Thesis Reference

Thesis

Exploring regulation and expression of the Abd-B Homeotic Gene using BAC technology in Drosophila: a new role in reproduction

GLIGOROV, Dragan

Abstract

We discovered that the hox gene Abdominal B is specifically expressed in the secondary cells of the Drosophila male accessory gland. Using an Abd-B BAC reporter coupled with a collection of genetic deletions, we discovered an enhancer in the iab-6 regulatory domain that is responsible for Abd-B expression in these cells removal of which results in visible morphological defects in the secondary cells. Mates of iab-6 mutant males show defects in long-term egg laying and suppression of receptivity phenotypes. These data for the first time uncovered part of the function of the secondary cells. Transcriptome analysis from WT and mutant accessory glands led us to consider a list of 73 target genes that are down regulated in the mutant gland. The results RNAi experiments on these genes are presented in detail within the thesis. Interesting case of transvection as well as Gal4 toxicity are also included in these thesis.

Reference

GLIGOROV, Dragan. Exploring regulation and expression of the Abd-B Homeotic Gene using BAC technology in Drosophila: a new role in reproduction. Thèse de doctorat : Univ. Genève, 2013, no. Sc. 4562

URN : urn:nbn:ch:unige-290620 DOI : 10.13097/archive-ouverte/unige:29062

Available at: http://archive-ouverte.unige.ch/unige:29062

Disclaimer: layout of this document may differ from the published version.

1 / 1 UNIVERSITE de GENEVE FACULTE DES SCIENCES Département de génétique et evolution Professeur François Karch

Exploring Regulation and Expression of the Abd-B Homeotic Gene Using BAC Technology in Drosophila: A New Role in Reproduction

THESE

Présentée à la Faculté des Sciences de l’Université de Genève

pour obtenir le grade de Docteur ès sciences, mention biologie

par

Dragan Gligorov de Macédoine

Thèse No – 4562 -

Genève Atelier d’impression ReproMail

Mai 2013 Table of content

Résumé français 3

Summary 7

Introduction 11

Abd-B regulation 11

The domain model 14

Long-distance interaction in the BX-C 18

Transvection 18

Boundary Elements in Long-Distance Chromatin Interactions 20

Results 24

Part I. Ectopic trans-activation of Abd-B in the salivary gland by the 24 Abd-B Gal4 Bac

Adult salivary gland shows ectopic Abd-B expression 26

DNA FISH 28

Salivary gland morphological phenotype 30

Secondary cell enhancer studies suggest Gal-4 toxicity 35

Conclusion 41

Part II. A novel function for Abd-B in the male accessory gland 43

Creation of BAC reporters/fusions for Abdominal-B 47

Previously unknown location of Abd-B expression in adult flies 51

Secondary cell enhancer 55

Abd-B expression in secondary cells is independent of the initiator 61

Part III. Dissection of the secondary cell transcriptome 62

RNAi 64

Preliminary in situ hybridization results 69

Abd-Bm ISH 70

Antibody development 71

Vacuolar markers 71

Discussion 74

New insights into Abd-B regulation 74

Initial observation from the mRNA-seq data 77

Possible crosstalk between the different cell types in the 79 male reproductive system Cluster or group of genes are simultaneously regulated 80

RNAi of candidate genes 81

The vacuoles 83

Abd-Bm in situ hybridization 84

My Summary 86

Materials and Methods 89

Appendix 113

Table 1. The 73 candidate genes, predicted molecular function, maximal tissue 113 expression Table 2. RNAi experiment egg laying and secondary cell morphological data 116

References 120

My First Paper ( added as a pdf print out from the journal PLOS Genetic with supplementary figures ) After

page. A novel function for the hox gene abd-B in the male accessory gland regulates the long-term 130 female post-mating response in Drosophila.

Résumé français

Les gènes homéotiques (également connus sous le nom de gènes architectes, ou gènes Hox) sont connus pour le rôle qu’ils jouent dans la détermination des structures qui se forment le long de l’axe antéropostérieur des organismes à symétrie bilatérale. C’est l’analyse génétique chez la drosophile ( Drosophila melanogaster) qui a conduit à l’identification des gènes homéotiques, grâce à la découverte de mutations qui transforment les antennes des drosophiles en pattes, ou des mutations qui conduisent à l’apparition de mouches avec 2 paires d’ailes au lieu d’une seule.

De façon très intrigante, les gènes architectes sont arrangés le long du chromosome dans le même ordre que les segments qu’ils spécifient le long de l’axe antéropostérieur. De façon encore plus remarquable cette correspondance entre organisation génomique et axe antéro-postérieur a

été conservée au cours de l’évolution, et des complexes similaires de gènes architectes (ou complexes Hox) se retrouvent chez les vertébrés, les mammifères et chez l’homme. Au cours de mon travail de thèse j’ai étudié la régulation du gène homéotique Abdominal-B (Abd-B) qui appartient au complexe bithorax et qui détermine l’identité des segments abdominaux postérieur de la drosophile (A5 à A8). Le gène Abd-B est très complexe et occupe avec ses séquences régulatrices beaucoup d’espace sur le chromosome. Afin de mieux comprendre son mode de régulation, nous avons créer un chromosome artificiel d’origine bactérienne qui exprime une protéine fluorescente de méduse (GFP) dans le contexte génomique normal d’Abd-B.

L’expression de la GFP mimant celle du gène Abd-B, peut alors être suivie in vivo, en observant des embryons, larves ou mouches adultes à la lumière ultra-violette. J’ai ainsi découvert, que le

3 gène Abd-B est exprimé dans les « glandes accessoires » de l’appareil reproductif mâle. Ces

« glandes accessoires », (qui pourraient s’apparenter à la prostate chez l’homme), synthétisent un cocktail de peptides qui composent le liquide séminal et qui modifient le comportement des femelles une fois l’accouplement terminé. Lors de l’accouplement, la drosophile femelle reçoit le sperme qu’elle stocke dans des structures spécialisées, les spermathèques et les glandes séminales, pour féconder de manière autonome les nombreux ovoyctes qu’elle libère durant la dizaine de jours suivants. Ce sperme contient en plus des spermatozoïdes, des composés, parmi lesquels le « sex peptide » qui induit chez la femelle, des transformations physiologiques telles que la stimulation de l’ovogenèse ou du système immunitaire, ainsi qu’un changement de comportement. Les femelles fraichement fécondées repoussent les sollicitations d’autres mâles.

En d’autres termes, en transférant son « sex petide », le male s’assure de l’exclusivité de la transmission de ses propres gènes. Les « glandes accessoires » sont des organes tubulaires composés d’un millier de cellules d’origine mésodermale (les cellules principales). A l’extrémité distale de la glande se trouvent une soixantaine de cellules (dites secondaires) à la morphologie clairement distincte du reste des cellules de la glande, par la présence de grandes vacuoles dans leur cytoplasme. Le gène Abd-B est exprimé spécifiquement dans ces cellules secondaires. En puisant dans la collection d’allèles du laboratoire , j’ai identifié une mutation qui élimine l’expression d’ Abd-B dans les cellules secondaires des glandes accessoires. La perte de l’expression d’ Abd-B dans ces cellules ne cause pas leur transformation en cellules principales. Le gène Abd-B n’agit donc pas comme déterminant de l’identité cellulaire dans les glandes accessoires. Les cellules secondaires restent secondaires, mais les vacuoles présentes dans leur cytoplasme disparaissent. Cette mutation n’a aucune autre conséquence sur la spécification des segments abdominaux et les mouches éclosent avec une morphologie externe

4 parfaitement normale.. En collaboration avec le laboratoire de Mariana Wolfner de l’Université de Cornell dans l’état de New York, nous avons démontré que les femelles fécondées par les males mutants ne repoussent plus les nouveaux courtisans après un accouplement. En référence

à ce phénotype cet allèle a été baptisé iab-6cocu . Le « sex peptide » qui est synthétisé par les cellules principales est bien transmis aux femelles. Mais, s’il reste détectable pendant une dizaine de jours chez les femelles fécondées par des males normaux, le « sex peptide » disparaît beaucoup plus rapidement des femelles fécondées par des males iab-6cocu . Cette découverte a une certaine résonnance dans le petit monde intéressé par la question du changement de comportement des femelles suite à l’accouplement, car elle démontre l’importance des cellules secondaires des glandes accessoires. L’existence de deux types cellulaires distincts dans les glandes accessoires, cellules primaires et secondaires et l’expression du gène Abd-B uniquement dans ces dernières, suggère un mécanisme de compartimentation. On peut imaginer que le liquide séminal doit être activé lors de l’éjaculation, pour que le « sex petide » soit stabilisé une fois transféré à la femelle.. Des expériences dites de « proteomic » ont permis l’identification d’environ 180 protéines spécifiques des glandes annexes (appelées Acps pour « Accessory gland-specific proteins). Avec notre nouvelle lignée exprimant la GFP spécifiquement dans les cellules secondaires et l’identification de la mutation qui élimine l’expression d’ Abd-B dans ces mêmes cellules, le laboratoire dispose de nouveaux outils pour identifier les Acps spécifiques des cellules secondaires et ainsi mieux comprendre la complexité de la biologie de la reproduction chez la drosophile.

Ces observations pourraient également apporter un éclairage sur des questions évolutives.

L’arrangement des gènes homéotiques au sein des complexes Hox reflète l’ordre des segments ou métamères dans lesquels ils sont actifs. Le gène Abd-B et ses homologues chez les vertébrés

(hox10-13) sont positionnés à l’extrémité des complexes Hox active dans les segments ou métamères postérieurs de l’embryon. Chez la drosophile, le gène Abd-B est actif dans les segments abdominaux 5 à 8 et dans la « primordia » qui va donner naissance aux structures génitales externes. Cependant, chez des insectes plus primitifs tels que la sauterelle, ou chez les araignées, le gène Abd-B n’est exprimé que dans les structures génitales externes. Cette observation a incité plusieurs chercheurs à proposer que la fonction ancestrale du gène Abd-B

était de spécifier les structures génitales externe et qu’il avait été recruté plus tard au cours de l’évolution, comme gène de spécification des segments abdominaux postérieurs. Chez les mammifères les gènes Hox10-13 (homologues du gène Abd-B) sont également actifs dans le bouton génital, la prostate et la glande séminale. Ainsi, cette conservation de l’expression dans la prostate chez les mammifères et dans les glandes accessoires chez les drosophiles pourrait renforcer l’hypothèse que la fonction primordiale du gène Abd-B chez les arthropodes et de ses homologues hox10-13 chez les mammifères serait de spécifier les organes de reproductions. La position d’ Abd-B et de ses homologues hox10-13 au sein des complexes Hox expliquerait la raison pour laquelle les organes génitaux se développent toujours à l’extrémité postérieure des organismes à symétrie bilatérale.

Summary

Homeotic genes (also known as “architect genes”, or Hox genes) are known for their role in the specification of the structures that form along the anteroposterior axis of bilateria (organisms from the animal kingdom with bilateral symmetry at the same stage of development). Homeotic genes were discovered almost a century ago in Drosophila through the identification of mutations that transform antennas to legs, or mutations that lead to the emergence of flies with 4 wings instead of 2. Strikingly, these architect genes are arranged along the chromosome in the same order as the body segments they specify along the anteroposterior axis of the fly.

Furthermore this remarkable correspondence between genomic organization and anteroposterior axis has been conserved through evolution, and similar complexes of architect genes (Hox complex) are found in other invertebrates, in vertebrates, mammals and human. During my thesis work, I have analyzed the regulation of the Abd-B homeotic gene from the bithorax complex (BX-C) in Drosophila. The Abd-B gene species the identities of the segments that form the posterior abdomen of the fly (A5 to A8). The Abd-B gene is quite complex with regulatory regions that are spread over large regions of DNA. In order to better understand how it is regulated, I have reconstructed the entire Abd-B locus on a bacterial artificial chromosome. In this reconstituted locus however, the Abd-B coding sequences were replaced by sequences coding for a green fluorescent protein from jellyfish (GFP). After introducing this large construct into the fly genome, one can follow Abd-B expression in living embryos, larvae or adults flies by simple illumination with ultraviolet light under the microscope. This procedure

7 enabled me to discover that Abd-B is expressed in the "accessory glands" of the male reproductive tract. The "accessory glands" (which correspond to the male prostate and seminal vesicles in mammals) is responsible for the synthesis of a cocktail of proteins that constitute the seminal fluid. Some of these proteins have the power to change the female’s behavior after mating (the so-called post-mating response or PMR). It should be noticed that in Drosophila , females store the sperm in specialized structures (called spermathecae and seminal receptacles).

This storage enables the female to fertilize autonomously, the many oocytes that she will release during ~10 days that follow mating. In addition to transmitting his sperm, the male adds a cocktail of proteins, including the “sex peptide”, which will elicit different physiological and behavior changes in the female, ensuring thereby optimal use of his sperm. Among these changes (eg, stimulation of oogenesis or of the immune system), freshly fertilized females reject other courting males for a period of about 10 days after mating. In other words, by transferring his "sex petide", the male ensures the fidelity of the female for a period of ten days. The induced physiological changes in the female result in a genetic advantage for the genes of the copulating male in populating the next generation. Accessory glands are tubular organs composed of a thousand cells of mesodermal origin named the “main cells”. At the distal end of the gland, there are about 40 cells per lobe (the secondary cells) that are clearly distinguishable from the main cells by the presence of large vacuoles in their cytoplasm. Abd-B is specifically expressed in these secondary cells. Looking in the large collections of Abd-B alleles available in the laboratory, I have identified a small deletion that eliminates Abd-B expression in these secondary cells. The loss of expression of Abd-B does not cause the transformation of secondary cells into main cells. Thus, Abd-B does not act as a determinant of cell identity in the accessory glands.

While the secondary cell fate is not affected in the mutant, the cells appearance changes as

8 revealed by the loss of their characteristic large vacuoles. The small deletion that eliminates expression of Abd-B in the secondary cells has no other effect on the specification of the abdominal segments and flies hatch with a completely normal external morphology. However, male fertility is affected. In collaboration with the laboratory of Mariana Wolfner from Cornell

University in upstate New York, we have discovered that females fertilized by the mutant males do not exhibit the long-term behavioral change post mating and do not reject subsequent courtship by males. In reference to this phenotype the allele was named iab-6cocu . The "sex peptide" which is synthesized by the main cells is transmitted to females. But although the "sex petide" remains detectable in females for ten days after mating by normal males, it disappears much faster in females fertilized by iab-6cocu males. This finding has some importance in the small community interested in the post mating response, because it demonstrates the importance of the secondary cells in this process. The existence of two distinct cell types in the accessory glands suggests a mechanism of compartmentalization. One can imagine that the seminal fluid must be enabled upon ejaculation, so that the "sex petide" is stabilized once transferred to the female. In general, the vacuoles are formed by the fusion of small vesicles involved in intracellular trafficking and in secretion. One can imagine that the large vacuoles of the secondary cells are the storage site of compounds that must be strictly separated from other compounds synthesized by the main cells. Proteomic technology led to the identification of 208 Accessory gland-specific proteins (Acps). With the Drosophila line expressing GFP specifically in secondary cells and with the identification of the mutation that eliminates expression of Abd-B specifically in these cells, the laboratory has now powerful tools to identify Acp specific for the secondary cells and to better understand the complexity of the biology of reproduction in

Drosophila .

These findings may also have evolutionary implications. During embryogenesis, the establishment of the anteroposterior axis in organisms with bilateral symmetry such as worms, arthropods or vertebrates, proceeds by segmentation and/or metamerisation into repetitive structures. Each segment, or metamer, subsequently acquires an identity through the activity of the homeotic genes. As mentioned above, the arrangement of homeotic genes in the Hox complex reflects the order of the metamers or segments in which they are active. The Abd-B gene, and its orthologous counterparts in vertebrates (hox10-13), are positioned at the end of the

Hox complexes and are active in the posterior segment or metamers. In Drosophila, Abd-B is active in abdominal segments 5 to 8/9, as well as, in the "primordia" of the external genital structures (the so-called genital disc). However, in more primitive insects such as grasshoppers and in spiders, the Abd-B gene is solely expressed in the external genital structures. This observation has led several researchers to propose that the ancestral function of the Abd-B gene was the specification of the external genital structures, and that Abd-B was later recruited during evolution as a gene to specify posterior abdominal segments. Interestingly, the function of the

Abd-B class genes in seminal protein producing tissues seems to be an ancient and conserved function, as the orthologs of Abd-B in mammals, the hox10-13 class of genes, are expressed in the mammalian prostate and seminal vesicle. This conservation of function supports the hypothesis that the primary function of the Abd-B gene in arthropods (and its hox10-13 counterparts in mammals) is the specification of the genital structures. The position of Abd-B and its counterparts within the Hox clusters may explain why the reproductive organs always develop at the posterior end of bilateria.

INTRODUCTION

Abd-B regulation

The homeobox-containing transcription factor, Abdominal B (Abd-B), determines the segmental identity of the last five segments of the fly (the 5 th through 9 th abdominal segments)

(Figure 1). Together with the abdominal-A (abd-A) and Ultrabithorax (Ubx ) genes, Abd-B makes up one of the two Drosophila homeotic gene clusters, known of as the Bithorax complex

(BX-C) (Lewis 1954), (Maeda and Karch 2006). These three genes are responsible for patterning the posterior 2/3 of the fly, from the posterior thorax to the posterior tip of the abdomen.

Figure 1. Diagram of the BX-C. The multicolored bar represents the DNA of the BX-C. Map coordinate numbering follows the numbering established by the original Drosophila Genome Project sequencing of the BX-C (Martin et al.,1995). The three BX-C homeotic genes, Ubx , abd-A and Abd-B are indicated below this bar (with exons indicated by the black horizontal bars and introns indicated by the diagonal lines connecting the bars). The individual cis- regulatory domains are indicated by the different colored regions on this bar. The orange and red regions ( abx/bx and bxd/pbx ) control Ubx expression. The regions shaded in blue ( iab-2, 3 and 4) control abd-A expression. And theregions shaded in green ( iab-5 through iab-8) control Abd-B expression. The corresponding adult segments affected by mutations in each cis -regulatory region are indicated on the diagram of the adult fly using the same color code. ( Figure adopted from Maeda and Karch 2006 - The ABC of the BX-C: the bithorax complex explained ) 11

As alluded to above, the Abd-B transcription factor is expressed in the 5 th through 9 th abdominal segments of the fly. In the embryo, however, where segmental borders are not easily seen until later stages, metameric units known as parasegments (PSs) are generally used to describe expression patterns. Early in embryonic development the Drosophila embryo is divided into 14 PSs by the products of the gap and pair-rule genes. Each embryonic PS roughly corresponds to the posterior half of one future adult segment and the anterior half of the next adult segment. Abd-B is thus expressed in embryonic PS 10-14 of the Drosophila embryo

(Figure 2). In this thesis, I will use both segment and/or parasegment nomenclature depending upon the stage of development referred to.

Figure 2 . The Drosophila embryo is metamerized into 14 parasegments. The segments and parasegments are slightly shifted relative to one another. In the thorax and the abdomen, this shift is approximately half a segment, meaning that a parasegment comprises the posterior half of one segment and the anterior half of the next. For example, PS6 comprises the posterior of segment T3 and the anterior segment A1. ( Figure adopted from Maeda and Karch 2006 - The ABC of the BX-C: the bithorax complex explained )

The expression of Abd-B is set very early in development and can be detected at the protein level by about 3-4 hours of embryonic development (Celniker, Keelan et al. 1989). There are two isoforms of Abdominal B , the “morphogenic” (m) form, which is expressed in parasegments 10-13, and the “regulatory” (r) form, which is expressed only in parasegment 14.

Expression of both Abd-B isoforms is controlled by a large cis -regulatory region that spans about

100kb. Mutational analysis has subdivided this region into four cis -regulatory domains, called infrabdominal (iab ) domains, each seemingly controlling the expression of the Abd-Bm isoform in a specific parasegment of the embryo (Lewis 1978; Zavortink and Sakonju 1989). For example, the iab-5 domain controls the expression of Abd-Bm in PS10 (making up the visible portion of the Abdominal segment 5 (A5) of the adult fly). Meanwhile, the iab-6 domain controls the expression Abd-Bm in PS11 (A6 of the adult fly) (Figure 1). Interestingly, these iab domains are aligned along the chromosome in an order colinear to the segments in which they function along the A-P axis.

Genetic data suggests that only one iab domain controls Abd-B expression in a given parasegment of the embryo (Mihaly, Barges et al. 2006). This is supported by the fact that deletion of a single domain generally affects the development of only one parasegment. In parasegments anterior to where a domain is required to activate transcription, Abd-B is thought to be kept in a repressed state by the Polycomb repression system (Zink and Paro 1989; Zink,

Engstrom et al. 1991). Given the complex regulatory interactions in the BX-C, it has become a model system to study gene expression and the interplay between chromatin structure and gene expression.

Since the identification of the cis-regulatory domains of the BX-C, these domains have been dissected using transgenic reporter assays to identify individual regulatory elements capable of modifying reporter gene expression. This analysis has revealed that each cis -regulatory domain of the BX-C seems to be composed of a similar set of cis -regulatory elements (for a review see (Maeda and Karch 2006)). Among the elements identified were early embryonic enhancers (also called initiators), cell-type-specific enhancers, silencers and insulators.

Interestingly, although homeotic gene expression is restricted along the A-P axis, many of the

13 elements identified by transgenic analysis only control reporter gene expression in a tissue- specific manner, but not in an A-P position-restricted manner. Thus, within their normal genomic context, the cis-regulatory elements must be modulated by other cis-regulatory elements to gain

A-P restriction. These data have led to the driving hypothesis in BX-C research where the cis- regulatory elements of the BX-C are controlled as a group through the activation or repression of parasegment-specific (PS-specific) chromatin domains (Peifer, Karch et al. 1987; Bender and

Hudson 2000).

The domain model

According to this model, the BX-C functions through multiple layers of control. First, there are the enhancers that directly activate homeotic gene expression in a pattern appropriate for a specific segment. These are the cell-/tissue-specific enhancers. Numerous elements of this type have been found in the BX-C including enhancers driving gene expression in the CNS, epidermis and gut mesoderm (Mihaly, Barges et al. 2006). Genetic deletion analysis has shown that these enhancers are grouped so that all the enhancers required to produce a pattern appropriate for a given segment/parasegment are clustered into a single region of the BX-C cis - regulatory sequence. Once again, as the transgenic data reveals, these enhancers, on their own, drive gene expression in specific tissues, but are not restricted along the A-P axis.

The second layer of control comes from Polycomb-response element silencers (PREs).

Within each cis-regulatory domain there seems to be at least one PRE (and probably multiple

PREs). These silencers are thought to turn off the clusters of enhancers in parasegments where they are not needed, via modification of the local chromatin structure around the enhancers

(Simon, Chiang et al. 1992; Orlando and Paro 1993; Chiang, O'Connor et al. 1995; Fitzgerald

14 and Bender 2001; Akbari, Bousum et al. 2006; Maeda and Karch 2006; Müller and Kassis 2006).

The stable gene silencing resulting from this modification of chromatin structure has led to these elements often being called maintenance elements. The maintenance activity of PREs can be observed in transgenic assays when combined with enhancers. For example, the iab-6 initiator fragment (a specific type of early embryonic enhancer, see below) drives reporter gene expression in PS11 and more- posterior parasegments early in development. Later, this pattern becomes disrupted and, depending upon transgene insertion site, reporter gene expression becomes chaotic (Figure 3 A and B). Panels C and D show the case of the iab-5 initiator that contains also a PRE, the PRE element placed next to the iab-5 fragment preserves the reporter gene pattern of expression in the late embryo stages (Figure 3 C and D). This PRE can come from any domain, once again indicating that PREs do not, by themselves, sense postional information.

Figure 3 . Reporter constructs identify initiator and maintenance elements. Drosophila embryos immunostained for the B-galactosidase protein. (A,C) Early embryos at germband extension, where the posterior parasegments have curved around towards the dorsal side; (B,D) later stage embryos. ( A,B) Embryos in which lacZ expression is driven by an element from the iab-6 region. (A) In early embryos, lacZ expression is restricted to the posterior of the embryo, with its anterior border positioned at PS11. (B) At later stages of development, the repression of lacZ anterior to PS11 is lost, as the iab-6 element becomes active throughout the embryo. ( C,D) Embryos in which lacZ expression is driven by a DNA fragment derived from iab-5. (C) In early embryos, the anterior border of lacZ expression is positioned at PS10. (D) Later in development, the anterior border of lacZ expression is maintained, indicating the presence of both an initiator and a maintenance element on this fragment. ant., anterior; post., posterior. ( Figure adopted from Maeda and Karch 2006 - The ABC of the BX-C: the bithorax complex explained )

Domain boundary elements form a third layer of control. Each of the PS-specific enhancer clusters seems to be flanked by boundary elements. In situ , we have shown that loss of a domain boundary causes the fusion of PS-specific domains, resulting in mutant phenotypes, where the affected segments displays phenotypes characteristic of the more-posterior segment

(for review see (Gurudatta and Corces 2009; Maeda and Karch 2011)). For example, the deletion of the Fab-7 boundary, which lies between the iab-6 (controlling Abd-B expression in PS11/A6) and iab-7 domains (controlling Abd-B expression in PS12/A7), results in a homeotic transformation of A6 towards A7 (Gyurkovics, Gausz et al. 1990). In transgenic assays, these elements have been shown to behave as insulators, blocking both positive and negative effects of cis-regulatory elements on reporter gene activity (Hagstrom, Muller et al. 1996; Zhou, Barolo et al. 1996). These results have led to the hypothesis that domain boundary elements are required to maintain the autonomous function of each enhancer cluster from the influences of neighboring cis-regulatory domains. However, the presence of boundary elements cannot explain the A-P restriction of the BX-C regulatory elements. As with the enhancers and silencers, when taken out of the BX-C, boundary elements do not seem to have an A-P restricted activity.

