by culturing and culture-independent molecular methods. Environ. Microbiol. 7, 1743–1754. Cai, T., Lou, G., Yang, J., Xu, D., Meng, Z., 2008. Development and evaluation of real-time loop-mediated isothermal amplification for hepatitis B virus DNA quantification: a new tool for HBV management. J. Clin. Virol. 41, 270–276. Caligiorne, R.B., de Resende, M.A., Dias-Neto, E., Oliveira, S.C., Azevedo, V., 1999. Dematiaceous fungal pathogens: analysis of ribosomal DNA gene polymorphism by polymerase chain reaction–restriction fragment length polymorphism. Mycoses. 42, 609–614. Carrión, A.L., Silva-Hutner, M., 1971. Taxonomic criteria for the fungi of chromoblastomycosis with reference to Fonsecaea pedrosoi. Int. J. Dermatol. 10, 35–43. Chariyalertsak, S., Sirisanthana, T., Supparatpinyo, K., Praparattanapan, J., Nelson, K.E., 1997. Case-control study of risk factors for Penicillium marneffei infection in human immunodeficiency virus-infected patients in northern Thailand. Clin. Infect. Dis. 24, 1080–1086. Chen, Y.C., Eisner, J.D., Kattar, M.M., Rassoulian-Barrett, S.L., Lafe, K., Bui, U., Limaye, A.P.,Cookson, B.T., 2001. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J. Clin. Microbiol. 39, 4042–4051. da Silva, J.P., Alviano, D.S., Alviano, C.S., de Souza, W., Travassos, L.R., Diniz, J.A., Rozental, S., 2002. Comparison of Fonsecaea pedrosoi sclerotic cells obtained in vivo and in vitro: ultrastructure and antigenicity. FEMS Immunol. Med. Microbiol. 33, 63–69. Datta, K., Bartlett, K.H., Marr, K.A., 2009. Cryptococcus gattii: emergence in Western North America: exploitation of a novel ecological niche. Interdiscip. Perspect. Infect. Dis. 2009, 176532. De Andrade, T.S., Cury, A.E., de Castro, L.G., Hirata, M.H., Hirata, R.D., 2007. Rapid identification of Fonsecaea by duplex polymerase chain reaction in isolates from patients with chromoblastomycosis. Diagn. Microbiol. Infect. Dis. 57, 267–272. de Hoog, G.S., Queiroz-Telles, F., Haase, G., Fernandez-Zeppenfeldt, G., Attili Angelis, D., Gerrits van den Ende, A.H., Matos, T., Peltroche-Llacsahuanga, H., Pizzirani-Kleiner, A.A., Rainer, J., Richard-Yegres, N., Vicente, V., Yegres, F., 2000. Black fungi: clinical and pathogenic approaches. Med. Mycol. 38 (Suppl 1), 243–250. de Hoog, G.S., Attili-Angelis, D., Vicente, V.A., Gerrits van den Ende, A.H., Queiroz-Telles, F., 2004. Molecular ecology and pathogenic potential of Fonsecaea species. Med. Mycol. 42, 405–416. de Hoog, G.S., Nishikaku, A.S., Fernández-Zeppenfeldt, G., Padin-Gonzalez, C., Burger, E., Badali, H., Richard- Yegres, N., van den Ende, A.H., 2007. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud. Mycol. 58, 219–234. Elliott, S., Sandler, A.D., Meehan, J.J., Lawrence, J.P., 2006. Surgical treatment of a gastric diverticulum in an adolescent. J. Pediatr. Surg. 41, 1467–1469. Endo, S., Komori, T., Ricci, G., Sano, A., Yokoyama, K., Ohori, A., Kamei, K., Franco, M., Miyaji, M., Nishimura, K., 2004. Detection of gp43 of Paracoccidioides brasiliensis by the loop-mediated isothermal amplification (LAMP) method. FEMS Microbiol. Lett. 234, 93–97. Enosawa, M., Kageyama, S., Sawai, K., Watanabe, K., Notomi, T., Onoe, S., Mori, Y., Yokomizo, Y., 2003. Use of loop- mediated isothermal amplification of the IS900 sequence for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis. J. Clin. Microbiol. 41, 4359–4365. Fader, R.C., McGinnis, M.R., 1988. Infections caused by dematiaceous fungi: chromoblastomycosis and phaeohyphomycosis. Infect. Dis. Clin. North. Am. 2, 925–938. Fernández-Zeppenfeldt, G.R.-Y.N., Yegres, F., Hernández, R., 1994. Cladosporium carrionii: hongo dimórfico en cactáceas de la zona endémica para la cromomicosis en Venezuela. Revista Iberoamericana de Micologia 11,

86 LAMP screening of pathogens

61–63. Guerriero, C., De Simone, C., Tulli, A., 1998. A case of chromoblastomycosis due to Phialophora verrucosa responding to treatment with fluconazole. Eur. J. Dermatol. 8, 167–168. Hagiwara, M., Sasaki, H., Matsuo, K., Honda, M., Kawase, M., Nakagawa, H., 2007. Loopmediated isothermal amplification method for detection of human papillomavirus type 6, 11, 16, and 18. J. Med. Virol. 79, 605–615. Hilmarsdottir, I., Haraldsson, H., Sigurdardottir, A., Sigurgeirsson, B., 2005. Dermatophytes in a swimming pool facility: difference in dermatophyte load in men´s and women´s dressing rooms. Acta Derm. Venereol. 85, 267–268. Ikadai, H., Tanaka, H., Shibahara, N., Matsuu, A., Uechi, M., Itoh, N., Oshiro, S., Kudo, N., Igarashi, I., Oyamada, T., 2004. Molecular evidence of infections with Babesia gibsoni parasites in Japan and evaluation of the diagnostic potential of a loopmediated isothermal amplification method. J. Clin. Microbiol. 42, 2465–2469. Inacio, J., Flores, O., Spencer-Martins, I., 2008. Efficient identification of clinically relevant Candida yeast species by use of an assay combining panfungal loopmediated isothermal DNA amplification with hybridization to species-specific oligonucleotide probes. J. Clin. Microbiol. 46, 713–720. Iseki, H., Alhassan, A., Ohta, N., Thekisoe, O.M., Yokoyama, N., Inoue, N., Nambota, A., Yasuda, J., Igarashi, I., 2007. Development of a multiplex loop-mediated isothermal amplification (mLAMP) method for the simultaneous detection of bovine Babesia parasites. J. Microbiol. Methods 71, 281–287. Iwamoto, T., Sonobe, T., Hayashi, K., 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples. J. Clin. Microbiol. 41, 2616–2622. Iwatsu, T., Miyaji, M., Taguchi, H., Okamoto, S., 1982. Evaluation of skin test for chromoblastomycosis using antigens prepared from culture filtrates of Fonsecaea pedrosoi, Phialophora verrucosa, Wangiella dermatitidis and Exophiala jeanselmei. Mycopathologia 77, 59–64. Iwen, P.C., Hinrichs, S.H., Rupp, M.E., 2002. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med. Mycol. 40, 87–109. Karuppayil, S.M., Peng, M., Mendoza, L., Levins, T.A., Szaniszlo, P.J., 1996. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi. J. Med. Vet. Mycol. 34, 117–125. Kuhn, D.M., Ghannoum, M.A., 2003. Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective. Clin. Microbiol. Rev. 16, 144–172. Lee, M.F., Chen, Y.H., Peng, C.F., 2009. Evaluation of reverse transcription loop-mediated isothermal amplification

in conjunction with ELISA-hybridization assay for molecular detection of Mycobacterium tuberculosis. J. Chapter Microbiol. Methods 76, 174–180. Marciniak, J., Kummel, A., Esener, S., Heller, M., Messmer, B., 2008. Coupled rolling circle amplification loop- 6 mediated amplification for rapid detection of short DNA sequences. Biotechniques 45, 275–280. Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell Probes. 16, 223–229. Najafzadeh, M.J., Gueidan, C., Badali, H., Gerrits van den Ende, A.H.G., Xi, L., de Hoog, G.S., 2009a. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med. Mycol. 47, 17–25. Najafzadeh, M.J., Rezusta, A., Cameo, M.I., Zubiri, M.L., Yus,M.C., Badali, H., Revillo, M.J., De Hoog,G.S., in press-a. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med. Mycol. 48,390-3. Najafzadeh, M.J.B., H. Sun, J. Xi, L., Gerrits van den Ende, A.H.G., de Hoog, G.S., in press-b. Fonsecaea nubica, a new species of agent of human chromoblastomycosis revealed using molecular data. Med Mycol. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63. Ohori, A., Endo, S., Sano, A., Yokoyama, K., Yarita, K., Yamaguchi, M., Kamei, K., Miyaji, M., Nishimura, K., 2006. Rapid identification of Ochroconis gallopava by a loopmediated isothermal amplification (LAMP) method. Vet. Microbiol. 114, 359–365. Padhye, A.A., Hampton, A.A., Hampton, M.T., Hutton, N.W., Prevost-Smith, E., Davis, M.S., 1996. Chromoblastomycosis caused by Exophiala spinifera. Clin. Infect. Dis. 22,331–335. Poon, L.L., Wong, B.W., Chan, K.H., Ng, S.S., Yuen, K.Y., Guan, Y., Peiris, J.S., 2005. Evaluation of real-time reverse transcriptase PCR and real-time loop-mediated amplification assays for severe acute respiratory syndrome coronavirus detection. J. Clin. Microbiol. 43, 3457–3459. Queiroz-Telles, F., Esterre, P., Perez-Blanco, M., Vitale, R.G., Salgado, C.G., Bonifaz, A., 2009. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med. Mycol. 47, 3–15. Rubin, H.A., Bruce, S., Rosen, T., McBride, M.E., 1991. Evidence for percutaneous inoculation as the mode of transmission for chromoblastomycosis. J. Am. Acad. Dermatol. 25, 951–954. Salgado, C.G., da Silva, J.P., Diniz, J.A., da Silva, M.B., da Costa, P.F., Teixeira, C., Salgado, U.I., 2004. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Rev. Inst.

87 Chapter 6

Med. Trop. Sao Paulo 46, 33–36. Spatafora, J.W., Mitchell, T.G., Vilgalys, R., 1995. Analysis of genes coding for smallsubunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens. J. Clin. Microbiol. 33, 1322–1326. Sudhadham, M., Prakitsin, S., Sivichai, S., Chaiyarat, R., Dorrestein, G.M., Menken, S.B.J., De Hoog, G.S., 2008. The neurotropic black yeast Exophiala dermatitidis has a possible origin in the tropical rain forest. Stud. Mycol. 61, 145–155. Surash, S., Tyagi, A., de Hoog, G.S., Zeng, J.S., Barton, R.C., Hobson, R.P., 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med. Mycol. 43, 465–472. Vicente, V.A., Attili-Angelis, D., Pie, M.R., Queiroz-Telles, F., Cruz, L.M., Najafzadeh, M.J., de Hoog, G.S., Zhao, J., Pizzirani-Kleiner, A., 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud. Mycol. 61, 137–144. Vidal, M.S., Castro, L.G., Cavalcante, S.C., Lacaz, C.S., 2004. Highly specific and sensitive, immunoblot-detected 54 kDa antigen from Fonsecaea pedrosoi. Med. Mycol. 42, 511–515. Xi, L., Lu, C., Sun, J., Li, X., Liu,H., Zhang, J., Xie, Z., de Hoog, G.S., 2009. Chromoblastomycosis caused by a meristematic mutant of Fonsecaea monophora. Med. Mycol. 47, 77–80. Yoshida, A., Nagashima, S., Ansai, T., Tachibana, M., Kato, H., Watari, H., Notomi, T., Takehara, T., 2005. Loop- mediated isothermal amplification method for rapid detection of the periodontopathic bacteria Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola. J. Clin. Microbiol. 43, 2418–2424. Zeng, J.S., de Hoog, G.S., 2008. Exophiala spinifera and its allies: diagnostics from morphology to DNA barcoding. Med. Mycol. 46, 193–208.

88 Chapter 7

Rapid detection and identification of fungal pathogens by rolling circle amplification (RCA) using Fonsecaea as a model

M. J. Najafzadeh1, 2, 3, J. Sun1, 4, V.A. Vicente1, 5 & G. S. de Hoog1, 2, 6*

1CBS–KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands; 3Department of Parasitology and Mycology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran; 4Department of Dermatology, The Second Affiliated Hospital, Sun Yat-Sen University, Guangzhou, Guangdong, China; 5Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil; 6Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China

In press in: Mycoses

89 Chapter 7

Abstract We aimed to describe a rapid and sensitive assay for identification of pathogenic fungi without sequencing. The method of rolling circle amplification (RCA) is presented with species of Fonsecaea, agents of human chromoblastomycosis, as a model. The internal transcribed spacer (ITS) rDNA region of 103 Fonsecaea strains was sequenced and aligned in view of designing three specific padlock probes to be used for the detection of single nucleotide polymorphisms in three Fonsecaea species. The 38 strains included for testing the specificity of RCA comprised 17 isolates of Fonsecaea pedrosoi, 13 of Fonsecaea monophora and eight of Fonsecaea nubica. The assay successfully amplified DNA of the target fungi at the level of species, while no cross reactivity was observed. The amplification product was visualised on a 1% agarose gel to verify the specificity of probe–template binding. Amounts of reagents were minimised to avoid the generation of false-positive results. The simplicity, sensitivity, robustness and low costs provide RCA a distinct position among isothermal techniques for DNA diagnostics as a very practical identification method.

