City University of New York (CUNY) CUNY Academic Works
All Dissertations, Theses, and Capstone Projects Dissertations, Theses, and Capstone Projects
5-2018
Non-canonical Activation of CREB/crh-1 Mediates Neuroprotection in a Caenorhabditis elegans Model of Excitotoxic Necrosis
K. Genevieve Feldmann The Graduate Center, City University of New York
How does access to this work benefit ou?y Let us know!
More information about this work at: https://academicworks.cuny.edu/gc_etds/2590 Discover additional works at: https://academicworks.cuny.edu
This work is made publicly available by the City University of New York (CUNY). Contact: [email protected]
NON-CANONICAL ACTIVATION OF CREB/CRH-1 MEDIATES NEUROPROTECTION IN A CAENORHABDITIS ELEGANS MODEL OF EXCITOTOXIC NECROSIS
by
KATHERINE GENEVIEVE FELDMANN
A dissertation submitted to the graduate faculty in Biology (Neuroscience) in partial fulfillment
of the requirements for the degree of Doctor of Philosophy, The City University of New York
2018
© 2018
KATHERINE GENEVIEVE FELDMANN
All Rights Reserved
ii Non-canonical Activation of CREB/crh-1 Mediates Neuroprotection in a Caenorhabditis elegans Model of Excitotoxic Necrosis
by
Katherine Genevieve Feldmann
This manuscript has been read and accepted for the Graduate Faculty in Biology in satisfaction of the dissertation requirement for the degree of Doctor of Philosophy.
______Date Chair of Examining Committee Dr. Itzhak Mano, CUNY Medical School
______Date Executive Officer Dr. Cathy Savage-Dunn
Supervisory Committee ______Dr. Jonathan Levitt, City College
______Dr. Andreas Kottmann, CUNY Medical School
______Dr. Monica Driscoll, Rutgers University
______Dr. Shai Shaham, Rockefeller University
______Dr. Christine Li, City College
THE CITY UNIVERSITY OF NEW YORK
iii ABSTRACT
Non-canonical Activation of CREB/crh-1 Mediates Neuroprotection in a Caenorhabditis elegans model of excitotoxic necrosis
by
Katherine Genevieve Feldmann
Advisor: Itzhak Mano
Excitotoxicity, which is a major cause of neurodegeneration in brain ischemia, can also activate neuroprotective pathways. A frequently suggested neuroprotective cascade involves the activation of the transcription factor CREB by its phosphorylation, but on its own this mode of
CREB activation is promiscuous. We aim to elucidate the specific mechanism of CREB activation in excitotoxicity-induced neuroprotection, focusing on three suggested models: CREB phosphorylation by calcium-activated kinases in the cytoplasm or nucleus, and the activation of
CREB by CRTC (an important cofactor). Using a C. elegans model of excitotoxicity, we demonstrate that CREB’s neuroprotective effect is mainly seen in neurons exposed to a moderate insult. Surprisingly, we find that CREB’s effect does not depend on the classic phosphorylation- activator CaMKK or the phosphorylation-dependent cofactor CBP. Instead, we find that the neuroprotective function of CREB in excitotoxicity depends on its cofactor CRTC/crtc-1 and its upstream regulators. Discovering the exact mechanism of CREB activation that is important for excitotoxic neuroprotection and examining CREB-mediated regulation of conserved neuroprotective genes may allow us to find candidate targets for future therapeutic interventions in brain ischemia.
iv Acknowledgements
First off, I would like to thank my mentor Dr. Itzhak Mano for his willingness to accept me as a student and give me a second chance in graduate school. He has always impressed upon us that we are and always will be a part of his lab family. It took a year or two to realize how sincerely he meant this. Over the years, he has supported me and trained me to become an independent scientist, from the beginning to the end. Most importantly, I take away two lessons or mottos: 1) never forget the big picture, in that we are doing research that translates to helping others, and 2) always give others second chances. Finally, his dedication and support is above and beyond what I could have imagined a mentor would provide. I am also very grateful for the other Mano lab members past and present, especially Ayesha Chowdhury who has graciously put up with me over the years. Also, I thank the many undergraduates who helped make my project possible on a daily basis.
I would further like to thank Dr. Chris Li for being a wonderful lab neighbor, and for her continued support in research and the various conversations we have had throughout the years.
The Li lab members have also helped me so much with experiments and have helped keep me
‘sane’ day-to-day (looking at you Adanna and Ji-Sup). I give a special thank you to my committee members, Dr. Jonathan Levitt, Dr. Andreas Kottmann, Dr. Monica Driscoll and Dr.
Shai Shaham, for their wonderful advice, feedback, and encouragement throughout the years.
Your advisement has been invaluable throughout this process.
Most importantly, I would not be here today without my amazing family. There are not even words to express my gratitude. To my wonderful friends, especially the members of CCNY
Science Alliance and the Queens Crew, I am forever indebted to you. All y’all have basically become my second family with whom I share many wonderful memories.
v Table of Contents
Copyright Statement ii
Unsigned Approval Page iii
Abstract iv
Acknowledgements v
Table of contents vi
List of Figures x
Chapter 1: General Introduction
1.1 Stroke is a major cause of death and disability in the United States 2
1.2 Glutamate is a major excitatory neurotransmitter in the nervous system 5
1.3 Glutamate is removed from the synapse by Glutamate Transporters 7
1.4 Energy is necessary for normal Glutamate signaling 8
1.5 Excitotoxicity is caused by a malfunction of GluTs resulting in 9 hyperstimulation of GluRs, which ultimately leads to cell death
1.6a Necrosis is the main form of cell death experienced by cells in the core 10 of stroke patients
1.6b Apoptosis is form of programmed cell death, mostly found 10 in the penumbra region
1.6c Autophagy is a process that can serve as a pro-death or 11 pro-survival process
1.7 DAPK is Ca2+/CaM-dependent kinase and a conserved mediator of 12 neurodegeneration
1.8 CREB is a crucial transcription factor important in the nervous system 12 and well known for its role in synaptic plasticity
1.9 CREB plays a role in neuroprotection 14
vi 1.10 CREB is found in all tissues, playing a role in multiple processes 16
1.11 Ca2+/Calmodulin-dependent kinases CAMKs are intracellular calcium- 17 responsive molecules
1.12 AMPKs (5’ AMP-activated protein kinase) and SIKs (Salt-Inducible Kinases) 18 play a role in several processes including energy homeostasis and neuroprotection
1.13 CREB-/cAMP-regulated Transcriptional Coactivators (CRTC) enhance 19 CREB activity
1.14 FOXO Transcription Factors are important in longevity 20 and neuroprotection
1.15 Using C. elegans as a model organism offers several advantages to 21 studying biological processes
1.16 Glutamatergic Signaling, GluRs and GluTs alike, are conserved in C. elegans 22
1.17 CREB signaling is important in synaptic plasticity in C. elegans 23
1.18 C. elegans Model of Excitotoxic Necrosis mimics that of mammalian 23 excitotoxicity
1.19 References 25
1.20 Supplemental 32
Chapter 2: Non-canonical Mechanism of CREB Activation in Nematode Excitotoxicity
2.1 Abstract 34
2.2 Introduction 35
2.2.1 Neurons are differentially susceptible to damage in response 35 to various insults
2.2.2 Structure and function of NMDARs and AMPARs determine 36 their role in excitotoxicity: Crucial differences between Mammals and C. elegans
2.2.3 Deciphering between canonical and non-canonical mechanisms of CREB 37 activation
2.3 Results 39
vii
2.3.1 CREB’s role in neuroprotection is conserved in nematodes 39
2.3.2 CREB protects neurons receiving milder Glutamate insults 40
2.3.3 CREB does not seem to protect neurons by decreasing GluR activity 43