The last layer of control is thought to be the initiator elements (Simon, Mark et al. 1990;

Qian, Capovilla et al. 1991; Mullerl and Bienz 1992; Zhou, Ashe et al. 1999; Shimell, Peterson et al. 2000). These elements, when taken out of the BX-C can sense an A-P positional address.

Indeed sequence analysis of known insulator elements shows that they contain binding sites for numerous maternal, gap and pair-rule genes. As each domain seems to have at least one initiator element, it was hypothesized that they might be hubs, controlling domain activation/repression.

This idea is supported by recent work from our lab. In this work, our lab showed that deletion of the initiator from iab-6 seemed to completely inactivate the iab-6 domain and that exchanging

16 the iab-6 initiator with that of iab-5 caused a homeotic transformation in which A5 took the identity of A6 (Iampietro, Cléard et al. 2008). These experiments showed, not only, that the iab-

6 initiator was necessary for domain function (other experiments showed that it was not sufficient), but that placing an initiator for iab-5 in the domain could activate the A6 enhancers one segment too anterior (in A5, where iab-5 is normally active).

Figure 4. Organization of a Abd-B regulatory domain. The upper portion of the figure represents the Abdominal B cis-regulatory region. The name of each domain is written bellow the line representing the region. On the lower portion of the figure is the zoomed in iab-6 domain. Within are marked the separate components of the the domain Init- initiator, PRE – polycomb response elements. The cylinder and the bar are tissue specific enhancers while the red circles are the boundaries of the domain. Within the simple model the relationship between the initiator the enhancers and the PREs is also represented. When the domain is active the initiator represses the PREs and allows the enhancers to activate Abd-B expression. ( Figure adopted from Maeda and Karch 2011 - Gene expression in time and space: additive vs hierarchical organization of cis-regulatory regions )

Taken together, we, and others, have proposed a domain model for BX-C gene regulation.

According to the domain model, initiator elements act early in development to set up the state of the domain, active/inactive. The maintenance elements conserve this state throughout development by compacting non-initiated domains into silenced, heterochromatic-like chromatin. In active domains, tissue-specific enhancers are free to interact with the promoter, leading to Abd-B expression in an A-P-restricted, tissue-specific manner. Meanwhile, the

17 boundary elements keep the each domain autonomous from the regulatory influences of the neighboring domains (Figure 4) (Mihaly, Barges et al. 2006).

Long-distance interaction in the BX-C

The domain model for BX-C gene regulation is now fairly well accepted. Yet, even if we accept the domain model as mostly true (an assumption that we now know has many exceptions), it remains only a schematic model for how the BX-C works. There remain a number of important details to be answered before a mechanistic understanding of the BX-C can be claimed.

One important question still remaining is how elements in such a large cis -regulatory region can find and control gene expression at a promoter located tens of kbs away? Furthermore, how can these elements find this promoter when competing with so many other elements capable of controlling gene expression at the same promoter?

Transvection.

The question of how enhancers in the BX-C find their target promoter is one that has troubled BX-C researchers for some time. Even before the stucture of the genes was known, studies of the phenomenon of transvection in the BX-C hinted that elements must exist in the BX-

C that aid gene expression across chromosomal distances.

In the 1950s, Ed Lewis uncovered different mutant combinations whose phenotypes varied depending upon chromosomal pairing. In general, these phenotypes increased in severity when one of the mutations was carried on a rearranged chromosome. Based on these results, he hypothesized that when chromosomes are paired, there must be a type of complementation that

18 occurs between them that helps the fly to compensate for specific mutations. He called this phenomenon, “transvection” (Lewis 1954).

In Drosophila , homologous chromosomes are paired in somatic cells. This pairing sometimes enables an enhancer from one chromosome to direct the expression of its gene target on a homologous chromosome (Lee and Wu 2006). Although the phenomenon of transvection has been observed at a number of fly loci, the BX-C remains a “hotspot” for examples of transvection. Because of this, a number of labs have tried to identify elements important for mediating transvection in the BX-C.

Both (Hopmann, Duncan et al. 1995) and (Sipos, Mihály et al. 1998) describe transvection events in the Abd-B cis -regulatory region. In both cases, they showed that deletions removing sequences around Abd-B could be complemented by deletions or rearrangements affecting in the cis -regulatory region controlling Abd-B expression. For example, a deletion of iab-7 (controlling Abd-B in PS12/A7) placed in trans over an Abd-B promoter deletion results in a phenotype that looks more or less wild type. Classical genetics would suggest that these flies should display an iab-7 phenotype (and A7 to A6 homeotic transformation), as the iab-7 chromosome should not be able to make Abd-B in PS12/A7 and the Abd-B mutant chromosome should not be able to make Abd-B at all. Using these types of phenotypes and different deletion mutations, Hopmann et al. identified a region downstream of the Abd-B transcription unit that is required to mediate this transvection event. Further dissection of this transvection mediating region (TMR) by the group of Mike Levine has suggested that the Fab-8 boundary or the nearby iab-8 PRE (both contained within the TMR fragment) may be the important elements mediating transvection (Zhou, Ashe et al. 1999). Sipos et al., on the other hand, showed the importance of the 5’ Abd-B promoter region, which they called the tethering region.

In terms of trans-acting elements mediating transvection, not much is known. Outside of the zeste (z) gene, which has been shown to be responsible for some transvection events outside of the BX-C, little has been discovered. It has been suggested that Polycomb group genes may play a role in transvection, as the finding of the iab-8 PRE in the TMR may suggest. Consistent with this idea is the fact that PREs display a transvection-like phenomenon called pairing- sensitive repression, where paired PREs silence more than non-paired PREs (Kassis, VanSickle et al. 1991). However, more recent microscopy studies, looking at long distance chromatin interaction between BX-C elements in cells, seem hint more to a role for the boundary elements in transvection than the PREs (Bantignies, Grimaud et al. 2003; Vazquez, Muller et al. 2006; Li,

Muller et al. 2011).

Boundary Elements in Long-Distance Chromatin Interactions

As mentioned above, each domain in the BX-C is thought to be bordered by elements called domain boundaries. In transgenic constructs, these domain boundary elements have the ability to act as insulators, blocking enhancer-promoter interactions when placed between the two elements. In the BX-C, however, we know that insulator activity is probably not the activity that domain boundaries perform, as many are located between enhancers and promoters that are known to interact. Since transgenic insulator activity is an artificial activity that could be explained through numerous mechanisms, we, and others, thought of possible mechanisms of domain boundary activity that might lead to insulator function on transgenes. One idea that arrose from these thoughts was that domain boundaries might be involved in mediating long distance chromatin interactions to help divide the BX-C into individual domains and potentially

20 aid in targeting domains to a promoter. This hypothesis was supported by a number of findings including those from the transvection studies mentioned above.

Studies on the Su(Hw) insulator from the gypsy retrotransposon also suggested that elements with insulator activity may mediate long-distance chromatin interactions. According to this work, enhancer controlled gene expression was shown to be blocked by one copy of a

Su(Hw) insulator when place between the enhancer and the promoter. However, when two copies of the insulator were placed between the enhancer and the reporter gene promoter, gene expression was restored. This blocking could not be explained by simply stating that two, nearby insulators cancel each other out, as a second reporter, placed in between the two Su(Hw) insulators was still blocked from responding to the enhancer (Cai and Shen 2001; Muravyova,

Golovnin et al. 2001). This led to the idea that the two insulators might be interacting to create chromatin domains (or loops), where adjacent domains were kept independent of neighboring cis -regulatory effects, but that domains further away could bypass these effects (Cai and Shen

2001; Muravyova, Golovnin et al. 2001).

Work from our lab showed that BX-C boundaries also mediate long distance interactions.

For this, we placed Gal-4 binging sites near the Fab-7 boundary element and used a Gal4-DNA binding domain-Dam methyltransferase fusion to perform Dam-ID. This work showed that targeting of the Dam methyl-transferase to the Fab-7 boundary led to methylation, not only at the

Fab-7 boundary, but also at the Abd-B promoter and, to a lesser extent, at the Fab-8 boundary

(Cléard, Moshkin et al. 2006). This “trans-methylation” meant that these three elements must be in close proximity within the nucleus. The finding that the Abd-B promoter was in close proximity to the Fab-7 boundary was consistent with a previous finding by Sipos et al., that suggested that an area near the Abd-B promoter, called the Promoter Proximal Tethering

Element, was required for long distance, enhancer-promoter interactions in the BX-C (Sipos,

Mihály et al. 1998). Interestingly, the Dam-ID methylation pattern changed depending on the A-

P position in the fly. Methylation at the promoter only occurred in the anterior areas of the fly.

In other words, Fab-7 seemed to be in close proximity to the Abd-B promoter in tissues where

Abd-B was silenced. Combining this finding with the phenotype of Fab-7 deletion mutants led to a model in which boundaries are attached to a tethering region near the promoter and be released sequentially as domains become active. This sequential releasing would allow distal enhancers to be sequestered near the promoter, and if released from the tethering region, able to interact with the Abd-B promoter to activate transcription (Figure 5).

Figure 5. Boundary tethering model. In this model, boundaries are represented by red circles, the inactive regulatory regions are covered by green circles (representing Polycomb silencing), and active regulatory regions are depicted by black lines. Based on the DamID results (Cleard et al., 2006), we believe that the boundaries tether the inactive cis - regulatory domains to a region near the Abd-B promoter. In doing so, boundaries form chromatin domains, keeping each domain autonomous and preventing the imbedded enhancers from interacting with the Abd-B promoter. Once a domain is activated, the boundary element would release from the tethering region and allow the formerly enclosed enhancers to interact with Abd-B promoter. For example, in A5, Mcp is released allowing the enhancers contained in iab-5 to activate Abd-B. Since the next downstream regulatory domain ( iab-6) is still tethered by the next boundary ( Fab- 6), only the appropriate regulatory iab-5 domain is able to regulate Abd-B in A5. The elements are not drawn to scale. (Figure adopted from Maeda and Karch 2007 – Making connections: boundaries and insulators in Drosophila )

Most of the cis -regulatory elements described above were identified and studied using P element transgenes, where fragments of interest were placed into a reporter and inserted randomly into the fly genome. Although this approach has proven to be quite useful, it has some drawbacks when studying complex regulatory regions, where chromatin structure impacts regulatory activities. Increasing the size of P-element transgenes to try to incorporate more complexity has proven problematic, as increasing transposon size rapidly decreases transformation efficiency. Thus, far, our lab has tried to bypass these problems by performing most of our experiments on mutations affecting the actual BX-C. Although we have developed tools to help streamline this process, outside of a few regions where we have good tools, this approach is slow and labor intensive. During my thesis, I have tried to use BAC-based transgenes to model the complexities of the BX-C, while keeping some of the experimental flexibility of transgenic reporter analysis.

RESULTS

Part I. Ectopic trans-activation of Abdominal B in the salivary glands by the

Abd-B-Gal4 BAC

Transvection is a phenomenon in which the regulatory sequences of a gene on one chromosome modify the expression of the gene allele on its homologous chromosome. A number of reports from both Drosophila (Lewis 1954; Henikoff and Dreesen 1989; Geyer, Green et al.

1990; Dreesen, Henikoff et al. 1991; Hagstrom, Muller et al. 1997; Li, Muller et al. 2011) and mammalian model systems (Spilianakis and Flavell 2004; Spilianakis, Lalioti et al. 2005; Ling,

Li et al. 2006) have been published describing this phenomenon. In flies, where chromosomes are paired throughout the cell cycle, most studies are based on findings of pairing-dependent allelic complementation or silencing. Often, this takes the form of an enhancer of a gene with a mutated promoter driving expression from a second mutant allele on the homologous chromosome that contains a wild-type promoter but lacks a functional enhancer. While both alleles, by themselves are null, together they are able to reconstitute gene function. In general, this phenomenon is pairing-dependent. Chromosomal rearrangements that prevent pairing generally disrupt these transvection interactions.

Although classical transvection is defined as a pairing-dependent phenomenon, numerous transvection-like phenomena have been reported that are independent of chromosome pairing.

Perhaps not surprisingly, a number of these examples come from studies of the BX-C, the place

24 where transvection was first discovered. Within the Abd-B region of the BX-C there are at least five examples of transvection-like phenomena that are pairing independent (Hendrickson and

Sakonju 1995; Hopmann, Duncan et al. 1995; Sipos, Mihály et al. 1998; Muller, Hagstrom et al.

1999; Bantignies, Grimaud et al. 2003). In each of these cases, elements located at disparate locations in the genome (even on other chromosomes) seemed to interact to regulate gene expression. In most of these examples, domain boundary elements were shown to play a key role in the long-range regulatory interactions (Sipos, Mihály et al. 1998; Muller, Hagstrom et al.

1999; Bantignies, Grimaud et al. 2003; Gohl, Muller et al. 2008; Li, Muller et al. 2011). Given the findings mentioned in the introduction, that boundaries seem to promote physical, long-range interactions, this is perhaps not surprising (Muravyova, Golovnin et al. 2001; Cléard, Moshkin et al. 2006). Thus, although chromosome pairing is not required for these regulatory interactions, the localized physical interactions between the two gene copies is reminiscent of classical transvection.

During the course of my thesis work, I observed many phenomena that seem to be transvection-related. In this chapter, I will describe these findings and my attempts to further investigate these phenomena. Unfortunately, these results do not provide any firm conclusions.

They do, however, clearly demonstrate how little we know about the complex mechanisms of gene regulation.

Adult salivary gland shows ectopic Abd-B expression.

Using our Abd-B-Gal::UAS-GFP reporter to discover new locations of Abd-B expression in the adult fly, we surprisingly detected a strong GFP signal in the adult salivary glands (Figure

1A). Expression of Abd-B in this tissue was never reported, and examination of the origins of the salivary gland made this expression pattern seem to be an artifact. The adult salivary glands are thin, transparent, single-cell-layered tubes that extend from the head until the first abdominal segment of the fly. They develop from a set of imaginal cells located at the border between the larval salivary duct and the larval salivary glands, called the ring cells. The posterior-most ring cells gives rise to the thin tube structures that will extend to the first abdominal segment, forming the secretory part of the adult salivary glands. Meanwhile, the anterior part of the ring cells produces the salivary duct, which fuses with its partner at the neck level and join to the pharynx

(Demerec 1950).

Figure 1. Adult salivary glands. A) Adult salivary glands expressing the Abd-B-Gal4 UAS-GFP reporter. B) Abd-B antibody staining in flies carrying the Abd-B-Gal4 UAS- GFP reporter. Clear signal localized in the nucleus of the salivary gland cells can be detected, C) Abd-B antibody staining in adult salivary glands of wild type flies. No signal in the nucleus of the salivary gland cell is detected. The green staining visible is overexposure of the background so the tissue would be visible.

In the larval gland, Abd-B is known to inhibit salivary gland formation in PS14, while the teashirt gene inhibits salivary gland formation in PS3-13 (Andrew 1998). Thus, it seemed likely that the GFP expression in the adult salivary gland was simply a result of position effect on the

BAC reporter. Antibody staining confirmed the notion that no Abd-B protein is present in wild

26 type adult salivary glands. However, when performing this staining on Abd-B-Gal4::UAS-GFP reporter flies, we found distinct Abd-B staining in the adult salivary glands (Figure 1B).

Examining younger Abd-B-Gal4::UAS-GFP individuals showed that both GFP reporter expression and Abd-B expression could be detected in the ring and salivary duct cells of the larval salivary glands, as well as, in the precursors of the salivary gland in the embryo (Figure 2).

Figure 2. Ectopic activation of Abd-B expression in embryonic and larval salivary glands. Top three panels are embryos (A, B, C), three bottom panels are anterior part of the third instar larva salivary glands (D, E, F). A and D are Abd-B staining of wild type embryo and larval salivary gland. No signal in the anterior part of the embryo is detectable. There is also no detectable signal in the salivary glands, the red is the overexposure of the tissue in order to become visible. B and C are embryonic and larval salivary gland expression of the Abd-B-Gal4 UAS-GFP reporter. In the embryo ectopic expression can be detected in the anterior part of the CNS as well as in the salivary gland precursors (white arrow). In the larval salivary glands signal can be seen in the ring cells and the salivary gland duct cells (white arrows – ring cells, yellow arrow – duct cells). C and F are Abd-B staining of embryo and larval salivary glands in the background of the Abd-B-Gal4 UAS-GFP reporter. As with the signal coming from the reporter Abd-B staining can be detected in the precursor of the salivary glands in the embryo (white arrow) as well in the ring cells (white arrow) and larval salivary gland duct cells (yellow arrow) in the larval salivary glands.

This early expression was likewise dependent upon the presence of the Abd-B-

Gal4::UAS-GFP reporter. As we knew from previous experiments that the Abd-B-Gal4 BAC does not express any Abd-B protein by itself, we concluded that the ectopic expression of Abd-B in the adult salivary glands must come from the endogenous locus in the BX-C. Since this Abd-B staining was also dependent upon the Abd-B-Gal4 BAC, we believe that the Abd-B expression in

27 the salivary glands is caused by transvection between the Abd-B-Gal4 BAC on the second chromosome and the endogenous Abd-B locus on the third (Figure 3).

Figure 3. Model of transvection between Abd-B and 51C locus. Model of what might be happening between the endogenous Abd-B locus on the third chromosome (green lines) and the Abd-B-Gal4 BAC integrated in the second chromosome (yellow lines, green part represents the BAC integrated at position 51C). The red stars represent possible enhancer that when brought in close proximity to the endogenous Abd-B promoter could activate Abd-B expression ectopically in the salivary glands.

DNA FISH.

In order to verify a physical interaction between the Abd-B-Gal4 BAC and the endogenous Abd-B locus, we performed two-color DNA FISH analysis. 15 kb probes were designed to the 51C region (the site of integrations of the Abd-B BAC) and a region in the Abd-B locus not included on the Abd-B-Gal4 BAC. We used these probes to stain adult, larval (ring cells) and embryonic salivary glands. While embryonic salivary glands could not be imaged, we were able to detect signals in the two remaining tissues. Unfortunately, in these cells we always detected two distinct signals in the nuclei. No dramatic increase in colocalization was ever detected between lines carrying the BAC and lines without the BAC. (Figure 4).

This lack of positive data, while disappointing, does not mean that no transvection exists.

Indeed, the genetic data strongly suggests that an interaction must exist between the Abd-B-Gal4

BAC transgene on the second chromosome and the endogenous Abd-B region on the third

28 chromosome. We simply could not visualize an interaction. There are a number of possible explanations for this problem.

Figure 4. Double labeled DNA fluorescent in situ hybridization . Abd-B locus in green, 51C locus in red. Images represent screen shots of 3D rendered confocal stacks by the software Imaris. A) is a control, a larval salivary gland nuclei where Abd-B expression is not detected with the reporter BAC in the background, no overlap between the two signal is expected and we didn’t detect any overlap. B) Ring cells of larval salivary glands, no overlap between the signals was detected. C) larval salivary gland duct cells, no overlap of the two signals detected. D) Adult salivary gland, no overlap of the two signals was detected. (videos are available on demand).

First and foremost among the possibilities stems from the fact that we do not know when the interaction will take place. We know from studies mentioned in the introduction that the transcriptional availability of the BX-C is generally set early in development and then maintained throughout later stages of development. Because of this maintenance of transcriptionally permissive chromatin, the transvection interaction might have occurred earlier in development in just a few cells to set up an open chromatin state that is then maintained until later stages. This change of chromatin state would lead to expression of Abd-B at earlier stages, as additional positive factors may be required to activate transcription. These factors might bind to elements within the BX-C that, under normal circumstances, would be packed into Polycomb silenced chromatin. The transient nature of such interactions has been suggested by other studies

29 examining chromatin interactions between BX-C elements. In these studies, the authors generally found that the two interacting loci did not show colocalization in the vast majority of cells

(Bantignies, Grimaud et al. 2003).

Salivary gland morphological phenotype

While establishing stocks for an unrelated set of experiments, we noticed that flies carrying the Abd-B-Gal4::UAS-GFP reporter and different deletions in the Abd-B cis -regulatory region had markedly reduced adult salivary glands (Figure 5). This phenomenon was observed only in the newly established lines and was not seen in the stocks carrying the Abd-B-Gal::UAS-

GFP reporter alone. Interestingly, after several generations, we noticed that this salivary gland morphological phenotype gradually weakened.

Figure 5. Collection of salivary gland phenotypes. The mutation in question is homozygous with the Abd-B-Gal4 UAS-GFP reporter in the background. The names of the mutants are written on the picture. WT is a wild type salivary gland. As can be seen WT is a long straight tube like organ with a squiggly end. In comparison most of the mutant salivary glands presented here are smaller with undetermined shape.

Based on these initial observations, we performed preliminary experiments to determine if different mutations in the Abd-B gene could disturb the morphology of the adult salivary gland.

These experiments made particular sense, given that we already observed ectopic Abd-B expression in the salivary glands and wondered if this ectopic expression led to the

30 morphological phenotypes. The experiment was designed as a simple F1 screen to test if heterozygosity for various mutations could modify the morphology of the adult salivary gland in the presence of a copy of the Abd-B-Gal4::UAS-GFP BAC. A numerical scale was established for scoring the phenotype based on the length of the gland and its morphology. This scale is presented in Table 1. From these crosses, it soon became evident that the BAC itself was also capable of modifying the morphology of the adult salivary glands, if outcrossed. This finding was consistent with the previous findings that the phenotype is suppressed over generations. As this suppression occurs over only a couple of generations, we hypothesize that this suppression is probably occurring at the level of chromatin structure and not an accumulation of suppressor mutations. The fact that flies carrying the BAC alone also show morphological defects in the salivary gland is consistent with the hypothesis that ectopic Abd-B may be the cause of the salivary gland phenotype.

Table 1. Scoring of adult salivary glands phenotype based on their length. The table explains the scoring system for the salivary glands based on their length, location and brief explanation of the phenotype. Column one names the three body parts of the fly and subdivides them. Depending on the mutant the salivary gland length can reach all the way to the abdomen or be just the head. Column two shows the numbers 1 to 6 which are used to score the phenotype, 1 - severe reduction in length, 6- normal looking salivary glands. Column three gives a short description of the phenotype for each number.

The results from crossing in Abd-B mutations into the BAC background yielded somewhat puzzling results. For these experiments, we used three Abd-B mutations: Df P9 , which removes the entire BX-C, Df D18 , which removes the entire Abd-Bm coding region plus a little of the neighboring sequences, and Abd-BD16 , which is an Abd-B point mutation that is a protein null. While outcrossed Abd-B-Gal4::UAS-GFP flies show mild defects in salivary gland

31 formation (scores between 4 and 5), crossing in either Df P9 or Df D18 mutations was able to suppress this mild effect (Figure 6). This effect was particularly noticeable if the Abd-B-

Gal4::UAS-GFP came from male (see below). Thus, these results are consistent with the idea that reducing the level of Abd-B in the BX-C or changing the pairing interactions (as these deletions remove substantial portions of the Abd-B region), is able to decrease the salivary gland phenotype. The confusing result comes from the Abd-BD16 allele. When Abd-BD16 is crossed into the BAC background, an enhancement of the phenotype is seen. Like the other Abd-B mutations, the Abd-BD16 allele should show reduced Abd-B levels. The difference between Abd-BD16 and the other Abd-B alleles tested lies in the possibility that the other Abd-B alleles remove interaction motifs important for transvection. Relative to a wild type copy, however, D16 should differ only by the loss of one copy of Abd-B. Thus, if we believe that ectopic Abd-B expression causes the salivary gland phenotype, we must conclude that Abd-BD16 has some peculiar characteristics (like a mutation in a regulatory element binding site) that we still do not understand.

Continuing this mutational analysis, we also examined the effects that other elements or proteins known to be involved in transvection could have on the salivary gland phenotype. For these experiments, we crossed in mutations removing BX-C domain boundaries ( Mcp 1; Fab7 1), and mutations in known transvection-mediating molecules (zeste, Polycomb proteins (Pc, pcl and Asx) and boundary proteins (CTCF)). As before, the progeny of the cross were dissected and their salivary glands scored based on their length (Figure 6).

Interestingly, as implied above, the phenotypes change depending upon the parental origin of the BAC, with females often showing a weaker phenotype (more-wild-type) than males

(Figure 7). One possible explanation for this is based on the different epigenetic inheritance from male and from female. As mentioned earlier, the quick suppression of the salivary gland

32 phenotype suggests that epigenetic/chromatin regulation may be involved in the manifestation of the salivary gland phenotype. In males, it is known that during spermatogenesis all the histones get replaced by protamines, thereby, removing all histone marks that regulate gene expression

((Daxinger and Whitelaw 2010) – review on transgenerational epigenetic inheritance). In

Figure 6. Chart showing salivary gland phenotype variation in different mutant backgrounds. The flies scored for their salivary gland phenotype were produced by crossing the stock Abd-B-Gal4 UAS-GFP reporter flies (striped bar marked with AGFP/Cy) with ten different mutants ( Pcl,Asx; Pc3 ; Mcp; Z op6 ; Abd-BD16 ; CTCF 0463 ; Fab-71; CTCF p366 ; Abd-BD18 and Abd-BP9 ) and Oregon R as control (Green bars marked with AGFP/+). The left side of the chart, left of the stripped bar, are results where the origin of the BAC reporter is from the male while the right side are results where the origin of the BAC reporter is from the female. The scored mutations were heterozygous. About 30 flies (15 male and 15 females) were scored for their phenotype based on the salivary gland length per mutation per origin of the BAC reporter. Score of one was given for a severe phenotype while score of six is for normal salivary gland phenotype (see table 1 for more detailed explanation of the scoring of salivary glands).

females, however, histone marks have the possibility to be transmitted to the next generation.