Key words: Fonsecaea, chromoblastomycosis, RCA, rapid diagnosis

Introduction Fungal infections that cause life-threatening infections in critically ill and immunocompromised patients have increased significantly over the last decades. In addition, the burden of disease of mutilating infections in healthy individuals, such as chromoblastomycosis, is increasingly recognised. Rapid and specific identification of fungal pathogens in early stages of the infection is important for timely and appropriate treatment with antifungal agents.1,2 Conventional methods for fungal identification in the clinical laboratory rely on morphological and physiological tests and need several days or weeks and are frequently unspecific.3 Molecular identification mostly implies sequencing, which is relatively expensive and time-consuming. Rolling circle amplification (RCA) was introduced as a rapid and specific tool for molecular diagnostics4–7 of microbial agents including fungi.8,9 The RCA method is discussed in this article using the genus Fonsecaea. This genus of black yeast-like fungi comprises potential agents of chromoblastomycosis, a chronic, cutaneous and subcutaneous infection with high morbidity and characterised by the presence of muriform fungal cells in tissue.10,11 Chromoblastomycosis is found worldwide, but most reports of the disease are from tropical and subtropical climates. 12–14 The genus comprises two sibling species, Fonsecaea pedrosoi and Fonsecaea monophora,11,15 while a third one, Fonsecaea nubica, was described recently.16 The latter taxon was reported from Brazil and southern China. Patients with chromoblastomycosis are supposed to have acquired their infection after traumatic inoculation of contaminated material such as spines of cactus17 or of mimosa plants.18 However, fungi isolated directly from the environment often concern less virulent siblings of the species rather than the pathogens themselves.19 With environmental search for the culprit pathogen yielding many avirulent

90 RCA counterparts, precise identification at the level of molecular species is therefore essential. Laboratory diagnosis of chromoblastomycosis relies on presence of the muriform cells in tissue and on microscopic morphology of the agent, which both have low specificity. Rolling circle amplification is a sensitive, specific and reproducible isothermal DNA amplification technique for rapid molecular identification of microorganisms. RCA-based diagnostics are characterised by good reproducibility, with less amplification errors as compared with PCR.5 The method uses a padlock probe, a circularisable oligonucleotide consisting of two segments complementary to the 3´ and 5´ ends of the target and a linker sequence.20 When the 3´ and 5´ terminal regions of the oligonucleotide probes are juxtaposed to the sequence of interest, the probe ends can be joined by a DNA ligase to form a circular DNA molecule that can be amplified by RCA. Recently the power of padlock probes to accurately identify target nucleic acid sequences, with high specificity down to the single nucleotide polymorphism level, has been demonstrated.4,6,21,22 RCA assays have been used for rapid identification of bacteria,23 viruses7,24 and fungi.8,9,25 In this study, we develop a specific, sensitive and rapid method for identification of clinically important Fonsecaea species by RCA.

Material and methods

Fungal strains Thirty-eight Fonsecaea isolates were studied, including 17 F. pedrosoi, 13 F. monophora and eight F. nubica. Thirty isolates originated from patients with chromoblastomycosis, two from brain infection, one from an animal ear and five from the environment. Twenty-five strains came from the South and Central America, five from Southern China and eight isolates came from other countries. Strain data and GenBank accession numbers have been published elsewhere.15,16 To evaluate the specificity of three Fonsecaea-specific padlock probes, we tested Chapter five closely related species:26 Cladophialophora bantiana (CBS 678.79, Gen Bank EU103992), Cladophialophora minourae (CBS 556.83, GenBank AY251087), Cladophialophora modesta 7 (CBS 985.96), Cladophialophora saturnica (CBS 109630, GenBank FJ385270) and a hitherto unidentified Cladophialophora species (dH 12336). The affinity of Fonsecaea to these species was established using a phylogenetic tree constructed with Small SubUnit (SSU) rDNA sequences.26 Strains were maintained on slants of 2% malt extract agar (MEA) and oatmeal agar (OA) at 24oC. Species identity was confirmed by sequencing rDNA internal transcribed spacer (ITS), partial β-tubulin (BT2), actin (ACT1), and cell division control protein (cdc42) genes, supplemented with Amplified Fragment Length Polymorphism profiles

DNA extraction and ITS PCR amplification DNA extraction and PCR amplification of ITS regions were performed as described previously.15,27 We used ITS amplicons for RCA reactions.

Tree building A consensus tree of 38 members of Fonsecaea species based on ITS constructed with the Tree

91 Chapter 7

Finder algorithm (v. June 2007, by Gangolf Jobb) with 100 bootstrap replicates and edited with MEGA4 software.28 Based on SSU data26 strain CBS 306.94 (Cladophialophora arxii) was off among the species closest to Fonsecaea species and was taken as outgroup.

Padlock probe design For the selection of padlock probes, sequences of ITS regions of 103 Fonsecaea strains (F. monophora, F. pedrosoi and F. nubica) from the CBS reference collection were aligned and adjusted manually using BioNumerics v. 4.61 (Applied Maths, Kortrijk, Belgium) to identify informative nucleotide polymorphisms. Three padlock probes targeting the ITS region were designed and were ordered from Invitrogen Inc (Breda, The Netherlands). In order to optimise binding efficiency to target DNAs, the padlock probes were designed with minimum secondary structure and with Tm of the 5´ end probe binding arm close to or above ligation temperature (63ºC, see below). To increase its discriminative specificity, the 3´ end binding arm was designed with a Tm 10–15ºC below ligation temperature. The linker regions of each Fonsecaea species-specific probe were taken from Zhou et al.8 and the 5´ and the 3´ binding arms were designed in this article (Table 1). Sequences of the two primers used for RCA and the oligonucleotide padlock probes are listed in Table 1. The oligonucleotide probes used were c. 92-99 nt in length and consisted of two adjacent target complementary sequences (14–20 nt) with a spacer region (63 nt) to facilitate loop formation and provide a template for RCA primer binding.

Ligation of padlock probe One microlitre of ITS amplicon was mixed with 2 U pfu DNA ligase (Epicentre Biotechnologies, Madison, WI,USA) and 0.1 lmol l-1 padlock probe in 20 mmol l-1 Tris-HCl (pH 7.5), 20 mmol l-1 Cl, 10 mmol l-1 MgCl2, 0.1% Igepal, 0.01 mmol l-1 rATP, 1 mmol l-1 DTT with a total reaction volume of 10µl. Padlock probe ligation was conducted with one cycle of denaturation for 5 min at 94ºC, followed by five cycles of 94ºC for 30 s and 4 min ligation at 63ºC.7

Exonucleolysis Exonucleolysis is required to remove unligated padlock probe and template PCR product and thus reduce subsequent ligation-independent amplification events. It was performed in a 20 µl vol by addition of 10 U each of exonuclease I and III (New England Biolabs, Hitchin, UK) to the ligation mixture and incubation at 37ºC for 30 min, followed by 94ºC for 3 min to inactive the exonuclease reaction.

Rolling circle amplification (RCA) reaction Two microlitre of ligation product was used as template for RCA. The total volume was 50 µl containing 8 U Bst DNA polymerase (New England Biolabs), 400 µmol l-1 deoxynucleoside triphosphate mix, 10 pmol of each RCA primer in distilled water. Probe signals were amplified by incubation at 65ºC for 60 min, and accumulation of double stranded DNA products was visualised on a 1% agarose gel to verify the specificity of probe–template

92 RCA

Table 1. Rolling circle amplification padlock probes and padlock probe-specific primers used in this study. Oligonucleotides Sequences

RCA1 [4] 5´-ATGGGCACCGAAGAAGCA-3´

RCA2 [4] 5´-CGCGCAGACACGATA-3´

FOP 5´Pa-497AAGAAGCTCAGTGTACCGGG477 gatcaTGCTTCTTCGGTGCCCATtacgaggtgcggatagctacCGCGCAGACACGATAgtcta 514CGATACGTGCTCAATA498 3´

FOM 5´Pa-111AGCGGTCCTCCAGCG96 gatcaTGCTTCTTCGGTGCCCATtacgaggtgcggatagctacCGCGCAGACACGATAgtcta 125CAACGCCCGCATTG112 3´

FON 5´Pa-397 CAGGGGCTTGAGGGGGTGAT376 gatcaTGCTTCTTCGGTGCCCATtacgaggtgcggatagctacCGCGCAGACACGATAgtcta 422CGTCCAACACCAAGCG398 3´

FOM, Fonsecaea monophora, FOP, Fonsecaea pedrosoi; FON, Fonsecaea nubica; RCA, rolling circle amplification. a At the 5` end of probe, “P” indicates 5`-phosphorilation. The underlined sequences are the binding arms of the padlock probes, which are joined by the backbone of the probe including the non-specific linker region, which is the same for all three padlock probes. binding. Positive reactions showed a ladder-like pattern, whereas negative reactions showed a clean background.

Results Fonsecaea species were easily distinguished from each other and from other members of the order Chaetothyriales (black yeast and relatives) by ITS sequence analysis (Fig. 1). Each of the three recently recognized clinically relevant species had several unique nucleotide positions. The duration of the RCA assay was 2 h. Positive responses proved to be highly specific for all strains; individual species-specific probes being correctly identified in all three Fonsecaea species analysed (F. pedrosoi, F. monophora and F. nubica). No cross reaction was observed between the three Fonsecaea species (Fig. 2a, b). The products of the RCA reaction Chapter were visualised by electrophoresis on 1% agarose gels. Positive responses showed ladder-like patterns after RCA, whereas with negative results the background remained clean. When 7 the exonucleolysis step was omitted, a single weak band was visible on the gel representing a non-specific band that did not interfere with the RCA reaction (data not shown). The concordance of RCA results and identification with ITS sequencing was 100%. The five closely related relevant species used for comparison, i.e. C. bantiana (CBS 678.79), C. minourae (CBS 556.83), C. modesta (CBS 985.96), C. saturnica (CBS 109630) and a hitherto unidentified Cladophialophora species (dH 12336), yielded negative results with the Fonsecaea-specific padlock probes (data not shown).

Discussion Rolling circle amplification is a robust and simple, isothermal in vitro DNA amplification technique emerging as a tool for rapid detection of specific nucleic-acid sequences in DNA samples.5 The use of a padlock probe to circularise oligonucleotides was discovered by Nilsson et al. 20. The method is based on the replication of a short, single stranded DNAcircle

93 Chapter 7

Fig. 1. Consensus tree of Fonsecaea based on Internal Transcribed Spacer (ITS) ribosomal DNA of 38 strains, constructed with the Tree Finder algorithm (v. June 2007) with100 bootstrap and edited with Mega 4 software. CBS 306.94 was taken as outgroup(bootstrap values >70 are shown at branches in bold).

94 RCA by BstDNApolymerases at constant temperature. The technique was first applied by Fire et al. 29 and Liu et al. 29,30 in the mid 1990s. The sensitivity of RCA enables accurate and reliable detection and quantification of gene copy numbers,discrete antigen–antibody complexes, and mRNA expression levels in individual cells.5 Its technical simplicity makes the method also applicable for rapid and specific routine diagnostics of pathogenic fungal agents.In this study, the RCA assay was developed for the identification of the three currently recognised pathogenic Fonsecaea species. ITS sequencing is the gold standard for species identification of black yeast and relatives,31 but sequencing is expensive, time-consuming and impractical for analysis of large numbers of isolates.8 In addition, validated databases for comparison are required, as GenBank data are polluted within correctly identified sequences. The RCA reaction is relatively free from requirement for expensive laboratory equipment and can be performed within 2 h isothermally at 65ºC in a water bath, thermocycler, heating block or microwave.32 However, a positive signal was usually evident 15 min after commencement of the RCA reaction when detected by real time PCR.8,9 In this study, we used the fungal genus Fonsecaea as a model organism, as it contains three species which potentially cause the same disease, chromoblastomycosis, and are morphologically indistinguishable from each other. Rapid identification of the agents is significant because virulence differs between species, F. monophora also being an agent of primary encephalitis.33 RCA amplicons were detected here with gel electrophoresis, but other researchers used fluorescence,34 radiolabelling35 or UV absorbance.36 Recently also loop-mediated isothermal amplification (LAMP) has been proposed for rapid diagnosis of Fonsecaea.27 LAMP proved to be a fast and sensitive method based on direct amplification of fungal DNA, whereas for RCA, ITS amplicons are needed. However, with the LAMP assay, we could not distinguish between the different species of the genus Fonsecaea, because they differ in relatively few nucleotide polymorphisms that were sufficient to allow successful RCA diagnostics. Thus, RCA is more specific than LAMP, Chapter but LAMP is more sensitive than RCA.27 Thus far, the RCA method has only rarely been 7

Fig. 2. Gel representation of specificity of RCA probes. Amplification of probe signals was seen only with matched template-probe mixtures (empty lanes denote absence of signals with unmatched template-probe mixtures). The species-specific probes are labelled as shown at the top of the figure (FOM, Fonsecaea monophora; FOP, Fonsecaea pedrosoi and FON, Fonsecaea nubica). (A) Lane “M” is DNA smart ladder; lane 1, 4, and 7, F. monophora (CBS 269.37); lane 2, 5 and 8, F. pedrosoi (CBS 271.37); lane 3, 6 and 9, F. nubica (CBS 269.64). (B) Lane “M” is DNA smart ladder; lane 1- 4 are F. monophora (CBS 117238, CBS 102225, CBS 121727 and CBS 121724 respectively); lane 5- 8 are F. pedrosoi ( CBS 253.49, CBS 122741, CBS122849 and CBS 274.66 respectively ); lane 9- 12 are F. nubica (CBS 444.62, CBS 272.29, CBS 270.37 and CBS 121734 respectively).

95 Chapter 7

applied in medical mycology. Papers were limited to Candida, Aspergillus and Scedosporium,8 Cryptococcus25 and Trichophyton.9 In this study, we have demonstrated that RCA is a very efficient method for specific and sensitive identification of fungal pathogens and opportunistic agents, with species-specific detection of Fonsecaea taxa and excluding the closely related species of the genus Cladophialophora. Judging from these results and given the simplicity of the method, it is our impression that RCA deserves a place in routine testing in laboratories for fungal diagnostics where large numbers of samples are to be screened. The establishment of the test is relatively expensive, but with high throughput applications, the performance of testing will be rapid and inexpensive. For identification of very low volume of cases, the method is less suitable.

Acknowledgements This study was financially supported by the Ministry of Health and Medical Education of Iran, Mashhad University of medical sciences, Mashhad, Iran and Brazilian Government fellowship from Coordenação de Pessoal de Nível Superior (CAPES).