2.3.4 Canonical Activators, CaMKK/ckk-1 and CBP/cbp-1 do not play 44 a significant role in nematode excitotoxic necrosis
2.3.5 Non-canonical activators, CaMKI/IV/AMPK/CRTC, mediate neuroprotection 46 in excitotoxicity
2.3.6 CRTC/crtc-1 works in the same pathway and downstream of AMPK 49
2.3.7 CRTC is expressed in glr-1 expressing neurons 51
2.3.8 Unphosphorylatable (S76A, S179A) active CRTC is sufficient to induce 52 neuroprotection
2.3.9 CREB phosphorylation is not important in excitotoxicity-induced 53 neuroprotection in C. elegans
2.4 Conclusions and Discussion 55
2.5 Materials and Methods 61
2.6 Acknowledgements 66
2.7 References 66
2.8 Supplemental 71
Chapter 3: Examining the collaboration of CREB with transcription factor FOXO/daf-16 and downstream targets of CREB/crh-1 in Neuroprotection
3.1 Abstract 73
3.2 Introduction 74
3.2.1 An examination of previously reported downstream genes regulated 75 by both CREB and DAF-16 shows common targets
3.2.2 Priority of genes to examine in our study of neuroprotective genes using 76 qRT-PCR
viii 3.3 Results 79
3.3.1 CREB and DAF-16 corroborate to confer neuroprotection in nematode 79 excitotoxicity
3.3.2 dct-5 seems to be upregulated in excitotoxic conditions in the absence of CREB 82
3.4 Conclusions and Discussion 84
3.5 Materials and Methods 86
3.6 Acknowledgements 88
3.7 References 88
3.8 Supplemental 91
Chapter 4: Death Associated Protein Kinase (DAPK)-mediated neurodegenerative mechanism in nematode excitotoxicity
4.1 Abstract 93
4.2 Introduction 94
4.3 Results 94
4.3.1 Pharmacological inhibition of autophagy, using 3-MA, has a significant 96 but small effect in excitotoxicity
4.3.2 PINN-1 works upstream or in parallel with DAPK in nematode excitotoxicity 98
4.4 Conclusions and Discussions 97
4.5 Materials and Methods 99
4.6 Acknowledgements 102
4.7 References 102
Chapter 5: Conclusions, Discussions, and Future Experiments
5.1 Conclusion 104
5.2 Future Experiments 106
5.3 References 107
ix List of Figures
Figures
1. Schematic of Stroke Damage: Core & Penumbra…………………………………………………………...3
2. Glutamatergic signaling in normal and excitotoxic conditions………………………………………9
3. CREB domains with phosphorylation sites, CREB binds as a dimer……………………………...13
4. Phosphorylation states determine CRTC location and activity…………………………………….20
5. Models of CREB activation: Canonical vs. Non-canonical…………………………………………….39
6. CREB is crucial for neuroprotection…………………………………………………………………………...40
7. CREB preferentially protects interneurons……………………………………………………………41-42
8. Spontaneous mobility and Nose Touch (NOT) assays in CREB and CRTC mutants………..43
9. Canonical activator CaMKK/ckk-1 does not play a role in nematode excitotoxicity…..…..43
10. CBP/cbp-1 does not play a role in nematode excitotoxicity……………………………………….46
11. CaMKI/IV/ cmk-1 plays a roles in excitotoxicity……………………………………………………….47
12. Loss of SIK2/AMPK decreases neurodegeneration...... …………………………………...48
13. CRTC plays a crucial role in neuroprotection……………………………………………………………49
14. Epistatic analysis of CRTC and SIK2/AMPK in excitotoxicity……………………………………..50
15. Wildtype CRTC is expressed in glr-1-expressing neurons………………………………………….51
16. Unphosphorylatable CRTC is sufficient to provide neuroprotection…………………………..53
17. CREB phosphorylation is not necessary to confer neuroprotection…………………………...54
18. Schematic of collaboration of CREB and FOXO/DAF-16…………………………………………….74
19. Inhibition of PI3K/age-1 confers additional neuroprotection in absence of CREB………80
20. CREB and DAF-16 work in separate but parallel pathways for neuroprotection…………81
x 21. Gene expression studies in excitotoxicity………………………………………………………………….82
22. Epistatic analysis of DAPK and autophagy (using 3-MA)……………………………………………97
23. Epistatic analysis of DAPK and PIN1 in excitotoxicity………………………………………………..99
Tables
1. Comparison of fold changes between experimental to Wildtype N2…………………………….83
Supplemental Figures and Tables
Figure S1. Alignment of canonical human CREB and C. elegans CRH-1……………………………..32
Figure S2. Degeneration frequency of individual neurons in nuIs5……………………………..…...71
Table S1. Counting Glutamatergic inputs to glr-1 expressing neurons…………………………..…72
Table S2. Common downstream targets of CRH-1 & DAF-16………………………………..……….…89
xi
Chapter 1
Introduction and background
1.1 Stroke is a major cause of death and disability in the United States
Stroke is the fifth leading cause of death and the leading cause of long-term neuronal damage (Murphy et al. 2015) affecting 795,000 people in the US each year (Mozafarrian et al.
2015). Most strokes are in the form of brain ischemia, which is caused by a temporary lack of blood flow to regions of the brain (due to a thrombus or embolus), and cause acute damage. The occurrence of stroke is higher in the African American population (Towfighi and Saver, 2011) and other minority populations (Morgenstern et al., 2004). In addition to race and ethnicity, several other factors contribute to the large medical disparity, such as socioeconomic status and even geographic location within the US (Kulshrestha et al. 2013). The only effective current treatment being used in the clinic (which is based on thrombolysis) is beneficial only if the patients receive the treatment within two hours of stroke onset.
However, several factors, including the detrimental lack of insurance, will sway the patients’ decision to even go to the hospital. Any delay in intervention leads to more significant brain damage and long-term disability. Assuming the patient experiences long-term disability, there will be significant need for long-term care, which is also very costly, but most importantly, the patient will experience decreased quality of life on a daily basis. Therefore, effective treatment is a large unmet need and there is an urgent necessity to find effective therapeutic treatments that can be administered in a larger time window (hours, days). Mitigating the neuronal damage also improves the patients’ well-being and quality of life.
In ischemic stroke, blood flow is blocked to regions of the brain, usually due to a buildup of plaque causing an arterial block or due to the travel of an embolus or blood clot from another part of the body (e.g., the heart) that gets lodged in a brain artery. The lack of blood flow causes a deprivation of oxygen and glucose to these regions, thus causing an energy deficit; lack of
2 energy, in the form of ATP, significantly hinders normal cellular processing. The special sensitivity of the brain to such an energy deficit is due to an inability to power “clean-up” systems in the brain, and a buildup of the neurotransmitter glutamate (Glu) in the synapse (Rossi et al. 2000), which when in excess causes cell death and brain damage (see further mechanistic details below). The damage is seen very quickly at the center of the site of the insult, called the core, while in the surrounding area, called the penumbra, the damage develops more gradually. The cells exposed to the highest insult of Glu (and resulting toxic ion Figure 1 Neurons at the core of the stroke undergo necrosis, while neurons in the penumbra influx) die by a process called necrosis, tend to undergo apoptotic cell death. (Figure 1 modified from Dirnagl et al. 1999) whereas the cells further away in the penumbra, can be viable for hours, but may eventually succumb to necrosis as well, undergo apoptotic cell death, or recover (Dirnagl et al. 2009; Figure 1). Because these neurons may receive partial blood flow from surrounding collateral arteries, these cells can also be ‘injured’,
‘unresponsive’, or ‘stunned’, but remain viable for hours. However, these cells might eventually recover, and are therefore potentially salvageable (Moskowitz et al. 2010). It therefore becomes critical to find ways to stop the progression of further damage.