Potentially, this is what we observe in our experiments. When the Abd-B-Gal4 BAC comes from

33 the female, there may be a certain level of epigenetic marks in place to deal with the problematic transgene. When the Abd-B-Gal4 BAC comes from the male, no such marks are present, and therefore we observe a stronger abnormal salivary gland phenotype.

Figure 7. Dependence of the adult salivary gland phenotype on the origin of the Abd-B-Gal4 BAC reporter chromosome. In picture A is an adult salivary gland coming from a cross (see above the picture A) where the male is the donor of the Abd-B-Gal4 BAC chromosome. In B the situation is reversed and the Abd-B-Gal4 BAC reporter chromosome is coming from the female. A clear difference can be seen in this example between the two salivary glands when the Abd-B-Gal4 BAC reporter chromosome is coming from the male we observe a much more severe phenotype than when the BAC reporter chromosome is coming from the female. Pictures are taken at the same magnification.

Luckily, in our experiments, the trends remain the same for both males and females. The

Polycomb mutants seem to have the highest impact on the salivary gland phenotype with a maximum score of two for salivary gland length in males (Figure 6, orange and red bars). This enhancement could be due to the silencing effect of PcG proteins or on the modification of the long-range interactions. However, if Abd-B expression is important for the phenotype then interfering with the long range interactions would be expected to suppress the salivary gland phenotype instead of enhancing it, unless as we mentioned before, it’s the boundaries that mediate long-range interaction. Mutations in the Zeste gene also shows significant enhancement of the salivary gland phenotype irrespective of the origin of the reporter chromosome (Figure 6, yellow and light purple bars). As the Zeste protein is thought to be involved in transvection and

34 homologous chromosome pairing, (Bickel and Pirrotta 1990), perhaps one can imagine that disrupting the pairing interaction between the two homologues may somehow strengthen long- distance BAC interactions, and thus, leading to higher levels of Abd-B mis-regulation.

Deletion of individual insulator elements like Mcp 1 and Fab-71, as well as mutations for the insulator protein CTCF produces no significant difference from the control (Figure 6, light blue, grey, pink and purple bars). These results were not particularly surprising. The deletion of individual boundaries would only remove one of many such elements (our BAC contains four known boundary elements) and thus, might not be expected to cause a strong phenotype. The

CTCF result can also be explained by redundancy or the fact that the mutation was only present as a heterozygote. CTCF is known to bind to most BX-C boundaries (with Fab-7 being the known exception). However, given the fact that many boundaries seem to contain multiple binding sites for multiple boundary proteins, it is likely that removal of a single copy of a single, boundary protein might not cause a dramatic effect. While it is possible that homozygous CTCF deletions might show a stronger rescue phenotype, our work on the Fab-7 boundary suggests that boundary proteins play highly redundant roles.

Secondary cell enhancer studies suggest Gal-4 toxicity

An alternative hypothesis to ectopic Abd-B causing the salivary gland phenotype is that the Gal-4 or GFP expressed from the BAC may cause the phenotype. Although high levels of

Gal-4 and GFP have been shown to be toxic, this possibility was originally thought to be unlikely due to the fact that the BAC driver does not seem to express at extremely high levels

(probably less than the endogenous Abd-B locus).

Figure 8 . Orientation of the D5/DI enhancer fragments in relation to Gal4. Gal4 itself should always have the same location and orientation within the construct, next to the white gene, with its transcription going towards the white , however because of cloning issues for DIrsG4 (E) that was impossible. All constructs were integrated in the same integration site, 59D3 (VK00001) A) Represents the location of the enhancer fragment D5/DI within the iab-6 domain of the Abd-B cis -regulatory region. The blue line is the D5 fragment while the light blue section is the part that the DI fragment covers. The dashed arrow line represents the direction of transcription of the male specific abdominal (msa ) transcript whose actual start site is somewhere in the DI fragment region. On the right of the enhancer in red is the Fab-7 boundary. On the right most area is the Abd-B transcription start with an arrow showing the direction of transcription. B) Construct where the orientation of the D5 (based on the direction of transcription of msa) in relation to Gal4 transcription is opposite. C) D5 is in the same orientation as Gal4. D) DI is basically the same as B with DI having the opposite orientation of Gal4. E) DI has the same orientation as Gal4.

Data we obtained from our secondary cell-specific drivers made us reconsider this assumption.

As mentioned earlier, we made multiple Gal-4 drivers based on the sequences deleted in the iab-

6cocu allele. One driver carries the 2.8 kb region deleted in the iab-6cocu allele, while the other contains only the 1.1kb region that seems to be important for the iab-6cocu phenotype. Although enhancers are generally thought to function in an orientation-independent manner, we decided, in this case, to isolate transformants from embryos injected with plasmids where the enhancers were placed in both orientations relative to the Gal-4 coding sequence. These drivers are called

D5rsG4rs and D5G4rs for the the 2.8 kb enhancer and DIrsG4 and DIG4rs for the 1.1 kb enhancer. For convenience, we will refer to enhancer orientation based on the promoter for the male-specific abdominal ( msa ) transcript, located on both of these fragments. As expected, all constructs were able to drive expression in the secondary cells (Figure 8).

Surprisingly, however, we found that when heterozygous, these drivers behave slightly differently. It turns out that drivers in which the enhancer is oriented with the msa transcript going away from the Gal4 showed a secondary cell morphological phenotype similar to iab-6cocu

(Figure 9). Upon closer inspection, especially when looking at homozygous drivers, the morphological phenotype was far worse than the iab-6cocu phenotype (Figure 10). As the secondary cell phenotype was observed in a line containing the UAS-GFP transgene and high levels of GFP are known to be toxic ((Haseloff and Amos 1995), we decided to test if the GFP marker was having an effect on the secondary cells. As seen in (Figure 11), the phenotypes persisted, even when the GFP marker was removed.

Figure 9. Secondary cells of accessory glands from flies heterozygous for the transgenic reporter construct crossed with to a uasGFP. From the pictures it can be seen that A and C have a severe secondary cell phenotype reminiscent of iab-6cocu phenotype. B and D on the other hand have no secondary cell phenotype.

Figure 10. Secondary cells of accessory glands from flies homozygous for the transgenic reporter construct with a uasGFP recombined on the same chromosome. From the pictures it can be seen that D5G4rs and DIG4rs have a very severe secondary cell phenotype. D5rsG4rs and DIrsG4 on the other hand have no or very mild secondary cell phenotype.

Next, we wondered if the drivers were somehow affecting the levels of Abd-B expression.

In as much as the phenotypes we observe with the drivers are reminiscent of the iab-6cocu phenotype, this seemed like a distinct possibility. We, therefore, stained accessory glands from the driver lines for Abd-B protein. This analysis showed that Abd-B protein levels seemed relatively normal. While we cannot rule out a slight change in Abd-B protein levels, based on previous RNAi results, we know that the iab-6cocu phenotype only occurs when Abd-B levels are substantially reduced.

Figure 11. GFP’s impact on secondary cell phenotype. Pictures of secondary cells of accessory glands from flies homozygous for the transgenic reporter construct captured under a light microscope using Nomarski filter. From the pictures it can be seen that even without GFP, D5G4rs and DIG4rs have a severe secondary cell phenotype. D5rsG4rs and DIrsG4 on the other hand have no secondary cell phenotype. Dashed lined circles mark individual secondary cells.

Based on these experiments, we conclude that changes in Abd-B expression are not the cause of this phenotype.

Thus, we are left with the hypothesis that Gal-4 expression might be the cause of the secondary cell phenotype with the drivers. It has been reported by the Lehmann lab (Liu and

Lehmann 2008), that overexpression of Gal4 can have toxic effects on the cell. They show that

Gal-4 can cause misexpression of many genes by a factor of 1.5X causing cell death (apoptosis or necrosis). As Gal4 is known to be temperature sensitive, we examined accessory glands from driver flies grown at 18º C (Duffy 2002). Consistent with Gal-4-based toxicity, lowering growth temperature suppressed the secondary cell phenotype (Figure 12).

Figure 12. Effect of temperature on the phenotype. Secondary cells from flies heterozygous for the transgenic Gal4 driver kept at 18°C. All constructs have normal looking secondary cells even D5G4rs and DIG4rs that at room temperature show drastic secondary cell phenotype.

Furthermore, lines with the same construct as D5 but without Gal4 show no secondary cell phenotype (Figure 13).

Figure 13. Effect of Gal4 on the secondary cell phenotype. In panels A and B are secondary cells from D5 and D5rs insertion of the same constructs as the driver lines but without Gal4 (see figure 8 for directionality information). There is no discernible secondary cell phenotype in any of them.

Conclusion

Based on these experiments, we can now re-examine our results regarding the salivary gland phenotype. Although the amount of Gal-4 does not seem (to our eyes) to be very high in lines carrying the BAC, it is still possible that it is sufficient to cause some problems. In that case, ectopic Abd-B expression could simply be benign and the salivary gland atrophy would be due to Gal-4 expression.

How, then, do we integrate all of this data into a coherent picture? The simplest answer is we probably can’t. Still, I would like to propose some ideas regarding our findings. First, we do believe that some sort of transvection-like phenomenon is occurring in these animals.

Regardless of phenotypic consequences, Abd-B is ectopically expressed when the BAC is present in these animals. While our original hypothesis was that an enhancer near the BAC integration site transvected to regulate gene expression from the endogenous Abd-B promoter, the situation may, in fact, be more complicated. While examining our cocu driver lines, we discovered that these transgenes also drive expression of Gal-4 in the larval salivary glands. This expression is distinct from the BAC expression pattern (does not express in the ring cells) and does not seem to affect Abd-B expression. Still, this is interesting because these transgenes are inserted into a completely different genomic location. It seems like too large a coincidence that both sites would be situated near salivary gland enhancers. Based on this, we believe that some enhancers in the

BX-C may be capable of expressing in the salivary glands, from ectopic context. What probably prevents these enhancers from working in the salivary glands is the Pc repression system.

The BAC contains many PRE sequences. It is for this reason that the BAC expresses in a pattern very much like the wild-type locus. Yet, we do observe some areas of ectopic expression, like in the salivary glands and in some cells of the CNS. These ectopic expression locations may be the

41 products of position effects, as we originally prosed for the salivary glands. Alternatively, however, I would like to suggest that these ectopic areas of expression might be due to a weakening of the Pc repression system on the BAC.

Our crosses involving Pc mutations and the BAC transgene showed that a loss of Pc increases the salivary gland phenotype. If we assume that the salivary gland atrophy is caused by a change in Gal-4 expression, then lessening Pc silencing on the BAC might increase Gal-4 expression directly. But transvection might also play a role in this process, as Pc silences better when PREs are paired. If we assume that the BAC sometimes pairs with the endogenous BX-C, then this pairing would be expected to enhance the Pc silencing on the BAC. Relaxation of the pairing by Zeste mutations would then reduce Pc silencing, and thus enhance the salivary gland phenotype. And lastly, deletions in the Abd-B region that cannot pair in the region of the endogenous Abd-B gene, might promote pairing to the BAC and strengthen Pc to suppress the salivary gland phenotype. If this model is correct, we need not invoke position effect from a nearby enhancer causing the ectopic Abd-B expression, but simply an improperly silenced BX-C enhancer driving Abd-B expression in the salivary glands. This improperly silenced enhancer probably comes from the BAC copy of the Abd-B region, as this copy is probably more sensitive to Pc levels.

Part II. A novel function for Abd-B in the male accessory gland

The Abdominal-B locus spans approximately100kb and includes a number of different cis -regulatory elements (see general introduction). This size and complexity presents a problem for researchers in that the transgenic systems generally used to study cis -regulatory elements are size restricted. For example, P-elements generally do not exceed much more than 35kb, as insertion frequency drops dramatically with increasing transposon size. This makes the modeling of complex interactions between cis -regulatory elements difficult, as one cannot easily fit all one wants on such a small piece of DNA.

Another problem with the study of cis -regulatory elements on transgenes is that the location of integration is always subject to some sort of position effect. Depending upon the location of transgene insertion, different effects can often be observed (for a review see (Ryder and Russell 2003)). For this reason, multiple transgenic lines must be obtained and compared to determine a reliable readout. To make matters even worse, this all assumes random insertion into the genome. However, we know that P-elements do not insert randomly into the genome (Liao,

Rehm et al. 2000). We also know that many cis -regulatory elements like insulators and PREs elements interact with each other in the nucleus and can bias transgene insertion site preference

(Whiteley and Kassis 1997; Bender and Hudson 2000; Fujioka, Wu et al. 2009). Thus, a distinct bias in insertion sites can be expected that might skew the interpretation of one’s results.

It is for all these reasons that much of the work in the Karch lab is now performed by actually modifying the endogenous BX-C sequence. This is a time and labor intensive endeavor, but one that has proven quite successful (Cléard, Moshkin et al. 2006; Mihaly, Barges et al.

2006; Iampietro, Cléard et al. 2008; Iampietro, Gummalla et al. 2010). Still, outside of a few areas in the BX-C where our lab has made tools to speed up the process, systematic modification of the BX-C is still beyond our reach. During my graduate work, I have spent time trying to recreate the biological complexity of the BX-C within the experimental convenience of transgenic analysis. For this, I have turned to two tools to help bypass the problems associated with P-element transgenesis. The first tool was modified bacterial artificial chromosomes

(BACs) to model BX-C complexity. The second tool was the PhiC31 integration system (Groth,

Fish et al. 2004) to allow us to insert these BACs into the fly genome (Venken, He et al. 2006).

In 2001, a technique was developed to facilitate manipulations of large constructs, such as BACs, using in vivo homologous recombination in E. coli . This technology is now commonly called recombineering (Copeland, Jenkins et al. 2001). This technique uses homology regions to target specific modifications to precise sites in the bacterial genome or on BACs. Expression of three recombination genes ( Red genes: Gam, Exo and Beta ) from the λ bacteriophage is critical for this technology. Basically, the technique works as follows. First, a mutagenic fragment is designed containing DNA sequences identical to the regions flanking the area of DNA to be modified. Between these homology areas (of at least 50 bp and often 500 bp), any sequence modifications can be added. Next, E. coli deficient for many of the genes of its own recombination system are grown under conditions where the three phage red genes are induced.

These bacteria are made competent and transformed with the linear mutagenic DNA fragment.

Within the bacteria, the Gam protein starts by inhibiting the transformed linear DNA sequence from being degraded by the RecBCD nuclease. Then the second protein, Exo, a 5’-3’ exonuclease, generates a 3’ single stranded DNA on both ends of the linear fragment in the homology region. The Beta protein is then recruited to the 3’ ssDNA ends and helps target the

44 fragment to its complementary sequence in the genome or on the BAC. Recombineering is an efficient way to engineer large constructs without the need for the classical cloning tools like restriction endonucleases and ligases.

In 2006, BAC recombineering was successfully combined with the PhiC31 system, thus showing that large constructs can be efficiently integrated in the Drosophila genome (Venken,

He et al. 2006). The PhiC31 integrase is an enzyme that mediates the site-specific recombination between two short DNA sequences: attB and attP . In its native setting, the PhiC31 integrase comes from the bacteriophage PhiC31, where it is used to integrate the phage genome into its bacterial host genome via and interaction between the phage attachment site ( attP ) and the bacterial target sequence ( attB ) (Thorpe, Wilson et al. 2000; Groth, Fish et al. 2004). Unlike other phage recombination systems, the PhiC31 system recombines between two divergent sequences instead of two identical sequences. This means that upon recombination, the sequences become hybrid sites between attP and attB sites, called attL (attachment left) and attR

(attachment right) sites. These hybrid sites are no longer substrates for the PhiC31 recombinase.

In practical terms, this makes the recombination reaction unidirectional, unlike the bidirectional reactions of the CRE/lox and FLP/FRT systems (Groth, Fish et al. 2004).

In terms of a transformation tool, there are numerous advantages to the PhiC31 system over standard, P-element-mediated transformation systems. First, the system is site-specific. This means that once an attP or B site is inserted into the genome, any DNA sequence containing the complementary att site can be integrated into the same genomic locus. Integration into the same genomic locus means that all transformants can be compared against each other without worrying about varied position effects from random transgene insertion. Next, integration sites can be pre-screened for detrimental position effects and integration frequencies. Given a good

45 integration site, transformation efficiencies can be as high as 60% (% surviving injected offspring yielding transformed progeny) (Bischof, Maeda et al. 2007). Another great advantage of the system is that unlike P-element-mediated transformation, the system is not limited by the size of the construct, allowing much larger constructs to be integrated. Indeed, the only limitation in size seems to be the determined by the fragile nature of large pieces of DNA and their increased in viscosity when in an aqueous environment. These limitations are more limitations of the injection procedure used to create transgenic flies than the PhiC31 system itself.

By the time I joined the lab, numerous attP landing platforms had already been created throughout the fly genome. Many of these platforms were created through collaboration between our group and the group of Prof. Konrad Basler at the University of Zurich (Bischof, Maeda et al. 2007). These landing sites were partially pre-screened for both position effects and integration frequencies. Also, a stable, germline source of the PhiC31 integrase was supplied in these lines under the control of the vasa promoter. This system allowed for easy integration of a desired construct by simply adding an attB site and selectable marker to the construct, and injecting it into embryos.

Using this system, I set out to find new tissues in which Abd-B is expressed in the fly and then to understand the mechanism by which Abd-B expression is controlled in these cells.

Because recombineering could be used to quickly modify regions of the BAC to help find novel cis -regulatory elements, we thought this method would prove to be quite efficient. As is explained below, however, my project took on a different twist, as we quickly discovered that the enhancer I was attempting to locate was in an area where we have tools for quick genetic manipulation.

Creation of BAC reporters/fusions for Abdominal B.

In order to discover new tissues in which the Abd-B gene functions, we undertook the creation of transgenic reporters that accurately reproduce the Abd-B expression pattern throughout development. Previous studies indicated that the Abd-B gene is expressed as two isoforms, the Abd-B m and r forms, and that the expression of these two isoforms requires separate elements located within a large cis -regulatory region spanning >90kb of DNA

(Zavortink and Sakonju 1989). As the Abd-Br isoform is thought to be primarily involved in the formation of the external genitalia (Foronda, Estrada et al. 2006), we decided to concentrate our study on the Abd-Bm isoform, which is involved in determining segment identity. BACR24L18 is a BAC of ~172kb that contains the Abd-B, and much of the abd-A region of the Bithorax complex ( BX-C).

Figure 1. Extend of DNA contained in the Abd-B BAC A) Molecular map of the abdominal region of the Bithorax complex numbered in kb according to (Martin, Mayeda et al. 1995)(Genbank U31961). The abd-A and Abd-B transcription units are drawn below the DNA line along with the extent of the segment-specific iab cis - regulatory domains iab-2 through iab-9. B) The rectangle depicts the extent of the BAC used in this study. Note that it lacks the B,C and γ promoters specific for the Abd-Br form. The Gal-4 coding sequence was inserted within the 5’UTR of the Abd-Bm form. C) The structure of the vector sequences used to propagate the BAC and to select the integration within the Drosophila genome. Note the presence of two gypsy insulator sequences flanking the mini-white sequences to prevent possible position effect on white expression (see material and methods for further details).

By recombineering, we reduced BAC24L18 to contain mostly the iab-5 to iab-8 domains required for Abd-Bm expression (removing many of the Abd-Br alternative promoters and its regulatory elements) and the Abd-Bm coding sequence (Figure 1B). A PhiC31 AttB integration sequence and a white marker were also added during the reduction step (Figure 1. B & C).

We first tested if expression derived from the sequences on this BAC was sufficient to rescue Abd-B mutant phenotypes. We integrated the Abd-B BAC into the 51C landing platform

(Bischof, Maeda et al. 2007) and tested for complementation of two large deletions affecting

Abd-B activity. We found that the presence of a copy of the BAC on the second chromosome rescues the mutant phenotypes of iab -6,7 IH and iab -5,6 J82 (Mihaly, Barges et al. 2006) (Figure

2.).

Figure 2. Rescue of iab-6,7 IH by the Abd-B Bac. Panel A and B show male abdominal cuticle preparations from homozygous iab-6,7 IH rescued with one copy of the Abd-B BAC (panel A) and homozygous iab-6,7 IH (panel B). Male abdomens were cut along the dorsal midline and flattened on a slide. The dorsal surface of each abdominal segment has a rectangular plate of hard cuticle called the tergite. Only half of the tergites of the 4th, 5th and 6th abdominal segments (numbered) are visible, as well as the genitalia at the bottom. In as much as the iab- 6,7 IH phenotype is fully rescued by the Abd-B BAC the cuticle shown in panel A can be considered as wild type . Note that the 5th and 6th tergites are pigmented. The ventral surface of abdominal segments is composed of soft cuticle called the pleura. On the ventral midline of the pleura there are small plates of harder cuticle called sternites. In wild type (as well as in panel A), the 6th sternite, circled in red, can be easily distinguished from the more anterior sternites by its different shape and by the absence of bristles. Note also the absence of the 7 th abdominal segment present in embryos and larvae, which does not contribute to any adult structures after metamorphosis. B In iab-6,7 IH , A6 is completely transformed into a copy of A5 as revealed by the presence of a 6 th sternite that completely resembles a more-anterior sternite, covered with bristles (circled in red in panel B). The striking appearance of a 7 th tergite is indicative of a homeotic transformation into A6. The transformation is however only partial as seen by the shape of the 7 th sternite that resembles the 6 th , but harbors a few bristles (A5 character) see also reference (Mihaly, Barges et al. 2006)

Because the sequences preserved on the BAC seemed to drive appropriate Abd-Bm expression, we proceeded to modify the BAC by recombineering to replace the first codon of the first exon of Abd-B with the sequence encoding the Gal4 transcription factor, the mCherry fluorophore coupled to a nuclear localization signal (NLS) and the mCherry as N-terminal fusion to Abd-Bm . By inserting the mCherry sequence just before the stop codon of the last exon of

Abd-B a C-terminal fusion was also created (Figure 3). In the two reporter constructs, the Gal4 or mCherry-NLS coding sequence ends with a stop codon, thus eliminating Abd-B expression from

Figure 3. BAC recombineering. A) Scheme of the initial recombineering to modify the original BACR24L18 by inserting the attB site (barred section of targeting construct), the white gene (red arrow section) needed for integrant selection after embryo injection and the kanamycin resistance gene (yellow arrow) to select clones positive for the recombineering step. The Black and the blue sections at the end of the targeting construct are the homology regions used to target the construct to a particular location of the BAC. The area marked in green on the BAC is the Abd-B regulatory and coding region, the area marked with blue is Abd-A regulatory and coding region which with this first step are deleted from the BAC. The BAC modified in panel B is the BAC that is constructed after the recombineering procedure A. In the text this BAC is also referred as the rescue BAC since it has the intact Abd-Bm form and is able to rescue Abd-B mutants (see figure 2. B, C, & D) Panels are the scheme of modifying the rescue BAC into a reporter BAC by the use of a double selection recombineerng system for seamless insertion of the reporter sequences. SacB was used as the negative selector (in its presence on 5-10% sucrose plates E. coli does not grow) while Ampicillin was used as the positive selector in the double selection cassette. In B in the first step of insertion of the double selection cassette in the N or C terminal end of Abd-B. In panel C. is the result of the recombineering done in B. and the continuation of the process to replace the double selection cassette with the reporter construct. In panel D is the result of C indicating the construction of the four BAC reporter constructs. The N-mCherry fusion , the C- mCherry fusion the mCherry reporter and the Gal4 reporter.

the BAC. As no sequences are removed for the region, we hoped to retain any sequences that are important for Abd-B gene regulation. The final BACs used in these experiments were approximately 109kb for the mCherry reporter and fusion constructs, and approximately 111kb for the Gal4 reporter construct (Figure.1B). All four constructs were integrated into the 51C landing platform on the second chromosome. It must be noted that none of the chromosomes carrying the BAC integrants are homozygosable. The reason for this homozygous lethality is

49 still not entirely clear, especially since Abd-B is not being expressed from half of our constructs.

However, we have noticed some strange transvection-like phenomena (see below) with the

BACs that could account for some of this phenotype.

Figure 4. Embyonic expression patterns driven by the Abd-B-Gal4 Bac. Embryos were fixed and stained with antibodies directed against ß-galactosidase.(panels A,B,C and D) and Abd-B (panels E,F,G and H). Panel A,B and C show that the Abd-B-Gal4 BAC mimics Abd-B temporal activation during germband elongation shown in panels F,G and H (see ref (Simon, Chiang et al. 1992)). In panels D and E, stage 14 embryos were opened along the dorsal midline (through the amnioserosa) and flattened on a microscope slide: anterior is at the top, the ventral midline with the developing CNS is visible in the center. Panel E is stained for Abd-B. The parasegmental boundaries are indicated. Arrows in panel D point towards the anterior, ectopic expression already visible earlier in panels B and C. Note also the group of neuroblasts expressing lacZ in parasegments anterior to PS10.