References 1. Hsiao CR, Huang L, Bouchara JP, Barton R, Li HC, Chang TC. Identification of medically important molds by an oligonucleotide array. J Clin Microbiol 2005; 43: 3760-8. 2. Najafzadeh MJ, Falahati M, Pooshanga Bagheri K., Fata A., Fateh R. Flow cytometry susceptibility testing for conventional antifungal drugs and comparison with the NCCLS broth macrodilution test. DARU 2009; 17: 94-8. 3. Larone DH. Medically important fungi: a guide to identification: Washington, D.C., 2002. 4. Faruqi AF, Hosono S, Driscoll MD, et al. High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification. BMC Genomics 2001; 2: 4. 5. Demidov VV. Rolling-circle amplification in DNA diagnostics: the power of simplicity. Expert Rev Mol Diagn 2002; 2: 542-8. 6. Alsmadi OA, Bornarth CJ, Song W, et al. High accuracy genotyping directly from genomic DNA using a rolling circle amplification based assay. BMC Genomics 2003; 4: 21. 7. Wang B, Potter SJ, Lin Y, et al. Rapid and sensitive detection of severe acute respiratory syndrome coronavirus by rolling circle amplification. J Clin Microbiol 2005; 43: 2339-44. 8. Zhou X, Kong F, Sorrell TC, Wang H, Duan Y, Chen SC. Practical method for detection and identification of Candida, Aspergillus, and Scedosporium spp. by use of rolling-circle amplification. J Clin Microbiol 2008; 46: 2423- 7. 9. Kong F, Tong Z, Chen X, et al. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification. J Clin Microbiol 2008; 46: 1192-9. 10. Bonifaz A, Carrasco-Gerard E, Saul A. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 2001; 44: 1-7. 11. De Hoog GS, Attili-Angelis D, Vicente VA, Gerrits van den Ende AHG, Queiroz-Telles F. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 2004; 42: 405-16. 12. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 2009; 47: 3-15. 13. Xi L, Sun J, Lu C, et al. Molecular diversity of Fonsecaea (Chaetothyriales) causing chromoblastomycosis in southern China. Med Mycol 2009; 47: 27-33. 14. Najafzadeh MJ, Rezusta A, Cameo MI, et al. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol. 2010; 48(2):390-3 15. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 2009; 47: 17-25. 16. Najafzadeh MJ, Sun J, Vicente V, Xi L, Gerrits van den Ende AHG, de Hoog G S. Fonsecaea nubica, a new species of agent of human chromoblastomycosis revealed using molecular data. Med Mycol 2010; 48(6):800-6. 17. Fernández-Zeppenfeldt G R-YN, Yegres F, Hernández R. Cladosporium carrionii: hongo dimórfico en cactáceas de

96 RCA

la zona endémica para la cromomicosis en Venezuela. Revista Iberoam de Micol 1994; 11: 61-3. 18. Salgado CG, da Silva JP, Diniz JA, et al. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Rev Inst Med Trop Sao Paulo 2004; 46: 33-6. 19. Vicente VA, Attili-Angelis D, Pie MR, et al. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 2008; 61: 137-44. 20. Nilsson M, Malmgren H, Samiotaki M, Kwiatkowski M, Chowdhary BP, Landegren U. Padlock probes: circularizing oligonucleotides for localized DNA detection. Science 1994; 265: 2085-8. 21. Pickering J, Bamford A, Godbole V, et al. Integration of DNA ligation and rolling circle amplification for the homogeneous, end-point detection of single nucleotide polymorphisms. Nucleic Acids Res 2002; 30: e60. 22. Nilsson M. Lock and roll: single-molecule genotyping in situ using padlock probes and rolling-circle amplification. Histochem Cell Biol 2006; 126: 159-64. 23. Tong Z, Kong F, Wang B, Zeng X, Gilbert GL. A practical method for subtyping of Streptococcus agalactiae serotype III, of human origin, using rolling circle amplification. J Microbiol Methods 2007; 70: 39-44. 24. Haible D, Kober S, Jeske H. Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. J Virol Methods 2006; 135: 9-16. 25. Kaocharoen S, Wang B, Tsui KM, Trilles L, Kong F, Meyer W. Hyperbranched rolling circle amplification as a rapid and sensitive method for species identification within the Cryptococcus species complex. Electrophoresis 2008; 29: 3183-91. 26. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits van den Ende AHG, de Hoog GS. Biodiversity of the genus Cladophialophora. Stud Mycol 2008; 61: 175-91. 27. Sun J, Najafzadeh MJ, Vicente V, Xi L & de Hoog GS. Rapid detection of pathogenic fungi of the genus Fonsecaea by Loop Mediated Isothermal Amplification. Microbiol Methods 2010; 80(1): 19-24. 28. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24: 1596-9. 29. Fire A, Xu SQ. Rolling replication of short DNA circles. Proc Natl Acad Sci U S A 1995; 92: 4641-5. 30. Liu D, Daubendiek SL, Zillman MA, Ryan K, Kool ET. Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases. J Am Chem Soc 1996; 188: 1587-94. 31. Zeng JS, de Hoog GS. Exophiala spinifera and its allies: diagnostics from morphology to DNA barcoding. Med Mycol 2008; 46: 193-208. 32. Yoshimura T, Nishida K, Uchibayashi K, Ohuchi S. Microwave assisted rolling circle amplification. Nucleic Acids Symp Ser (Oxf) 2006: 305-6. 33. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 2005; 43: 465-72. 34. Schweitzer B, Wiltshire S, Lambert J, et al. Immunoassays with rolling circle DNA amplification: a versatile platform for ultrasensitive antigen detection. Proc Natl Acad Sci U S A 2000; 97: 10113-9. 35. Baner J, Nilsson M, Mendel-Hartvig M, Landegren U. Signal amplification of padlock probes by rolling circle

replication. Nucleic Acids Res 1998; 26: 5073-8. Chapter 36. Kuhn H, Demidov VV, Frank-Kamenetskii MD. Rolling-circle amplification under topological constraints. Nucleic Acids Res 2002; 30: 574-80. 7

97 98 Chapter 8

In vitro activities of eight antifungal drugs against 55 clinical isolates of Fonsecaea species.

M. J. Najafzadeh,1,2,3 H. Badali,1,2,4 M. T. Illnait-Zaragozi,5 G. S. de Hoog,1,2,6 & J. F. Meis7*

1CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands, 3Department of Parasitology and Mycology, faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4Department of Medical Mycology and Parasitology, School of Medicine/Molecular and Cell Biology Research Center,Mazandaran University of Medical Sciences, Sari, Iran, 5Department of Mycology, Tropical Medicine Institute Pedro Kouri, Havana, Cuba, 6Peking University Health Science Center, Research Center for Medical Mycology,Beijing, China, 7Department of Medical Microbiology and Infectious Diseases, Canisius Wilhelmina Hospital, Nijmegen, The Netherlands

*Corresponding author. Mailing address: Department of Medical Microbiology and Infectious Diseases, Canisius Wilhelmina Hospital, Nijmegen 6500, The Netherlands. Phone: 31243657514. Fax: 31243657516. E-mail: j.meis@ cwz.nl.

Publiced in: Antimicrob Agents Chemother. 2010; 54(4):163 6-8

99 Chapter 8

Abstract The in vitro activities of eight antifungal drugs against clinical isolates of Fonsecaea pedrosoi (n = 21), Fonsecaea monophora (n= 25), and Fonsecaea nubica (n = 9) were tested. The resulting

MIC90s for all strains (n= 55) were as follows, in increasing order: posaconazole, 0.063 µg/ml; itraconazole, 0.125 µg/ml; isavuconazole, 0.25 µg/ml; voriconazole, 0.5 µg/ml; amphotericin B, 2 µg/ml; caspofungin, 2 µg/ml; anidulafungin, 2 µg/ml; and fluconazole, 32 µg/ml.

Key word: Fonsecaea, chromoblastomycosis, antifungal susceptibility.

Introduction Fonsecaea spp., anamorph members of the order Chaetothyriales (black yeasts and other melanized fungi), are principal agents of human chromoblastomycosis (16), a chronic cutaneous and subcutaneous infection characterized by slowly expanding skin lesions, a granulomatous immune response, and the presence of meristematic melanized muriform fungal cells in tissue scrapings (4). The last characteristic is a crucial diagnostic indicator that tends to be similar irrespective of the fungal pathogen. Chromoblastomycosis occurs worldwide in tropical and subtropical climates. Fonsecaea spp. are recoverable from environmental sources, so the disease is considered to be of traumatic origin (8, 9). The taxonomy of the genus Fonsecaea has been reviewed recently (12), and on the basis of sequence data, the following three species are recognized: Fonsecaea pedrosoi, Fonsecaea monophora, and Fonsecaea nubica. These species are morphologically identical, but their clinical spectra differ slightly: F. pedrosoi and F. nubica appear to be associated strictly with chromoblastomycosis, whereas F. monophora has also been isolated from brain abscesses, cervical lymph nodes, and bile (4, 13, 18). Therapy for chromoblastomycosis is challenging because there is no consensus regarding the treatment of choice. Several treatment options have been applied, but these tend to result in protracted disease, low cure rates, and frequent relapses (5, 9, 10, 16, 18). The therapeutic outcomes are variable and are allegedly dependent on the site of infection, lesion size, the etiological agent, and the patient´s health status (4). The specific identification of the causative pathogen is important for epidemiological reasons. The vast majority of cases of chromoblastomycosis in which the pathogen has been identified are caused by F. pedrosoi; for example, F. pedrosoi was isolated from 94% (66/69 cases) of patients with chromoblastomycosis in Sri Lanka (2) and from 98% (77/78 cases) of patients with culture- positive chromoblastomycosis in Brazil (17). The present study aimed at determining the in vitro susceptibilities of clinical isolates of Fonsecaea spp. to seven marketed antifungal drugs and the experimental 1,2,4-triazole antimycotic isavuconazole (11). Fifty-five Fonsecaea strains were obtained from the Centraalbureau voor Schimmelcultures (Utrecht, The Netherlands) and comprised 21 F. pedrosoi strains, 25 F. monophora strains, and 9 F. nubica strains. Fifty isolates originated from patients with chromoblastomycosis, one isolate was recovered from a patient with a cerebral

100 AFST infection, two isolates were from diseased animals, and two isolates were clinical isolates from unknown sources. Seventeen strains came from southern China, 30 from South and Central America, and 8 from other countries (The Netherlands, Spain, Uruguay, Libya, France, United Kingdom). Strain identities were verified by sequencing the ribosomal internal transcribed spacer (ITS), tubulin (BT2), and actin (ACT1) regions. In vitro susceptibility was determined as described in CLSI document M38-A2 (6). Briefly, the isolates were cultured on potato dextrose agar (35°C) for up to 7 days, and inocula were prepared by gently scraping the surface of the fungal colonies with a sterile cotton swab moistened with sterile physiological saline containing 0.05% Tween 40. Large particles in the cell suspensions were allowed to settle for 3 to 5 min at room temperature, and then the concentration of spores in the supernatant was adjusted spectrophotometrically (530 nm) to a percent transmission in the range 68 to 71, corresponding to 1.5 ×104 to 4 ×104 CFU/ml, as controlled by quantitative colony counts (6). Antifungal drugs were obtained as reagent-grade powders. The final concentrations of amphotericin B (AMB; Bristol-Myers Squibb, Woerden, The Netherlands), itraconazole (ITR; Janssen Research Foundation, Beerse, Belgium), voriconazole (VOR; Pfizer Central Research, Sandwich, United Kingdom), posaconazole (POS; Schering-Plough, Kenilworth, NJ), and caspofungin (CAS; Merck, Sharp & Dohme, Haarlem, The Netherlands) ranged from 0.016 to 16 µg/ml; the fluconazole (FLU; Pfizer) assay range was 0.063 to 64 µg/ml; and the isavuconazole (ISA; Basilea Pharmaceutica International AG, Basel, Switzerland) and anidulafungin (ANI; Pfizer) assay ranges were 0.008 to 8 µg/ml. After 72 h of incubation at 35°C, MICs and minimum effective concentrations (MECs) were determined visually by comparison of the growth in the wells containing the drug with the drug-free control. The MICs of AMB, ITR, VOR, POS, and ISA were defined as the lowest drug concentration that prevented any discernible growth (100% inhibition), whereas for FLU, the MIC was taken as the lowest concentration supporting ≥50% growth inhibition compared to the growth in the control wells. For CAS and ANI, MECs were determined microscopically as the lowest concentration of drug promoting the growth of small, round, compact hyphae relative to the appearance of the filamentous forms seen in the control wells. Quality control strains Paecilomyces variotii (ATCC 22319), Candida Chapter parapsilosis (ATCC 22019), and Candida krusei (ATCC 6258) were included in each assay 8 run. The geometric mean MICs, MIC ranges, MIC50s, and MIC90s for the Fonsecaea isolates are presented in Table 1. For each drug-species pair, the MIC50 and geometric mean MIC values differed by <1 log2 dilution step, indicating that in all cases the MIC50 obtained by inspection reasonably reflected the central tendency of the antifungal susceptibility of the population. All isolates had low MICs (MIC90s ≤ 0.5 µg/ml) for POS, ITR, ISA, and VOR; less active drugs (MIC90s ≥2 µg/ml) were AMB, CAS, ANI, and FLU. There were no significant differences in the activities of the surveyed drugs against F. pedrosoi, F. monophora, and F. nubica. The MICs obtained in this study were similar to those obtained in other studies of Fonsecaea isolates (1, 3, 7, 14–16, 21). Treatment of chromoblastomycosis is difficult. In cases caused by Cladophialophora carrionii and Phialophora verrucosa, patients generally

101 Chapter 8

Table 1. G mean, MIC ranges, MIC50 and MIC90 values (µg/ml) obtained by antifungal testing of amphotericin B, fluconazole, voriconazole, itra conazole, posaconazole, isavuconazole, caspofungin and anidulafungin of F. pedrosoi, F. monophora and F. nubica isolates. (For caspofungin and anidulafungin, MICs are read as MECs).

Fonsecaea species / Drugs GM MIC range MIC50 values MIC90 values All Fonsecaea Strains (n=55)

Amphotericin B 1,013 0.5-2 1 2

Fluconazole 19,08 8-64 16 32

Itraconazole 0,082 0.031-0.25 0,063 0,125

Voriconazole 0,29 0.125-1 0,25 0,5

Posaconazole 0,041 0.016-0.063 0,031 0,063

Isavuconazole 0,196 0.063-1 0,25 0,25

Caspofungin 2,15 1-4 2 2

Anidulafungin 3,43 1-8 4 2

F. pedrosoi (n=21)

Amphotericin B 0,967 0.5-2 1 2

Fluconazole 22,25 8-32 32 32

Itraconazole 0,082 0.031-0.25 0,063 0,125

Voriconazole 0,336 0.125-0.5 0,5 0,5

Posaconazole 0,050 0.031-0.063 0,063 0,063

Isavuconazole 0,226 0.063-0.25 0,25 0,25

Caspofungin 2,43 2-4 4 4

Anidulafungin 3,5 2-8 8 8

F. monophora (n=25)

Amphotericin B 1,11 0.5-2 1 2

Fluconazole 19,91 8-64 16 32

Itraconazole 0,078 0.031-0.25 0,063 0,125

Voriconazole 0,257 0.125-1 0,063 0,125

Posaconazole 0,037 0.16-0.063 0,031 0,063

Isavuconazole 0,184 0.063-1 0,125 0,25

Caspofungin 1,94 1-4 2 2

Anidulafungin 3,78 1-8 4 8

F. nubica (n=9)

Amphotericin B 0,925 0.5-2 1 2

Fluconazole 18,66 16-32 16 32

Itraconazole 0,099 0.031-0.25 0,125 0,25

Voriconazole 0,314 0.25-0.5 0,25 0,5

Posaconazole 0,036 0.031-0.063 0,031 0,063

Isavuconazole 0,17 0.063-0.5 0,125 0,5

Caspofungin 2,16 2-4 2 4

Anidulafungin 2,51 2-8 2 8

102 AFST respond well to relatively low doses of most antimycotics. The in vitro susceptibilities of C. carrionii strains to antifungal drugs (20) were similar to those of the Fonsecaea spp. In this study, using unique clinical isolates of Fonsecaea from patients with chromoblastomycosis, we demonstrated differences in the activities of the compounds. ITR has frequently been used to treat chromoblastomycosis attributed to Fonsecaea spp., although elevated ITR MICs have been encountered in sequential isolates during ITR treatment (1). POS is a new oral triazole that is used for the treatment of invasive fungal infections (19), including infections caused by the species associated with chromoblastomycosis (14). In the present study,

POS had the lowest MICs among all the drugs examined, although the MIC90s for ITR and

ISA were only 1 and 2 log2 dilution steps higher, respectively. The experimental drug ISA possesses potent, broad-spectrum activity against the yeasts and molds implicated in serious mycoses (11). POS, ITR, ISA, and VOR all seem to be potential candidates for use for the treatment of chromoblastomycosis, whereas echinocandins will probably have only a limited role in treatment for this indication due to their relatively high MICs and the lack of oral formulations. However, the in vitro results presented here need to be confirmed in studies with the appropriate animal models of chromoblastomycosis.