Currently, the time it takes for patients to be diagnosed and be ready for intervention to mitigate neuronal damage and activate these survival mechanisms is within a few hours of stroke onset. One suggested strategy to halt any further damage in stroke patients (past hospital admission) is to stop the neurodegenerative process, which is known to be mediated mostly by
Glu overstimulating Glu Receptors (GluRs). Several researchers hypothesized that blocking
3 GluR activity would mitigate the damage seen in stroke. A large number of clinical trials administered these GluR antagonists. However, instead of enhanced survival, these drugs were either ineffective, or even hastened death (Davis et al. 2000). If Glu antagonists cause more cell death, it means that at that point in time, after stroke, the action of Glu had a beneficial role.
Therefore, it seems that glutamate can activate both early cell death and late cell survival pathways. This outcome drives us (and many other researchers) to ask what signaling events take place downstream of GluR activation, as this remains largely unknown.
Based on the failures of these trials and a large body of additional evidence, recent research suggests that GluR activation can also activate later events in the form of cell survival pathways, a major one being a pathway whose signaling activates a ubiquitous transcription factor, CREB (cAMP Response Element Binding Protein) (Meller et al. 2005; Gidday 2006;
Hardingham and Bading 2010; Kitagawa 2012) and other neuroprotective pathways. According to this view, a possible way to explain the ineffectiveness of GluR antagonists is that although blocking GluRs is an effective approach within two hours of stroke onset (as used in animal models), many patients seek treatment too late for the drug to be an effective blocker of GluR- mediated neurodestructive processes, yet administration at this time is also effective in preventing the action of GluR-mediated protective signaling (Lai et al. 2014). Taken together, initial observations underline the notion that we must continue the search for effective therapeutic options for brain ischemia. One of these options may be targeting the molecules that act or exert their effects hours or even days after stroke onset.
4 1.2 Glutamate is a major excitatory neurotransmitter in the nervous system
Glutamate is the major excitatory neurotransmitter in the CNS and is used as a signal for many cellular processes (Watkins 2000). Indeed, about 90% of synapses and neurons in the
CNS use Glu as their neurotransmitter (Siegel 2006 textbook). The resting concentration of Glu in the synapse is kept below the detection level of GluRs, at about 25 nM. However, as Glu is a key amino acid in cell metabolism, Glu has an intracellular concentration of 10 mM, making Glu uptake into cells very challenging (Tzingounis and Wadiche, 2007). And yet, robust Glu clearance is essential, because aberrant Glu signaling can lead to extensive damage and a wide range of neurodegenerative diseases (Lewerenz and Maher, 2015). Thus glutamate levels must be closely regulated. Glu serves as a ligand and binds its receptors to exert its effects. There are two major types of Glutamate receptors: ionotropic and metabotropic glutamate receptors
(mGluRs). mGluRs are G-protein coupled receptors; when Glu binds mGluRs it causes a conformational change in the receptor, which in turn activates a G-protein, which uses its α- subunit to activate or inhibit second-messenger producing enzymes such as phospholipase c or adenylyl cyclase (Niswender and Conn, 2010). Adenylyl cyclase converts adenosine triphosphate (ATP) to cyclic adenosine monophosphate (cAMP) which then activates Protein
Kinase A (PKA). PKA can then phosphorylate and activate several downstream targets to significantly propagate the signal.
By contrast, ionotropic receptors are ligand-gated ion channels and are named according to the Glu-derivative for which they have the highest affinity: AMPA (α-amino-3-hydroxy-5- methyl-4-isoxazolepropionic acid), NMDA (N-methyl-D-aspartate), and Kainate (Traynelis et al.
2010). For the purpose of this dissertation, I will be focusing on the calcium-permeable, AMPA
Receptors but will also discuss NMDA Receptors. Both AMPARs and NMDARs are tetramers
5 (Mano and Teichberg, 1998; Laube et al. 1998), with each subunit containing a binding site for an amino acid. The subunit composition can change the receptor properties. Specifically,
NMDARs require two obligatory NR1 subunits (containing Glycine binding sites) and two NR2 subunits (of the subtypes A-D with Glu binding sites; some NR3 subunits also exist, but their function is not completely clear).
AMPARs serve as more simple ligand gated ion channels (Traynelis et al. 2010).
AMPARs consist of four types of subunits, GluA1-A4 (or GluR 1-4) (Siegel 2006, textbook).
Glu binds AMPARs and allows mostly monovalent cations such as Na+ to flow through the pore.
AMPAR complexes that do not contain the A2 subunits also allow Ca2+ permeability, but the second membranal segment of GluA2 contains an Arg residue (which is encoded only following mRNA editing) that exerts a dominant effect and prevents Ca2+ permeability. Thus, subunit composition and mRNA editing determine if the AMPAR complex is calcium-permeable or not.
Signaling through AMPARs causes rapid depolarization and thus serve to conduct fast excitatory potentials.
In the presynaptic cell, Glu is packaged into vesicles via vesicular glutamate transporter
(vGluT), which is an H+-coupled transporter that loads vesicles for Glu release. Presynaptic excitation allows Ca2+ to enter the presynaptic terminal, causing Glu-filled vesicles to fuse at the presynaptic terminal. Glu is released from the presynaptic cell, into the synapse, and binds
GluRs. GluRs of the AMPAR subtype are simple Glu-gated channels, and most AMPARs are permeable only to monovalent cations such as Na+: When Glu binds AMPARs it causes a conformational change, specifically in the M2 segment of each subunit, which allows the receptor to permit Na+ influx into the postsynaptic cell. This Na+ influx causes depolarization of the postsynaptic cell, which can propagate the action potential; NMDARs are more complex,
6 because they are also permeable to the larger ion Ca2+ and because they depend on both Glu gating and cellular depolarization in order to propagate an action potential: If the postsynaptic cell is sufficiently depolarized, it will cause NMDARs to open and allow Ca2+ influx. NMDARs rely on AMPAR depolarization because the NMDAR channel pore can be blocked by Mg2+ ions; sufficient depolarization by the AMPAR-mediated Na+ influx causes the Mg2+ in the NMDARs to be ejected from the channel’s pore, therefore allowing the influx of calcium (Furukawa et al.
2005). This influx of Ca2+ activates several downstream signaling cascades, and can further cause not only the propagation of an action potential, but also longer-term changes in neuronal activity.
When Calcium enters the cell, it acts as a second messenger, activating several signaling cascades. Many of these cascades involve a calcium-binding small protein called calmodulin; the binding of Ca2+ changes calmodulin’s conformation allow it to bind and activate its many enzyme targets and confer on them regulation by Ca2+ concentration. Of particular importance are the members of the family of Ca2+/CaM-dependent protein kinases, especially CaMKK and
CaMKI/IV, which can participate in a cascade of kinases activated by other kinases. This kinase cascade can go on to activate several other targets depending on the cellular context.