To study the Abd-B expression pattern, a line was established containing the Abd-B-Gal4

BAC and a UAS-GFP reporter on the same chromosome. While the mCherry constructs could also have been used (and indeed were checked for pattern confirmation), we chose to use the

Gal4 reporter due to the signal amplification from the Gal4 transcription factor. Initial examination of the embryonic expression pattern in these lines confirms that the Abd-B-Gal4

BAC appears to recapitulate most of the wild-type expression pattern of Abd-Bm in early embryos (Fig.4). However, we do observe some evidence of ectopic expression from the BAC, particularly in the ventral nerve cord (Figure 4D). Even with the slight level of ectopic

50 expression, the Abd-B-Gal4 BAC seems to be a useful tool, as it recapitulates the known patterns of Abd-B expression even in adult and larval tissues (Figure 5). The other three constructs Abd-

B-mCherry-N, Abd-B-mCherry-C and Abd-B-mCherry reporter exhibited the same pattern of expression as the Gal4 BAC (Figure 6 A-E) in all areas that were checked, however at a much weaker level.

Figure 5. Larval and adult expression patterns driven by the Abd-B-Gal4 BAC. A and B: pictures of live larvae and adult expressing GFP under the control of the Abd-B-Gal4 BAC. A third instar larva is shown in A. The arrow points towards the posterior part of the CNS that has fused with the brain after nerve chord contraction. The region corresponding to abdominal segments A5 to A8 is indicate by a bracket. An adult male is shown in panel B. Most of the fluorescence seen in the abdomen emanates from the accessory gland and the fat body.

Previously unknown location of Abdominal B expression in adult flies.

Using the new Abd-B-Gal4 BAC reporter, we identified the adult male accessory gland

(Figure 7) as a location of Abd-B expression (Figure 7B). More specifically, based on the expression of our Abd-B-Gal4 BAC, Abd-B appears to be specifically expressed in the secondary cells (Figure 7B,C, and D).

The accessory glands of Drosophila melanogaster are part of the male reproductive system, somewhat similar to the prostate gland and seminal vesicles in mammals. Much of the male reproductive system develops during the pupal stage from the ectodermal cells of the male genital disc. The cells that give rise to the accessory glands are not initially part of the genital disc. Instead they are recruited to the genital disc, with the help of the fibroblast growth factor

(FGF), from mesodermally derived cells expressing the fibroblast growth factor receptor (FGFR) during the late third instar stage. Upon recruitment, these cells lose their mesodermal marker

51 twist and start expressing the epithelial marker Coracle, suggesting that they transform from mesodermal to epithelial cells (Ahmad and Baker 2002).

A B C

D E

F G

Figure 6. Expression pattern exhibited from the Abd-B mCherry fusion BAC constructs. A) Antibody Abd-B staining in wild type embryo; B) Antibody Abd-B staining in embryo carrying the Abd-B-mCherry-C , a mild expression of Abd-B anterior to PS10 can be detected (compare with A); C) Antybody RFP staining in embryo carrying the Abd-B-mCherry-C , strong anterior RFP signal can be detected; D) Antibody Abd-B staining in wild type larval CNS; E) Abd-B-mCherry-N construct expressing mCherry, strong expression in the posterior part of the brain (presumptive ventral cord), ectopic expression can be detected in the more anterior parts compared to D (wild type) where there is no Abd-B expression in the anterior part of the larval brain; F & G) Abd-B-mCherry-N & Abd- B-mCherry-C fusion constructs expressing mCherry in the secondary cells of the accessory glands.

The male accessory glands are composed of two types of binucleated cells: the main cells and secondary cells. The main cells have a hexagonal shape and are the majority of the cells of the gland, making up 96% of the gland (~1000 cells). The remaining 4% of the gland is made up of secondary cells (~40 cells) that are located at the distal tip of the gland, interspersed between the main cells. The secondary cells are much larger than the main cells and are pear shaped, with multiple large vacuoles (Figure 7C & D). The primary purpose of the accessory glands seems to be the production of accessory gland proteins (Acps) to be transferred to the female upon copulation. Within the female, these Acps (over 180 Acps) elicit numerous behavioral and physiological changes in the female including an increased rate of egg laying and ovulation, a

52 reduction in receptivity to secondary courting males, and the formation of a mating plug

(Wolfner 2009).

B Testis

Secondary cells

C E

Accessory glands D Main cells F Ejaculatory duct Secondary cells Ejaculatory bulb

Figure 7 . Expression patterns driven by the Abd-B-Gal4 BAC . A) Cartoon depicting the male reproductive apparatus with testis, the paired accessory glands, the ejaculatory duct and ejaculatory bulb. Each accessory gland contains two secretory cell types, the main cells which make up the majority of the gland (top insert) and the secondary cells which are located at the distal tip of the gland interspersed among the main cells (bottom insert) Drawing by J. L. Sitnik; B) Picture of the male reproductive system from flies carrying the Abd-B-Gal4 BAC crossed to a UAS-GFP reporter with the secondary cells of the accessory glands showing GFP expression. The different organs composing the system are marked. C) Magnification of three secondary cells from flies carrying the Abd-B-Gal4 BAC crossed to a cytoplasmic UAS-GFP reporter . The multiple, large vacuoles, characteristic of secondary cells, can be visualized through their exclusion of the GFP protein. The two nuclei of the cells can also be seen as slightly more intense GFP signals..; D) The tip of the accessory gland with GFP expressed specifically in the secondary cells driven by the Abd-B-Gal4 BAC (green), co-stained with the membrane staining dye, FM4-64, in red. The two cell types can be clearly distinguished with examples indicated with white lines.; E) Abd-B antibody staining of the tip of an accessory gland on Abd-B-Gal4 BAC, UAS-GFP flies (red). Only secondary cell nuclei are stained. F) GFP expression (green) in the same gland overlaid onto the Abd-B antibody staining (red) shown in panel E. Each cell with Abd-B protein expression also expresses GFP. The white scale bar on figures C, D, E, and F represents 50mm.

The effects elicited by the Acps in the female are known of as the post mating response

(PMR). The PMR can be divided into two phases: the short term response (STR), which refers to effects within the first 24 hours after mating, and the long-term response (LTR), which lasts for up to 10 days after mating. As the Drosophila female stores sperm after mating, the LTR is thought to involve Acps attached to or stored together with the sperm, while the STR is thought to involve the freely diffusing Acps in the seminal fluid.

The most studied Acp is the sex peptide (SP, Acp70A ) that, among other things, is responsible for the increases in egg laying and the reduction in female receptivity after mating.

After mating, SP is anchored to the sperm tail and together with the sperm is stored in the female sperm storage organs (Peng, Chen et al. 2005). The gradual release of the sperm and the SP makes the LTR possible.

As mentioned above, we found Abd-B expression specifically in the secondary cells of the accessory glands. Most of the known Acps, including sex peptide, are made in the main cells.

Very little is known about the role of the secondary cells in producing the PMR. Thus, we thought that an exploration into the role of Abd-B in the secondary cells might lead to the identification of a function for these mysterious cells.

To confirm the reporter result, we stained both wild-type and Abd-B-Gal4 UAS-GFP reporter accessory glands with an antibody directed against Abd-B (Figure 8). Like the reporter, immunostaining for the Abd-B protein showed staining specifically in the secondary cells

(Figure 8A,B & D). Interestingly, we also see Abd-B staining in the ejaculatory duct (Figure 8A) that is not observed with our reporter (Figure 7B). This is perhaps not surprising, as the ejaculatory duct is a structure derived from the male genital disc, a tissue that primarily expresses the Abd-Br isoform (Foronda, Estrada et al. 2006) (also recognized by our antibody).

Figure 8. Endogenous Abd-B expression in wild type accessory gland and ejaculatory duct . Panel A shows a WT pair of accessory glands connected with the ejaculatory duct stained with antibodies directed against Abd-B. Note the staining in the secondary cells at the tips of the accessory glands as well as the strong expression in the ejaculatory duct. Panels B, C and D show a magnification of the distal tip of an accessory gland stained with antibodies agains Abd-B (red) and with DAPI (blue). Note that both main and secondary cells are binucleated.

Secondary cell enhancer.

In order to examine the role of Abd-B in the development of the accessory glands, we sought a method to remove Abd-B expression exclusively in the secondary cells. Rather than use the traditional FLP-FRT system for making clones, we reasoned that in our collection of Abd-B cis -regulatory mutations (Mihaly, Barges et al. 2006), we may already have a deletion that specifically removes secondary cell enhancers. Given our hypothesis that Abd-B might act as a cell fate determinant in the secondary cells, we screened a set of large, overlapping deficiencies covering the Abd-B cis -regulatory region for defects in secondary cell formation (Figure 9A). To make this analysis easier, homozygous mutant flies were screened in lines that also contain a copy of our BAC reporter to mark the cells that would normally become secondary cells. Two of the lines examined, iab-6,7 IH & iab -5,6 J82 (Figure 9 B & D), showed a distinct morphological abnormality in the secondary cells. This abnormality can be easily seen using the cytoplasmic

GFP marker. In wild-type cells, the GFP marker outlines the presence of large vacuolar structures in the secondary cells (Figure 7C, 9C). In both the iab-6,7 IH & iab-5,6 J82 mutants,

55 these structures appear to be absent, and consequently the GFP marker is almost uniformly distributed across the cytoplasm.

Figure 9. Mutants affecting Abd-B expression in the accessory gland. A The Molecular map of the Abd-B gene region is shown with its extensive 3’ cis -regulatory domains iab-5 through iab-8 (the iab-4 domain regulates abd-A). The extents of the various deficiencies that were used to map the enhancer responsible for Abd-B expression in the secondary cells are shown below the molecular map. The red circles on the map represent the boundaries separating the parasegment-specific cis-regulatory domains of Abd-B. The green triangle above the iab-6 domain marks the iab-6 initiator. B) UAS-GFP expression driven by Abd-B-Gal4 in a WT for the BX-C. C) Same as B , but in an iab-6, 7IH homozygous male or in an iab-5,6 J82 homozygous male ( D). Note that in the iab-6, 7 IH and iab-5,6 J82 background, the numerous vacuoles, characteristic of the secondary cells (visible by black holes in the GFP background), are lost. However, the vacuoles are not affected in iab-4,5,6 DB . Thus, the critical region required for proper secondary cell specification based on these 3 deficiencies is indicated by the dotted-line box in panel A. E) UAS-GFP expression driven by Abd-B-Gal4 in secondary cells of iab-6cocu males, the vacuoles are lost, giving rise to staining comparable to panels C and D. F) shows iab-6cocu accessory glands stained with an Abd-B antibody. While Abd-B expression is absent in iab-6cocu . The white horizontal scale bars in each of the panels represents 50mm.

Based on the sequences uncovered by both the iab-6,7 IH & iab-5,6 J82 mutations, we concluded that the iab-6 domain, responsible for Abd-B expression in segment 6, is also responsible for Abd-B expression in the secondary cells. Thus, we screened our collection of

smaller iab-6 deficiencies (Iampietro, Gummalla et al. 2010) for the secondary cell phenotype.

From this analysis, we were able to narrow down the location containing the secondary cell

enhancer to a 2.8kb region in iab -6 (Figure 9 A, E & F). Flies lacking this 2.8 kb region ( iab-6∆5)

specifically lack Abd-B protein expression in the secondary cells (Figure 9 F), and show distinct

secondary cell morphological defects (Figure 9 E). Like the larger deficiencies above, iab-6∆5

homozygous males lack the large vacuoles characteristic of secondary cells.

Figure 10. Secondary cells do not transform to main cells in iab-6∆5 mutant flies. Panels A and B show the expression of lacZ construct, detected by anti B-galactosidase antibody, in the pattern of the sex peptide, main cells only. In panel A is a wild type expression of SP. SP is in red, marking the main cells, while the secondary cells are marked in green thanks to the expression of UAS-GFP driven by the Abd-B-Gal4 BAC reporter. There is no overlap of the two stainings in normal accessory glands. In panel B SP is in green still marking the main cells of iab-6∆5 flies. In red is staining for Dve which is also secondary cell specific (Minami et al. 2012). In this case Secondary cell also there is no overlap of the signals, meaning specific marker that the secondary cells do not start to express SP in iab-6∆5 mutant background. In panels C and D is an characterized secondary cell lacZ reporter staining in wild type and iab-6∆5 background, respectively. In both cases the staining pattern doesn’t change, the secondary cells even in the mutant background still express the secondary cell reporter.

Although these secondary cells are not normal, we do not detect any expression of main

cell-specific markers in these cells, suggesting that they are not transformed towards a main cell

fate (they still express the secondary cell lacZ reporter gene and fail to express the SP lacZ

reporter gene (Figure 10) (Styger 1992)). To test if Abd-B is capable of transforming main cells

into secondary cells, we expressed Abd-B across the whole accessory gland using a paired-Gal4

driver (Jiao, Daube et al. 2001). The most common result of this ectopic expression was cell

death in the main cells. These results suggest that Abd-B expression in the secondary cells is

57 required for morphological differentiation but may not be necessary for the initial differentiation between the two cell types.

Figure 11. Dissection of the 2.8kb enhancer region. A) The dark blue line represents the 2.8kb enhancer region marked as D5. Below that line are three lines marked with DI (D), DII (E) and DIII (F) which represent 1.1 deletions from the 2.8kb region. The DII & DIII (red) didn’t show any secondary cell abnormality, compare image B (wild type secondary cells), where the vacuoles are clearly visible with E & F. While the DI deletion (light blue) has the same secondary cell phenotype as the 2.8kb deletion, compare picture C with D.

To further narrow down the 2.8kb enhancer region, we designed and created three overlapping deletions of 1.1kb, named DI, DII and DIII (Figure 11) using the same procedure and platform as the one used to create the iab-6∆5 deletion (Iampietro, Gummalla et al. 2010).

Only the DI deletion showed the characteristic iab-6∆5 phenotype while DII and DIII looked normal (Figure 11 D, E and F). We also performed experiments where we replaced the 2.8kb enhancer with the paired enhancer, mf9 (Xue and Noll 2002). This enhancer was previously

58 shown to drive expression in both the main cells and the secondary cells. Unfortunately, the chromosome carrying the prd enhancer could not be made homozygous, indicating that this enhancer exchange it is lethal to the fly.

Figure 12. Rescue of iab-6cocu by an Abd-B expressing Bac. Images of the tip of accessory glands observed in “Nomarski” microscopy to visualize the characteristic vacuoles of the secondary cells (in panel A, a few secondary cells are circled). Note that these large vacuoles are lost in glands from iab-6cocu homozygotes (panel B). Panel C shows the secondary cells of a homozygous iab-6cocu gland carrying a copy of the Abd-B Bac on the 2 nd chromosome. Note the reappearance of a few vacuoles. This partial rescue suggests that a single copy of the Abd-B BAC does not resume the same level of Abd-B expression from the endogenous locus.

As further confirmation of the importance of Abd-B and the 2.8kb iab-6 enhancer in secondary cell development, we performed a number of control experiments. First, we crossed in a BAC transgene containing the wild-type Abd-B region and tested for rescue of the cellular phenotype. As expected, the secondary cells of males, homozygous for the iab-6∆5 mutation but carrying one copy of the Abd-B BAC are substantially rescued (containing a number of large vacuoles) (Figure 12). Although this rescue is quite evident, it is not complete, a fact that probably reflects a weaker level of expression from the BAC relative to the native Abd-B locus.

Next, we created a transgene carrying the 2.8 kb region deleted in iab-6∆5 (called D5-Gal4 ) or the 1.1kb region deleted in iab-6DI (called DI-Gal4 ) driving Gal4 expression. These lines drive

Gal4 expression specifically in the secondary cells within the male reproductive tract (Figure

13). Using these DI-Gal4 & D5-Gal4 drivers, we were then able to drive expression of an Abd-B

RNAi construct in the secondary cells. Knocking down Abd-B in the secondary cells was able to partially phenocopy the iab-6∆5 mutation (Figure 14). The strength of this phenotype could be enhanced by the inclusion of a Dicer 2 overexpression transgene in the background.

Figure 13. Secondary cell specific drivers. A & B) show the tip of an accessory gland from a fly carrying the D5-Gal4 and DI-Gal4 driver driving GFP expression in the secondary cells.

iab-6∆5 was originally isolated in Iampietro et al (Iampietro, Gummalla et al. 2010), where they did not observe any visible external phenotype. With the discovery of the secondary cell phenotype and the strong reproductive phenotype described by our collaborators from

Cornell University (Jessica Sitnik and Mariana Wolfner), we have renamed this allele iab-6cocu

(“cocu” means “cuckold” in French, reflecting that the mates of these males fail to reject other suitors).

Figure 14. Phenocopying iab-6cocu phenotype by Abd-B RNAi. The four panels A-D show secondary cells in which UAS-GFP is driven by the D5-Gal4 driver. In WT (A), the vacuoles are easily detectable as black discs in the background of GFP. In panel B, the D5 driver activates a UAS-Abd-B hairpin construct (obtained from the VDRC; (Dietzl, Chen et al. 2007)) to inactivate Abd-B by RNA interference (in addition to the UAS-GFP ). Vacuoles are perhaps as numerous as in panel A, but overall smaller in size. In panel C, a UAS-Dicer was introduced to enhance RNA interference on top of the Abd-B hairpin construct and UAS-GFP . The GFP staining appears more uniform as a result of the much smaller size of the vacuoles. Panel D shows the uniform GFP staining in the background of iab- 6cocu .

Abd-B expression in secondary cells is independent of the initiator.

Interestingly, although the secondary cell enhancer was found in the iab-6 domain, it does not seem to be regulated like other BX-C enhancers. Previous work has demonstrated that most enhancers in the BX-C function coordinately through their integration into segment- specifically activated chromatin domains (see above) (Peifer, Karch et al. 1987; Bender and

Hudson 2000; Mihaly, Barges et al. 2006). A special domain control element, called an initiator, is thought to dictate the activity state of a domain along the A-P axis (Simon, Peifer et al. 1990;

Singh and Brown 1997; Iampietro, Gummalla et al. 2010). Thus, deletion of the iab-6 initiator would be predicted to inactivate Abd-B expression in the secondary cells, because the secondary cell enhancer should be coordinately regulated with the other enhancers in the iab-6 domain. In contrast to this prediction, we observed that deletions of the iab-6 initiator, which seem to show a complete transformation of A6 to A5, display wild-type accessory glands (Figure 15). From these experiments, we conclude that Abd-B expression in the secondary cells is set up by a different mechanism than that of tissues arising early in development.

Figure 15. Abd-B expression in secondary cells is independent of the initiator. A The molecular map of the Abd-B gene region is shown with its extensive 3’ cis - regulatory domains iab-5 through iab-8 (the iab-4 domain regulates abd-A). The red circles on the map represent the boundaries separating the parasegment-specific cis- regulatory domains of Abd-B. The green triangle above the iab-6 domain marks the iab-6 initiator. B) UAS-GFP expression driven by Abd-B-Gal4 in secondary cells of iab-64 (initiator deletion) males. Note the normal aspect of GFP staining in iab-64 relative to the WT shown in figure 9C). C) shows iab-64 accessory glands stained with an Abd-B antibody. While Abd-B expression appears normal in iab-64, the signal is absent in iab-6cocu (figure 9F). The white horizontal scale bars in each of the panels represents 50mm.

Part III. Dissection of the secondary cell transcriptome.

Investigating the targets of Abd-B using mRNA-seq

Because of the modest amount of information on secondary cells in the literature, and in order to further understand the secondary cell phenotype in Abd-B mutants, we performed an mRNA-seq analysis comparing the transcriptomes of wild-type accessory glands and iab-6cocu accessory glands. For our wild-type line, we used the iab-5,6 rescue line. This line was made using the same PhiC31 system that we used to make the iab-6cocu flies, but differs in that a wild-type piece of DNA was integrated into the platform instead of the mutant piece. In this way, we hoped to obtain a genetic background as similar as possible between the two lines.

Total RNA was isolated from 100 accessory glands from each genotype and was sent for deep sequencing on an Illumina sequencer at FASTERIS SA (Geneva, Switzerland).

Bioinformatic analysis was also also performed at Fasteris. The HiSeq run yielded 66,943,897 reads, 36,740,061 for iab-5,6 rescue and 30,203,836 for iab-6cocu . For iab-5,6 rescue 71.0% of reads were mapped to the reference genome while for for iab-6cocu 70.6% were mapped. Counts were normalized as reads per million (RPM) by dividing by the total number of reads and multiplying by 1 million, leaving us 8,764 genes to compare. By simply dividing the number of reads per gene of iab-5,6 rescue with iab-6cocu , we were able to determine the most down regulated genes in the iab-6cocu male accessory glands, as compared to iab-5,6 rescue . The reverse operation was also performed in order to determine the most up regulated genes in iab-6cocu . Using an arbitrary cut- off value of 5x, we found that 73 genes were down-regulated in iab-6cocu flies by a factor of five or more relative to iab-5,6 rescue flies. By contrast, 115 genes were found to be up-regulated by a

62 factor of 5. In a first step, we decided to focus our attention on the down-regulated genes, believing (for no real reason) that the loss of a product might account for the Abd-B phenotype more than an up regulated product.

Table 1. Top ten most down regulated genes from the mRNA-seq. This table is just a piece from the much larger table displayed in the appendix of the thesis (Table 1) with all 73 genes.

The predicted functions of the 10 most down regulated genes are summarized in Table 1

(see appendix Table 1 for list of the 73 candidate genes). According to the FlyBase predictions, the most common functions were listed as unknown (34.2% or 25 genes), serine-type endopeptidase activity (8.2% or 6 genes), transferase activity (8.2% or 6 genes), sodium:iodide symporter activity (6.8% or 5 genes) and transmembrane transporter function (5.5% or 4 genes).

As for the tissue in which these genes are expressed at a highest level, the FlyAtlas Anatomical

Expression database indicates that 24 (32.8%) show highest expression in the malpighian tubules, 12 (16.4%) show highest expression in the testis, 9 (12.3%) show highest expression in the midgut and 2 (2.7%) show the highest level of expression in the accessory glands. The two showing highest expression in the accessory glands are CG11598 (Ravi Ram, Ji et al. 2005) and

CG3349 (Ravi Ram and Wolfner 2007). These genes have previously been identified as genes

63 encoding Acps but have not been characterized. Since known Acps are secreted molecules it is interesting to note that 38 (52.02%) of the 73 genes have a signal sequence, though it is clear that the iab-5,6 cocu phenotype is the result of a loss in the transcription of a specific Acp. Lastly, it is interesting to note that some of the genes seem to cluster to a specific genetic locus. CG12809,

CG33783, CG33784, CG33631, CG5361 and CG33630 are all located next to each other within

13kb. The genomic co-localization of the genes, together with the RNA-seq results suggests that these genes are probably co-regulated as a gene neighborhood. A detailed account of the molecular characteristics and mRNA-seq results for the 73 genes can be found in the table 1

(appendix).

RNAi.

In order to further narrow down the list of candidate genes responsible for the cocu phenotypes, we decided to perform an RNAi screen of the candidate genes. Fly lines carrying

UAS-RNAi constructs for most of our candidate genes were ordered from the Vienna Drosophila

RNAi Center (VDRC). Males from the received lines (Table 6 in material and methods section) were crossed to the DI-Gal4 and DI-Gal4, UAS-GFP driver line females. The UAS-GFP marker, which is excluded from the secondary cell vacuoles, was used as an aid to visualize the cellular phenotype. Driver lines with and without a GFP marker were used separately in order to eliminate the effect, if any, of the UAS-GFP on the phenotype. Based on our examination under fluorescence and Nomarski microscopy, we did not observe any differences between the unmarked lines and the lines with the UAS-GFP marker. Below, I primarily show images derived from the GFP-marked secondary cells for visual simplicity.

Figure 1. RNAi experiment results for genes that showed a secondary cell phenotype. Names of the genes are embedded in the images. Their predicted function is noted below each image for each gene. The cross was DI-Gal4 X RNAi for the Nomarsky images (A-F) and DI-Gal4 UAS-GFP X RNAi for the fluorescence images (G-L). WT – wild type secondary cells (A) with nicely formed vacuoles, look like doughnuts with Nomarski, while in the rest of the pictures the vacuoles are gone or not the right size, they look like small bumps. Representative secondary cells from each panel on Nomarski images are marked with a circle with dashed line. In the GFP fluorescent images the vacuoles are clearly visible as black holes within the secondary cells with variable size, depending on the figure.

The male progeny from the crosses above were collected and subjected to two types of analysis. First, at least three accessory glands from virgin males were dissected to examine secondary cell morphology using Nomarski microscopy for the DI-Gal4 crosses (Figure 1 A-F) or using fluorescent microscopy for the DI-Gal4, UAS-GFP crosses (Figure 1 G-L). Second, an egg-laying assay was performed to determine if any of the knocked-down genes exhibit an egg- laying phenotype similar to that seen in iab-6cocu mutants (Gligorov, Sitnik et al. 2013).

Figure 2. Genes from the RNAi screen that showed a mild secondary cell morphological phenotype. Variable size of vacuoles can be detected in all images (A-J) but not an absence of vacuoles. Embedded in the image is the name of the gene whose knockdown causes the presented phenotype.

For few of the candidate genes, CG7882, CG9509, CG10514, CG14069 and CG31034 a detectable secondary cell phenotype of variable severity was detected (Figure 1 G-L). In general, these phenotypes ranged from displaying a lower number of smaller vacuoles to the loss of most vacuoles from the secondary cells. Many more showed a weaker and less penetrant phenotype, often consisting of more and smaller vacuoles than normal, in only one or two of the accessory glands dissected. The genes that exhibited this kind of phenotype are depicted in figure 2:

CG5106, CG31198, CG33630, CG9294, CG15406, CG6602, CG12809, CG13538, CG18088 and CG14681 . The rest of the candidates screened didn’t display any secondary cell morphological phenotype.