Acknowlegment This study was partly funded by an educational grant from Basilea Pharmaceutica International AG, Basel, Switzerland. M. J. Najafzadeh and H. Badali were supported by the Ministry of Health and Medical Education of the Islamic Republic of Iran (grant no. 13117 and 13081). J.F.M. received grants from Astellas, Merck, Basilea, and Schering- Plough. He has been a consultant to Basilea and Merck and received speaker´s fees from Merck, Pfizer, Schering-Plough, Gilead, and Janssen Pharmaceutica. None of the other authors has a potential conflictof interest.

References 1. Andrade, T. S., L. G. Castro, R. S. Nunes, V. M. Gimenes, and A. E. Cury. 2004. Susceptibility of sequential Fonsecaea pedrosoi isolates from chromoblastomycosis patients to antifungal agents. Mycoses 47:216–221.

2. Attapattu Maya, C. 1997. Chromoblastomycosis—a clinical and mycological study of 71 cases from Sri Lanka. Chapter Mycopathologia 137:145–151.

3. Bonifaz, A., E. Martinez-Soto, E. Carrasco-Gerard, and J. Peniche. 1997. Treatment of chromoblastomycosis 8 with itraconazole, cryosurgery, and a combination of both. Int. J. Dermatol. 36:542–547. 4. Bonifaz, A., E. Carrasco-Gerard, and A. Saul. 2001. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 44:1–7. 5. Bonifaz, A., V. Paredes-Solis, and A. Saul. 2004. Treating chromoblastomycosis with systemic antifungals. Expert Opin. Pharmacother. 5:247–254. 6. Clinical and Laboratory Standards Institute. 2008. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi, 2nd ed. Approved standard. CLSI document M38-A2. Clinical and Laboratory Standards Institute, Wayne, PA. 7. de Bedout, C., B. L. Gomez, and A. Restrepo. 1997. In vitro susceptibility testing of Fonsecaea pedrosoi to antifungals. Rev. Inst. Med. Trop. Sao Paulo 39:145–148. 8. de Hoog, G. S., D. Attili-Angelis, V. A. Vicente, A. H. Gerrits Van Den Ende, and F. Queiroz-Telles. 2004. Molecular ecology and pathogenic potential of Fonsecaea species. Med. Mycol. 42:405–416. 9. Esterre, P., and F. Queiroz-Telles. 2006. Management of chromoblastomycosis: novel perspectives. Curr. Opin. Infect. Dis. 19:148–152.

103 Chapter 8

10. Garnica, M., M. Nucci, and F. Queiroz-Telles. 2009. Difficult mycoses of the skin: advances in the epidemiology and management of eumycetoma, phaeohyphomycosis and chromoblastomycosis. Curr. Opin. Infect. Dis. 22:559– 563. 11. Guinea, J., and E. Bouza. 2008. Isavuconazole: a new and promising antifungal triazole for the treatment of invasive fungal infections. Future Microbiol. 3:603–615. 12. Najafzadeh, M. J., C. Gueidan, H. Badali, A. H. G. Gerrits van den Ende, L. Xi, and G. S. de Hoog. 2009. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med. Mycol. 47:17–25. 13. Najafzadeh, M. J., A. Rezusta, M. I. Cameo, M. L. Zubiri, M. C. Yus, H. Badali, M. J. Revillo, and G. S. De Hoog. 1 June 2010, posting date. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med. Mycol. 48(2):390-3. 14. Negroni, R., A. Tobon, B. Bustamante, M. A. Shikanai-Yasuda, H. Patino, and A. Restrepo. 2005. Posaconazole treatment of refractory eumycetoma and chromoblastomycosis. Rev. Inst. Med. Trop. Sao Paulo 47:339–346. 15. Queiroz-Telles, F., K. S. Purim, J. N. Fillus, G. F. Bordignon, R. P. Lameira, J. Van Cutsem, and G. Cauwenbergh. 1992. Itraconazole in the treatment of chromoblastomycosis due to Fonsecaea pedrosoi. Int. J. Dermatol. 31:805– 812. 16. Queiroz-Telles, F., P. Esterre, M. Perez-Blanco, R. G. Vitale, C. G. Salgado, and A. Bonifaz. 2009. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med. Mycol. 47:3–15. 17. Silva, J. P., W. de Souza, and S. Rozental. 1999. Chromoblastomycosis: a retrospective study of 325 cases on Amazonic region (Brazil). Mycopathologia 143:171–175. 18. Surash, S., A. Tyagi, G. S. de Hoog, J. S. Zeng, R. C. Barton, and R. P. Hobson. 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med. Mycol. 43:465–472. 19. Torres, H. A., R. Y. Hachem, R. F. Chemaly, D. P. Kontoyiannis, and I. Raad. 2005. Posaconazole: a broad- spectrum triazole antifungal. Lancet Infect. Dis. 5:775–785. 20. Vitale, R. G., M. Perez-Blanco, and G. S. de Hoog. 2009. In vitro activity of antifungal drugs against Cladophialophora species associated with human chromoblastomycosis. Med. Mycol. 47:35–40. 21. Yu, J., R. Li, M. Zhang, L. Liu, and Z. Wan. 2008. In vitro interaction of terbinafine with itraconazole and amphotericin B against fungi causing chromoblastomycosis in China. Med. Mycol. 46:745–747.

104 Chapter 9

Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora

M. J. Najafzadeh1, 2, 3, A. Rezusta4, M. I. Cameo4, M. L. Zubiri5, M. C. Yus6, H. Badali1, 2, M. J. Revillo4 & G. S. de Hoog1, 2*

1CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands; 3Department of Parasitology and Mycology, Faculty of medicin, Mashhad University of Medical Sciences, Mashhad, Iran; 4Microbiología, Hospital Universitario Miguel Servet, Instituto Aragones de la Salud, Zaragoza, Spain; 5Dermatologí, Hospital Universitario Miguel Servet., Zaragoza, Spain; 6Anatomía Patológica. Hospital Universitario Miguel Servet, Zaragoza, Spain.

*Correspondence: G.S. de Hoog, Centraalbureau voor Schimmelcultures, P.O. Box 85167, NL-3508 AD Utrecht, The Netherlands. Phone: (31) 30-2122663. Fax: (31) 30-2512097. E-mail: [email protected]

Published in: Med Mycol. 2010 mar; 48(2):390-3

105 Chapter 9

Abstract We report a case of chromoblastomycosis in a 67-year-old female farmer, which involved a large (20x30 cm) cicatricial erythematous plaque on the inner side of her right thigh. The lesion was initially a small nodule which gradually extended over 36 years. Direct microscopic examination revealed a granulomatous lesion with muriform cells surrounded by giant cells. The mould recovered in cultures was dark olivaceous and identified as Fonsecaea monophora by ribosomal internal transcribe spacer (ITS) sequence data. The lesion was successfully cured after 4 months treatment with itraconazole, but there was a relapse.

Keywords: Chromoblastomycosis, Fonsecaea monophora, itraconazole.

Introduction Chromoblastomycosis is a chronic, cutaneous and subcutaneous infection haracterized by slowly expanding skin lesions with muriform cells in tissue, provoking a granulomatous immune response. The disease occurs worldwide, but most cases have been reported from tropical and subtropical climates. It is caused by members of the ascomycete order Chaetothyriales, comprising the black yeasts and relatives. To date, six species have been proven as a causative agent of the disease, i.e., Fonsecaea pedrosoi [1,2], F. monophora [3,4], Cladophialophora carrionii [5], C. samoënsis [5], Phialophora verrucosa [6,7] and Rhinocladiella aquaspersa [8,9]. Several Exophiala species (E. jeanselmei and E. spinifera) have been confirmed as occasional agents of the disease [10,11]. The etiologic agents are supposed to gain entrance through the skin by traumatic implantation of contaminated material. The majority of lesions are observed on extremities of outdoor workers [1,12-14]. Carrión [15] and Queiroz-Telles et al. [1] described five types of lesions; nodular, tumorous, verrucose, cicatricial and plague types. As yet it is unknown whether these types are associated with specific etiologic agents or are dependent on host responses. The present case reports a chronic infection caused by a Fonsecaea species. The genus Fonsecaea presently comprises two species, F. pedrosoi and F. monophora [3,16]. While morphologic differentiation is difficult, their separation was recently confirmed by Najafzadeh et al. [16] using multilocus analysis. The pathology of the two species may be somewhat different, i.e., F. pedrosoi thus far is strictly associated with chromoblastomycosis, while F. monophora seems to be a more general opportunist [3], including, for example, cases of brain infection [17].

Case report While the patient was a 67-year-old female farmer living in Spain, she was born in Equatorial Guinea. She presented with a cicatricial erythematous plaque (20x30 cm in diameter) with verrucous margins in the internal face of the right thigh (Fig. 1). The lesion started 36 years earlier in Guinea as a small subcutaneous nodule which was pruritic and painless. A trauma or inoculation was not recalled. No satellite lesions or lymphadenopathies were observed and she had not received any antifungal therapy. Although a partial resection was made

106 chromoblastomycosis caused by Fonsecaea monophora

Fig.1. cicatricial erythematous plaque in the internal Fig. 2. muriform cells in histopathological examination face of the right thigh with verrucous zones. of biopsy (hematoxylin–eosin stain) 12 years earlier, there had been a relapse in the lesion. Results of blood tests were within normal limits except for a slight neutropenia and glycaemia (7.5 mM/L). Thyroid function and urine biochemistry were normal. Examination of potassium hydroxide mounts from the lesion revealed brown muriform cells. Histopathology with haematoxylin and eosin staining of the epidermis showed hyperkeratosis and parakeratosis, and a granulomatous response with histiocytes, plasma cells, polymorphonuclear cells and giant cells including muriform cells (Fig. 2). These results confirmed the clinical diagnosis of chromoblastomycosis. Fungal culture of skin scales on malt extract agar (MEA) yielded velvety to cottony, dark olivaceous colonies after 14 days at 25oC (Fig. 3). Microscopic appearance was indistinguishable from that of F. pedrosoi (Fig. 4). Partial sequences of the rDNA Internal Transcribed Spacer (ITS), actin (ACT1) and β-tubulin (BT2) domains were compared with GenBank and aligned with voucher strains maintained at CBS including ex-types of Fonsecaea species. The isolate showed close sequence similarity with CBS 269.37, the ex-type strain of F. monophora. The sequence data for the isolate were deposited in GenBank with accession numbers FJ785471, Chapter

FJ785472 and FJ785473 for ITS, ACT1 and BT2, respectively. The isolate was preserved in 9 the reference collection of the CBS-KNAW Fungal Biodiversity Centre with accession number CBS 123849. The patient showed good response to treatment with 400 mg/day for the first month and 200 mg/day for the next three months of systemic itraconazole. However, discontinuation of treatment resulted in a relapse.

107 Chapter 9

Fig. 3. Macroscopic appearance of F. monophora. Fig. 4. Microscopic appearance of F. moniophora (CBS 123849). Discussion Fonsecaea monophora is presently recognized as one of the agents of human chromoblastomycosis. Xi et al. [4] described 20 cases of chromoblastomycosis caused by this species, which proved to be the predominant etiologic agent of the disease in southern China. Zhang et al. [18] reported three further cases caused by F. monophora in southern China. Yoguchi et al. [19] discussed 27 cases by F. monophora from Japan and showed that Chinese populations of the fungus are very similar in sequence of ITS region to those from Japan and they located in Subgroup B-2. The present report is the first proven case of chromoblastomycosis caused by F. monophora originating from the African continent. An earlier African case was concerned with a brain infection [17]. Clinically our case could be classified [1] as the plaque type of chromoblastomycosis, with slight elevation of the lesion and having a sharp reddish margin. There is no definite incubation period and most cases have a slow, chronic course. In the present case, the initial lesion gradually extended over 36 years and represents the longest course of the disease reported. During the long duration of the infection, the lesion had enlarged considerably, and could be classified as ‘severe´ according to Queiroz-Telles et al. [1]. Bonifaz et al. [20] studied 51 cases involving F. pedrosoi and Phialophora verrucosa in Mexico and found that the longest course of disease was 24 years, with a minimum of 2 months. In another study from Malaysia, where the etiologic agent was not specified, the duration of symptoms ranged between 5 months and 13 years [21]. Zhang et al. [18] reported a case of chromoblastomycosis caused by F. monophora with a 24 year history. Histopathology is identical in all types of chromoblastomycosis, and is essential for diagnosis and confirmation. In this study hyperkeratosis and parakeratosis were observed, as well as abundant presence of polymorphonuclear cells and giant cell formation. Muriform cells were easily identified in routine haematoxylin-eosin stain and KOH wet

108 chromoblastomycosis caused by Fonsecaea monophora mounts. Although the host defence mechanisms in the lesions is still not well understood, Davila et al. [22] reported that distinct immunehistopathological alterations were correlated with clinical aspects of the lesions. The authors suggested that patients with lesions presenting as verrucous plaques had a type Th2 immunological response, while patients with lesions presenting as erythematous atrophic plaque had a type Th1 response. Patients are primarily male rural workers who are supposed to acquire the infection after having been pricked by contaminated thorns or wood splinters. Our patient did not recall any trauma but a microtrauma may have occurred. The infection process in chromoblastomycosis is still not well understood. Salgado et al. [12] isolated a fungus morphologically identified as Fonsecaea pedrosoi from thorns of the plant Mimosa pudica at the site of infection specified by one of their atients. However, Vicente et al. [23] demonstrated that such environmental strains may differ at the molecular level from clinical strains. The involvement of environmental F. pedrosoi isolates has thus far not been proven by direct isolation methods. Possibly this is related to differential virulence and predilection of the species concerned. Fonsecaea monophora seems to be less strictly associated with chromoblastomycosis than F. pedrosoi, and can be directly isolated from the environment, whereas for F. pedrosoi enrichment via a mouse or another mammal is required [23]. Treatment of chromoblastomycosis may be difficult because of the presence of therapy-refractory muriform cells and differential susceptibilities between taxonomically closely related groups [20]. There is no drug of choice for treatment of the disorder and results may depend on the size and severity of the lesions [1], etiologic agent, patient status and clinical localization [20]. In the present case the patient was initially cured after 4 month treatment with systemic itraconazole 200-400 mg/day. The result of the present study confirms earlier reports which indicated that itraconazole provides an effective therapy of chromoblastomycosis caused by Fonsecaea, Phialophora and Cladophialophora carrionii [20,24-27], but the period of treatment should probably be extended. Some authors have reported that a combination of itraconazole treatment with cryosurgery using liquid nitrogen has a synergistic effect and appears to be the best treatment for extended lesions [20,28,29]. Alternative, combination therapy of itraconazole with terbinafin might be a treatment option. Voriconazole and posaconazole also have in vitro activity against these fungi [24,30,31].

Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content Chapter and writing of the paper. 9

References 1. Queiroz-Telles F, Esterre P, Perez-Blanco M, et al. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 2009; 47: 3–15. 2. López Martínez R, Méndez Tovar LJ. Chromoblastomycosis. Dermatol Clin 2007; 25: 188-194. 3. de Hoog GS, Attili-Angelis D, Vicente VA, et al. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 2004; 42: 405–416. 4. Xi L, Sun J, Lu S, et al. Molecular diversity of Fonsecaea causing chromoblastomycosis in southern China. Med

109 Chapter 9

Mycol 2009; 47:27-33. 5. Badali H, Gueidan C, Najafzadeh MJ, et al. Biodiversity of the genus Cladophialophora. Stud Mycol 2008; 61: 175-191. 6. Hofmann H, Choi SM, Wilsmann-Theis D, et al. Invasive chromoblastomycosis and sinusitis due to Phialophora verrucosa in a child from northern Africa. Mycoses 2005; 48: 456–461. 7. Gugnani HC, Egere JU, Suseelan AV, et al. Chromomycosis caused by Phialophora pedrosoi in eastern Nigeria. J Trop Med Hyg 1978; 81: 208–210. 8. Arango M, Jaramillo C, Cortes A, et al. Auricular chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 1998; 36: 43–45. 9. Marques SG, Pedrozo Silva CM, Resende MA, Andreata LS, Costa JM. Chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 2004; 42: 261–265. 10. Queiroz-Telles F, McGinnis MR, Salkin I, et al.Subcutaneous mycoses. Infect Dis Clin N Amer 2003; 17: 59–85. 11. Padhye AA, Ajello L. A case of chromoblastomycosis with special reference to the mycology of the isolated Exophiala jeanselmei. Mykosen 1987; 30: 134. 12. Salgado CG, Da Silva JP, Diniz JAP, et al. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Revta Inst Med Trop S Paulo 2004; 46: 33–36. 13. de Hoog GS, Nishikaku AS, Fernández-Zeppenfeldt G, et al. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species, Stud Mycol 2007; 58: 219–234. 14. de Hoog GS, Guarro J, Gené J, Figueras MJ. Atlas of Clinical Fungi, 2nd edn. Utrecht / Reus: Centraalbureau voor Schimmelcultures / Universitat Rovira i Virgili, 2000. 15. Carrión AL. Chromoblastomycosis. Ann N Y Acad Sci 1950; 50: 1255–1282. 16. Najafzadeh MJ, Gueidan C, Badali H, et al. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 2009; 47: 17–25. 17. Surash S, Tyagi A, de Hoog GS, et al. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 2006; 43: 465–472. 18. Zhang J, Xi L, Lu C, et al. Successful treatment for chromoblastomycosis caused by Fonsecaea monophora: a report of three cases in Guangdong, China. Mycoses 2009; 52: 176–181. 19. Yaguchi T, Tanaka R, Nishimura K, et al. Molecular phylogenetics of strains morphologically identified as Fonsecaea pedrosoi from clinical specimens. Mycoses 2007; 50: 255-260. 20. Bonifaz A, Carrasco-Gerard E, Saul A, Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 2001; 44: 1–7. 21. Jayalakshmi P, Looi LM, Soo-Hoo TS. Chromoblastomycosis in Malaysia. Mycopathologia 1990; 109: 27–31. 22. Davila SC, Pagliari C, Duarte MI. The cell-mediated immune reaction in the cutaneous lesion of chromoblastomycosis and their correlation with different clinical forms of the disease. Mycopathologia 2002; 156: 51–60. 23. Vicente VA, Attili-Angelis D, Pie MR. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 2008; 61: 137–144. 24. Vitale RG, Perez-Blanco M and de Hoog GS. In vitro activity of antifungal drugs against Cladophialophora species associated with human chromoblastomycosis. Med Mycol 2009; 47: 35–40. 25. Kumar B, Kaur I, Chakrabarti A, et al. Treatment of deep mycoses with itraconazole. Mycopathologia 1991; 115: 169–174. 26. Restrepo A, Gonzales A, Gomez I, et al. Treatment of chromoblastomycosis with itraconazole. Ann NY Acad Sci 1988; 544: 504–516. 27. Borelli D. A clinical trial of itraconazole in the treatment of deep mycoses and leishmaniasis. Revta Infect Dis 1987; 9 (Suppl. 1): S57–S63. 28. Castro Luiz GM, Pimentel Eugênio RA, Lacaz CS. Treatment of chromomycosis by cryosurgery with liquid nitrogen: 15 years´ experience. Int J Dermatol 2003; 42: 408–412. 29. Kullavanijaya P, Rojanavanich V. Successful treatment of chromoblastomycosis due to Fonsecaea pedrosoi by the combination of itraconazole and cryotherapy. Int J Dermatol 1995; 34: 804–807. 30. Negroni R, Tobón A, Bustamante B, et al. Posaconazole treatment of refractory eumycetoma and chromoblastomycosis. Revta Inst Med Trop S Paulo 2005; 47: 339–346. 31. Esterrea P, Queiroz-Telles F. Management of chromoblastomycosis: novel perspectives. Curr Opin Infect Dis 2006; 19:148–152.

110 Chapter I0

Summary and discussion

111 Chapter 10

Summary and discussion Fonsecaea is one of the main agents of human chromoblastomycosis. The disease occurs worldwide, but most cases have been reported from tropical and subtropical climates (Bonifaz et al. 2001; Kawasaki et al. 1999; Najafzadeh et al. 2009; Queiroz-Telles et al. 2009; Tanabe et al. 2004). The general hypothesis is that fungi gain entrance through the skin by traumatic implantation of contaminated material (de Hoog et al. 2004; Esterre and Queiroz- Telles 2006). This suggests that the etiological agents are environmental saprobes, and that the onset of disease is strictly coincidental. Particularly fungi growing on or in prickly plants, such as living Cactaceae and Mimosa have been discussed as sources of infection (Salgado et al. 2004). The classical studies of Zeppenfeldt et al. (1994), who isolated fungi resembling the chromoblastomycosis agent Cladophialophora carrionii from spines of Stenocereus cactus, seemed to confirm this hypothesis. However, there are several indications that shed doubt on the supposed totally random inoculation process of chromoblastomycosis. In humans, the male : female ratio is 63 : 2; this male preponderance of 97% cannot be explained by different exposition rates. A similar male preponderance of 79.3% is observed in the cerebral pathogen Cladophialophora bantiana (unpublished data). Other established pathogens as Madurella mycetomatis have a strong male preponderance (Ahmed et al. 2004), whereas this is less in the compost fungus Aspergillus fumigatus (Ann 2010; Maiz et al. 2008). Recent molecular data have shown that the situation is at least more complicated than anticipated. The cactus-borne species isolated by Zeppenfeldt et al. (1994) appeared to belong to another species, C. yegresii, while C. carrionii was prevalent on the human host, with only some occasional isolations from cactus debris (de Hoog et al. 2007). A similar situation might be found in Fonsecaea; for this discussion Salgado et al. (2004) published an informative case. These authors suggested a link between a case of human chromoblastomycosis by F. pedrosoi, and a Fonsecaea-like isolate from Mimosa plant spines in an environment where the patient had hurt himself. The similarity between the strains was based on morphology only. Recently, in a molecular study by Vicente et al. (unpublished data) 56 Fonsecaea-like strains were isolated from sharp plant materials in the direct vicinity of patients with Fonsecaea chromoblastomycosis using an oil flotation method (Vicente et al. 2008). It was confirmed that it is possible to recover human-pathogenic species of Fonsecaea from environmental sources. However, only three strains were F. pedrosoi and one F. monophora. The remaining 52 strains belonged to hitherto unknown molecular siblings of Fonsecaea. Thus at least there are large differences in virulence between closely related species. If inoculation of Fonsecaea from plant materials and development of chromoblastomycosis is a random process, it remains unclear why clinical cases are dominated by the three species F. pedrosoi, F. monophora (de Hoog et al. 2004; Najafzadeh et al. 2009) and F. nubica (Najafzadeh et al. 2010), whereas the disease is never caused by any of the environmental species which by their higher frequency in nature would have a much higher chance to be

112 Disscusion inoculated. According to current knowledge F. pedrosoi, F. monophora and F. nubica are more virulent than the taxa that are strictly environmental. They form a single, well-separated clade from their molecular siblings. Thus two possible hypotheses might be proposed: either an environmental factor has emerged in the pedrosoi clade that coincidentally promotes virulence and is not shared by species outside the clade. The presence of such a factor might in the near future be solved by comparative genomics. Alternatively, a gradual adaptation process to the vertebrate host might occur. In that case a hitherto unknown mammal host might be concerned, as it is difficult to imagine how the factors acquired in the human host could be transmitted to a next, environmental generation. Within the pedrosoi clade the ecological differences between species are slight. Fonsecaea pedrosoi, F. monophora and F. nubica have similar morphology and could not be distinguished phenotypically, but their separation on the basis of multilocus data and AFLP are unambiguous (Najafzadeh et al. 2009, 2010, 2011). Clinically their distinction might be relevant, because, judging from current frequencies on humans; the species seem to differ in pathology and virulence, despite absence of differences in the temperature relations between the species. Fonsecaea pedrosoi and F. nubica thus far are strictly associated with chromoblastomycosis, whereas F. monophora, in addition to causing chromoblastomycosis, also affects other organs such as brain, bile and cervical lymph nodes (Koo et al. 2010; Surash et al. 2005; Yaguchi et al. 2007). In this thesis, research was focused on the genetic variation of Fonsecaea species, rapid detection and identification and the antifungal susceptibility of Fonsecaea species − topics which thus far have been explored only fragmentarily. In Chapter 2 we investigate the genetic diversity and species delimitation of Fonsecaea. Based on the Multilocus sequence typing, i.e., rDNA Internal Transcribed Spacers (ITS), partial genes and introns of actin (ACT1) and β-tubulin (BT2) genes we classified strains of Fonsecaea into three major clades, which were supported by high bootstrap values, group A and B contain the ex-type strain of F. pedrosoi and F. monophora respectively and group C did not include any type strain. Based on sequences of ITS, cdc42, BT2 and ACT1 and on AFLP profiles we show that Fonsecaea contained the three major clades, which were supported by high bootstrap values, Group A and B was already exist, but group C was introduced as a new Fonsecaea species, called F. nubica (Chapter 3). Morphological distinction of Fonsecaea species is difficult, but their separation on the basis of multilocus data is unambiguous. In Chapter 4, we introduce F. multimorphosa, a new species of Fonsecaea isolated from the left occipital lobe of the cerebrum of an 18-month-old Australian spayed female cat. The etiologic agent was identified as ‘Cladosporium bantianum´ by morphology, but the ITS sequences of voucher strain CBS 980.96 show more than 10% difference with type strain of Cladophialophora bantiana, CBS 173.52 and thus clearly belong to another taxon. Chapter Strains similar to CBS 980.96 had been recovered from the place where the patients acquire chromoblastomycosis in the state of Paraná in Brazil. The set of environmental strains showed I0 slight deviation from CBS 980.96 in ITS, BT2 and TEF1 genes. The clinical vs. environmental

113 Chapter 10 strains were also different in growth velocity. The neurotropic strain CBS 980.96 grew consistently slower on all media, and had a different profile of cardinal temperatures, being able to grow at 37oC and 40oC. The environmental strains were therefore doubtfully treated as being conspecific with CBS 980.96. On the basis of morphology and sequences the strains did not match with any known species. In Chapter 5, the molecular epidemiology of 81 Fonsecaea strains was studied using AFLP analysis; these strains were already identified using multilocus sequencing. AFLP data show that Fonsecaea 5 populations can be distinguished: F. monophora and F. nubica clusters were subdivided in two groups each. Strains in each group mostly had been collected at relatively close geographical distances. This suggests that vectors of dispersal of Fonsecaea species are slow, leading to significant regional diversification. In Chapters 6 and 7 we develop methods for detection. Conventional methods for fungal identification in the clinical laboratory rely on morphological and physiological tests and need several days or weeks and are frequently unspecific (Larone 2002). Molecular identification mostly implies sequencing, which is relatively expensive and time-consuming and impractical for large number of isolates. In this thesis we used from Loop-mediated isothermal amplification (LAMP) and rolling circle amplification (RCA) for rapid detection and identification of Fonsecaea strains. LAMP (Chapter 6) is a powerful nucleic acid amplification technique that rapidly and accurately amplifies target DNA under isothermal conditions; we used this method for rapid screening of Fonsecaea from other Chaetothyriales (black yeast and relatives). The detection limit was found to be 0.2 fg DNA. The second molecular identification technique that was established is rolling circle amplification (RCA) (Chapter 7). This technique had primarily been developed for virus diagnostics. Using ITS amplicons as templates, this technique proved to be suitable for the identification of three Fonsecaea species. The simplicity, sensitivity, robustness and low costs make RCA an attractive technique for the reliable identification of sibling species and other closely related fungi (Kaocharoen et al. 2008; Kong et al. 2008; Zhou et al. 2008). LAMP proved to be a fast and sensitive method for direct amplification of fungal DNA from environmental samples, whereas for RCA ITS amplicons are needed. However, with the LAMP assay, we could not distinguish between the different species of the genus Fonsecaea, because they differ in relatively few nucleotide polymorphisms that were sufficient to allow successful RCA diagnostics. Thus, RCA is more specific than LAMP, but LAMP is more sensitive than RCA. In Chapter 8 Antifungal susceptibility of Fonsecaea species is presented. In vitro susceptibility of 55 clinical Fonsecaea isolates were tested against amphotericinB, itraconazole, voriconazole, posaconazole, caspofungin, fluconazole, isavuconazole and anidulafungin by a broth microdilution method as described by the Clinical and Laboratory Standard Institute (CLSI; formerly the National Committee for Clinical Laboratory Standards) (Approved

Standard M38-A2). All isolates had low MICs (MIC90s ≤ 0.5 µg/ml) for PCZ, ITZ, ISA, and VRC; less active drugs (MIC90s ≥2 µg/ml) were AMB, CAS, ANI, and FLZ. There were no significant

114 Disscusion differences in the activities of the surveyed drugs against F. pedrosoi, F. monophora, and F. nubica. These data will help defining treatment recommendations and establishing guidelines for antifungal therapy. A rapid, effective antimycotic therapy is the key to a positive patient outcome. Providing proper identification tools allowing species identification in less than one working day, and comprehensive data on antimycotic susceptibility patterns will lead to a more targeted antifungal therapy. Chromoblastomycosis patients are a true therapeutic challenge for clinicians (Esterre & Queiroz-Telles 2006) because of the presence of therapy-refractory muriform cells and differential susceptibilities between taxonomically closely related groups (Bonifaz et al. 2001). Several treatment options have been applied, but these tend to result in protracted disease, low cure rates, and frequent relapses. Treatment may depend on the size and severity of the lesions, etiologic agent, patient status and clinical localization. In Chapter 9, we report a case of Chromoblastomycosis by F. monophora in female farmer from Spain. The lesion started 36 years earlier when she living in Guinea. The lesion was successfully cured after 4 months treatment with itraconazole, but there was a relapse.