1.3 Glutamate is removed from the synapse by Glutamate Transporters
After Glu binds its synaptic receptors, it dissociates and is simultaneously taken up by
Glutamate transporters (GluTs) on the surrounding cells. This process must be tightly regulated to ensure that consecutive synaptic pulses are sharply separated so as to prevent Glu from accumulating and causing damage. In humans, these transporters are called Excitatory Amino
Acid Transporters (EAATs) and they are categorized into five types (EAAT1-5): some are
7 located on the astrocytes (EAAT 1,2), some on postsynaptic cells (EAAT 3,4) and some are found in the retina (EAAT5) (Danbolt 2001; Divito and Underhill 2014). EAATs consist of eight transmembrane (TM) domains, with two hairpins that coordinate with TM7 & TM8 to comprise the catalytic core. Because the synaptic Glu concentration is 25nM and intracellular
Glu concentration is ~10 mM (including astrocytes), the transporters need to extract Glu out of the synapse and into the cell against a sharp concentration gradient. To do that, GluTs function as secondary active transporters, powered by the Na+/K+ gradients across the cell membrane.
This clearance is crucial for normal cellular and synaptic transmission (Figure 2, left). GluT malfunction can lead to significant pathological conditions, and GluTs have therefore also been studied as potential therapeutic targets (Hu et al. 2017).
1.4 Energy is necessary for normal Glutamate signaling
The proper function of these transporters is indirectly energy dependent, energy which comes from oxygen and glucose supplied by the blood circulation. The supply of oxygen and glucose allows the cell to produce ATP that powers a Na+/K+ ATPase, a cell-membrane transport system that pumps 2 K+ ions into the glia/neuron and 3 Na+ out, creating a concentration gradient of Na+ and K+. This creates a high Na+ concentration outside the cell and thus a powerful driving force that can, with adequate coupling, push other molecules against their concentration gradients. GluTs use this driving force to transport Glu: they bind and transport 3 Na+ down their concentration gradient into glia together with 1 Glu molecule, which moves against its concentration gradient. The internalized Glu that is taken up by the GluTs can then be recycled by being converted to Glutamine, sent back to the neuron and used again as glutamate. Glial cells contain the enzyme Glutamine Synthetase, which converts Glutamate to Glutamine (Gln).
8 Gln can then be transported out of the glia and taken up by the presynaptic cell to be converted back to glutamate (by the enzyme glutaminase) and thus be recycled.
1.5 Excitotoxicity is caused by malfunction of GluTs resulting in hyperstimulation of
GluRs, which ultimately leads to cell death
In contrast to normal conditions, in ischemia, there is a lack of blood flow and therefore lack of energy to the affected regions of the brain. Lack of energy in the brain region diminishes the necessary concentration gradient produced by the Na+/K+ ATPase, which leads to a significant malfunction of the GluTs; since GluTs depend on 3 ions of Na+ for every cycle of Glu transport, even a small drop in the Na+ driving force will dramatically affect Glu transport. This causes Glu transporter to be extremely sensitive to energy levels, and Glu can even be released from the glia into the synapse, causing a significant buildup of Glu in the synapse. The buildup of Glu causes hyperstimulation of the GluRs leading to excess ion flow (Na+ and Ca2+) into the postsynaptic cell. Excessive Ca2+ influx into the cell causes neurodegeneration; this condition is termed excitotoxicity (Figure 2, right). This can lead to cell death of different types ranging from necrosis to apoptosis, depending on the scenario.
Figure 2 Schematic of Glutamatergic signaling in normal and excitotoxic conditions. In excitotoxicity, GluTs malfunction, leading to a buildup of Glu in the synapse.
9 1.6a Necrosis is the main form of cell death experienced by cells in the core of stroke patients
As mentioned above, the cells at the core of the insult undergo rapid and very destructive cell death called necrosis. Recent evidence suggests that although necrosis is not planned or programmed in advance, it does not mean that it is left unregulated (Vanden Berge et al. 2014).
Necrosis is caused by a toxic influx of ions, especially Na+ and Ca2+ into the cell. As ions enter the cell, water follows to balance the hypertonic solution. This leads to cell bursting or lysis of the cell. This cell lysis leads to release of cellular contents, and importantly cytoplasmic glutamate (which is naturally made in the cell as a metabolite in energy metabolism and protein building), intracellular calcium ions, and pro-inflammatory factors. The release of Glu and Ca2+ will go on to create a propagating wave of destruction to the surrounding neurons, causing extensive neuronal damage, especially in the neighboring cells.
1.6b Apoptosis is form of programmed cell death, mostly found in the penumbra region
In contrast to necrosis at the core of the stroke area, the cells in the surrounding area, called the penumbra, gradually transitions to showing other forms of cell injury, and some might undergo a form of cell death called apoptosis. These cells may receive partial blood supply and therefore receive a milder insult, affording them the time to adapt and choose less damaging forms of cell death. Apoptosis is a form of programmed cell death and crucial for normal organismal development, aging processes and tissue maintenance (Horvitz 1999; rev Elmore
2007). Apoptosis is a fairly organized process that is characterized by morphological changes in the cell, DNA fragmentation and involvement of cysteine proteases called caspases. There is an extrinsic pathway that involves the activation of receptors of the tumor necrosis factor (TNF) or the Fas receptors. The ligand binding to these receptors causes recruitment of adaptor proteins that contain a conserved protein-protein interaction motif called the death domain (TRADD or
10 FADD & RIP, respectively). These proteins will then associate with procaspase-8, resulting in the formation of death-inducing signaling complex (DISC) and activation of the so-called executioner caspases (3, 6, and 7).
Intrinsic pathway activation is usually triggered by a lack of growth factors, hormones, or cytokines and results in a disruption of the mitochondrial transmembrane potential by causing the opening of the mitochondrial transition pore (MPT) (Elmore 2007). The opening of this pore causes release of pro-apoptotic signals from the mitochondrial intermembrane space, such as cytochrome c. The release of cytochrome c can then go on to activate APAF1, caspase-9 and ultimately caspase-3. Though the exact mechanism to control release of cytochrome c is unknown, it is thought that the Bcl-2 family of proteins modulates mitochondrial outer membrane permeability and thus regulates the release of cytochrome c. Release of these mitochondrial residents can lead to activation of procaspases; the activation of the executioner caspases lead to DNA fragmentation, and changes in membrane morphology.
1.6c Autophagy is a process that can serve as a pro-death or pro-survival process
Autophagy is considered a form of cell death but can also play a role in cell survival and used to maintain cellular homeostasis (Ravikumar et al. 2010; Chen and Klionsky, 2011).
Autophagy is the process by which cells can degrade and recycle protein aggregates and remove damaged organelles by engulfing them by autophagosomes. These autophagosomes then fuse with lysosomes and the contents are then degraded by lysosomal enzymes. Although autophagy occurs under basal conditions, it is essential to clear the cell of damaged organelles or other potentially destructive cellular components which, if disrupted, can lead to metabolic and neurodegenerative diseases. Recently autophagy inhibitors have been employed for their potential role as therapeutic targets in some cancers (Mizushima et al. 2008; Menzies et al.
11 2017). In addition to autophagy, there are several other mediators of neurodegeneration that play a role downstream of GluR stimulation and Ca2+ influx.