Figure 3. Results the RNAi egg laying assay for genes CG7882 and CG9505 . Both show the most drastic secondary cell morphological phenotype. Eggs were counted for 5 days after mating. The chart shows CG7882 (dark blue) and CG9509 (red) following the iab-6cocu(purple) egg laying phenotype. T test values for CG7882 p=0,009256 and CG9509 p=0,055006. (n=10)

The results of the egg-laying screen also varied from gene to gene (Table 2 of appendix – for the raw data coupled with secondary cell morphology data information). The top two candidate genes, CG7882 and CG9509 (Figure 3), showed a severe reduction of egg-laying.

Interestingly, these two candidates also displayed a severe secondary cell morphological phenotype. The next few genes with an egg-laying phenotype, CG15406, CG9036 and CG3285 , 67 showed only mild or no secondary cell morphological phenotype (Figure 2 E; Figure 4 dark blue line). Interestingly, two of the genes that showed a severe secondary cell morphological phenotype, CG10514 and CG31034 , showed no detectable egg-laying phenotype.

Figure 4. Results the RNAi egg laying assay for genes CG15406 (dark blue), CG9036 (purple) and CG3285 (light blue) that show an egg laying phenotype but no secondary cell morphological phenotype. Eggs were counted for five days after mating. The chart shows CG9306 and CG3285 following the iab-6cocu (red) egg laying phenotype with CG15406 following close as well. The T test results for these knockdowns are CG9306 p=0,126138 ; CG3285 p=0,011017; CG15406 p=0,009256. (n=10)

Based on the comparison between the two RNAi screens (the secondary cell morphology and the egg-laying screen), we decided to focus our future efforts on eight candidate genes,

CG7882, CG9509, CG3285, CG14069, CG15406, CG3349, CG13793 and CG14292 . All of them showed an egg-laying phenotype of variable degrees and three of them, CG7882, CG9509 and CG14069 showed a severe secondary cell morphological phenotype (Figure 1 J, K, H; appendix Table 2). The other genes from the list were left aside because either they didn’t show an egg laying phenotype of sufficient severity.

Based on their amino acid sequence the predicted function for CG7882, CG3285 and

CG15406 is in “general sugar transport”, while CG9509 is a predicted glucose-methanol-choline oxioreductase and CG13793 is a predicted neurotransmitter transporter. Finally, CG14069,

CG3349 and CG14292 have no predicted molecular function. We used TargetP 1.1

(http://www.cbs.dtu.dk/services/TargetP/) to predict their cellular localization based on sequence information. Five of them CG14069, CG15406, CG3349, CG13793 and CG14292 were predicted, with variable degrees of confidence, to be located somewhere in the secretory pathway. CG3285 was predicted with low confidence to be located in the mitochondria. As for

CG7882 and CG9509 based on their sequence data this software cannot predict their location within the cell.

Figure 5. Preliminary in situ hybridization results for genes CG7882, CG9509, CG15406, CG10514, CG31034 and CG14069 . A signal at the tip of the accessory gland can be seen coming from the secondary cells. There is background staining in the lumen of the glands, making definitive clear results lacking. Names of the genes are embedded in the images (A-F). Four of them are genes selected for the final 8, A, B, C and F.

Preliminary in situ hybridization results.

For some of the 73 candidate genes ( CG7882, CG9509, CG15406, CG10514, CG31034 and CG14069 ) in situ hybridization was performed in order to establish the location of their expression within the accessory glands (Figure 5). For this, we used DNA probes made from exonic sequences from the candidate genes. The preliminary results seem to indicate that all of them are specifically expressed in the secondary cells. Convincingly strong secondary cell

69 staining could be obtained from CG10514 , CG31034, CG15406 and CG14069 . The results for

CG7882 and CG9509 were less convincing, but the weak staining observed seemed to be secondary cell specific. In situ hybridization for the rest of the 73 candidates has been attempted, but has been difficult to achieve as transcripts seem to be expressed at a low level and developing a reliable protocol for in situ hybridization on accessory glands has been difficult.

Abd-Bm ISH .

In order to prove our assertion that the Abd-Bm form is only expressed in the secondary cells and the Abd-Br form is expressed in the ejaculatory duct of the accessory glands we designed in situ hybridization probes that could distinguish between the two isoforms. Indeed when in situ hybridization using these probes was performed on iab-5,6 rescue male accessory glands, we could clearly see staining in the secondary cells with the Abd-Bm probe and not with the Abd-Br probe while the result for ejaculatory duct staining was reversed (Figure 6).

Figure 6. Differential expression of the two Abd-B isoforms. The images are from in situ hybridization experiments where probes specific for the Abd-B m and the r isoforms were used to distinguish between the two. Panel A is staining with Abd-Bm specific probe, while the m isoform appears in the secondary cells of the accessory glands ( A), isoform r is detected in the ejaculatory duct only ( B). Surprisingly, the Abd-Bm isoform is still detectablt in iab-6cocu accessory glands. The black arrows in the images point to stained areas.

We also performed the same staining on cocu males. The Abd-Br probe gave the expected staining; the ejaculatory duct was clearly stained. However, when we stained with the

Abd-Bm probe we got a clear staining of the secondary cells in the accessory glands of the iab-

6cocu males (Figure 6 C). This result was unexpected as antibody staining for Abd-B shows that

Abd-B protein is completely lost in secondary cells of cocu males (Figure 9F, results part II). As

I mentioned above, however, in situ hybridization on accessory glands has been extremely difficult to accomplish and Abd-B is not that highly expressed. This finding still must be confirmed, though it leads to some intriguing possibilities regarding Abd-B regulation in the secondary cells.

Antibody development.

In order to further explore the importance of the eight selected candidate genes, we have started the process of producing antibodies against all eight proteins. To do this, we designed

~50 amino acid long sequences from each target genes and expressed them as 6-his tagged fusion proteins (using pQE31) in the SG13009 bacterial strain. Thus far, we have been able to express and purify three out of the eight antigens and sent two ( CG9509 and CG15406 ) to be injected into rabbits at the Pocono Rabbit Farm & Laboratory (PRF&L, PA 18325, USA) using their “49 Day Mighty Quick Protocol” (PRF&L – proprietary protocol).

Vacuolar markers.

Our work has shown that a loss of Abd-B in the secondary cells causes a loss of their characteristic vacuoles. Yet, although we used this phenotype as an indication of dysfunction in the secondary cells, we still have no clue as to their function in vivo. We have assumed that these vacuoles might store molecules for secretion into the lumen of the accessory gland to be included into the male seminal fluid. However, we have never observed a change in the number or size of

71 the vacuoles in dissected accessory glands from virgin or mated males. Even males dissected just after mating seem to display normal secondary cell vacuoles. Thus, we wondered if these vacuoles were secretory or something else. In order to begin to unravel this mystery, we decided to look vesicular trafficking markers.

Different endosomal pathways exist within the cells and each type of vesicle displays different markers depending upon the pathway in which they participate. The most commonly used markers are the Rab family of small GTPases. After consulting with our colleague Marcos

Gonzales-Gaitan here in Geneva, we obtained a battery of fly lines containing UAS driven GFP- tagged vesicular trafficking markers to test. Rab4-GFP was used as a marker for the early and fast recycling endosomes while Rab5-GFP as a marker for the early endosomes. Rab7-GFP was used to mark the late endosomes and Rab11-GFP for the slow recycling endosomes (for review on Rabs see (Fukuda 2008; Hutagalung and Novick 2011)). Hepatocyte growth factor-regulated tyrosine kinase substrate (Hrs)-GFP was used to label sorting endosomes and multivesicular bodies while a “tandem of FYVE domains” (originating from the hrs gene) was used as a marker for sorting endosomes. The Smad anchor for receptor activation (Sara)-GFP marks sorting and early endosomes (for review see (Gonzalez-Gaitan 2003). Finally, two constructs from the

Uninflatable gene ( Uif ) were used to mark the general secretory pathway, Uif-ecd-GFP is the extra cellular domain of Uif and Uif-C-term-GFP is the C terminal region of Uif including the transmembrane domain to mark the membrane of secretory vesicles (unpublished). We used our

DI-Gal4 driver to drive expression of each construct and examined their localization within the secondary cells (Figure 7). To limit the overexpression effects, a Gal-80 expressing transgene was also included in the background. The results showed that Rab7, Rab11, Hrs, uif-C-term,

FYVE and Sara are all located on the membrane of the large vacuoles. Meanwhile, Uif-ecd was

72 located within the vacuoles. The Rab4 and Rab5 proteins were not associated with the vacuoles at all. These results at first seem contradictory because the vacuoles harbor characteristics of different classes of endosomes such as, late endosomes (Rab7), recycling endosomes (Rab11 and

Hrs), secretory endosomes (uif-exo, uif-c-term) and early endosomes (SARA). The result with

SARA is a bit odd since SARA is usually seen coupled with Rab4 and Rab5 staining. These results, obtained by overexpression should be interpreted cautiously, because they seem to indicate that the secondary cell vacuoles may represent a new kind of intracellular vesicle.

Figure 7. Endosome markers. To determine the localization of markers for different endosome pathways with in the secondary cells the DI-Gal4 driver was used to drive of UAS-XXXX-GFP constructs in the background of gal80ts. Glands were dissected and imaged from flies after 1-2 days incubation at 25°C, they were initially kept at 18°C. Names of the genes/constructs tested are written on the images. Uif C-term, Hrs, Rab-11, Sara, FYVE and Rab-7 have vacuoles positive for these markers. Uif-ecd locates to the inside of the vacuoles. Rab-4 and Rab-5 don’t show any localization to the vacuoles.

DISCUSSION

Here, I have described results showing that Abd-B is expressed in the secondary cells of the Drosophila male AG. Using mutations that specifically remove Abd-B from these cells, we have been able to uncover roles for this previously unstudied but important reproductive cell type. Furthermore, we show that Abd-B expression in these mesodermally-derived cells does not fit the classical domain model paradigm developed for the segment-identity function of the Hox genes in ectodermal tissues. And finally, with the aid of our collaborators whose work we will not present here, we demonstrate that the secondary cells of the male AG synthesize products necessary for maintenance of the seminal fluid’s effects on the female PMR (Gligorov, Sitnik et al. 2013).

New insights into Abd-B gene regulation

Due to the large size and complexity of the Abd-B regulatory region, we created a BAC- reporter construct to monitor Abd-B expression in the adult fly. When combined with fluorescent markers, this method allowed us to bypass the technical issues of antibody penetration and the laborious dissections needed for in situ hybridization or immunohistochemistry to identify a novel area of Abd-B expression in the adult. Overall, the BAC reporter is able to accurately reproduce the known, complex Abd-B expression pattern; in fact, it should be noted that our

BAC construct reproduces the Abd-Bm expression pattern better than even an enhancer trap line inserted in the Abd-B promoter ( Abd-B-Gal4 LDN ) (de Navas, Foronda et al. 2006). Furthermore,

74 by combining our BAC reporter with pre-existing deletion mutations, we were able to discover the function of a vital gene in an adult tissue without the need to create mitotic clones.

From the standpoint of Hox gene regulation, our discovery of the secondary cell enhancer is quite interesting because, unlike other cell-type specific enhancers from the BX-C, the secondary cell enhancer does not seem to be regulated by a domain initiator (Simon, Peifer et al. 1990;

Mihaly, Barges et al. 2006; Iampietro, Gummalla et al. 2010). Most cell-type specific enhancers from the BX-C are not intrinsically restricted along the A-P axis. They are restricted only to a specific cell-type and gain A-P restriction through clustering in a BX-C regulatory domain. For example, in a transgene assay, an enhancer from the iab-7 domain (called 11X) drives expression in the tracheal placodes in all segments. However, in the BX-C, this enhancer seems to be active only in the Abd-B expression domain (Mihaly, Barges et al. 2006). The clustering of enhancers to one area of the chromosome is thought to allow all of the enhancers to be coordinately regulated along the A-P axis as a domain through the changing of the local chromatin environment. The

Polycomb (Pc) repression machinery is thought to be critical for this process by creating repressive chromatin over inactive domains ((Mihaly, Barges et al. 2006) and refs. therein).

Specialized elements, called initiators, seem to read an A-P segmental address and act as domain activators, probably by preventing Pc repressive complexes from establishing on active domains

(Iampietro, Gummalla et al. 2010).

The domain model predicts that deletion of an initiator element should prevent domain activation, leaving all enhancers in its domain inactive (Iampietro, Gummalla et al. 2010). Based on this paradigm and the fact that the secondary cell enhancer was found in the iab-6 domain, we expected that the deletion of the iab-6 initiator would abolish Abd-B expression in the secondary cells. However, we found that Abd-B expression in the secondary cells of initiator mutants was

75 normal. This finding argues against the strictest interpretation of the initiator model. We can propose several hypotheses to resolve this discrepancy. For example, the Pc repression system is known to act on many genes during development, but its main targets appear to be the homeotic genes during the establishment of segment identity. It is possible that late in development, after cells have made initial cell fate de cis ions (and the segment identity role of the homeotic genes might be less important), the targets of Pc silencing might change. Such loosening of Pc silencing over the Abd-B cis -regulatory regions would allow previously silenced enhancers to become available for regulating Abd-B expression so that it could perform other functions, such as in the secondary cells.

Alternatively, the difference in Abd-B gene regulation that we observe in secondary cells may reflect the cellular origin of the secondary cells. Most BX-C cis -regulatory mutations were isolated based on cuticular phenotypes and confirmed using antibody staining in the epidermis and CNS. These tissues are of ectodermal origin, unlike the mesodermally-derived secondary cells (Ahmad and Baker 2002). Perhaps, the rules governing the coordination of Hox expression in the ectoderm do not hold true in the other germ layers. Consistent with this, BX-C genes are expressed differently in the gut visceral mesoderm than in the ectoderm (Bienz, Saari et al.

1988).

Evolutionary considerations may provide some explanation for why the fly uses different means of controlling Abd-B expression in embryonic segment identity specification vs . in later reproductive tissues. Abd-B class Hox proteins play roles in the formation of the external genitalia in both arthropods and mammals (Dolle, Izpisua-Belmonte et al. 1991; Freeland and

Kuhn 1996; van der Hoeven, Sordino et al. 1996; Warot, Fromental-Ramain et al. 1997; Damen and Tautz 1999). Due to the similarity in expression pattern and function, it has been proposed

76 that Abd-B’s role in the formation of the genitalia predates its role in segmental identity (Kelsh,

Dawson et al. 1993; Damen and Tautz 1999). Here, we have shown that Abd-B is also important for correct development of cells within the Drosophila male AG that produces many seminal fluid proteins required for male reproductive success. The mammalian orthologues of Abd-B, the

Hox9 to 13 class of genes, are expressed in the developing seminal vesicle and prostate gland, both seminal protein secreting organs (Huang, Li et al. 1997; Thomson and Marker 2006). The analogy in function between these organs, and their similarity in gene expression patterns suggests that the role of Abd-B class genes in the male reproductive tract might be an ancient, conserved function, potentially independent of its role in segmental identity. In this light, it would not be surprising that Abd-B regulation in the secondary cells escapes the domain regulation seen for Abd-B function in segment identity determination. The cis -regulatory domains for segment identity could have been added separately, possibly through co-opting the abd-A gene regulatory regions, as suggested by transvection studies (Hendrickson and Sakonju

1995; Hopmann, Duncan et al. 1995). In any case, the adding of cis -regulatory sequences and the consequent constraints of the domain model on Abd-B would necessarily have to preserve its late function in the secondary cells.

Initial observations from the mRNA-seq data

In order to better understand the molecule nature of the iab-6cocu phenotype, we performed an RNA-seq experiment comparing wild-type ( iab-5,6 rescue ) to iab-6cocu accessory glands. Based on the bioinformatics analysis and FlyBase search of the top candidates, we were not able to draw any conclusion about the secondary cell morphology or reproductive phenotypes. The reason for this is that 34% of our candidate genes were without any known

77 function, and that the function of most of the other candidates were predicted molecular functions rather than experimentally confirmed functions. Only two of our candidates were confirmed Acps, whose function is also unknown. The positive information obtained from the in silico analysis is that over 50% of the 73 candidate genes have a predicted signaling sequence, making them potential Acps, though it must be noted that our phenotype need not be due to directly affecting Acp expression.

The mRNA-seq data also suffers from a great deal of noise. This noise is not a reflection on the quality of the reads themselves, as the RNA-seq worked quite well. The main problem with our results is simply that the secondary cells represent less than 1% of the cell mass used for the RNA isolation. This problem stems from the fact that secondary cells make up only a small part of the accessory glands and, for ease of dissection, our RNA isolation was performed on accessory glands attached to the ejaculatory duct and bulb. Thus, the data has a high background noise resulting from the transcripts coming from the other cell types. While we believe that in our list of 73 down-regulated candidate genes, we were able to identify some secondary cell specific genes, there are probably many other genes whose down regulation we missed. One major category of genes that we might have missed will be those genes whose expression in the secondary cells requires Abd-B, but that are also expressed in the main cells or in the ejaculatory duct. These genes would be missed due to the low number of cells in which their expression was affected. Example of such genes would be the genes coding for proteins involved in endosome trafficking. One reason for setting the cut off limit of to >5X for most down-regulated genes was to hopefully get around this noise problem. For further experiments of this kind, cell or nuclei sorting using one of our fluorescent markers would help solve this problem. Yet, regardless of this problem, we were able to notice some interesting things.

Possible crosstalk between the different cell types in the male reproductive system

Close examination of the mRNA-seq data produced results suggesting cross-talk between the different cells of the male reproductive system. For example, CG11598 is a gene that is normally expressed in all of the cells of the accessory glands. Given the fact that 96% of the accessory gland is made up of main cells, we imagined that a gene like CG11598 would be mostly unaffected by the removal of Abd-B in the secondary cells, which make up only 4% of the gland.

However, the mRNA-seq data shows that CG11598 is down-regulated >60X in the iab-6cocu flies. Thus, somehow a change in the secondary cells causes a dramatic decrease in the amount of this transcript in the whole gland. Data from the list of up-regulated genes is also consistent with the idea of cell-cell communication within the male reproductive tract. As mentioned above, we found 115 genes up-regulated by a factor >5X in iab-6cocu relative to iab-5,6 rescue accessory glands. For a few of the up-regulated genes, their location of normal expression is known to be outside of the secondary cells. For example, the Peb and PebII genes code for proteins involved in the formation of the mating plug and are normally expressed the ejaculatory bulb. Yet according to our mRNA-seq data, these genes were found to be up-regulated by 301X and 476X, respectively. Thus, a lack of Abd-B in the secondary cells causes a large increase in the expression of ejaculatory bulb genes. While we cannot rule out that the Abd-B protein normally inhibits the expression of these proteins in the secondary cells, when combined with the data from the loss of function genes, it is consistent with the idea that secondary cells might influence the expression profiles of genes in other cells. The fact that the secondary cells are located at the tip of the accessory gland could place these cells in a good place to regulate the secretory status of the cells further down as the peristaltic movement of the accessory gland dictates the unidirectional movement of the secreted proteins towards the ejaculatory bulb. This hypothesis

79 will have to be explored in more detail, first using in situ hybridization to visualize where the misexpression/loss-of-expression occurs.

Cluster or group of genes are simultaneously regulated

Another interesting observation that arose from the mRNA-seq data is that we found a number of clusters of genes within the 73 down-regulated candidates that seems to be coordinately regulated. The largest cluster of down-regulated genes is located on the third chromosome at position 85F9. This cluster includes six genes ( CG12809 , CG33783, CG33784, CG33631,

CG5361 and CG33630 ) covering ~15 kb of DNA all show severely reduced expression levels in iab-6cocu accessory glands (Figure 23). We also found a number of gene pairs ( CG17210 and

CG5207; CG18444 and CG18211 ; CG2196 and CG2187; CG10514 and CG11892 ) that are down regulated. This clustering of down-regulated genes suggests that these genes may be coordinately regulated as a gene neighborhood by Abd-B or a downstream target of Abd-B.

Unfortunately, ChIP-seq experiments have yet to be performed on Abd-B. Also the binding site preferences of the Abd-B protein is highly pleiotrophic, precluding good bioinformatic analysis.

We have examined the extensive ChIP data on the modEncode browser to examine chromatin states of the areas around the clusters. Although this data is not non-tissue specific, we did notice that some regions, like that of the six-gene cluster, seem to be part of a larger gene region sharing the same chromatin state.

Figure 23. Gene cluster. Screen shot from SeqMonk software used for graphical representation and analysis of sequence data. Shown on the screen marked by the dashed square is the mRNA-seq data CG33630, CG33631, CG33783, CG33784, CG12809 and CG5361 . The first three blue stripes are marked gene, mRNA and CDS. The big white stipe is the representation of the reads from the control while the big gray stripe is the reads in the cocu mutant. If we compare the white and gray stripe for the marked area we see a big difference. In the control all these genes are well expressed while in the mutant they have a severely reduced expression level.

RNAi of candidate genes

The RNAi experiments helped us connect the two phenotypes we observed in iab-6cocu flies with candidate effector genes. Apart from helping us narrow down the list of candidates, the

RNAi also validated the mRNA-seq data and showed that the two phenotypes we observed could be partially separated into two pathways.

From our RNAi screen, we found five genes whose knockdown showed a severe secondary cell morphological phenotype ( CG7882, CG9509, CG10514, CG14069 and

CG31034 ). Interestingly, while knockdown of three of these genes also showed PMR egg laying phenotypes in mates of knockdown males, the knockdown of the two genes with the most severe morphological phenotypes ( CG10514 and CG31034 ) did not display a significant egg-laying phenotypes. Likewise, we found five genes whose knockdown caused an egg-laying phenotype, but did not show a morphological phenotype ( CG3285, CG15406, C3349, CG13793 and

CG14292 ). These results clearly demonstrate that the two phenotypes observed in iab-6cocu males, while potentially related, can be separated.

We can imagine a number of possible functions for our candidate effectors. First would be secreted factors that are Acp genes themselves, or genes encoding proteins that interact with

Acps to modify directly or indirectly the PMR. Knockdown of these genes might be expected to affect the PMR, but, given that none of these candidates seem to be expressed at an extremely high level, probably would not affect the structure of the cells themselves. CG14292, CG3285 and CG3349 fall into this category. Each of these genes encodes a protein that contains a signal peptide, and knockdown of each gene causes a PMR phenotype but no cellular phenotype.

CG3349 is already know to be an Acp (Ravi Ram and Wolfner 2007). Although our own RNAi experiments did not show dramatic reduction in egg laying with CG3349 , more-detailed analysis performed by our collaborators, J. Sitnik and Mariana Wolfner seem to show CG3349 knockdown causing a significant decrease in eggs laid by their mates (data not shown). CG14069 is also potential Acp candidate as it codes for a small secreted molecule, similar to other Acps.

CG3285 , on the other hand may be more of an accessory/helper protein as it has a predicted transmembrane domains.

Given the fact that injuring the vesicular trafficking system of the cell would probably effect both vacuolar structures and the PMR ( CG7882, CG9509 and CG14069 ), the candidate genes whose knockdown selectively affected the vacuoles but did not cause a PMR defect, is hard to reconcile. Yet, CG10514 and CG31034 both affect the vacuole structure but do not effect the PMR. This would indicate that these molecules must only selectively damage the trafficking system. If we assume the simplest model for secondary cell function (a model far from proven), we can imagine that knockdown of CG10514 and CG31034 might still allow Acps and secreted

Acp helper molecules to be secreted and reach the accessory gland lumen. Alternatively, if our ideas about the vacuoles being a new type of vesicle is correct, then exactly what these

82 molecules are doing can be much more varied. Potentially these molecules could simply affect the size of the vacuoles (through vesicular fusion?), making them less visible in our assays, but not critically affecting their actual function.

The Vacuoles.

During this study, we were hoping that some of the experiments we performed would give us a glimpse into the function of the vacuole structures within the secondary cells. However the answer to what the vacuoles are doing remain elusive. The experiments designed to look at the Rab family of endosome markers placed this vacuoles in the late endosome pathway, the recycling endosome pathway and in the secretory pathway. These pathways are generally considered mutually exclusive, since their destination and function are very different. For example, the late endosome pathway usually finishes with at the lysosome, while the recycling endosome pathway ends at the cellular membrane. Of course, it must be noted here that these experiments were performed under slight overexpression conditions. While the techniques we used are common in the vesicular trafficking field, they are known to occasionally result in artifacts. We tried to control for this by using a gal80-expressing transgene in the background to limit overexpression, but to be absolutely sure of our results we would need antibodies.

Unfortunately, antibodies to these proteins are unavailable. We do, however, have access to a

GFP-fusion knock-in library of each of the Rab proteins (from Susan Eaton’s lab). This library should express each Rab protein as a GFP fusion using its own promoter at its native location in the genome. Studying the Rab protein complement of these vacuoles using this library should be very informative. If our preliminary data can be verified, then this would mean the secondary cell vacuoles might be extremely interesting. One of our lab’s favorite possibilities is that they

83 are Acp modification factories, fusing with small endosomes containing molecules from the lumen of the accessory glands, modifying them and then re-secreting them via small endosomes.

This might account for the varied Rab array and the fact that the large vacuoles never seem to change throughout the male reproductive lifespan.

Abd-Bm in situ hybridization .