References Ahmed AO, van Leeuwen W, Fahal A, van de Sande W, Verbrugh H, van Belkum A, 2004. Mycetoma caused by Madurella mycetomatis: a neglected infectious burden. Lancet Infect Dis 4, 566-574. Ann LCY, 2010. Host-Pathogen Interaction in Aspergillus Infection Radboud University Nijmegen, p. 191. CLSI, 2008. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi, Approved Standard M38-A2 C, Clinical and Laboratory Standards Institute, Wayne, PA, USA. Bonifaz A, Carrasco-Gerard E, Saul A, 2001. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 44, 1-7. de Hoog GS, Attili-Angelis D, Vicente VA, Gerrits van den Ende AHG, Queiroz-Telles F, 2004. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 42, 405-416. de Hoog GS, Nishikaku AS, Fernandez-Zeppenfeldt G, Padin-Gonzalez C, Burger E, Badali H, Richard-Yegres N, Gerrits van den Ende AHG, 2007. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol 58, 219-234. Esterre P, Queiroz-Telles F, 2006. Management of chromoblastomycosis: novel perspectives. Curr Opin Infect Dis 19, 148-152. Kaocharoen S, Wang B, Tsui KM, Trilles L, Kong F, Meyer W, 2008. Hyperbranched rolling circle amplification as a rapid and sensitive method for species identification within the Cryptococcus species complex. Electrophoresis 29, 3183-3191. Kawasaki M, Aoki M, Ishizaki H, Miyaji M, Nishimura K, Nishimoto K, Matsumoto T, De Vroey C, Negroni R, Mendonca M, Andriantsimahavandy A, Esterre P, 1999. Molecular epidemiology of Fonsecaea pedrosoi using mitochondrial DNA analysis. Med Mycol 37, 435-440. Kong F, Tong Z, Chen X, Sorrell T, Wang B, Wu Q, Ellis D, Chen S, 2008. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification. J Clin Microbiol 46, 1192-1199. Koo S, Klompas M, Marty FM, 2010. Fonsecaea monophora cerebral phaeohyphomycosis: case report of successful surgical excision and voriconazole treatment and review. Med Mycol 48, 769-774. Larone DH, 2002. Medically important fungi: a guide to identification, 4th ed ed. Washington, D.C. Maiz L, Cuevas M, Lamas A, Sousa A, Quirce S, Suarez L, 2008. [Aspergillus fumigatus and Candida albicans in cystic fibrosis: clinical significance and specific immune response involving serum immunoglobulins G, A, and M]. Arch Bronconeumol 44, 146-151. Najafzadeh MJ, Vicente VA, Klaassen CHW, Bonifaz A, Gerrits van den Ende AHG, Menken SBJ, de Hoog GS, 2011. Chapter Molecular epidemiology of Fonsecaea species. Emerg. Infect. Dis. 17. 464-9. I0 Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS, 2009. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 47, 17-25. Najafzadeh MJ, Sun J, Vicente VA, Xi L, Gerrits van den Ende AHG, de Hoog GS, 2010. Fonsecaea nubica sp. nov, a

115 Chapter 10

new agent of human chromoblastomycosis revealed using molecular data. Med Mycol 48, 800-806. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A, 2009. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 47, 3-15. Salgado CG, da Silva JP, Diniz JA, da Silva MB, da Costa PF, Teixeira C, Salgado UI, 2004. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Rev Inst Med Trop Sao Paulo 46, 33-36. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP, 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 43, 465-472. Tanabe H, Kawasaki M, Mochizuki T, Ishizaki H, 2004. Species identification and strain typing of Fonsecaea pedrosoi using ribosomal RNA gene internal transcribed spacer regions. Nippon Ishinkin Gakkai Zasshi 45, 105-112. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, de Hoog GS, Zhao J, Pizzirani- Kleiner A, 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 61, 137-144. Yaguchi T, Tanaka R, Nishimura K, Udagawa S, 2007. Molecular phylogenetics of strains morphologically identified as Fonsecaea pedrosoi from clinical specimens. Mycoses 50, 255-260. Zeppenfeldt. G, Richard-Yegres N, Yegres F, Hernandes R, 1994. Cladosporium carrionii: hongo dimorfico en cactaceas de la zona endemica para la cromicosis en Venezuela. Revista Iberoam Micol 11, 61-63. Zhou X, Kong F, Sorrell TC, Wang H, Duan Y, Chen SC, 2008. Practical method for detection and identification of Candida, Aspergillus, and Scedosporium spp. by use of rolling-circle amplification. J Clin Microbiol 46, 2423-2427.

116 Disscusion

Samenvatting en discussie Fonsecaea is een van de belangrijkste veroorzakers van chromoblastomycose bij de mens. Dit ziektebeeld komt wereldwijd voor, maar vooral in de tropen en subtropen (Bonifaz et al. 2001; Kawasaki et al. 1999; Najafzadeh et al. 2009; Queiroz-Telles et al. 2009; Tanabe et al. 2004). Men neemt over het algemeen aan dat de fungi via de huid worden geïnoculeerd via besmet materiaal (Esterre & Queiroz-Telles 2006). Dit zou betekenen dat de ziekteverwekkers gewone saprofieten uit de omgeving zijn, die door puur toeval in het lichaam terecht komen. Als terugkerende besmettingshaard werd vooral gedacht aan stekelige planten zoals cactussen en mimosa (Salgado et al. 2004). De klassieke studies van Zeppenfeldt et al. (1994), die schimmels isoleerde van stekels van de cactus Stenocereus die precies leken op een van de veroorzakers van chromoblastomycose, Cladophialophora carrionii, leken deze hypothese te bevestigen. Er zijn echter redenen om te twijfelen aan de volstrekte toevalligheid van het inoculatieproces in chromoblastomycose. Allereerst kan de man : vrouw verhouding van 63 : 2 in het patiëntenbestand niet verklaard worden door verschillen in expositie; mannen zouden 97% meer kans hebben om geprikt te worden. We zien een vergelijkbare mannelijke over-vertegenwoordiging (79.3%) bij herseninfecties door Cladophialophora bantiana (ongepubliceerde data). Ook bij andere bekende infectieuze schimmels als Madurella mycetomatis zien we een sterke mannelijke over-vertegenwoordiging (Ahmed et al. 2004), maar dat is veel minder het geval bij de compost schimmel Aspergillus fumigatus (Ann 2010; Maiz et al. 2008), waarbij het toeval een waarschijnlijker rol speelt. Recent moleculair onderzoek heeft inderdaad aangetoond dat de situatie complexer is dan werd aangenomen. De soort die op levende cactus groeit en die Zeppenfeldt et al. (1994) isoleerde, bleek tot een onbekende soort te behoren, Cladophialophora yegresii, terwijl C. carrionii vrijwel uitsluitend op menselijke patiënten voorkomt en slechts af en toe op dode cactus-resten werd aangetroffen (de Hoog et al. 2007). Iets vergelijkbaars zou een rol kunnen spelen in Fonsecaea; Salgado et al. (2004) publiceerden daartoe een illustratieve ziektegeschiedenis. Deze auteurs veronderstelden een directe verbinding tussen chromoblastomycose door F. pedrosoi en een Fonsecaea-achtig isolaat van de stekels van een Mimosa plant waaraan de patiënt zich eerder had verwond. De overeenkomst tussen planten humane stammen was gebaseerd op morfologie. Maar onlangs lieten Vicente en collega´s zien, in een nog ongepubliceerde moleculaire studie over 56 Fonsecaea-achtige stammen van scherpe plantenmaterialen rond de woningen van geïnfecteerde patiënten, dat slechts drie stammen tot Fonsecaea pedrosoi of F. monophora behoorden, de bekende veroorzakers van chromoblastomycose. De overige 52 isolaten behoorden tot onbeschreven moleculaire siblings van Fonsecaea. Er zijn blijkbaar grote

verschillen in virulentie tussen op elkaar lijkende soorten. Chapter Als inoculatie van Fonsecaea van plant materiaal en de ontwikkeling van I0 chromoblastomycose een toevallig process zou zijn, waarom vindt infectie dan uitsluitend plaats door de drie soorten F. pedrosoi, F. monophora (de Hoog et al. 2004; Najafzadeh et

117 Chapter 10 al. 2009) en F. nubica (Najafzadeh et al. 2010), en nooit door de andere Fonsecaea-achtige soorten uit de omgeving? Deze zijn vermoedelijk veel algemener en hebben dus een grotere kans geïnoculeerd te worden. De virulentere soorten F. pedrosoi, F. monophora en F. nubica vormen een ondersteunde monofyletische groep, die moleculair duidelijk is afgegrensd van de omgevings-isolaten. Er zijn dus twee hypotheses mogelijk: misschien is een factor verworven in de pedrosoi clade die bij toeval virulentie bevordert en die niet voorkomt bij species buiten de clade. Misschien kunnen we dit binnenkort oplossen via comparative genomics. Als alternatief kan een geleidelijke aanpassing aan de gewervelde gastheer worden verondersteld. Maar in dat geval moeten we een tot nu toe onbekende zoogdier-gastheer veronderstellen, want het is moeilijk voor te stellen hoe factoren die tijdens het verblijf in de gastheer eventueel worden verworven naar een volgende schimmel-generatie kunnen worden overgebracht. De ecologische verschillen tussen soorten van de pedrosoi clade zijn betrekkelijk gering. Fonsecaea pedrosoi, F. monophora en F. nubica veroorzaken dezelfde ziekte en kunnen fenotypisch niet worden onderscheiden, maar de verschillen op grond van multilocus sequentiëring en AFLP data zijn onmiskenbaar. Species-determinatie zou desondanks klinisch relevant kunnen zijn, want als we kijken naar hun frequentie in infecties zien we kleine verschillen in pathologie en virulentie zijn, ondanks hun vergelijkbare temperatuur- tolerantie. Fonsecaea pedrosoi en F. nubica zijn tot dusver altijd in chromoblastomycose aangetroffen, terwijl F. monophora daarnaast ook andere organen infecteert, zoals hersenen, de galblaas en de cervicale lympheknopen (Koo et al. 2010; Surash et al. 2005; Yaguchi et al. 2007). Het onderzoek beschreven in dit proefschrift betreft de genetische variatie van Fonsecaea soorten, hun snelle detectie en identificatie, en hun gevoeligheid voor antifungale middelen. Ondanks de veelheid aan publicaties over chromoblastomycose zijn deze aspecten in de literatuur nog nauwelijks belicht. In Hoofdstuk 2 onderzoeken we de genetische diversiteit en de soortsgrenzen in Fonsecaea. Dit gebeurt aan de hand van multilocus sequence typing, waarvoor rDNA Internal Transcribed Spacers (ITS), en delen van genen en introns van actine (ACT1) en β-tubuline (BT2) worden onderzocht. De Fonsecaea stammen kunnen worden ingedeeld in drie monofyletische hoofdgroepen, die statistisch worden ondersteund met hoge bootstrap waarden. Groepen A en B bevatten de ex-type stammen van F. pedrosoi en F. monophora, maar in group C bevindt zich geen typemateriaal. Met behulp van sequenties van ITS, cdc42, BT2 en ACT1 plus AFLP profielen tonen we aan dat group C een nieuwe Fonsecaea soort betreft, die als F. nubica wordt beschreven (Hoofdstuk 3). Morphologische identificatie van de nieuwe Fonsecaea species is moeilijk, maar de multilocus data zijn laten geen twijfel toe. In Hoofdstuk 4 wordt F. multimorphosa geïntroduceerd, een nieuwe Fonsecaea afkomstig uit de linker occipitale hersenlob van een 18 maanden oude Australische zwerfkat. De infectieuze schimmel was oorspronkelijk morfologisch gedetermineerd als ‘Cladosporium bantianum´, maar met ITS sequentiëring bleek deze stam, CBS 980.96, meer dan 10% van

118 Disscusion de type stam van Cladophialophora bantiana, CBS 173.52, af te wijken. CBS 980.96 behoorde dus onmiskenbaar tot een andere soort. Vergelijkbare stammen werden geïsoleerd uit de omgeving van patiënten met chromoblastomycose in de provincie Paraná in Brazilië, al weken deze iets af van CBS 980.96 in hun ITS, BT2 en TEF1 genen. De klinische stam groeide duidelijk langzamer dan de omgevingsisolaten, en vertoonde een andere temperatuur respons; de stam groeide goed bij 37oC en 40oC. Gezien deze lichte verschillen kan niet met zekerheid worden gezegd of alle stammen tot eenzelfde soort behoren. Morfologisch en moleculair verschilde de soort van alle tot dusver bekende species. In Hoofdstuk 5 wordt de moleculaire epidemiologie van 81 Fonsecaea stammen onderzocht met behulp van AFLP analyse; dezelfde stammen waren al op naam gebracht met multilocus sequentiëring. Op grond van de AFLP data kunnen vijf Fonsecaea populaties worden onderscheiden, doordat de F. monophora en F. nubica clusters elk konden worden onderverdeeld in twee subgroepen. Stammen uit eenzelfde groep kwamen meestal uit geografisch relatief dichtbij gelegen gebieden. Dit suggereert dat de vectoren voor verspreiding van Fonsecaea species relatief langzaam zijn, waardoor regionale diversificatie ontstaat. In de Hoofdstukken 6 en 7 worden detectie-methoden ontwikkeld. Conventionele methoden voor het identificeren van schimmels in het klinische laboratorium berusten vaak nog op morphologie en op fysiologische tests die dagen tot weken in beslag nemen en vaak onvoldoende spefifiek zijn (Larone 2002). Moleculaire identificatie wordt meestal gedaan door middel van sequentiëring, hetgeen relatief kostbaar is en eveneens veel tijd kost en daardoor ongeschikt is om grotere aantallen stammen af te werken. In dit proefschrift gebruiken we Loop-mediated isothermal amplification (LAMP) en Rolling circle amplification (RCA) om Fonsecaea stammen snel en betrouwbaar op naam te kunnen brengen. LAMP (Hoofdstuk 6) is een krachtige DNA techniek waarmee snel en accuraat target DNA wordt geamplificeerd bij gelijkblijvende temperatuur. We hebben deze method toegepast om Fonsecaea en andere Chaetothyriales (zwarte gisten en verwanten) snel te kunnen screenen. De detectiegrens was 0.2 fg DNA. De tweede moleculaire identificatie-methode is Rolling circle amplification (RCA) (Hoofdstuk 7). Deze techniek werd oorspronkelijk ontwikkeld om virus aan te tonen. Als we ITS amplicons gebruiken als templates, blijkt deze techniek geschikt te zijn voor de identificatie van de drie chromoblastomycosis veroorzakende Fonsecaea species. Het gebruiksgemak, de gevoeligheid, de betrouwbaarheid en de lage kosten maken RCA aantrekkelijk voor het identificeren van siblings en andere nauw verwante schimmels (Kaocharoen et al. 2008; Kong et al. 2008; Zhou et al. 2008). LAMP blijkt een snelle en gevoelige method te zijn voor de directe amplificatie van schimmel DNA in monsters uit de omgeving, maar voor RCA zijn ITS amplicons noodzakelijk. Chapter Daarentegen kunnen de soorten van het genus Fonsecaea met de LAMP assay niet worden onderscheiden, omdat ze in te weinig basen verschillen. Samengevat is RCA meer specifiek I0 dan LAMP, maar LAMP is meer gevoelig dan RCA.