1.7 DAPK is a Ca2+/CaM-dependent kinase and a conserved mediator of neurodegeneration
One of these pro-death mediators is DAP Kinase. DAPKs (Death-Associated Protein
Kinases) are a family of Serine/Threonine kinases that are triggered by the Ca2+/CaM complex.
DAPKs contain a Death Domain (DD) that serves to interact with DDs of other proteins to exert its effects. DAPK was originally found to mediate interferon, IFN-γ mediated apoptotic cell death (Feinstein et al. 1995). Furthermore, DAPKα was found to promote TNF-induced apoptosis while DAPKβ negatively regulates this process (Jin et al. 2001). In addition to its function in neurodegeneration, DAPK also functions in tumor suppression, immune response, oncogenesis and cell death (autophagy, apoptosis) (Bialik and Kimchi, 2014). However, as mentioned, blocking the GluRs did not mitigate neuronal damage; although it should have inhibited the cell death pathways, it also blocked the cell survival pathways. One of these cell survival pathways involves the activation of transcription factor CREB (Turski and Ikonimidou,
2002).
1.8 CREB is a crucial transcription factor important in the nervous system and well known for its role in synaptic plasticity
CREB (Ca2+/cAMP Response Element Binding Protein), is a Ca2+/cAMP activated, bZip domain-containing transcription factor, that binds to cAMP Response Elements (CRE), which are TGACGTCA DNA sequences (Montminy et al. 1986, 1987). CREB is a transcription factor
12 that consists of several domains including Q1, Q2, Kinase-inducible domain (KID, part of the
Transactivation Domain, also includes Ser133 residue) and a crucial leucine zipper (bZip) domain that allows for DNA binding and dimerization, as CREB binds as a dimer (Dwarki et al.
1990) (Figure 3).
Figure 3 Schematic of CREB domains and labeled phosphorylation sites. CREB binds as a dimer and forms a Leucine zipper (left, from Altarejos and Montminy 2011; right, https://lookfordiagnosis.com)
Several early studies established the activation of CREB by phosphorylation at S133
(Gonzalez and Montminy, 1989). It was initially shown to be a target of Protein Kinase A (PKA)
(Lamph et al. 1990) although later studies showed CREB to be targeted by a family of CaMKs
(Ca2+/Calmodulin Dependent Kinases). Both of these kinases (and several others) can activate and phosphorylate CREB at Ser133 (P-CREB). Serine 133 is CREB’s most studied phosphorylation site (though CREB does have several other phosphorylation sites, such as
Ser142 which is shown to be an inhibitory phosphorylation (Parker et al. 1998)). P-CREB recruits its cofactor CREB Binding Protein (CBP) (Chrivia et al. 1993). CBP is a histone acetyltransferase whose function is to modify histones and ‘relax’ DNA packaging, allowing for transcription to occur. In addition to opening up DNA packaging, CBP can also recruit the basal components of the transcriptional machinery, such as Transcription Factor IIB & IID (Xing et al.
1995).
13 The most studied role of CREB is its function in synaptic plasticity, long-term potentiation (LTP)/learning, and memory (Dash et al. 1990; Sheng et al. 1990, 1991; Kaang et al. 1993; Kandel 2001; Hardingham et al. 2001). The first example of LTP was demonstrated in
1973, whereby tetanic stimulation in the CA3 region of the hippocampus led to increased and sustained response in the postsynaptic CA1 neuron (Bliss and Lomo 1973). This increased response is the molecular basis for synaptic strengthening. Later, Kaang et al. (1993) performed extensive studies on synaptic activity in Aplysia and found that repetitive stimulation of the gill resulted in long-term facilitation (LTF, synaptic strengthening) between the sensory and motor neurons, causing long-term changes in the synapse. Importantly, this study showed that CREB- mediated gene transcription and protein synthesis were required for LTF. Later, CREB was further found to play a role in mammalian LTP and other forms of synaptic plasticity (Dash et al,
1990; Bourtchuladze et al. 1994; Kandel 2001; Cohen and Greenberg, 2008). Synaptic plasticity in the form of LTP is believed to furnish the molecular basis for learning and memory, but plasticity can also seen in the form of cellular tolerance and cell survival.
1.9 CREB plays a role in neuroprotection
For a cell to survive an insult, it must activate cell survival pathways. A good example is ischemic preconditioning. Ischemic preconditioning occurs when a patient experiences a sublethal transient ischemic attack (TIA); this TIA activates endogenous neuroprotective mechanisms in response to this insult. If this same patient later experiences a full blown ischemic attack, their neurons are much more likely to recover (Wegener et al. 2004). After inducing ischemia via Middle Cerebral Artery Occlusion (MCAO) or Oxygen & Glucose Deprivation
(OGD), Meller et al. (2005) saw upregulation of anti-apoptotic gene Bcl-2 (Meller et al. 2005).
14 Upon further examination, chromatin immunoprecipitation experiments showed increased binding of CREB to CREs on the promoter of Bcl2; introduction of CRE oligos, however, blocked CREB binding and thus blocked the protection. These experiments demonstrated a causal link between CREB and neuroprotection. Furthermore, CREB was also found to have a lead role in excitotoxicity-induced neuroprotection.
One way to study excitotoxicity is to induce hypoxia, which can, depending on severity, induce apoptotic or necrotic cell death. Using both moderate and severe hypoxic-ischemia models in the rat brain, Walton and colleagues (1999) showed that the severe condition induced necrosis, whereas the moderate hypoxia caused apoptosis. However, the severe condition resulted in enhanced P-CREB and levels of BDNF, thus suggesting that CREB may be the key to neuroprotection (Walton et al. 1999; Walton and Dragunow 2000). Further studies showed that in conditions of global ischemia, a NMDAR antagonist diminished CREB phosphorylation and ischemic toleration and that extracellular calcium was responsible for the increase in CREB phosphorylation (Mabuchi et al. 2001). This set of studies also demonstrated in vivo that Glu exposure induced CRE-mediated gene transcription, suggesting that CREB is indeed providing neuroprotection.
Based on the previous studies, one could infer that the absence or disruption of CREB would result in catastrophic consequences, such as increased cell death. Indeed, using a
Cre/loxP system in mice to disrupt CREB caused increased neurodegeneration in developing brain and in the hippocampus (Mantamadiotis et al. 2002) inducing phenotypes similar to those of Huntington disease. Based on these studies and others, it was suggested that the failure of
GluR antagonists to mitigate neuronal damage was due to blocking CREB activation (Turski and
Ikonomidou, 2002).
15 However, others suggested that there are different consequences to stimulating synaptic versus extrasynaptic NMDARs and that this dictates that CREB activation in hypoxia
(Hardingham et al. 2002). Because activating extrasynaptic NMDARs leads to CREB inhibition, these authors suggest that antagonizing this inhibition by blocking extrasynaptic NMDARs could prove an effective therapy. Furthermore, it is suggested the stimulating synaptic NMDAR CREB activation works through nuclear calcium signaling to activate neuroprotective properties
(Hardingham and Bading, 2010). CREB-regulated genes have been identified and examined in excitotoxic conditions, but with focus on anti-apoptotic conditions or activity-induced genes, leading to the identification of genes such as Atf3, Btg2, Bcl6 and Nr4a1 (Zhang et al. 2007;
Zhang et al. 2009). These studies provide several lines of evidence that demonstrate that CREB activation is crucial in neuroprotection. Exactly how CREB is exerting its (especially anti- necrotic) effects downstream remains largely unknown (Kitagawa 2007; Sakamoto et al. 2011).