The finding of the Abd-Bm transcript in iab-6cocu secondary cells is confusing and requires further confirmation. As mentioned above, in situ hybridization has proven difficult in the accessory gland and thus, this result is still not confirmed. However, if this result turns out to be correct, it would mean that Abd-B must be regulated at the translational level in the secondary cell and this regulation must require the area deleted in the iab-6cocu flies. Of course, we know that Abd-B protein is lost in iab-6cocu flies, and that the cocu region has enhancer activity. We also know that the cocu phenotype is caused by the loss of Abd-B from Abd-B rescue experiments and Abd-B RNAi experiments. So, how can this supposed cis -regulatory sequence regulate Abd-B expression at a post-translational level? As it turns out, the region deleted in iab-

6cocu also contains the promoter for a long, non-coding RNA (lncRNA). This lncRNA (~70 kb long) happens to be produced only in males and is imaginatively called the male-specific abdominal lncRNA ( msa ). Thus far, this transcript has no experimentally determined function, though, based on the fact that it shares much of its structure with another lncRNA, called the iab-

8 ncRNA , it is likely to be important in the regulation of Hox genes. The iab-8 ncRNA is known to serve as the precursor to a miRNA whose targets include the Ubx hox gene and the abd-A hox gene. This miRNA, however, seems to have no effect on the Abd-B transcript. Interestingly, however, both lncRNAs also potentially code for a micropeptide. One micropeptide has been

84 shown to regulate the processing of the Shavenbaby protein in flies (Kondo, Plaza et al. 2010). It may be possible that the micropeptide predicted in the iab-8 and msa lncRNAs may be real and modulate Abd-B protein levels.

MY SUMMARY

The work presented in this thesis started six years ago with the idea of making an Abdominal B reporter to explore its expression throughout the development of Drosophila. What I particularly liked about my project and using the Abd-B - Gal4 reporter BAC is the exploration. There was no clear direction or expectation of results. Before discovering the signal that the Abd-B-Gal4

BAC produced in the secondary cells, I and most of the people in the lab had no idea what accessory glands are. Discovering Abd-B expression there led to adding a bit more to the understanding of Abd-B regulation, even if it was an exception to the established domain model.

The fact that because of lack of tools the secondary cells were basically unexplored made the project even more exciting. This lead to a fruitful collaboration with Jessica Sitnik a PhD student in Mariana Wolfner’s lab, together we were able for the first time to glimpse into the function and purpose of these cells. Of course the interest didn’t stop with the results in the paper as can be seen from the rest of the thesis work. Some very interesting questions are arising as we are digging deeper into Abd-B’s role in these cells, especially the function of the vacuoles. Some of the preliminary work on this subject is mentioned in the thesis, for example, the section on endosomal markers. The results from that experiment give tantalizing clues that an interesting discovery lays in that direction. Since we have the tools now, the secondary cell drivers described in the last section of the thesis, it should be easier to continue the work in this field.

I would also like to redo the mRNA-seq experiment but on sorted secondary cells so as to eliminate most of the noise and hopefully get a true picture of the transcriptome profile of these cells. Abd-B ChIP-seq would nicely complement these results in a way that we would not have

86 to bias ourselves to a down regulated or up regulated genes but rather to genes directly shown to be influenced by Abd-B. This could serve as a starting point to building an interaction network between the genes responsible for the secondary cell phenotypes. Proteomics analysis would be beneficial as well in answering the hypothesis that molecules are taken up from the lumen directly or transferred from the adjacent main cells to the secondary cells where they are modified and stored in the vacuoles until secretion. Combining the transcriptome with the proteome profile would answer that question but also give an insight into the composition of the vacuoles if comparative analyses with cocu mutants are performed.

Many questions remain to be answered. With our study of the secondary cells I believe that we just opened up another avenue of research that not only our lab but other Drosophila labs interested gene regulation, reproduction, vesicular trafficking and so on, would be interested in exploring.

One thing that I have put aside but remains as an untapped potential are the fusion BACs. They can be used in taking a more biochemical approach to studying Abd-B regulation by performing

ChIP or IP experiments. Hopefully, a future PhD student in the lab will utilize these tools for work on his/hers thesis.

The transvection problem is another one that I spent a substantial amount of time and effort on.

My only regret is not being able to give a confirmation on the molecular level of the chromosomal interaction observed genetically.

Finally I have to say that I enjoyed very much the diversity of problems that I came by during my thesis and the tools I employed to find answers to some of them. I wish I could answer all the questions that arose from the work so far but new questions always follow from the previous

87 ones. At one point you have to stop and let somebody else continue the work. Finally, this is me stopping.

THE END

MATERIAL AND METHODS

Creation of Abd-B rescue BAC.

The Abd-B rescue BAC was constructed from BACR24L18 (size – 171936bp;

AC095018), which contains the Abd-B region of the BX-C. We first constructed a pW25-based vector (Gong and Golic 2004) to be used to add sequences to the BAC for site-specific integration into the Drosophila genome. The original white gene carried by pW25 was replaced by a Su(Hw) insulator-flanked white gene from the SUPor-P plasmid (Patton, Gomes et al. 1992) by amplifying it with NotI-forward and AscI-PmeI reverse (see Table 1 for primer list). These primers carry restriction sites for insertion of the product into pw25 after appropriate enzyme digestion. A fragment containing the kanamycin resistance gene (KanR) was amplified from pIGCG21 (Lee, Yu et al. 2001) using the following primers: PmeI5’Kan, 5’attB3’KanAS. Next, an attB sequence was PCR amplified using the primers 3’Kan5’attBS, and PmeI3’attBAS. The

KanR and attB fragments were then mixed together with the PmeI5’Kan and PmeI3’attBAS primers for a final overlap PCR reaction. The resulting PCR fragment, containing the KanR gene and an attB sequence flanked by PmeI sites, was cloned into pGemTeasy. After sequencing, this fragment was excised with PmeI and cloned into the unique PmeI site of the modified pW25 vector (resulting in pW25/Kan-attB ).

To mediate recombination in bacteria, two homology regions were then added to this vector. First, an 859bp fragment from the iab4 region ( iab4 HR: 101409-102267 coordinates in the BACR24L18) was made by PCR with the primers: NotI iab4 and EagI iab4 . The resulting

PCR fragment was cut with NotI and inserted into the unique NotI site of the modified pW25. A second homology fragment was designed to target the SacBII gene present on the BAC backbone. Using the PCR primers: MluI SacBII and AscI SacBII, a 525bp fragment from SacBII was amplified (SacBII HR: 921-1445 coordinates in the BACR24L18). The resulting 525bp fragment was digested with AscI and MluI, and inserted into the unique AscI site of pW25/Kan- attB . Clones for both homology regions were selected in an orientation required by the homologous recombination process to function correctly. The completed construct was digested with the ISce-I endonuclease and the fragment containing the homology regions flanking the

KanR gene, the white gene and the attB site was gel purified. This fragment was then used to recombineer BAC24L18 using the protocol of Soren Warming (Warming, Costantino et al.

2005). The resulting BAC, called iab4-SacBII BACR24L18D (108528bp), contains the region of the BX-C from about iab-4 to the Abd-B m promoter. The overall structure of this BAC was verified by restriction enzyme mapping [using three restriction digests (EcoRI, XmaI, BamHI)

(data not shown)].

Abd-B Gal4 reporter BAC.

Using iab4-SacBII BACR24L18D as a base we used recombineering to replace the start codon of the Abd-Bm isoform with sequence encoding the Gal4 transcription factor. First, a negative/positive selection cassette was created using the SacB gene and the Ampicillin resistance ( AmpR ) gene. SacBII was digested out of the plasmid pSK2-SACBK MAR using

BamHI and EcoRI and cloned in pHSS7 (Smith, Wohlgemuth et al. 1993). The AmpR gene was then amplified with primers ( Amp BamHI and Amp XmaI) carrying a BamHI and XmaI site. The amplified AmpR fragment was digested with BamHI and XmaI and cloned into a pHSS7-SacBII digested with the same enzymes, producing pHSS7-SacBII/Amp.

The SacBII/Amp cassette was flanked by two large homology regions using an overlap

PCR strategy, as follows: The primers NHR L frw NotI/long and NHR L rev OL/long were first used to amplify the region 39201bp to 40325bp of iab4-SacBII BACR24L18D. At the same time, the primers NHR R frw OL/long and NHR R rev XmaI/long were used to amplify the

40326 to 41590bp region of iab4 -SacBII BACR24L18D. The two reaction products contain a

27bp region of complementarity to mediate overlap PCR. Thus, the two fragments were mixed together with the primers NHR L frw NotI/long and NHR R rev XmaI/long in an overlap PCR reaction. The resulting fragment, containing the two homology domains fused together, was digested with NotI and XmaI and cloned into pHSS7 (pHSS7-NHR-L/NHR-R). Next, from the previously created pHSS7-SacBII/Amp, the double selection cassette was amplified with primers

NSx/A new F EcoRI and NCSx/A new R XbaI . Digesting this PCR fragment with EcoRI and XbaI produced a fragment that could be inserted between the two homology domains of pHSS7-NHR-

L/NHR-R creating pHSS7-NHR-L/SacBII-Amp/NHR-R.

The primers F300 NS/A rec and R300 NS/A rec were used to amplify a fragment from pHSS7-NHR-L/SacBII-Amp/NHR-R for recombineering. This fragment contained 300bp of the homology regions on both sides of the cassette carrying the SacBII and AmpR genes. Once again recombineering was performed using the protocol of Soren Warming (Warming, Costantino et al. 2005), where the target BAC was iab4-SacBII BACR24L18D . BAC DNA purified from the

91 resulting ampicillin resistant/sucrose sensitive colonies were verified by extensive restriction enzyme digests. The new BAC was named iab4-SacBII BACR24L18D N S/A ins .

To replace the SacBII/AmpR cassette, the Gal4 gene (with a synthetic polyA tail) was

PCR amplified from the plasmid pTnT Gal4 (unpublished, pTNT base vector from Promega

Corp. , Madison, Wisconsin, USA) using the following primers: HR-R Gal4rep and HR-L

Gal4rep. These primers contain 55bp homology regions to mediate recombineering to the BX-C sequences just flanking the SacBII/AmpR cassette. The resulting targeting fragment was then phosphorylated by T4 kinase in order to improve the recombination reactions. After standard preparation of the recombineering DY380 strain containing iab4-SacBII BACR24L18D N S/A ins , bacterial colonies were selected on LB agar plates containing 10% sucrose. Restriction digestion of the candidate colonies with BamHI was performed in order to confirm the correct replacement of the SacBII/Amp cassette with Gal4. The final product is iab4-SacBII

BACR24L18D Gal4rep .

Abd-B mCherry N terminal fusion BAC.

First, mCherry was amplified using the primers mCh F KpnI and mCh R NotI . After digesting the product with KpnI and NotI, it was subcloned in pTnT (pTnT-mCherry). From this construct, a fragment was amplified using the primer pair C-t mCh-fus F and C-t mCh-fus R that contain 55bp homology regions to target for the replacement of the SacBII-Amp within the iab4-

SacBII BACR24L18D N S/A ins BAC. The rest of the process is the same as for the creation of the Gal4 BAC, described above. The final product is iab4-SacBII BACR24L18D N mCh-fus .

Abd-B mCherry reporter BAC.

As with the mCherry-Abd-B fusion, mCherry was subcloned in pTnT after first being amplified with the primer pair mCh F KpnI and mCh R NLS NotI and digested with KpnI and

NotI. The difference with the pTnT-mCherry construct mentioned above is that in this case the mCherry is tagged with an NLS sequence that is located in the pTnT-mCherryNLS primer. The primer pair, N-t mCh-rep F and N-t2 mCh-rep R , with 55bp homology regions was used to amplify the mCherryNLS reporter to replace the SacBII-Amp portion of the iab4-SacBII

BACR24L18D N S/A ins BAC. The rest of the process is the same as for the creation of the Gal4

BAC. The final product is iab4-SacBII BACR24L18D N mCh-rep .

Abd-B mCherry C terminal fusion BAC.

In order to make this construct the same strategy was used as with the creation of the

Gal4 reporter BAC. The first step was to create a plasmid with large homology regions specific for the C-terminal end of Abd-B that would be used to insert the double selection cassette in the first step of the two-step recombineering process. First, the region 43966-45060bp of the iab4-

SacBII BACR24L18D BAC was amplified by the primer pair CHR R frw OL/long and CHR R rev XmaI/long . Then, the region 42959-43965bp of the BAC was amplified with the primer pair

CHR L frw NotI/long and CHR L rev OL/long . The products of the two reactions were mixed and an overlap PCR was performed with the primer pair CHR L frw NotI/long and CHR R rev

XmaI/long . The product of the reaction was cut by NotI and XmaI and cloned in pHSS7 (pHSS7-

CHR-L/CHR-R). In order to place the double selection cassette between the two homology regions, the SacBII-Amp cassette was amplified from the vector pHSS7-SacBII/Amp using the primer pair C Sx/A new F SalI and NCSx/A new R XbaI . Next, a digestion by SalI and XbaI

93 followed. This allowed the product to be cloned into pHSS7-CHR-L/CHR-R to create pHSS7-

CHR-L/SacBII-Amp/CHR-R.

For recombineering, the SacBII-Amp cassette and 500bp homology regions were amplified using the primer pair F CS/A rec and R CS/A rec . In order to improve the recombination reaction the PCR products were phosphorylated using a T4 kinase.

Recombineering was performed according to the Soren Warming protocol using the iab4-SacBII

BACR24L18D BAC as target. Bacteria were plated on ampicillin plates. Colonies were tested for sucrose sensitivity by replica plating. From the positive colonies the BAC DNA was isolated and the proper insertion of the cassette was verified by restriction digestion. The resulting product from this reaction was named iab4-SacBII BACR24L18D C S/A ins .

For the second step of recombineering (the replacement of the SacBII-Amp cassette with mCherry) the primers C-t mCh-fus F and C-t mCh-fus R were used to amplify mCherry. This primer pair contains 55bp of homology for proper replacement of SacBII-Amp and insertion of the mCherry as C terminal fusion to Abd-B in the context of the BAC. As with most of the recombineering reactions, the replacement cassette was phosphorylated using T4 kinase in order to improve the recombination reaction. The target of the reaction, called iab4-SacBII

BACR24L18D C S/A ins was transformed into DY380 bacterial strain. The bacteria were plated on LB agar plates containing 10% sucrose. A BamHI digest was used to confirm the correct replacement of the SacBII-Amp with mCherry . The final product is the iab4-SacBII

BACR24L18D C mCh-fus .

Injections of BACs.

Using the PhiC31 system ((Bischof, Maeda et al. 2007); www.flyc31.org), site 51C on the second chromosome was chosen for integration of the BACs into the fly genome. For better integration frequencies, all BACs were isolated on the day of injection using the NucleoBond PC

20 (Macherey-Nagel ref. 740571) miniprep kit and resuspended in injection buffer (Drosophila protocols -Sullivan 2000). Embryos were injected with BAC DNA (at about 50-100ng/ul) through the chorion using the Eppendorf system (FemtoJet & TransferMan NK 2) equipped with

Femtotips II glass needles. Integration efficiency was about 5%, based on the total number of fertile adults that yielded at least one integrant.

Dissection and replacement of the 2.8kb cocu enhancer.

The 2.8kb region was divided into three overlapping regions of 1kb, named DI, DII and

DIII. The protocol for dissecting the iab6 domain within the KsY-iab6H construct (developed by

(Iampietro, Gummalla et al. 2010)) was used to delete each of these regions. The recombineering primers used for DI were F I and RI , for DII were F II and R II , and for DIII were F III and R III

(see Table 3 for primer list).

For the replacement of the 2.8kb cocu enhancer with the mf9 (Xue and Noll 2002) prd enhancer, an FRT-Kan-FRT-mf9 cassette in pGEM was first created. The mf9 enhancer was amplified with primers F mf9 NcoI and R mf9 EcoRI digested with NcoI and EcoRI and subcloned into pGEM-T easy, making pGEM-mf9. The FRT-Kan-FRT cassette was amplified using the primer pair F KF EcoRI and R KF SpeI, and then digested with EcoRI and SpeI and cloned into the pGEM-mf9 vector. Recombineering primers for integration in KsY-iab6H were F rec mfKF and R III .

Injections of the dissection and replacement of the cocu enhancer.

All the constructs were injected into the iab-5,6 CI line (ref CI) using the PhiC31 system of integration. Plasmid DNA was purified using the Qiagen midi prep kit (Cat.no. 12143 -

QIAGEN) and resuspended in injection buffer (Sullivan, Ashburner et al. 2000). Embryos were injected with plasmid DNA (at about 250ng/ul) through the chorion using the Eppendorf system

(FemtoJet & TransferMan NK 2) equipped with Femtotips II glass needles.

Two color fluorescent DNA FISH on salivary glands.

About 11kb of the 51C (10620407-10632081, dbxref=REFSEQ:NT_033778, ID=2R, species=Dmel, release=r5.50) locus and the Abd-B region (12663192-12675048 dbxref=REFSEQ:NT_033777, ID=3R, species=Dmel, release=r5.50 (excluding sequences found on the iab4-SacBII BACR24L18D BAC)) were probed. The probes were generated by mixing 6

PCR reactions of about 1.5kb (see Table 4 for the list of primers used). The probes were labeled using the “FISH Tag DNA Kit” as per instructions (“FISH Tag DNA Green kit” Cat.no. F32947;

“FISH Tag Orange Kit” Cat.no. F32948 - Invitrogen). Tissue probed was the larval and adult salivary glands using the two color fluorescent in situ DNA hybridization protocol for staining imaginal disks developed by Frederic Bantignies

(http://www.igh.cnrs.fr/equip/cavalli/Lab%20Protocols/p5.pdf). The only modification was that incubation time with the probes was 5 days.

96 mRNA-seq.

Total RNA was isolated from 100 pairs of accessory gland per genotype from iab5,6 rescue and iab-6∆5males using the miRNeasy Mini Kit (Cat.no 217004, Qiagen,). The reason for using this kit was because it enriches the <200nt fraction. A lot of the Acps are small peptides with mRNAs shorter than 200nt. Approximately 10ug of total RNA was obtained per genotype that was send to Fasteris (Fasteris SA, Geneva, CH) for transcriptome sequencing and bioinformatic analysis. The HiSeq run was performed on a Hi-Seq 2000 with 1X100+7 number of sequencing cycles using the TruSeq SBS v5 with the data analysis pipeline carried out by HiSeq Control

Soft. V. 1.1.37.8, RTA 1.7.48, CASAVA 1.7. Sequences were aligned to the Drosophila melanogaster genome revision 5.30.

Creation of a specific secondary cell Gal4 drivers based on the 2.8kb and 1.1kb cocu enhancer.

The 2.8kb and 1.1kb putative enhancer sequence removed in iab-6cocu were amplified by

PCR using the primer pairs D5 F & D5 R and D5 F & DI R , respectively (see Table 2 for primer list). All three primers contain a BamHI site at their 5’ ends. The amplified DNA fragments

(called D5 and DI) were cloned into the BamHI site of the pChs-Gal4 plasmid, which contains a minimal Hsp70 promoter upstream of the coding sequence for Gal4 and the HSP70 3’UTR

(Drosophila Genomics Resource Center (Apitz, Kambacheld et al. 2004). Clones with the enhancer in both orientations with respect to Gal4 were isolated. The ( D5/DI)-Gal4 cassettes in both orientations were digested out of the pChs-Gal4 vector with NotI and cloned into the NotI site of pattB (Bischof, Maeda et al. 2007). An insertion with the Gal4 coding sequence next to the white gene was selected for injection for all but one of the DI-Gal4 constructs where DI was

97 next to the white gene, this construct designation is DIrsG4 . The constructs were injected by

Genetic Services Inc (Cambridge, Mass) into the VK00001 (59D3) platform (Venken, He et al.

2006). The resulting integrants were named D5G4rs , D5rsG4rs , DIG4rs and DIrsG4 . In the main body of work only D5rsG4rs was used as representative of the 2.8kb enhancer and referred to as D5-Gal4 in the rest of the text, while DIrsG4 was used as representative of the 1.1kb enhancer and referred to as DI-Gal4 in the rest of the text.

The precise location of both of these regions within the Drosophila melanogaster genome is on the third chromosome at 12721546 – 12724398 (sequence ID:gb|AE014297.2|) for the

2.8kb enhancer region and 12721546 – 12722645 (sequence ID:gb|AE014297.2|) for the 1.1kb enhancer region.

2.8kb cocu enhancer in pattB.

The 2.8kb enhancer was amplified using the primer pair D5 F & D5 R , which contain

BamHI sites (see Table 2 for primer list). After restriction digest the PCR product was cloned in the BamHI site of the pattB vector. Both orientation of the product were isolated and sent for injection at Genetic Services Inc (Cambridge, Mass) into the VK00001 (59D3) platform

(Venken, He et al. 2006).

RNAi experiment.

Fecundity.

We used 3-5 day old virgin females from the w; DI-Gal4 as a specific secondary cell driver line and crossed them to males carrying different shRNA constructs for our candidate

98 genes (see table 6 for the list of genes and fly line ID from the VDRC). From theses crosses, male virgin progeny were collected and aged 3-6 days. Ten single crosses were established for each RNAi line with a single CS female in small vials with food. iab-6cocu males served as positive controls for the cocu phenotype, while w; DI-Gal4 /+ was used as negative control, females mated to these males show normal egg-laying phenotype. The male was removed after approximately 24h and the female was transferred to a new vial. The eggs laid in the previous vial were counted. For a period of five days, the process of female transferring and egg counting was repeated. Average number of eggs per day were analyzed in order to determine if a cocu phenotype was present.

Secondary cell morphological phenotype.

Male progeny from the ( ♀w; DI-Gal4,UAS-GFP X ♂RNAi and ♀w; DI-Gal4 X ♂RNAi) cross were dissected, mounted in PBS and observed under a fluorescence or light microscope for disturbance in the morphology of the secondary cells. Pictures were taken for every gene knockdown and compared to the cocu secondary cell phenotype.

In situ hybridization of accessory glands.

Probe synthesis.

We amplified the probe sequences for each candidate gene from previously isolated RNA from accessory glands using the “OneStep RT-PCR Kit” (Cat.no. 210210 - QIAGEN), (see table

7 for primer information). The PCR products were gel purified and their concentration determined by nanodrop. Using the “PCR DIG Probe Synthesis Kit” (Roche,

Cat.no.11636090910) with only the antisense primer and 100-200ng of gel purified PCR product, DNA probes were synthesized. Unincorporated nucleotides were removed from probe solutions by standard ammonium acetate/ethanol precipitation and probes were rehydrated in water.

Tissue preparation.

Accessory glands were dissected and fixed for 10 minutes using 4% paraformaldehyde in

PBT (Tween 20 – 0.01%) followed by 5 minute washes with PBT. Next, they were transferred to

100% ethanol with two intermediary wash steps. First, they were placed in a solution of PBT: ethanol, 1:1. After 5 minutes, half of the volume was removed and ethanol added in the amount of the removed volume. 5 minutes after that, the incubation solution was removed and the glands were washed 3 X 5 minutes with ethanol. At this step, the tissue was stored at -20°C until needed or at least for an hour before the next step. Rehydration of the tissue was performed by going through a 5 minute wash of 1:1 ethanol:PBT, a second 5 minute wash where you take away half the volume and replace it with PBT, followed by 3 X 5 minute washes of PBT. 2 X 5 minutes rinses were performed with 0.1M Triethanolamine, followed by 2 X 5 minutes washes with 0.1M

Triethanolamine supplemented with acetic anhydride (2.5uL acetic anhydride in 1mL 0.1M

Triethanolamine – made fresh). Afterwards, the glands were washed 3 X 5 minutes with PBT.

100

Prehybridization.

Prehybridization (50% Formamide, 5X SSC, 0.01% Tween 20), hybridization (50%

Formamide, 5X SSC, 100ng/ul salmon sperm DNA, 50ng/ul Heparin, 0.01% Tween 20), and probe hybridization (50% Deionized formamide, 5X SSC, 100ng/ul salmon sperm DNA, 50ng/ul

Heparin, 0.01% Tween 20) solutions were made. Tissues were incubated in a 1:1 mix of prehybridization solution with PBT for 5 minutes. Then incubated for 5 minutes in prehybridization solution. The hybridization solution was boiled for 5 minutes, then cooled on ice for 5 minutes. The hybridization solution was added to the tissue and incubated for at least an hour at 45°C.

Hybridization.

Approximately 1uL of probe solution was added to 100uL of probe in hybridization solution to make the working probe hybridization solution. The working probe hybridization solution was heated to 95°C for 5 minutes then cooled on ice for 5 minutes. This was then added to the tissue and incubated for 3 days at 45°C.

Post hybridization.

The hybridized tissue was then washed: 4 x 20 minutes at 45°C with prehybridization solution pre-warmed to 45°C, 1 X 30 minutes at room temperature with 2X SSC, 1 X 1 hour at

45°C in 2X SSC. 1 X 1 hour at 45°C with 0.1X SSC, and 4 X 15 minutes at room temperature with PBT. The tissue was then blocked for at least an hour with 1% BSA in PBT and then incubated over night with an anti-DIG antibody in 1% BSA in PBT solution (1:2000 dillution).

The tissue was then washed 3 X 5 minutes with PBT, 4 X 20 minutes with PBT and 2 X

5 minutes with alkaline phosphatase buffer (0.1M NaCl, 0.05M MgCl, 0.1M Tris pH 9.5, 0.01%

101

Tween 20, (levamisole – optional). 20ul of NBT/BCIP (Roche Cat.no. 11681451001) per 1ml of alkaline phosphatase buffer was then added until a signal became visible. The staining reaction was stopped with 2 X 5 minute washes with PBT. Tissue was mounted in 80% glycerol solution and observed under light microscope.

Production of antigen for antibody development.