119 Chapter 10

In Hoofdstuk 8 wordt de antifungale gevoeligheid van Fonsecaea soorten gepresenteerd. De in vitro gevoeligheid van 55 klinische isolaten van Fonsecaea worden getest tegen amphotericine B, itraconazol, voriconazol, posaconazol, caspofungine, fluconazol, isavuconazol en anidulafungine door middel van een microdilutie methode zoals beschreven in het protocol van het Clinical and Laboratory Standard Institute (CLSI 2008). Alle isolaten hadden lage MICs (MIC90s ≤ 0.5 µg/ml) voor PCZ, ITZ, ISA, en VRC; matig actieve middelen (MIC90s ≥ 2 µg/ml) waren AMB, CAS, ANI en FLZ. Er waren geen significante verschillen in de activiteiten van de onderzochte stoffen tegen F. pedrosoi, F. monophora en F. nubica. Deze gegevens zijn van betekenis bij het vaststellen van behandelingsprotocollen voor chromoblastomycose patiënten. Snelle en doeltreffende antifungale therapie is van het grootste belang om de kans op langduring succes te vergroten. Met moderne identificatiemethoden, waarmee de infectieuze soort binnen een dag op naam kan worden gebracht, en uitvoerige gegevens over antifungale gevoeligheid kan de therapie aanmerkelijk worden verbeterd. De behandeling van patiënten met chromoblastomycose blijft niettemin een uitdaging (Esterre & Queiroz-Telles 2006) door de invasieve vorm van de schimmel, de muriforme cel, die bestand is tegen extreme omstandigheden, en door verschillen in antifungale gevoeligheid tussen chromoblastomycose verwante veroorzakers buiten Fonsecaea (Bonifaz et al. 2001). In de praktijk zijn verschillende behandelingsschema´s geprobeerd, maar desondanks is het ziektebeeld vaak langduring, zijn de genezingspercentages laag, en vlamt de infectie vaak weer op. De behandeling kan mede afhangen van de grootte en de ernst van de lesies, van de veroorzakende soort, de gezondheidstoestand van de patiënt, en van de localisatie van de infectie. In Hoofdstuk 9 geven we een voorbeeld van een ziektegeschiedenis van chromoblastomycose veroorzaakt door F. monophora bij een Spaanse boerin. De lesie begon 36 jaar eerder, toen ze nog in Guinee woonde. De infectie werd succesvol behandeld met itraconazol gedurende vier maanden, hoewel het ziektebeeld uiteindelijk toch weer leek terug te keren.

Referenties Ahmed AO, van Leeuwen W, Fahal A, van de Sande W, Verbrugh H, van Belkum A, 2004. Mycetoma caused by Madurella mycetomatis: a neglected infectious burden. Lancet Infect Dis 4, 566-574. Ann LCY, 2010. Host-Pathogen Interaction in Aspergillus Infection Radboud University Nijmegen, p. 191. CLSI, 2008. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi, Approved Standard M38-A2 C, Clinical and Laboratory Standards Institute, Wayne, PA, USA. Bonifaz A, Carrasco-Gerard E, Saul A, 2001. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 44, 1-7. de Hoog GS, Attili-Angelis D, Vicente VA, Gerrits van den Ende AHG, Queiroz-Telles F, 2004. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 42, 405-416. de Hoog GS, Nishikaku AS, Fernandez-Zeppenfeldt G, Padin-Gonzalez C, Burger E, Badali H, Richard-Yegres N, Gerrits van den Ende AHG, 2007. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol 58, 219-234. Esterre P, Queiroz-Telles F, 2006. Management of chromoblastomycosis: novel perspectives. Curr Opin Infect Dis 19, 148-152. Kaocharoen S, Wang B, Tsui KM, Trilles L, Kong F, Meyer W, 2008. Hyperbranched rolling circle amplification as a rapid and sensitive method for species identification within the Cryptococcus species complex. Electrophoresis 29, 3183-3191.

120 Disscusion

Kawasaki M, Aoki M, Ishizaki H, Miyaji M, Nishimura K, Nishimoto K, Matsumoto T, De Vroey C, Negroni R, Mendonca M, Andriantsimahavandy A, Esterre P, 1999. Molecular epidemiology of Fonsecaea pedrosoi using mitochondrial DNA analysis. Med Mycol 37, 435-440. Kong F, Tong Z, Chen X, Sorrell T, Wang B, Wu Q, Ellis D, Chen S, 2008. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification. J Clin Microbiol 46, 1192-1199. Koo S, Klompas M, Marty FM, 2010. Fonsecaea monophora cerebral phaeohyphomycosis: case report of successful surgical excision and voriconazole treatment and review. Med Mycol 48, 769-774. Larone DH, 2002. Medically important fungi: a guide to identification, 4th ed ed. Washington, D.C. Maiz L, Cuevas M, Lamas A, Sousa A, Quirce S, Suarez L, 2008. [Aspergillus fumigatus and Candida albicans in cystic fibrosis: clinical significance and specific immune response involving serum immunoglobulins G, A, and M]. Arch Bronconeumol 44, 146-151. Najafzadeh MJ, Vicente VA, Klaassen CHW, Bonifaz A, Gerrits van den Ende AHG, Menken SBJ, de Hoog GS, 2011. Molecular epidemiology of Fonsecaea species. Emerg. Infect. Dis. 17. 464-9. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS, 2009. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 47, 17-25. Najafzadeh MJ, Sun J, Vicente VA, Xi L, Gerrits van den Ende AHG, de Hoog GS, 2010. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med Mycol 48, 800-806. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A, 2009. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 47, 3-15. Salgado CG, da Silva JP, Diniz JA, da Silva MB, da Costa PF, Teixeira C, Salgado UI, 2004. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Rev Inst Med Trop Sao Paulo 46, 33-36. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP, 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 43, 465-472. Tanabe H, Kawasaki M, Mochizuki T, Ishizaki H, 2004. Species identification and strain typing of Fonsecaea pedrosoi using ribosomal RNA gene internal transcribed spacer regions. Nippon Ishinkin Gakkai Zasshi 45, 105-112. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, de Hoog GS, Zhao J, Pizzirani- Kleiner A, 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 61, 137-144. Yaguchi T, Tanaka R, Nishimura K, Udagawa S, 2007. Molecular phylogenetics of strains morphologically identified as Fonsecaea pedrosoi from clinical specimens. Mycoses 50, 255-260. Zeppenfeldt. G, Richard-Yegres N, Yegres F, Hernandes R, 1994. Cladosporium carrionii: hongo dimorfico en cactaceas de la zona endemica para la cromicosis en Venezuela. Revista Iberoam Micol 11, 61-63. Zhou X, Kong F, Sorrell TC, Wang H, Duan Y, Chen SC, 2008. Practical method for detection and identification of Candida, Aspergillus, and Scedosporium spp. by use of rolling-circle amplification. J Clin Microbiol 46, 2423-2427. Chapter I0

121 Chapter 10

Acknowledgements The work presented in this book would never have been completed without the help and support of many people. I take this opportunity to thank all those people who collaborated and helped me directly or indirectly, in this thesis. First of all, thanks to God, the merciful and the passionate, for providing me the opportunity to step in the excellent world of the sciences. I also would like to thank Ministry of Health and Medical Education of Iran and Mashhad University of Medical Sciences, Mashhad, Iran from where I was awarded a scholarship for financial support. I am heartily thankful to my promotor, Prof. Dr. Sybren de Hoog, for giving me the opportunity to do my PhD in his research group at CBS. Dear Sybren, Thank you for kind invitation, excellent supervision and patient guidance, motivation, ideas, encouragement, advice, valuable discussions and critical reading of the manuscripts. I really enjoyed working with you and your group and appreciate your optimistic words. Your office was always open for me to discus both scientific and personal issues. Finally I would like to thank you again for all the time you spent on revising my manuscripts, despite the fact that you were very busy. I would like to express my deepest gratitude to my second promotor, Prof. Dr. Steph Menken from UvA. Dear Steph, thank you for your great suggestions and advice through my PhD period and for your critical review of my manuscripts and valuable comments. I would like to express my gratitude to Dr. Jacques Meis for giving me the opportunity to do part of my scientific studies in Canisius Wilhelmia Hospital (CWZ) in Nijmegen. Dear Jacques, I enjoyed working with you and all the discussion we had over science, especially AFLP and AFST. Thanks for scientific comments of the manuscripts that made them better. I am grateful to my dissertation committee members: Prof. Dr. P.H. van Tienderen, Prof. Dr. M.J. Teixeira de Mattos, Prof. Dr. G. Haase, Dr. W. van de Sande and Dr. J.F.G.M. Meis for their time, interest, and helpful comments. I would like to express my thanks to Bert Gerrits van den Ende and Kasper Luijsterburg, my daily supervisors, who helped me from the very beginning of my study until the end. Dear Bert, I really enjoyed working with you, you are wonderful and a man of many talents, thank you for everything, your teaching, you patience, your flexibility. Dear Kasper, thank you for doing such a nice lay out for my thesis and your technical expertise and computer assistance. My sincere gratitude to Dr. Cecile Gueidan for her collaboration with my first paper and Dr. Ewald Groenewald for his help to submit the sequences of my genes to GenBank. My special thanks go to Dr. Richard Summerbell, who helped me to find a PhD position and for introducing me to Prof. de Hoog. I would like to acknowledge to Dr. Corné H. Klaassen, Ilse Curf-Breuker, Ferry Hagen, Corina Bens and Erik Geertsen of the Department of Medical Microbiology and Infectious Disease, Canisius Wilhelmina Hospital (CWZ) in Nijmegen for their excellent scientific

122 Disscusion collaboration and helpful discussions. All the staff members of the CBS-KNAW Fungal Biodiversity Centre have been very helpful and kind to me. I would like to thank you all for your great support and help during my study, which provided me a pleasant stay in the Netherlands. I will not be able to list all the names here, but I would like to express my gratitude to all staff members of culture collection (especially Marlene, Trix, Yda, Diana, Hanslin) for providing cultures, the media preparation team for providing media and reagents, the IT team for solving the computer problems, the facility and financial department team for taking care of orders and the cleaning team for providing a clean working environment. Special thanks to Susann Maas from the personnel office for arranging my visa and all procedures with Dutch immigration. She was always ready to help. I thank Manon, Tineke, Marjan and Rosali for their help and collaboration. I would like to show my gratitude to the scientific staff members of CBS, PhD students, postdocs and guest researchers: Jan, Jos, Richard, Timon, Neriman, Ursula, Dong, Vincent, Bart, Saulo, Rolf, Ferry, Lorenzo, Kantarawee, Ewald, Marizeth, Ulrike, Alexandrina, Joyce, Lute, Henk, William, Hamid, Qiaoyun, Bert, Kasper, Anne, Cecile, Vania, Joost, Sylvia, Hugo, Mahdi, Somayeh, Shuwen, Jingsi, Jiufeng, Peying, Ditte, Kittipan and Hesti for your support and valuable discussions we had during Monday morning CBS seminars and during my study. I am grateful to Dr. Abdollahi, Dr. Meshkatoddini and Mr Nazemi, scientific representatives of Iranian Students in Europe for their help and support. I would like to thank my colleagues in Mashhad and Tehran universities: Dr. Fata, Dr. Berenji, Dr. Mohajeri, Dr. Mokhtari, Dr. Naseri, Dr. Shamsian, Dr. Falahati, Dr. Oormazdi, Dr. Yazdanparast, Dr. Zeini and Dr. Kordbacheh for their encouragement, collaboration and scientific help. My time in Utrecht was made enjoyable in part due to the many Iranian friends: Mahdi (Vaezi), Jahangir, Vahid, Hamed, Hadi, Tokameh, Hossein, Bahram, Sadegh, Reza, Mahdi (Arzanlou), Somayeh, Mahdi (Davari), Hamid, Mohammad and their families. I would like to thank all of you for your invitation and emotional support. I owe my deepest gratitude to my parents for having encouraged me to study continuously and for their support during PhD. They have taught me about hard work and self-respect, about persistence and about how to be independent. Both have always expressed how proud they are of me and how much they love me. My Mother, especially, has played a great role in my progress, she always woke up me very early in the morning to study and she always said: “There is enough time to sleep after death, so work as long as you are alive”. Also, I want to thank my Brothers and Sisters for their emotional help, encouragement and understanding. I would like to express my gratitude to my Father, Mother, Brother and Sisters in law for their support, help and encouragement. Finally I would like to express my special gratitude to my wife, Maryam for the continuous Chapter and ever support, understanding, patience during the past years, and for so much time that you devoted to our sun and me. There is no word to express my gratitude to my little son, I0 Sadra. I owe an immeasurable debt and deep affection to Maryam and Sadra.