Still, it is clear that understanding these downstream pathway(s) is the key to effective therapeutics to activate neuroprotection relies on later events, and downstream of the receptors
(Lai et al. 2014). It is therefore critical to elucidate how exactly CREB is activated specifically in excitotoxic necrosis.
1.10 CREB is found in all tissues, playing a role in multiple processes
Although much of its fame comes from its action in the CNS, CREB is a crucial molecule in several processes and is expressed in every tissue, making it fairly non-specific. CREB is considered a prototype of a phosphorylation-triggered transcription factor and has a critical role in many fields outside neuroscience. Mammalian studies have found that there are at least 300 stimuli that can activate CREB and in vivo 4000-6000 promoter binding sites have been
16 identified, which gives it potential to regulate several thousand downstream target genes (Impey et al. 2004; Zhang et al. 2005). As CREB can be activated in several ways, the context/stimulus dictates the mode of CREB activation, and furthermore, regulates gene expression accordingly
(Cha-Molstad et al. 2004). The presence of growth factors, stress, neurotransmitters, calcium influx and inflammation can all activate CREB, working through kinases such as PKA, Akt, and
CaMKs that phosphorylate CREB (Mayr and Montminy 2001; West et al. 2001; Lonze and
Ginty, 2002; Deisseroth et al. 2003).
The vast majority of studies have placed a determinative importance on the increase or decrease of CREB phosphorylation at Ser133, supporting that this modification may serve as the key switch of its activation (Mayr and Montminy 2001). However, CREB phosphorylation is not sufficient to predict gene activation (Zhang et al. 2005). More recently it has been found that other factors, such as cAMP-regulated transcriptional coactivators (CRTCs), can activate CREB, independently of its phosphorylation. The activity of CRTCs has thus introduced a new mechanism of CREB activation, found to be important in some scenarios. Importantly though, in excitotoxicity, the first step is GluR stimulation that results in the influx of Ca2+ and activates mechanisms that lead to CREB activation.
1.11 Ca2+/Calmodulin-dependent kinases CAMKs are intracellular calcium-responsive molecules
Ca2+/Calmodulin-dependent protein kinases are activated upon an increase in intracellular calcium. There are several members of the CaMK family (CaMKI, CaMKII, CaMKIV and
CaMKK) that carry out several functions in the cell, most abundantly studied in neuronal functions (Takemoto-Kimura et al. 2017; Wayman et al. 2008). The functions include activity-
17 dependent processes such as synaptic plasticity, gene regulation and cellular remodeling. The roles of the specific CaMKs largely rely on their cellular localization. CaMKK, CaMKI and
CaMKII reside in the cytoplasm. CaMKK functions to phosphorylate several substrates including AKT8 and CaMKIV. CaMKI resides in the cytoplasm and may play a role in neuronal morphogenesis. In excitotoxicity, CaMKI can phosphorylate other kinases, such AMPKs and
SIKs, to enhance neuroprotection (Sasaki et al. 2011). CaMKII has been shown to play a significant role in LTP and has been found highly expressed in dendritic spines (Lisman et al.
2002; Matsushima et al. 1987). CaMKIV is mainly localized in the nucleus (Soderling 1999) and has been found to phosphorylate CREB on Ser133 (Soderling 1999), playing a role neuronal plasticity. Other kinases can play a role in plasticity by indirectly activating CREB by working through other kinases.
1.12 AMPKs (5’ AMP-activated protein kinase) and SIKs (Salt-Inducible Kinases) play a role in several processes including energy homeostasis and neuroprotection
AMPKs are a family of kinases that play a role in energy sensing with the goal of maintaining cellular homeostasis (reviewed in Garcia and Shaw, 2017). AMPKs are comprised of three subunits, with the α-subunit containing the catalytic domain; AMPK is activated upon phosphorylation of Thr172 of the α-subunit. AMPK is expressed in several cell types and can phosphorylate its downstream targets to activate or inhibit them, depending on context. For example, AMPK can activate ULK1, thereby activating autophagy. On the other hand, in the liver, AMPK will phosphorylate and inhibit CREB-regulated transcriptional coactivator
(CRTC2), thereby inhibiting gluconeogenesis. There are several related proteins that share
18 similarity to AMPK (Bright et al. 2009) that are also regulated by phosphorylation and perform similar functions.
Closely related kinases include SIKs, which are a subtype of AMPK (Wang et al. 1999) with a conserved Ser/Thr residue (Bright et al. 2009) and that is also activated by cAMP by phosphorylation in adipocytes (Henriksson et al. 2012; Bright et al. 2009). Both AMPKs and
SIKs can phosphorylate CRTCs (Sonntag et al. 2017) and have been found to play a role in neuroprotection (Sasaki et al. 2011; Xu and Ash, 2016). The activity of SIKs/AMPKs is context- dependent but can lead to CREB activation in neuroprotection through their effect on CRTCs.
1.13 CREB-/cAMP-regulated Transcriptional Coactivators (CRTC) enhance CREB activity
A family of CREB co-factors called cAMP-regulated transcriptional coactivators (CRTC, earlier also called transducers of regulated CREB activity, TORCS) was discovered in a screen searching for molecules that enhanced CRE activity (Conkright et al. 2003). There are three
CRTC family members, with each having has a CREB-binding domain (CBD) on the N- terminal, and regulatory, splicing regulating domain, and transactivation domain on the C- terminal (Altarejos and Montminy 2011). CRTCs bind CREB on its bZip domain on CREB’s C- terminal, and function to enhance CREB activity. CRTCs can function in the liver and play a role in metabolism, energy homeostasis, and lifespan.
CRTC1 is most highly expressed in the central nervous system, playing a role in late- phase LTP (Zhou et al. 2006; Kovacs et al. 2007) and in neuroprotection (Sasaki et al. 2011). On the other hand, CRTC2 is mostly found in the liver and plays a role in gluconeogenesis (Koo et al. 2005). In all these tissues, the subcellular localization of CRTC is crucial to its activity.
19 Under basal conditions, CRTC is phosphorylated by SIK2/AMPK and sequestered in the cytoplasm. Under stimulated conditions, SIK2 and AMPK are degraded, causing disinhibition and dephosphorylation of CRTC. Dephosphorylated CRTC can then translocate to the nucleus and bind CREB, and other bZip transcription factors (Altarejos and Montminy 2011) and can enhance CREB activation in neuroprotection.
Figure 4 Schematic diagram of phosphorylated CRTC in the cytoplasm and dephosphorylated CRTC nuclear translocation. (schematic from Mayr and Montminy, 2011). Thus far, we have examined the role of upstream modulators that lead to CREB activation in neuroprotection. However, in addition to activating CREB in neuroprotection, other transcription factors, such as FOXOs, can also modulate neuroprotection.
1.14 FOXO Transcription Factors are important in longevity and neuroprotection
FOXO proteins (Forkhead Box subclass O protein, so named due to their sequence similarity to the Drosophila gene Forkhead, are transcription factors that play a role in cell proliferation, longevity, and neuroprotection as well as other processes (McLaughlin and
Broihier, 2017). The state of phosphorylation determines their activity and location. In longevity and neuroprotection, activation of the IGF/insulin signaling pathways leads to
20 phosphorylation of FOXO, thereby causing it to remain in the cytoplasm. Inhibition of this pathway ultimately causes the lack of phosphorylation of FOXO, allowing it to translocate into the nucleus and bind the DNA. Interestingly, FOXO might act a pioneer transcription factor that can essentially prime the DNA to facilitate the activity of other transcription factors
(Lalmansingh et al. 2012). Importantly, FOXOs are evolutionarily conserved across species, including Caenorhabditis elegans, whose homolog is encoded by the daf-16 gene (Vowels and
Thomas, 1992) and whose activity modulates lifespan (Kenyon et al. 1993). In addition to conserved signaling cascades, C. elegans offers several other advantages for research.