Using the Abdesigner web site (http://helixweb.nih.gov/AbDesigner/), the amino acid sequence of the genes, CG7882, CG9509, CG15406, CG3285, CG3349, CG14292, 14069,

CG13793 , was analyzed for optimal immunizing peptides for antibody production. Based on these results, primers were developed for amplifying the desired peptide from a cDNA library

(see Table 5 for primer list). RNA was isolated from accessory glands using the “RNeasy Mini

Kit” (Cat.no. 74104 – QIAGEN). The “OneStep RT-PCR Kit” (Cat.no. 210210 - QIAGEN) was used to obtain the nucleotide sequence of the peptides directly from the RNA isolate. The primers used carried BamHI sites and were designed for subcloning the OneStep RT-PCR products into pQE-31. The initial cloning was done in DH5 α cells. The plasmid was retransformed into SG13009(pREP4) cells and the expression protocol described in “The

QAIexpressionist” (march 2001 fifth edition - QIAGEN) was followed to check for expression of the peptide. For the SDS-PAGE analysis, standard protocols were followed using 4-20% gradient gels.

The peptides produced from the pQE-31 vector are tagged with 6xHis. This allows for easy purification using Ni-NTA following the native condition purification procedure described in the “The QAIexpressionist” (march 2001 fifth edition - QIAGEN).

102

Purification efficiency was tested by running the samples on a 4-20% gradient gel after which a western blot (Protein Blotting Guide – Bio-Rad, third edition) was performed using an anti-His antibody (Covalab mab 9001) or anti-RGS antibody (Cat.no.34698 - QIAGEN). Visualization was performed using a secondary antibody (Cat.no. S3721 - Promega) coupled with alkaline phosphatase and using the standard NBT-BCIP a colorimetric assay.

Concentration of the peptides was determined using the “Bio-Rad Protein Assay”,

Microassay procedure. The samples were lyophilized and sent to Pocono Rabbit Farm &

Laboratory (PRF&L, PA 18325, USA) for injection in Rabbits using the Pocono Rabbit Farm &

Laboratory (PRF&L, PA 18325, USA).

Fly crosses and strains.

All crosses were done using standard genetic techniques. Fab7 1, iab-7Sz , iab-6,7 IH , iab-

5,6 J82 , and iab-4,5,6 DB are described in (Mihaly, Barges et al. 2006). The lines iab-6∆5 iab-6∆6 and iab-64 are described in (Iampietro, Gummalla et al. 2010). The line Iab-7blt described in

(Galloni et al., 1993); OR; the line Pc3 described in (Lewis, 1980); Pcl,Asx; Sw(Hw); the line

Mcp 1described in (Duncan, 1982); the line Zop6 described in (Lifschytz and Green, 1984); the line

Abd-BD16 described in (Karch et al. 1985); Df(3L)0463 (CTCF ) described in (Mohan, Bartkuhn et al. 2007); CTCF p306 ; the line Abd-BD18 described in (Hopmann et al. 1995); Df(3R)P9 described in (Lewis 1980); UAS-Rab4-GFP , UAS-Rab5-GFP , UAS-Rab7-GFP , UAS-Rab11-

GFP , UAS-SARA -GFP, UAS-FYVE-GFP, UAS-Hrs-GFP, UAS-Uif-ecd-GFP, UAS-Uif-C-term-

GFP (lines donated by Marcos Gonzales-Gaitan lab); the line iab-6∆5 was described as a deficiency without any phenotypic consequence. Following the LTR phenotype identified in this work the line was renamed iab-6cocu (reflecting that mates of these males fail to reject other suitors; “cocu” means “cuckold” in French). The BAC-AbdB Gal4 ,w+, UAS-GFP/Cy line carrying

103 the Abd-B-Gal4 BAC reporter and a UAS-GFP marker on the second chromosome was created for this study by recombining a chromosome carrying the BAC and a UAS-GFP chromosome.

The BAC reporter chromosome cannot exist as a homozygote. The 4.4E transgenic lacZ reporter line is described in (Mihaly, Barges et al. 2006). The Gal4 expressing lines driven by a paired enhancer ((w -; prd-mf5.2,w +/CyO), (w -;prd-mf5.4,w +), (w -;prd-mf5.5,w +), (w -;prd-mf9.3,w +), (w -

;prd-mf9.7,w +)) were obtained from Makus Noll’s laboratory (Jiao, Daube et al. 2001). They were used in a cross with a UAS-AbdBm (Castelli-Gair, Greig et al. 1994) flies for the experiment in which we tested for the ability of Abd-Bm to transform main cells into secondary cells. Flies for the RNAi screen of the candidate genes were obtained from the VDRC (Vienna

Drosophila Rnai Center) a list of which is provided in a table below.

Antibody, X-Gal and FM4-64 staining.

Antibody and X-Gal staining on embryos and dissected accessory glands was performed as described in (Hagstrom, Muller et al. 1996) and (Galloni, Gyurkovics et al. 1993) respectively, using a 20min fixation. The Abd-B primary antibody, obtained from the

Developmental Studies Hybridoma Bank, was diluted 1:4. Goat-anti-mouse secondary antibody, coupled to Alexa Fluor 488/555 X (Invitrogen AG), used to reveal Abd-B localization was used at 1:500 dilution. Goat HRP coupled anti-mouse was obtained from Biorad and used at 1:1’500 dilution. Staining with FM4-64 dye was done by placing a drop of the dye onto a microscope slide and placing a freshly dissected gland into it. The glands were immediately covered with a cover slip and visualized using fluorescent microscope at 555nm.

104

Primer table BACs Construction Name: Sequence: NotI-forward AAAAAGCGGCCGCGCGATAATCATTTAATAGTCGAC AscI-PmeI reverse AAAAAGGCGCGCCGTTTAAACCGAAATGCGTCGTTTAGAG CAG PmeI5’Kan GTTTAAACTGCAAGGCGATTAAGTTGGG 5’attB3’KanAS CCGTGACCTACATCGTCGACGGTACCTGCTCAGAAGAAC TCGTCAAGAAGGCG 3’Kan5’attBS CGCCTTCTTGACGAGTTCTTCTGAGCAGGTACCGTCGAC GATGTAGGTCACGG PmeI3’attBAS GTTAAACGGCTTGTCGACATGCCCGCCG NotI iab4 AAAAGCGGCCGCGGCGCTAAATGAATCCACCCACG EagI iab4 AAAACGGCCGGCCACATGGATGCCTCGTCAAG MluI SacBII AAAACGCGTGCCAACACGGGAACAGAAAACGG AscI SacBII AAAAGGCGCGCCCCTCGAAGAAGCCTCTGTTTGTC Amp BamHI AAAAAGGATCCCTCATGAGACAATAACCCTG Amp XmaI AAAAACCCGGGCTTGGTCTGACAGTTACC NHR L frw NotI/long AAAAAGCGGCCGCAAGCGGCCCTGCAACTTCGTCGAGGA CTGGGACTTGAACG NHR L rev OL/long TGCATTCTAGATTTTTGAATTCGACGGGCAGGGAGGGATG CGCCTGGGGATGCGGATG NHR R frw OL/long CCGTCGAATTCAAAAATCTAGAATGCAGCAGCACCATCTG CAGCAGCAGCAACAGCAGCAGCAGCAG NHR R rev XmaI/long AAAAACCCGGGTTGTTTGTCGATGTCATGGATGTGGGTGC ATTCACACCTC NSx/A new F EcoRI AAAAAGAATTCCAGCTCAACAGTCACACATAGACAG NCSx/A new R XbaI AAAAATCTAGAACGAGTTCTTCTGAGCGGGACTCTG F300 NS/A rec GTCACTCAGAGGAGTGAGAA R300 NS/A rec TGTACGGCGACAAGTGGCAC HR-R Gal4rep ACCCACCGCCCCGCACCCGCATCCGCATCCCCAGGCGC ATCCCTCCCTGCCCGTCATGAAGCTACTGTCTTCTAT HR-L Gal4rep GCTGCTGCTCCTGCTGCTGCTGCTGCTGTTGCTGCTGCT GCAGATGGTGCTGCTGTTCGCTATTACGCCAGCCCG F CS/A rec CATCGGACCACCCGCACTTG R CS/A rec GCTAATGAGAGCGTTGAGAG CHR L frw NotI/long AAAAAGCGGCCGCGTTATTATGGCGGAATATGTCAGTTAA GTGACCTCGCCAG CHR L rev OL/long GGTCATCTAGATTTTTGTCGACCTGGTGCATCTTGGCGGCA TGGTGACCCATGTTCAGGCTA CHR R frw OL/long ACCAGGTCGACAAAAATCTAGATGACCCTTGGACAACAGC AGCGCTGGCGCCATGGGCTTTG CHR R rev XmaI/long AAAAACCCGGGCGAAAGCGACTTCAACTATGGGGTAAACA TGCACACACTC C Sx/A new F SalI AAAAAGTCGACCAGCTCAACAGTCACACATAGACAG F CS/A rec CATCGGACCACCCGCACTTG

105

R CS/A rec GCTAATGAGAGCGTTGAGAG C-t mCh-fus F CCACCACCTGAACCTTAGCCTGAACATGGGTCACCATGCC GCCAAGATGCACCAGATGGTGAGCAAGGGCGAGGA C-t mCh-fus R ACTGCTAGTAGGTGGCAAAGCCCATGGCGCCAGCGCTGCT GTTGTCCAAGGGTCATTACTTGTACAGCTCGTCCA mCh F KpnI AAAAAGGTACCATGGTGAGCAAGGGCGAGGA mCh R NotI AAAAAGCGGCCGCTTACTTGTACAGCTCGTCCA mCh R NLS NotI AAAAAGCGGCCGCTTAGTGGAACGCGAAGAAGAACCCCTT GTACAGCTCGTCCA N-t mCh-rep F ACCCACCGCCCCGCACCCGCATCCGCATCCCCAGGCGCAT CCCTCCCTGCCCGTCATGGTGAGCAAGGGCGAGGA N-t2 mCh-rep R TGCTGCGGAGCGGGGAGGTGTTGCTGCTGTACGGCGACAA GTGGCACAGGCGGAGTTCGCTATTACGCCAGCCCG

Table 1. List of primers used to perform the different BAC constructs described in material and methods section.

Primer table Creation of a specific secondary cell D5/DI-Gal4 drivers D5 F AAAAAGGATCCCAGGAGCAATCCATCAAA D5 R AAAAAGGATCCACAGCTCTGCTTTTTGCTGA DI R AAAAAGGATCCGGCCGCCCAATGGATGTACA

Table 2. List of primers used to perform the different Gal4 driver constructs described in material and methods section.

106

Primer table Dissection and replacement of the cocu enhancer F I GGCAGCACGAATAGTTTAGTTTATTTTAGCCATAGCTCAAG AACGACAGCGAATACAAGCTTGGGCTGCAGG R I GGTGAATAATTTTTATTGCCGTAAATCACTGTGTCAATTGT GGTTGTAATCTCGCCCGGGGATCCTCTAGAG F II TCCGACTCCAATACGAAATTAATTGGTTCCGATTGCAACTG AGCGCAGTCGAATACAAGCTTGGGCTGCAGG

R II AGCATTTGTTTATCTGAAATTTTAATACGCTCCTTAATTTTT ATGGGTTCCTCGCCCGGGGATCCTCTAGAG F III CAAATTTTATGCTTTGTCACTGAAACGATTATGACGTCCGT TGCTCGTCCGAATACAAGCTTGGGCTGCAGG R III TTGGCAACAAAGTTGGATGCATTGTGGGTGGCAAAATATC AAACAATGGCCTCGCCCGGGGATCCTCTAGAG F rec mfKF GGCAGCACGAATAGTTTAGTTTATTTTAGCCATAGCTCAAG AACGACAGCTTGCCACATTGTGTGTGGAC

F mf9 NcoI AAAAACCATGGTTGCCACATTGTGTGTGGAC R mf9 EcoRI AAAAAGAATTCGCCCAGTTCTCGCAGTTCGA F KF EcoRI AAAAAGAATTCGAATACAAGCTTGGGCTGCAGG R KF SpeI AAAAAACTAGTCTCGCCCGGGGATCCTCTAGAG

Table 3. List of primers used to perform the different dissection and replacement constructs described in material and methods section.

107

Primer table FISH Abd -B locus probes FISH1 AB F GAAACCAGCCCAACAATGAG FISH1 AB R TGTTGTTGCAGACGTGTCTC FISH2a AB F GCACTTGGGAAGCAGCATAG FISH2a AB R CCTCATCCGTAATCGAAACG FISH3 AB F TGCTGTTGAATGTTGACCGA FISH3 AB R TGTGTATGGGAGTGCAAGTC FISH4a AB F GTTTGTTGGCATTTCGCACG FISH4a AB R TTATTTGTCTGGAGGTGAGC FISH5 AB F TGGTCCAACGGAATGGCGGA FISH5 AB R TTTGAGACTAGGCTTCTGCG FISH6 AB F GGCCAACTGAATTGCTAGCG FISH6 AB R CAATGCGATGTCAGCAGTAT Primer table FISH 51C locus probes FISH1 51C F ATGCAAGTAAAACAGTCGAG FISH1 51C R TTGCCTAGTTGGTTAAAGCC FISH2a 51C F CTCAAATGGCGCTTATCCTG FISH2a 51C R ATCGCCCAATCCCTGACACT FISH3a 51C F GGTCCGACTTTTGTGGAGCA FISH3a 51C R CAAGGCACAGATGGATAGGC FISH4 51C F TTCTAGTGGTTCGCACTGCA FISH4 51C R ATGGCTTTGAAACGCACCGT FISH5 51C F CACTCCATCGACTTGAATCA FISH5 51C R GTTCTCGAATCATCCCTGTG FISH6 51C F CCTATCTTTACTGGCACATC FISH6 51C R ACACAGAGTGAATGGCAGAG

Table 4. List of primers used to create FISH probes for the Abd-B and the 51C locus described in the materials and methods secton.

108

Primer table Antigen Expression cg7882ant -F AAAAA GGATCCAATGGCAAAGCCAAAAGTCGG cg7882ant -R AAAAAGGAT CCCTAATTGAGGGACCAGCTCCACT cg9509ant-F AAAAA GGATCCAAAGTCGGTCACGCCTCAAGG cg9509ant -R AAAAAGGATCCCTAATATCCTTTGCCTGTGCTCA cg3285ant -F AAAAA GGATCCACCGGAAACCCCACATCACCT cg3285ant-R AAAAAGGATCCCTAATCTCTGTAGTCGAAGGACT cg14069ant -F AAAAA GGATCCAAACTGGTCGGCTCAAA TAGC cg14069ant -R AAAAAGGATCCCTAGGCCAACTTGCGACATCGTC cg15406ant-F AAAAA GGATCCAAGGTGGAAGCGCGAGGAGGA cg15406ant-R AAAAAGGATCCCTAATCGGACATTGAGAGGCCAT cg3349ant -F AAAAA GGATCCACGAGTTTGCCGCAAAGTATG cg3349ant -R AAAAAGGATCCCTATTCACCGTCCTTCGACAGCC cg13793ant -F AAAAA GGATCCATACTACATTCATCAGAGACC cg13793ant-R AAAAAGGATCCCTAGTTAACCTCCTCGGTGCGAT cg14292ant -F AAAAA GGATCCACTCTCCCAGCCTGACTTTCC cg14292ant -R AAAAAGGATCCCTAGGCAGCAGCTGCTCCTGTGG

Table 5. List of primers used to perform the different antigen expression constructs described in material and methods section.

109

Fly line table VDRC Gene name: trasformant ID alpha-Est5 1 100526 (CG1089) 2 alpha-Est7 105273 3 alphaTry 103292 4 beat-Ic 105066 5 beat-IV 110257 6 betaTry 102898 7 CG10514 107169 8 CG10560 104272 9 CG11598 103262 10 CG12374 101566 11 CG12506 109086 12 CG13309 101094 13 CG13538 102614 14 CG13793 50167 15 CG14069 9519 16 CG14245 17839 17 CG14292 102225 18 CG14376 100667 19 CG14681 109085 20 CG14715 104124 21 CG15155 104046 22 CG15406 105077 23 CG15614 100503 24 CG17752 106787 25 CG2187 101065 26 CG2196 108782 27 CG3106 42699 28 CG31090 108499 29 CG31198 107738 30 CG3285 52669 31 CG33630 104105 32 CG33631 101627

110

33 CG33783 106535 34 CG33784 104931 35 CG5361 51985 36 CG6602 106152 37 CG6628 49368 38 CG6733 102774 39 CG7882 109918 40 CG8157 18585 41 CG8934 103285 42 CG9259 103953 43 CG9294 102143 44 CG9509 107089 45 Cpr56F 16856 46 Jon65Aiv 15299 47 Jon74E 105316 48 Jon99Cii 109902 49 NaPi-T 106729 50 nerfin-2 101434 51 obst-A 102591 52 phr 35499 53 ple 108879 54 scpr-A 43220 55 scpr-C 16610 56 Traf1 110766 57 Ugt86Dj 101244 58 yellow-e 100926 59 gsb 107940 60 cg3349 109764 61 cg18088 100340

Table 6. List of fly lines with the corresponding transformant ID obtained from the VDRC used in an RNAi experiment described in material and methods section.

111

Primer table In Situ Hybridization CG7882 S CATTAACGTTCTCAGAGGCG CG7882 AS CAAACAGTTCTGCTCCGATG CG9509 S ATCCGTTCCAGCAACACCTG CG9509 AS ACGCACAGCAAATGGGAGTC CG15406 S CATCTTCCAGTGGCAGTACC CG15406 AS GCACAGAACCACATGGTAGC CG3285 S CTATTGGGACGCAGGATTCG CG3285 AS CTGTACTGCTTAGGATCACC CG3349 S GCCAAGTTAGCAGTCAAGTC CG3349 AS TTTGATGCCATTCTTCTCCG CG14292 S TCGCAATTGTTCTACTGGCG CG14292 AS AAACGGGCCTGCCACTCGTC CG14069 AS CTAGGCCAACTTGCGACATC CG14069 S CAATTGCCATCGGATTGTTA CG13793 S ATTGGGAAAAACCCACGGAC CG13793 AS GGTGGAGCTACGAAACGGAG B gal S CCAGGCGTTAGGGTCAATGC B gal AS GTTAACCGTCACGAGCATCA AbdBr S CCATACAATTAGCGCCACTG AbdBrAS TGACCCATGTTCAGGCTAAG AbdBm S CAGCAGCAGCAACATGCAGT AbdBm AS GATAATCCACCAGAGGCTCC Table 7. List of primers used to make probes for in situ hybridization.

112

APPENDIX

Reads Reads Tissue normalized normalized Fold Reported or predicted expression Signal Gene for iab- for iab- Decrease molecular function maximum in Sequence 5,6rescue. 6cocu. adult flies RPM RPM transmembrane Malpighian CG17752 3,78 0,00 378334,00 Yes transsporter Tubules ubiquitously CG33775 1,93 0,00 193250,00 unknown No expressed transmembrane Malpighian CG15406 1,52 0,00 152422,00 No transsporter Tubules transmembrane Malpighian CG3285 1,28 0,00 127926,00 Yes transsporter Tubules sodium:iodide symporter Malpighian CG2196 1,28 0,00 127926,00 No activity Tubules serine-type endopeptidase CG18211 1,14 0,00 114317,00 Midgut Yes activity transferase activity, Malpighian CG10560 1,12 0,00 111595,00 transferring phosphorus- No Tubules containing groups serine-type endopeptidase CG6298 0,98 0,00 97985,70 Midgut No activity CG8197 0,79 0,00 78932,90 unknown Testis No CG14069 0,68 0,00 68045,60 cytokine activity Testis Yes serine-type endopeptidase CG31034 0,68 0,00 68045,60 unknown Yes activity serine-type endopeptidase CG18444 0,65 0,00 65323,80 Midgut Yes activity metallocarboxypeptidase CG12374 0,65 0,00 65323,80 Midgut Yes activity Malpighian CG13656 0,65 0,00 65323,80 unknown Yes Tubules zinc ion binding; nucleic CG12809 0,63 0,00 62602,00 Brain No acid binding Malpighian CG6733 0,63 0,00 62602,00 aminoacylase activity No Tubules CG10152 0,63 0,00 62602,00 unknown Brain Yes lipase activity; transporter Malpighian CG31272 0,54 0,00 54436,50 No activity Tubules CG33783 34,54 0,03 1043,24 unknown unknown No CG33784 18,97 0,03 573,00 unknown Eye yes ubiquitously CG33631 5,31 0,03 160,31 unknown yes expressed CR11700 13,96 0,20 70,29 unknown unknown unknown Male lipase activity; triglyceride CG11598 941,23 14,24 66,11 Accessory yes lipase activity Gland transferase activity, Malpighian CG9259 3,54 0,07 53,44 transferring phosphorus- No Tubules containing groups structural constituent of CG9036 1,74 0,03 52,61 Testis yes chitin-based cuticle;

113

structural constituent of chitin-based larval cuticle glucuronosyltransferase CG15902 1,52 0,03 46,04 Midgut yes activity ligand-gated ion channel ubiquitously CG14376 12,49 0,30 41,93 yes activity expressed CG13538 1,36 0,03 41,10 unknown Testis No extracellular matrix Malpighian CG7874 24,63 0,63 39,16 yes structural constituent Tubules CG8687 5,91 0,17 35,68 electron carrier activity Crop yes serine-type endopeptidase ubiquitously CG9294 2,29 0,07 34,53 No activity expressed neurotransmitter CG13793 40,53 1,26 32,21 Heart No transporter activity glucose transmembrane Malpighian CG7882 1,99 0,07 30,01 No transporter activity Tubules sodium:iodide symporter activity; sodium-dependent Malpighian CG42235 0,98 0,03 29,60 multivitamin No Tubules transmembrane transporter activity CG14681 22,26 0,79 28,02 structural molecule activity unknown yes choline dehydrogenase Malpighian CG9509 1,74 0,07 26,31 No activity Tubules Malpighian CG13309 0,87 0,03 26,31 chitin binding yes Tubules CG5106 4,27 0,17 25,81 unknown Testis yes CG1089 2,53 0,10 25,48 carboxylesterase activity Midgut no sodium:iodide symporter activity; sodium-dependent Malpighian CG42235 2,53 0,10 25,48 multivitamin No Tubules transmembrane transporter activity transferase activity, Malpighian CG10514 0,84 0,03 25,48 transferring phosphorus- no Tubules containing groups CG17052 0,76 0,03 23,02 chitin binding Carcass yes no, but alkaline phosphatase Malpighian CG5361 1,47 0,07 22,20 signal activity Tubules anchor ubiquitously CG1112 2,18 0,10 21,92 carboxylesterase activity no expressed serine-type endopeptidase CG6467 0,71 0,03 21,37 Midgut yes activity CG34167 13,34 0,63 21,20 unknown Testis No CG6628 2,04 0,10 20,55 unknown Testis yes transferase activity, transferring acyl groups Malpighian CG15155 0,68 0,03 20,55 no other than amino-acyl Tubules groups CG17210 1,99 0,10 20,00 unknown Testis yes CG41443 0,65 0,03 19,73 unknown Testis no CG9792 1,82 0,10 18,36 unknown Carcass yes sodium:iodide symporter Malpighian CG2187 0,60 0,03 18,09 No activity Tubules 114

Malpighian CG14292 2,40 0,13 18,09 unknown Yes Tubules metallopeptidase activity; CG31198 0,57 0,03 17,26 Midgut Yes zinc ion binding ubiquitously CG33630 0,54 0,03 16,44 unknown yes expressed CG3048 11,30 0,76 14,83 protein binding Heart No CG5207 7,57 0,53 14,28 unknown Testis yes no, but G-protein coupled receptor ubiquitously CG15614 1,22 0,10 12,33 signal activity expressed anchor transferase activity, Malpighian CG11892 1,52 0,13 11,51 transferring phosphorus- No Tubules containing groups CG12506 1,50 0,13 11,30 unknown Testis yes deoxyribodipyrimidine ubiquitously CG11205 12,25 1,09 11,21 No photo-lyase activity expressed transferase activity, transferring acyl groups CG3106 1,03 0,10 10,41 Midgut yes other than amino-acyl groups Malpighian CG7171 0,63 0,07 9,45 urate oxidase activity No Tubules CG14245 0,60 0,07 9,04 unknown Midgut yes CG14246 0,60 0,07 9,04 unknown Carcass yes Malpighian CG6602 1,69 0,20 8,49 unknown yes Tubules high affinity inorganic Malpighian CG10207 2,12 0,26 8,02 phosphate:sodium No Tubules symporter activity FK506 binding; peptidyl- ubiquitously CG14715 8,27 1,13 7,35 prolyl cis-trans isomerase Yes expressed activity CG8157 2,56 0,36 7,03 unknown Head yes tyrosine 3-monooxygenase CG10118 0,68 0,10 6,85 Brain No activity serine-type endopeptidase CG10764 0,65 0,10 6,58 Testis yes activity no, but CG4838 62,79 10,50 5,98 unknown Brain signal anchor Male CG3349 24,09 4,17 5,77 unknown Accessory yes Gland Table 1. Showing the fold decrease of the 73 candidate genes as well as their predicted molecular function and the tissue of maximum expression. Final 8 candidates are marked in yellow.