123 Chapter 10

Curriculum vitae Mohammad Javad Najafzadeh was born on September 16th 1977 in Mashhad, a city in North East of Iran. He studied at the Faculty of Basic Sciences, Iran University of Medical Sciences, Tehran, where he gained the degree of Bachelor of Laboratory Medical Sciences, in 2001. He continued with a 2.5 year postgraduate study and obtained Master’s degree in medical mycology at the same university. His master thesis was entitled:”Evaluation of susceptibility of conventional antifungal drugs with flow cytometry technique”. After completion of his master degree he returned to Mashhad and worked as lecturer in the Department of Parasitology and Mycology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran. In 2005 he received the first rank from all candidates in PhD entrance test of medical mycology and he received the grant for PhD degree from the Ministry of Health and Medical Education of Iran and Mashhad University of Medical Sciences, Mashhad, Iran. In 2006, he got the admission for PhD from Prof. Dr. G. S de Hoog and joined the Institute of Biodiversity and Ecosystem Dynamics (IBED), University of Amsterdam and the CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands. His research focused on biodiversity, pathogenicity, antifungal susceptibility and rapid identification of Fonsecaea and relatives under supervision of Prof. Dr. G.S. de Hoog and Prof. Dr. S.B.J. Menken. In the meantime, as a researcher he has collaboration with the department of Medical Microbiology and Infectious Diseases, Canisius Wilhelmina Hospital, Nijmegen, The Netherlands. After finishing his PhD study, he went back to Iran, and continued serving at the Department of Parasitology and Mycology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran.

List of publications: Mootha V, Shahinpoor P, Sutton D. A, Xin L, Najafzadeh MJ, de Hoog GS (2011). Identification problems with sterile fungi, illustrated by a keratitis due to a non-sporulating Chaetomium-like species. Med Mycol (accepted). Lackner M, Najafzadeh MJ, Sun J, Lu Q, de Hoog GS (2011). Rapid identification of Pseudallescheria / Scedosporium with Rolling Circle Amplification (RCA). (submitted). Najafzadeh MJ, Vicente VA, Sun J, Meis JF, de Hoog GS (2011). Fonsecaea multimorphosa sp. nov., a new opportunistic species of Chaetothyriales isolated from feline cerebral abscess. Fungal Biol. (in press). Sun J, Zhang J, Najafzadeh MJ, Badali. H, Li X, Xi L, de Hoog GS (2011). Melanization of a meristematic mutant of Fonsecaea monophora increases tolerance to stress factors while no effects on antifungal susceptibility. Mycopathologyia (in press). Sun J, Najafzadeh MJ, Zhang J, Vicente VA, Xi L, de Hoog GS (2011). Single-nucleotide polymorphism (SNP) based diagnostics of Penicillium marneffei by Rolling Circle Amplification (RCA). Mycoses (in press). Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, Seifert KA, Taylor JW, Wingfield MJ, Abaci O, Aime C, Asan A, Yan Bai F, de Beer ZW, Begerow D, Berikten D, Boekhout T, Buchanan P K, Burgess T, Buzina W, Cai L, Cannon PF, Crane JL, Damm U, Daniel HM, Diepeningen A D, Druzhinina I, Dyer PS, Eberhardt U, Fell JW, Frisvad JC, Geiser DM, Geml J, Glienke C, Gräfenhan T, Groenewald JZ, Groenewald M, de Gruyter J, Kellermann EG, Guo LD, Hibbett DS, Hong SB, de Hoog GS, Houbraken Y, Huhndorf SM, Hyde KD, Ismail A, Johnston PR, Kadaifciler DG, Kirk PM, Kõljalg U, Kurtzman CP, Lagneau PE, Lévesque CA, Liu X, Lombard L, Meyer W, Miller A, Minter DW, Najafzadeh MJ, Norvell L, Ozerskaya SM, Öziç R, Pennycook SR, Peterson SW, Pettersson OV, Quaedvlieg W, Robert V, Ruibal C, Schnürer J, Schroers HJ, Shivas R, Slippers B, Spierenburg H, Takashima M, Taşkın E, Thines M, Thrane U, Uztan AH, Raak M, Varga J, Vasco A, Verkley G, Videira SIR, de Vries RP, Weir BS, Yilmaz N, Yurkov A and Zhang N(2011). The Amsterdam Declaration on Fungal Nomenclature. IMA Fungus 2: 105–112. Najafzadeh MJ, Sun J, Vicente VA, Klaassen CHW, Bonifaz A, Gerrits van den Ende AHG, Menken SBJ, de Hoog GS (2011). Molecular epidemiology of Fonsecaea. Emerg Infect Dis 17: 464–469. Lu Q, Gerrits van den Ende AHG, Bakkers JM, Sun J, Lackner M, Najafzadeh MJ, Melchers WJ, Li R, de Hoog GS

124 Disscusion

(2011). Identification of Pseudallescheria/Scedosporium species by three molecular methods. J Clin Microbiol 49: 960–967. Fata S, Modaghegh H, Faizi R, Najafzadeh MJ, Afzalaghaee M, Ghasemi M, Mohammadian M, Meshkat M, Fata A (2011). Mycotic infections in diabetic foot ulcers. Jundishapur J Micro 4: 11–16. Badali H, Chander J, Gulati N, Attri A, Chopra R, Najafzadeh MJ, Chhabra S, Meis JF, de Hoog GS (2010). Subcutaneous phaeohyphomycotic cyst caused by Pyrenochaeta romeroi. Med Mycol 48: 763–768. Fata S, Derakhshan A, Bolourian AA, Sedaghat MR, Khakhshour H, Afzalaghee M, Meshkat M, Najafzadeh MJ, Fata A (2010). Mycotic keratitis, a study on etiologic agents, predisposing factors and the result of treatment among 44 patients. Med J Mashhad Univ Med Sci 53: 16–25. Najafzadeh MJ, Sun J, Vicente VA, Gerrits van den ende AHG, de Hoog GS (2010). Rapid detection and identification of fungal pathogens by rolling circle amplification (RCA) usingFonsecaea as a model. Mycoses (in press) doi:10.1111/j.1439-0507.2010.01995.x. Najafzadeh MJ, Sun J, Vicente VA, Gerrits van den Ende AHG, de Hoog GS (2010). Fonsecaea nubica, a new species of agent of human chromoblastomycosis revealed using molecular data. Med Mycol 48:800–806. Najafzadeh MJ, Badali H, Illnait-Zaragozi MT, de Hoog GS, Meis JF (2010). In vitro activities of eight antifungal drugs against 55 clinical isolates of Fonsecaea. Antimicrob Agents Chemother 54:1636–1638. Sun J, Najafzadeh MJ, Vicente VA, Xi L, de Hoog GS (2010). Rapid detection of pathogenic fungi of the genus Fonsecaea by Loop Mediated Isothermal Amplification. J Microbi Meth 80: 19–24. Badali H, Najafzadeh MJ, van Esbroeck M, van den Enden E, Tarazooie B, Meis JF, de Hoog GS (2010). The clinical spectrum of Exophiala jeanselmei, with a case report and in vitro antifungal susceptibility of the species. Med Mycol 48:318–327. Najafzadeh MJ, Falahati M, Poshang Bagheri K, Fata A, Fateh R (2009). Flow cytometry susceptibility testing for conventional anti fungal drugs and comparison with the NCCLS Broth Macrodilution Test. DARU 17: 94–98. Najafzadeh MJ, Rezusta A, Cameo MI, Zubiri ML, Yus M. C, Badali H, Revillo MJ, de Hoog GS (2010). Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol 48: 390– 393. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS (2009). Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 47: 17–25. Xi L, Sun J, Lu C, Liu H, Xie Z, Fukushima K, Takizawa K, Najafzadeh MJ, de Hoog GS (2009). Molecular diversity of Fonsecaea (Chaetothyriales) causing chromoblastomycosis in southern China. Med Mycol 47: 27–33. Vicente VA, Attili-Angelis D, Pie MR, Queiroz Telles F, Cruz LM, Najafzadeh MJ, de Hoog GS, Pizzirani-Kleiner A (2008). Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 6: 137–144. Badali H, C Gueidan, Najafzadeh MJ, Gerrits van den Ende AHG, de Hoog GS (2008). Biodiversity of the genus Cladophialophora. Stud Mycol 63: 175–191. Najafzadeh MJ, Falahati M, Akhlaghi L Poshang Bagheri K (2007). Susceptibility of clinical isolates of Candida species to conventional antifungal drugs. J Med School MUMS 50: 89–94.

Oral and poster presentations: Vicente VA, Najafzadeh MJ, Sun J, Robl D, de Hoog GS. Biodiversity of Fonsecaea sibling species isolated from endemic areas of chromoblastomycosis. 10th International Conference on Molecular Epidemiology and Evolutionary Genetics of Infectious Diseases (MEEGID), November 3–5, 2010, Amsterdam, The Netherlands (poster presentation). Najafzadeh MJ, de Hoog GS. Rapid identification and screening of fungi by loop-mediated isothermal amplification. 9th International Mycology Congress, August 1–6, 2010, Edinburgh, UK (oral presentation). Najafzadeh MJ, Vicente VA, Sun J, de Hoog GS. Fonsecaea nubica, a new species of agent of human chromoblastomycosis revealed using molecular data. 9th International Mycology Congress, August 1–6, 2010, Edinburgh, UK (poster presentation). Lackner M, Gerrits van den Ende AHG, Sun J, de Hoog GS, Najafzadeh MJ. RCA-based identification, a promising tool for environmental and clinical Pseudallescheria screening approaches 3rd International Workshop on Scedosporium May 6–8, 2010, Bonn, Germany Najafzadeh MJ, Vicente VA, Sun J, de Hoog GS. pathogenicity and epidemiology of Fonsecaea. Wetenschappelijke Voorjaarsvergadering NVMM & NVvM, April 20–21, 2010, Arnhem, The Netherlands (oral presentation)

Lackner L, Najafzadeh MJ, Kaltseis J, Sun J, de Hoog GS. Molecular identification and detection ofScedosporium/ Chapter Pseudallescheria strains. Wetenschappelijke Voorjaarsvergadering NVMM & NVvM , April 20–21, 2010,

Arnhem, The Netherlands (oral presentation). I0 Fata S, Derakhshan A, Bolourian AA, Sedaghat MR, Khakhshour H, Afzalaghee M, Meshkat M, Najafzadeh MJ, Fata A. Mycotic keratitis in Mashhad, Iran: Predisposing factors, etiologic agents & clinical manifestation. 14th ICID, March 9–12, 2010, Miami, Florida, USA (poster presentation).

125 Chapter 10

Najafzadeh MJ, Sun J, Vicente VA, Gerrits van den Ende AHG, de Hoog GS. Fonsecaea nubica, a new agent of human chromoblastomycosis revealed using molecular data. Nederlandse Vereniging voor Medische Mycologie, December 9th , 2009, Nijmegen, The Netherlands (oral presentation). Vicente VA, Pedroso C, Marques S, Resende MA, Queiroz-Telles F, Najafzadeh MJ. Chromoblastomycosis: the disease, its environmental agents, and environmental counterparts Nederlandse Vereniging voor Medische Mycologie, December 9th, 2009, Nijmegen, The Netherlands (oral presentation). de Hoog GS, Vicente VA, Najafzadeh MJ, Harrak J, Boeger W, Linhardt Saunte D. Black yeasts: Opportunists of cold- and warm-blooded animals ,Congrès de la Société Française de Mycologie Médicale, Jan 11–13, 2010, Martinique. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, de Hoog GS. Distribution and pathogenicity of Fonsecaea. The 17th Congress of the International Society for Human and Animal Mycology 2009, May 25–29, Tokyo, Japan (poster presentation). Najafzadeh MJ, Fata S, Derakhshan AA, Boloriyan AA, Fata A. Fungal keratitis associated with contact lens wear. The 17th Congress of the International Society for Human and Animal Mycology 2009, May 25–29, Tokyo, Japan (poster presentation). Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. 17th Congress of the International Society for Human and Animal Mycology 2009, May 25–29, Tokyo, Japan (poster presentation). Najafzadeh MJ, Gueidan C, Gerrits van den Ende AHG, de Hoog GS. Multilocus sequence typing (MLST) of the pathogenic genus Fonsecaea. KNAW Symposium: Fungi and Health, November 13–14, 2008, Amsterdam, The Netherlands (poster presentation). Badali H, de Hoog GS, Gerrits van den Ende AHG, Najafzadeh MJ. Environmental Chaetothyriales have an infectious potential. International Congress of Mycology, August 5–9, 2008, Istanbul, Turkey (poster presentation). Najafzadeh MJ, Gerrits van den Ende AHG, de Hoog GS. Separation of the species of Fonsecaea on the basis of genealogical concordance phylogenetic species recognition Wetenschappelijke Voorjaarsvergadering NVMM & NVvM, April 1–2 ,2008, Arnhem, The Netherlands (oral presentation). Najafzadeh MJ, Gerrits van den Ende AHG, de Hoog GS. Molecular phylogeny of Fonsecaea species based on ITS rDNA data. 1st International Congress on Health Genomics and Biotechnology, November 24–26, 2007, Tehran, Iran (poster presentation). Badali H, Gerrits van den Ende AHG, Najafzadeh MJ, de Hoog GS. Biodiversity of the genus Cladophialophora, agents of human infection. 3rd Trends in Medical Mycology, October 28–31, 2007, Torino, Italy (poster presentation). Najafzadeh MJ, Falahati M, Fata A, Poshang Bagheri K. Flow cytometry susceptibility testing for conventional anti fungal drugs and comparison with the NCCLS Broth Macrodilution Test. 3rd Trends in Medical Mycology, October 28–31, 2007, Torino, Italy (poster presentation). Najafzadeh MJ, Badali H, Gerrits van den Ende AHG, de Hoog GS. Multilocus Sequence Typing (MLST) of the pathogenic genus Fonsecaea. 3rd Trends in Medical Mycology, 28–31 October 2007, Torino, Italy (poster presentation).

Courses & workshops: 1. Searching public patent databases, June 23, 2011, Amsterdam, The Netherlands. 2. CBS symposium One Fungus One Name (1F=1N), April 19–20, 2011, Amsterdam, The Netherlands. 3. The dynamics of zygomycete research in a changing world, A workshop on Zygomycete biodiversity, March 3–5, 2011,Utrecht, The Netherlands. 4. ISHAM black yeast workshop, Emerging potential of black yeasts, May 14–16, 2010, Ljubljana, Slovenia. 5. Joint meeting on “Fungal Bioinformatics and Medical Mycology” November 12, 2010, Wageningen, The Netherlands. 6. Autumn meeting of the Netherlands Society of Microbiology, section mycology, November, 26, 2010, Utrecht, The Netherlands. 7. CBS Course Medical Mycology, March 15–26, 2010. CBS Fungal Biodiversity Centre, Utrecht, The Netherlands. 8. Revolution in Evolution? Epigenetic in Ecology and Evolution. September 18, 2009, Royal Netherlands Academy of Sciences (KNAW), Amsterdam, The Netherlands. 9. Biological safety course, April 14–24, 2008, Utrecht, The Netherlands. 10. PhD Course “Molecular Phylogenies: Reconstruction & Interpretation. October 13–17, 2008,Wageningen University, The Netherlands. 11. ISHAM black yeast workshop, Black Yeasts between Extremotolerance and Human Pathology”. April 26–28, 2007, CBS Fungal Biodiversity Centre, Utrecht, The Netherlands. 12. Introduction to Phylogenetic Analysis. 22–26 January, 2007, University of Leiden, The Netherlands.

126 Disscusion Chapter I0

127