1.15 Using C. elegans as a model organism offers several advantages to studying biological processes
C. elegans is a free-living soil-dwelling nematode, microscopic in size, first proposed as a model organism by Sydney Brenner in 1974 (Brenner, 1974). C. elegans is very easy to culture in a lab setting and has a rapid lifecycle (Riddle, 1978). Importantly, for this project, C. elegans uses glutamate as its main neurotransmitter. Glutamatergic signaling as well as several other signaling cascades are simplified (less redundancy and crosstalk) but conserved across evolution, including apoptosis (Conradt and Xue 2005) and insulin/ageing signaling pathways (i.e. involving FOXO/daf-16) (Kenyon, 2010). Glutamatergic signaling also potently controls several behavioral phenotypes, which are easily quantifiable. In addition, all C. elegans neurons have been identified and the functional connectivity is known (White et al. 1986), making it especially useful for neuronal identification studies; employing fluorescently labeled molecules is also extremely useful (Chalfie et al. 1994). C. elegans also serves as a great genetic model organism, with several available (or easily derived), genetic mutations.
21 1.16 Glutamatergic Signaling, GluRs and GluTs alike, are conserved in C. elegans
To our advantage, glutamatergic signaling is conserved in C. elegans. Unlike other invertebrates, C. elegans uses glutamate as its the main excitatory neurotransmitter. The C. elegans genome encodes ten ionotropic GluRs (8 AMPA-R –like subunit glr-1 – glr-8 and 2
NMDAR -like subunits, nmr-1, nmr-2) (Brockie and Maricq, 2001), and three metabotropic
GluRs mgl-1 - mgl-3 (Dillon et al. 2006, 2015). Non-NMDA receptors have a leading role in C. elegans neurophysiology. Importantly the nematode GluRs have conserved extracellular ligand binding domains and pore regions (TM1-TM3), which also contain a conserved Q/R site
(Seeburg et al. 1998) responsible for regulating calcium permeability. Non-NMDA receptors
(encoded by genes glr-1-glr-8) are expressed in the head and the ventral nerve cord. Here we focus on the glr-1/2 expressing neurons, which are responsible for the rapid and large currents
(Mellem, 2002) and mediate several behaviors.
There are six glutamate transporters (GluTs). Three of them are located on the canal cell
(glt-3,6,7), one is expressed in body wall muscles & hypodermis (glt-1) and one in a few pre- synaptic neurons (glt-4) (Mano et al. 2007). The expression of GLT-3,6,7 on the canal cell is surprising, because the canal cell is distal to the synapses in the nerve ring. Nonetheless, glt-3
KO still affects signaling in the glutamatergic head synapses, suggesting that fluids cleared by
GLT-3 on the canal cell have access to these synapses. The clearance strategy by these GluTs is the focus of another project in the lab (Lee, Chan, and Mano, unpublished), and the data suggest that glt-3 might affect Glu concentration in body fluids that are continuous with fluid found between the inner aspect of the nerve ring and the pharynx. Conservation of glutamatergic signaling is helpful and crucial to studying Glu-induced excitotoxic necrosis.
22 1.17 CREB signaling is important in synaptic plasticity in C. elegans
In addition to high conservation of molecular pathways like apoptosis and glutamatergic signaling, CREB and CREB signaling are also highly conserved in the nematode. C. elegans has one CREB homolog, encoded by the gene crh-1, which shares 50% primary sequence identity with vertebrate CREBs. The KID domain (containing S133 homologous residue, Ser29) shares
80% identity, and the DNA binding/bZip domain is 95% conserved (Kimura et al. 2002). There are seven isoforms of varying lengths (Supplemental Figure 1) and expression patterns
(Kaletsky et al. 2017). However, based on alignment it does not appear that Ser142 phosphorylation site is conserved in C. elegans. C. elegans has a crh-2 gene and a more distant homolog ATF7 (Shivers et al. 2010). But crh-2 is homologous to CREB3 and is paralogous to
SLBO, a C/EBPγ (Schwarz et al. 2012), suggesting that crh-1 is the only homolog of classical
CREB/CREB1. Moreover, upstream of CREB, signaling is also conserved. Importantly, the
CaMKK/CaMK/CREB cascade (Kimura et al. 2002), as well as activation mechanisms that involve AMPK/CRTC/CREB signal transduction, is conserved (Mair et al. 2011).
Studies in C. elegans have shown that CREB plays a role in neuroprotection from polyglutamine excitotoxicity (Bates et al. 2006), starvation response (Suo et al. 2006) and foraging behaviors (Zubenko et al. 2009). CREB plays significant roles in thermosensation
(Satterlee et al. 2004; Yu et al. 2014), longevity (Mair and Dillin 2011; Chen et al. 2016), synaptic plasticity and learning and memory (Kauffman et al. 2010, 2011; Timbers et al, 2011;
Nishida et al. 2011; Amano and Maruyama, 2011; Li et al. 2013; Lakhina et al. 2015; Nishijima et al. 2017; Freytag et al. 2017) and several other processes. Therefore, using C. elegans affords us the opportunity to extensively study the exact mechanism of CREB activation important for neuroprotection against excitotoxic necrosis.
23 1.18 C. elegans Model of Excitotoxic Necrosis mimics that of mammalian excitotoxicity
Several diseases can be modeled and studied in C. elegans, including, but not limited to, amyotrophic lateral sclerosis (ALS), Huntington’s, Parkinson’s, and Alzheimer’s disease
(Alexander et al. 2014), each of which are affected by aberrant glutamatergic signaling
(Lewerenz and Mahr, 2015). Using strong conservation in C. elegans, we have a well- established model of excitotoxicity, glt-3;nuIs5 (Mano et al. 2009). Our model combines a KO of glutamate transporter (GluT) GLT-3, encoded by the glt-3 gene. glt-3 KO by itself causes a decrease in the duration of spontaneous forward mobility and decreased pharyngeal pumping rate, indicative of increase Glu signaling (Mano and Driscoll, 2007; Mano et al. 2009). The integrated transgene nuIs5 combines Pglr-1::GαS* (a hyperactive (GTPase-deficient) form of rat
GαS with a Q227L substitution) and Pglr-1::GFP (Berger et al. 1998) which causes non-Glu- dependent necrosis most frequently in PVC neurons but less frequently in AVD, AVE, AVG,
PVQ, RIG and SMD neurons. The combination of nuIs5 with a deletion in glt-3 dramatically increases levels of neurodegeneration (Mano et al. 2009) and provides a model of glutamate- induced, nematode excitotoxic necrosis (and independent of apoptosis as seen by a mutation in the apoptotic gene ced-4 (Del Rosario et al. 2014)).
Although this is a not a perfect model of stroke, it is sufficient to mimic the key aspects of excitotoxicity, being a neurodegenerative necrosis triggered by excess Glu and mediated by
Ca2+-permeable GluRs. Yet, we also note some differences, since in mammals most of the Ca2+ - permeable GluRs are NMDARs, and that it is sufficient to knockout the glutamate transporters and cause excitotoxicity-induced cell death. In contrast, C. elegans uses Ca2+-permeable GluRs of mostly the AMPA subtype, and requires the Gαs hyperactivity to induce necrosis.