115

Avera Avera Avera Avera Avera ge No. ge No. ge No. ge No. ge No. Phenotyp Phenotype Descripti Descripti Gene Of Of Of Of Of e DIrsG4 DIrsG4,G on on Eggs Eggs Eggs Eggs Eggs X RNAi FP x RNAi Day1 Day2 Day3 Day4 Day5 very mild, NORMA some sec CG17752 26,10 17,70 8,40 3,80 24,60 NORMAL L cells look strange POSSIBL mild NORMAL CG15406 16,80 21,20 18,00 8,00 1,67 E phenotype ?? NORMA CG3285 39,30 10,70 11,30 5,70 6,80 NORMAL L weak phenotype NORMA NORMAL CG2196 36,70 21,00 20,50 19,60 17,10 , multy L? ? small vacuoles NORMA CG18211 25,50 28,70 17,30 2,80 25,90 NORMAL L NORMA 1/3 looked CG10560 37,20 8,30 14,00 17,33 26,67 L? suspicious NORMA NORMAL CG6298 32,20 12,11 3,56 4,22 30,44 L ? smaller POSSIBL severe CG14069 37,30 7,50 21,70 8,70 8,90 and more YES E phenotype vacuoles mild looking NORMA CG31034 33,60 18,00 18,40 26,10 15,22 YES phenotype L? , multy vacuoles NORMA CG18444 29,10 17,30 11,50 4,30 22,60 NORMAL L NORMA CG12374 35,00 11,00 16,22 2,00 25,67 NORMAL L mild some sec phenotype NORMA cells seem CG12809 29,30 20,20 17,70 14,30 5,90 YES , not all L? destroyed acc gld ? have it looks very NORMA NORMAL CG6733 32,10 20,70 20,00 1,80 22,70 much like L? ? D5 NORMA CG10152 13,70 2,50 15,40 10,33 24,78 NORMAL L 1/3 more NORMA CG31272 33,60 20,90 25,33 7,89 13,78 NORMAL then usual L vacuoles? NORMA CG33783 27,80 11,50 22,00 5,10 16,70 NORMAL L very mild, NORMA CROSS some sec CG33784 40,10 19,30 13,60 17,50 12,30 L MISSING cells look strange

116

NORMA CG33631 25,00 0,67 30,00 14,86 22,00 NORMAL L NORMA CG11598 36,22 18,67 28,89 24,00 3,63 L 1/3, many NORMA NORMAL CG9259 28,44 6,78 9,33 6,33 15,11 smaller L? ? vacoles NORMA CG9036 9,80 13,00 12,90 8,80 2,60 NORMAL L NORMA CG15902 36,90 11,30 15,90 4,70 23,30 NORMAL L NORMA CG14376 34,50 19,30 26,90 15,60 7,80 NORMAL L? 1/3 mild NORMA phenotype CG13538 36,40 13,60 15,00 11,30 7,00 ? L , smaler multy vac 1/3 accgld severe CG9294 36,80 11,90 10,40 3,60 23,50 YES have a ? phenotype pheno some sec NORMA cells seem CG13793 40,20 19,90 15,70 12,44 7,56 L? destroyed ? not in all acc gld, CG7882 28,40 10,20 0,90 0,40 0,20 YES many YES

small vacuoles NORMA CG42235 25,30 11,70 16,11 3,22 15,00 NORMAL L NORMA NORMAL CG43161 27,40 16,10 24,90 11,22 12,67 L ?? 1/3 have a severe mild CG9509 28,70 15,30 11,70 2,60 0,40 YES pheno, YES looking other less phenotype severe NORMA CG13309 22,50 9,10 18,67 8,29 14,14 NORMAL L very light POSSIBL CG5106 33,00 25,70 17,10 6,00 13,44 phenootyp POSSIBLE E e NORMA CG1089 34,90 10,00 14,70 8,44 16,67 NORMAL L 1/3 NORMA smaller CG42235 34,40 9,20 21,70 3,80 28,60 NORMAL L and more vacuoles 2/3 have a small CG10514 30,40 8,10 24,20 17,30 28,90 YES multy YES

vacule phenotype CG17052 29,80 22,11 17,00 2,11 14,22 NORMA NORMAL

117

L NORMA CG5361 22,30 20,67 19,00 14,67 2,44 NORMAL L NORMA CG1112 24,70 3,80 20,50 6,80 19,30 NORMAL L 1/3, mild NORMA CG6467 23,10 28,30 16,60 7,78 18,89 NORMAL looking L phenotype very mild, NORMA some sec CG6626 16,70 9,50 19,70 4,90 21,20 NORMAL L cells look strange mild NORMA CG15155 24,10 23,30 18,90 23,00 12,00 NORMAL looking L phenotype NORMA NORMAL CG9792 31,80 6,50 15,30 13,80 10,60 L ? vacuole NORMA CG2187 25,30 11,50 19,10 16,20 4,90 NORMAL slightly L irregular CROSS CG14292 21,10 24,40 19,70 12,90 4,20 NORMAL MISSING more NORMA vacuoles CG31198 41,70 21,60 25,40 8,00 15,70 POSSIBLE L? then usual? NORMA CG33630 40,60 30,10 10,70 4,30 19,60 YES L? 1/4 almost NORMA CG3048 29,60 30,00 6,40 7,20 24,50 NORMAL D5 L phenotype NORMA CG5207 37,90 10,40 20,10 9,90 18,50 NORMAL L NORMA CG15614 25,80 21,60 15,10 23,44 6,44 NORMAL L NORMA CG12506 27,30 15,80 11,90 3,80 17,40 NORMAL L NORMA CG11205 33,50 10,40 17,11 3,56 30,67 NORMAL L weak phenotype NORMA NORMAL CG3106 38,90 13,22 17,56 13,44 11,78 , multy L? ?? small vacuoles NORMA CG14245 46,40 26,60 13,60 6,90 21,80 NORMAL L look a NORMA CG6602 20,50 22,88 13,89 15,00 5,67 little POSSIBLE L? strange NORMA NORMAL CG10207 12,78 8,44 10,89 8,63 30,75 L ? NORMA CG14715 36,30 12,80 22,80 6,90 21,40 NORMAL L? NORMA 1/3 accgld NORMAL CG8157 39,20 13,40 20,20 10,44 5,89 L? have a ?

118

pheno NORMA CG10118 18,30 14,70 20,40 8,90 18,90 NORMAL L multiple smaller CG4838 39,30 7,90 17,00 1,50 32,80 then

normal vacuoles 1/3 have smaller NORMA multiple CG3349 17,40 8,40 19,60 1,00 14,30 NORMAL and more L? smaller vacuoles vacuoles 1/3 have a DI males 28,50 18,70 5,30 5,30 2,20 phenotype POSSIBL Dont look NORMAL CG18088 39,70 7,25 13,13 17,29 12,17 E normal ?? DIrsG4/+ 47,20 12,60 17,80 17,70 14,90 (CS) DIrsG4/+ 34,10 29,20 15,40 7,50 20,78 (yw) DIrsG4/F 34,67 21,56 15,56 2,89 21,00 X-36B DIrsG4/F 41,00 22,11 21,67 8,67 21,67 X-51C NORMA CG3388 24,00 12,70 24,30 3,11 28,44 POSSIBLE L? NORMA CG7997 32,70 28,20 23,40 7,10 28,90 NORMAL L DIrsG4/F 49,40 31,30 17,88 7,75 33,50 X-58A Table 2. Five day egg laying data from the RNAi experiment for the candidate genes available from the VDRC. Descriptive data on the secondary cell morphology also included. Final 8 candidates are marked in yellow.

119

REFERENCES

Ahmad, S. M. and B. S. Baker (2002). "Sex-specific deployment of FGF signaling in Drosophila

recruits mesodermal cells into the male genital imaginal disc." Cell 109 : 651-661.

Akbari, O. S., A. Bousum, et al. (2006). "Unraveling cis-regulatory mechanisms at the

abdominal-A and Abdominal-B genes in the Drosophila bithorax complex."

Developmental biology 293 : 294-304.

Andrew, D. J. (1998). "Regulation and formation of the Drosophila salivary glands." Ann N Y

Acad Sci 842 : 55-69.

Apitz, H., M. Kambacheld, et al. (2004). "Identification of regulatory modules mediating specific

expression of the roughest gene in Drosophila melanogaster." Dev Genes Evol 214 (9):

453-459.

Bantignies, F., C. Grimaud, et al. (2003). "Inheritance of Polycomb-dependent chromosomal

interactions in Drosophila." Genes & development 17 : 2406-2420.

Bender, W. and A. Hudson (2000). "P element homing to the Drosophila bithorax complex."

Development 127 : 3981-3992.

Bickel, S. and V. Pirrotta (1990). "Self-association of the Drosophila zeste protein is responsible

for transvection effects." The EMBO journal 9: 2959-2967.

Bienz, M., G. Saari, et al. (1988). "Differential regulation of Ultrabithorax in two germ layers of

Drosophila." Cell 53 (4): 567-576.

120

Bischof, J., R. K. Maeda, et al. (2007). "An optimized transgenesis system for Drosophila using

germ-line-specific phiC31 integrases." Proc Natl Acad Sci U S A 104 (9): 3312-3317.

Cai, H. N. and P. Shen (2001). "Effects of cis arrangement of chromatin insulators on enhancer-

blocking activity." Science 291 (5503): 493-495.

Castelli-Gair, J., S. Greig, et al. (1994). "Dissecting the temporal requirements for homeotic gene

function." Development 120 (7): 1983-1995.

Celniker, S. E., D. J. Keelan, et al. (1989). "The molecular genetics of the bithorax complex of

Drosophila: characterization of the products of the Abdominal-B domain." Genes &

Development 3: 1424-1436.

Chiang, a., M. B. O'Connor, et al. (1995). "Discrete Polycomb-binding sites in each

parasegmental domain of the bithorax complex." Development (Cambridge, England)

121 : 1681-1689.

Cléard, F., Y. Moshkin, et al. (2006). "Probing long-distance regulatory interactions in the

Drosophila melanogaster bithorax complex using Dam identification." Nature genetics

38 : 931-935.

Copeland, N. G., N. A. Jenkins, et al. (2001). "Recombineering: a powerful new tool for mouse

functional genomics." Nat Rev Genet 2(10): 769-779.

Damen, W. G. and D. Tautz (1999). "Abdominal-B expression in a spider suggests a general role

for Abdominal-B in specifying the genital structure." J Exp Zool 285 (1): 85-91.

Daxinger, L. and E. Whitelaw (2010). "Transgenerational epigenetic inheritance: more questions

than answers." Genome research 20 : 1623-1628.

121 de Navas, L., D. Foronda, et al. (2006). "A simple and efficient method to identify replacements

of P-lacZ by P-Gal4 lines allows obtaining Gal4 insertions in the bithorax complex of

Drosophila." Mech Dev 123 (11): 860-867.

Demerec, M. (1950). Biology of Drosophila. New York,, Wiley.

Dietzl, G., D. Chen, et al. (2007). "A genome-wide transgenic RNAi library for conditional gene

inactivation in Drosophila." Nature 448 (7150): 151-156.

Dolle, P., J. C. Izpisua-Belmonte, et al. (1991). "HOX-4 genes and the morphogenesis of

mammalian genitalia." Genes Dev 5(10): 1767-1767.

Dreesen, T. D., S. Henikoff, et al. (1991). "A pairing-sensitive element that mediates trans-

inactivation is associated with the Drosophila brown gene." Genes Dev 5(3): 331-340.

Drosophila protocols -Sullivan, W., Ashburner, M. and Scott, H. (2000). Cold Spring harbor

Laboratory Press: p353.

Duffy, J. B. (2002). "GAL4 system in Drosophila: a fly geneticist's Swiss army knife." Genesis

34 (1-2): 1-15.

Fitzgerald, D. P. and W. Bender (2001). "Polycomb group repression reduces DNA

accessibility." Mol Cell Biol 21 (19): 6585-6597.

Foronda, D., B. Estrada, et al. (2006). "Requirement of Abdominal-A and Abdominal-B in the

developing genitalia of Drosophila breaks the posterior downregulation rule."

Development 133 (1): 117-127.

Freeland, D. E. and D. T. Kuhn (1996). "Expression patterns of developmental genes reveal

segment and parasegment organization of D. melanogaster genital discs." Mech Dev

56 (1-2): 61-72.

122

Fujioka, M., X. Wu, et al. (2009). "A chromatin insulator mediates transgene homing and very

long-range enhancer-promoter communication." Development 136 (18): 3077-3087.

Fukuda, M. (2008). "Regulation of secretory vesicle traffic by Rab small GTPases." 65 : 2801-

2813.

Galloni, M., H. Gyurkovics, et al. (1993). "The bluetail transposon: evidence for independent

cis-regulatory domains and domain boundaries in the bithorax complex." Embo J 12 (3):

1087-1097 Issn: 0261-4189.

Geyer, P. K., M. M. Green, et al. (1990). "Tissue-specific transcriptional enhancers may act in

trans on the gene located in the homologous chromosome: the molecular basis of

transvection in Drosophila." EMBO J 9(7): 2247-2256.

Gligorov, D., J. L. Sitnik, et al. (2013). "A novel function for the hox gene abd-B in the male

accessory gland regulates the long-term female post-mating response in Drosophila."

PLoS Genet 9(3): e1003395.

Gohl, D., M. Muller, et al. (2008). "Enhancer blocking and transvection at the Drosophila

apterous locus." Genetics 178 (1): 127-143.

Gong, W. J. and K. G. Golic (2004). "Genomic deletions of the Drosophila melanogaster Hsp70

genes." Genetics 168 (3): 1467-1476.

Gonzalez-Gaitan, M. (2003). "Signal dispersal and transduction through the endocytic pathway."

Nat Rev Mol Cell Biol 4(3): 213-224.

Groth, A. C., M. Fish, et al. (2004). "Construction of transgenic Drosophila by using the site-

specific integrase from phage phiC31." Genetics 166 : 1775-1782.

Gurudatta, B. V. and V. G. Corces (2009). "Chromatin insulators: lessons from the fly." Brief

Funct Genomic Proteomic 8(4): 276-282.

123

Gyurkovics, H., J. Gausz, et al. (1990). "A new homeotic mutation in the Drosophila bithorax

complex removes a boundary separating two domains of regulation." EMBO J 9(8):

2579-2585.

Hagstrom, K., M. Muller, et al. (1996). "Fab-7 functions as a chromatin domain boundary to

ensure proper segment specification by the Drosophila bithorax complex." Genes &

Development 10 : 3202-3215.

Hagstrom, K., M. Muller, et al. (1997). "A Polycomb and GAGA dependent silencer adjoins the

Fab-7 boundary in the Drosophila bithorax complex." Genetics 146 (4): 1365-1380.

Haseloff, J. and B. Amos (1995). "GFP in plants." Trends Genet 11 (8): 328-329.

Hendrickson, J. E. and S. Sakonju (1995). "Cis and trans interactions between the iab regulatory

regions and abdominal-A and abdominal-B in Drosophila melanogaster." Genetics

139 (2): 835-848.

Henikoff, S. and T. D. Dreesen (1989). "Trans-inactivation of the Drosophila brown gene:

evidence for transcriptional repression and somatic pairing dependence." Proc Natl Acad

Sci U S A 86 (17): 6704-6708.

Hopmann, R., D. Duncan, et al. (1995). "Transvection in the iab-5,6,7 region of the bithorax

complex of Drosophila: homology independent interactions in trans." Genetics 139 (2):

815-833 Issn: 0016-6731.

Huang, H. F., M. T. Li, et al. (1997). "Androgen modulation of the messenger ribonucleic acid of

retinoic acid receptors in the prostate, seminal vesicles, and kidney in the rat."

Endocrinology 138 (2): 553-559.

Hutagalung, A. H. and P. J. Novick (2011). "Role of Rab GTPases in Membrane Traffic and Cell

Physiology." 119-149.

124

Iampietro, C., F. Cléard, et al. (2008). "Boundary swapping in the Drosophila Bithorax

complex." Development (Cambridge, England) 135 : 3983-3987.

Iampietro, C., M. Gummalla, et al. (2010). "Initiator elements function to determine the activity

state of BX-C enhancers." PLoS genetics 6: e1001260.

Jiao, R., M. Daube, et al. (2001). "Headless flies generated by developmental pathway

interference." Development 128 (17): 3307-3319.

Kassis, J. A., E. P. VanSickle, et al. (1991). "A fragment of engrailed regulatory DNA can

mediate transvection of the white gene in Drosophila." Genetics 128 (4): 751-761.

Kelsh, R., I. Dawson, et al. (1993). "An analysis of abdominal-B expression in the locust

Schistocerca gregaria." Development 117 (1): 293-305.

Kondo, T., S. Plaza, et al. (2010). "Small peptides switch the transcriptional activity of

Shavenbaby during Drosophila embryogenesis." Science 329 (5989): 336-339.

Lee, A. M. and C. T. Wu (2006). "Enhancer-promoter communication at the yellow gene of

Drosophila melanogaster: diverse promoters participate in and regulate trans

interactions." Genetics 174 (4): 1867-1880.

Lee, E. C., D. Yu, et al. (2001). "A highly efficient Escherichia coli-based chromosome

engineering system adapted for recombinogenic targeting and subcloning of BAC DNA."

Genomics 73 (1): 56-65.

Lewis, E. B. (1954). "The Theory and Application of a New Method of Detecting Chromosomal

Rearrangements in Drosophila melanogaster." The American Naturalist 88 (841): 225-

239.

Lewis, E. B. (1978). "A gene complex controlling segmentation in Drosophila." Nature

276 (5688): 565-570.

125

Lewis, E. B. (1980). "Report of New Mutants -- Drosophila melanogaster." Drosophila

Information Service 55 : 207-208.

Li, H. B., M. Muller, et al. (2011). "Insulators, not Polycomb response elements, are required for

long-range interactions between Polycomb targets in Drosophila melanogaster." Mol Cell

Biol 31 (4): 616-625.

Liao, G. C., E. J. Rehm, et al. (2000). "Insertion site preferences of the P transposable element in

Drosophila melanogaster." Proc Natl Acad Sci U S A 97 (7): 3347-3351.

Ling, J. Q., T. Li, et al. (2006). "CTCF mediates interchromosomal colocalization between

Igf2/H19 and Wsb1/Nf1." Science 312 (5771): 269-272.

Liu, Y. and M. Lehmann (2008). "A genomic response to the yeast transcription factor GAL4 in

Drosophila." Fly 2: 92-98.

Maeda, R. K. and F. Karch (2006). "The ABC of the BX-C: the bithorax complex explained."

Development (Cambridge, England) 133 : 1413-1422.

Maeda, R. K. and F. Karch (2011). "Gene expression in time and space: additive vs hierarchical

organization of cis-regulatory regions." Current opinion in genetics & development 21 :

187-193.

Martin, C. H., C. A. Mayeda, et al. (1995). "Complete sequence of the bithorax complex of

Drosophila." Proc Natl Acad Sci U S A 92 (18): 8398-8402.

Mihaly, J., S. Barges, et al. (2006). "Dissecting the regulatory landscape of the Abd-B gene of

the bithorax complex." Development (Cambridge, England) 133 : 2983-2993.

Mohan, M., M. Bartkuhn, et al. (2007). "The Drosophila insulator proteins CTCF and CP190

link enhancer blocking to body patterning." Embo J 26 : 4203-4214.

126

Müller, J. and J. a. Kassis (2006). "Polycomb response elements and targeting of Polycomb

group proteins in Drosophila." Current opinion in genetics & development 16 : 476-484.

Muller, M., K. Hagstrom, et al. (1999). "The mcp element from the Drosophila melanogaster

bithorax complex mediates long-distance regulatory interactions." Genetics 153 : 1333-

1356.

Mullerl, J. and M. Bienz (1992). "Sharp anterior boundary of homeotic conferred by the fushi

tarazu protein expression." 1: 3653 - 3661.

Muravyova, E., a. Golovnin, et al. (2001). "Loss of insulator activity by paired Su(Hw)

chromatin insulators." Science (New York, N.Y.) 291 : 495-498.

Orlando, V. and R. Paro (1993). "Mapping Polycomb-repressed domains in the bithorax complex

using in vivo formaldehyde cross-linked chromatin." Cell 75 (6): 1187-1198.

Patton, J. S., X. V. Gomes, et al. (1992). "Position-independent germline transformation in

Drosophila using a cuticle pigmentation gene as a selectable marker." Nucleic Acids Res

20 (21): 5859-5860.

Peifer, M., F. Karch, et al. (1987). "The Bithorax Complex - Control of Segmental Identity."

Genes & Development 1(9): 891-898.

Peng, J., S. Chen, et al. (2005). "Gradual Release of Sperm Bound Sex-Peptide Controls Female

Postmating Behavior in Drosophila." 15 : 207-213.

Qian, S., M. Capovilla, et al. (1991). "The bx region enhancer, a distant cis-control element of

the Drosophila Ubx gene and its regulation by hunchback and other segmentation genes."

The EMBO journal 10 : 1415-1425.

127

Ravi Ram, K., S. Ji, et al. (2005). "Fates and targets of male accessory gland proteins in mated

female Drosophila melanogaster." Insect biochemistry and molecular biology 35 : 1059-

1071.

Ravi Ram, K. and M. F. Wolfner (2007). "Seminal influences: Drosophila Acps and the

molecular interplay between males and females during reproduction." Integrative and

comparative biology 47 : 427-445.

Ryder, E. and S. Russell (2003). "Transposable elements as tools for genomics and genetics in

Drosophila." Brief Funct Genomic Proteomic 2(1): 57-71.

Shimell, M. J., A. J. Peterson, et al. (2000). "Functional analysis of repressor binding sites in the

iab-2 regulatory region of the abdominal-A homeotic gene." Dev. Biol. 218 : 38-52.

Simon, J., A. Chiang, et al. (1992). "Ten different Polycomb group genes are required for spatial

control of the abdA and AbdB homeotic products." Development 114 (2): 493-505.

Simon, J., M. Peifer, et al. (1990). "Regulatory elements of the bithorax complex that control

expression along the anterior-posterior axis." Embo J 9(12): 3945-3956 Issn: 0261-4189.

Singh, P. B. and D. Brown (1997). "Modelling the activity of the Ultrabithorax parasegment-

specific regulatory domains around their anterior boundaries." J Theor Biol 186 (4): 397-

413.

Sipos, L., J. Mihály, et al. (1998). "Transvection in the Drosophila Abd-B domain: extensive

upstream sequences are involved in anchoring distant cis-regulatory regions to the

promoter." Genetics 149 : 1031-1050.

Smith, D., J. Wohlgemuth, et al. (1993). "hobo enhancer trapping mutagenesis in Drosophila

reveals an insertion specificity different from P elements." Genetics 135 (4): 1063-1076.

128

Spilianakis, C. G. and R. A. Flavell (2004). "Long-range intrachromosomal interactions in the T

helper type 2 cytokine locus." Nat Immunol 5(10): 1017-1027.

Spilianakis, C. G., M. D. Lalioti, et al. (2005). "Interchromosomal associations between

alternatively expressed loci." Nature 435 (7042): 637-645.

Styger, D. (1992). Molekulare analyse des Drosophila melanogaster sex-peptid Gens. Ph.D,

University of Zürich.

Sullivan, W., M. Ashburner, et al. (2000). Drosophila protocols. Cold Spring Harbor, N.Y., Cold

Spring Harbor Laboratory Press.

Thomson, A. A. and P. C. Marker (2006). "Branching morphogenesis in the prostate gland and

seminal vesicles." Differentiation 74 (7): 382-392.

Thorpe, H. M., S. E. Wilson, et al. (2000). "Control of directionality in the site-specific

recombination system of the Streptomyces phage phiC31." Mol Microbiol 38 (2): 232-

241. van der Hoeven, F., P. Sordino, et al. (1996). "Teleost HoxD and HoxA genes: comparison with

tetrapods and functional evolution of the HOXD complex." Mech Dev 54 (1): 9-21.

Vazquez, J., M. Muller, et al. (2006). "The Mcp element mediates stable long-range

chromosome-chromosome interactions in Drosophila." Molecular biology of the cell 17 :

2158.

Venken, K. J. T., Y. He, et al. (2006). "P[acman]: a BAC transgenic platform for targeted

insertion of large DNA fragments in D. melanogaster." Science (New York, N.Y.) 314 :

1747-1751.

Warming, S., N. Costantino, et al. (2005). "Simple and highly efficient BAC recombineering

using galK selection." Nucleic Acids Res 33 (4): e36.

129

Warot, X., C. Fromental-Ramain, et al. (1997). "Gene dosage-dependent effects of the Hoxa-13

and Hoxd-13 mutations on morphogenesis of the terminal parts of the digestive and

urogenital tracts." Development 124 (23): 4781-4791.

Whiteley, M. and J. A. Kassis (1997). "Rescue of Drosophila engrailed mutants with a highly

divergent mosquito engrailed cDNA using a homing, enhancer-trapping transposon."

Development 124 (8): 1531-1541.

Wolfner, M. F. (2009). "Battle and ballet: molecular interactions between the sexes in

Drosophila." The Journal of heredity 100 : 399-410.

Xue, L. and M. Noll (2002). "Dual role of the Pax gene paired in accessory gland development

of Drosophila." Development (Cambridge, England) 129 : 339-346.

Zavortink, M. and S. Sakonju (1989). "The morphogenetic and regulatory functions of the

Drosophila Abdominal-B gene are encoded in overlapping RNAs transcribed from

separate promoters." Genes & Development 3: 1969-1981.

Zhou, J., H. Ashe, et al. (1999). "Characterization of the transvection mediating region of the

Abdominal-B locus." in Drosophila. Development 126 : 3057-3065.

Zhou, J., S. Barolo, et al. (1996). "The Fab-7 element of the bithorax complex attenuates

enhancer-promoter interactions in the Drosophila embryo." Genes Dev 10 : 3195-3201.

Zink, B., Y. Engstrom, et al. (1991). "Direct interaction of the Polycomb protein with

Antennapedia regulatory sequences in polytene chromosomes of Drosophila

melanogaster." EMBO J 10 (1): 153-162.

Zink, B. and R. Paro (1989). "In vivo binding pattern of a trans-regulator of homoeotic genes in

Drosophila melanogaster." Nature 337 (6206): 468-471.

130