Nonetheless, this Gαs hyperactivity might mimic the condition of ischemia in which there is a
24 significant release of adenosine into the synapse, which binds to G-protein coupled adenosine receptors, ultimately leading to increased activity of Gαs. Therefore, our nematode is substantially representative of (though not identical to) mammalian excitotoxicity, and we therefore call it nematode excitotoxicity. We can now use this model to address molecular mechanisms of neurodegeneration and neuroprotection that might also be similar to their counterparts in excitotoxicity seen in higher animals.
As mentioned above, CREB is a leading mediator of neuroprotection, but it is not clear what is the basis for its action specificity in excitotoxic necrosis. CREB can be activated by hundreds of stimuli and can regulate expression of thousands of downstream targets. This dissertation addresses a few questions in mechanisms of neurodegeneration and neuroprotection, but focuses on the question of how CREB is specifically activated in excitotoxicity-induced neuroprotection, and begins to address what specific downstream targets are important for neuroprotection.
1.19 References
Alexander AG, Marfil V, Li C. 2014. Use of Caenorhabditis elegans as a model to study Alzheimer's disease and other neurodegenerative diseases. Front Genet 5: 279 Altarejos JY, Montminy M. 2011. CREB and the CRTC co-activators: sensors for hormonal and metabolic signals. Nature reviews. Molecular cell biology 12: 141-51 Amano H, Maruyama IN. 2011. Aversive olfactory learning and associative long-term memory in Caenorhabditis elegans. Learn Mem 18: 654-65 Bates EA, Victor M, Jones AK, Shi Y, Hart AC. 2006. Differential contributions of Caenorhabditis elegans histone deacetylases to huntingtin polyglutamine toxicity. J Neurosci 26: 2830-8 Berger AJ, Hart AC, Kaplan JM. 1998. G alphas-induced neurodegeneration in Caenorhabditis elegans. J Neurosci 18: 2871-80 Bialik S, Kimchi A. 2014. The DAP-kinase interactome. Apoptosis 19: 316-28 Bliss TV, Lomo T. 1973. Long-lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path. J Physiol 232: 331-56
25 Bourtchuladze R, Frenguelli B, Blendy J, Cioffi D, Schutz G, Silva AJ. 1994. Deficient long- term memory in mice with a targeted mutation of the cAMP-responsive element-binding protein. Cell 79: 59-68 Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94 Bright NJ, Thornton C, Carling D. 2009. The regulation and function of mammalian AMPK- related kinases. Acta Physiol (Oxf) 196: 15-26 Brockie PJM, D.M., Zheng Y, Mellem J, Maricq, AV. 2001. Differential Expression of Glutamate Receptor Subunits in the Nervous System of Caenorhabditis elegans and Their Regulation by the Homeodomain Protein UNC-42. The Journal of neuroscience : the official journal of the Society for Neuroscience 21: 1510-22 Cha-Molstad H, Keller DM, Yochum GS, Impey S, Goodman RH. 2004. Cell-type-specific binding of the transcription factor CREB to the cAMP-response element. Proc Natl Acad Sci U S A 101: 13572-7 Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC. 1994. Green fluorescent protein as a marker for gene expression. Science 263: 802-5 Chen Y, Klionsky DJ. 2011. The regulation of autophagy - unanswered questions. J Cell Sci 124: 161-70 Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, et al. 2016. A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling. Dev Cell 39: 209-23 Chrivia JC, Kwok RP, Lamb N, Hagiwara M, Montminy MR, Goodman RH. 1993. Phosphorylated CREB binds specifically to the nuclear protein CBP. Nature 365: 855-9 Cohen S, Greenberg ME. 2008. Communication between the synapse and the nucleus in neuronal development, plasticity, and disease. Annu Rev Cell Dev Biol 24: 183-209 Conkright MD, Canettieri G, Screaton R, Guzman E, Miraglia L, et al. 2003. TORCs: transducers of regulated CREB activity. Molecular Cell 12: 413-23 Conradt B, Xue D. 2005. Programmed cell death. WormBook: 1-13 Danbolt NC. 2001. Glutamate uptake. Prog Neurobiol 65: 1-105 Dash PK, Hochner B, Kandel ER. 1990. Injection of the cAMP-responsive element into the nucleus of Aplysia sensory neurons blocks long-term facilitation. Nature 345: 718-21 Davis SM, Lees KR, Albers GW, Diener HC, Markabi S, et al. 2000. Selfotel in acute ischemic stroke : possible neurotoxic effects of an NMDA antagonist. Stroke 31: 347-54 Deisseroth K, Mermelstein PG, Xia H, Tsien RW. 2003. Signaling from synapse to nucleus: the logic behind the mechanisms. Curr Opin Neurobiol 13: 354-65 Dillon J, Franks CJ, Murray C, Edwards RJ, Calahorro F, et al. 2015. Metabotropic Glutamate Receptors: Modulators of context-dependent feeding behaviour in C. elegans. J Biol Chem 290: 15052-65 Dillon J, Hopper NA, Holden-Dye L, O'Connor V. 2006. Molecular characterization of the metabotropic glutamate receptor family in Caenorhabditis elegans. Biochem Soc Trans 34: 942-8 Dirnagl U, Becker K, Meisel A. 2009. Preconditioning and tolerance against cerebral ischaemia: from experimental strategies to clinical use. Lancet Neurol 8: 398-412 Dirnagl U, Iadecola C, Moskowitz MA. 1999. Pathobiology of ischaemic stroke: an integrated view. Trends Neurosci 22: 391-7 Divito CB, Underhill SM. 2014. Excitatory amino acid transporters: roles in glutamatergic neurotransmission. Neurochem Int 73: 172-80
26 Dwarki VJ, Montminy M, Verma IM. 1990. Both the basic region and the 'leucine zipper' domain of the cyclic AMP response element binding (CREB) protein are essential for transcriptional activation. The EMBO journal 9: 225-32 Elmore S. 2007. Apoptosis: a review of programmed cell death. Toxicol Pathol 35: 495-516 Feinstein E, Druck T, Kastury K, Berissi H, Goodart SA, et al. 1995. Assignment of DAP1 and DAPK--genes that positively mediate programmed cell death triggered by IFN-gamma-- to chromosome regions 5p12.2 and 9q34.1, respectively. Genomics 29: 305-7 Freytag V, Probst S, Hadziselimovic N, Boglari C, Hauser Y, et al. 2017. Genome-Wide Temporal Expression Profiling in Caenorhabditis elegans Identifies a Core Gene Set Related to Long-Term Memory. J Neurosci 37: 6661-72 Furukawa H, Singh SK, Mancusso R, Gouaux E. 2005. Subunit arrangement and function in NMDA receptors. Nature 438: 185-92 Garcia D, Shaw RJ. 2017. AMPK: Mechanisms of Cellular Energy Sensing and Restoration of Metabolic Balance. Mol Cell 66: 789-800 Gidday JM. 2006. Cerebral preconditioning and ischaemic tolerance. Nature reviews. Neuroscience 7: 437-48 Gonzalez GA, Montminy MR. 1989. Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59: 675-80 Hardingham GE, Arnold FJ, Bading H. 2001. Nuclear calcium signaling controls CREB- mediated gene expression triggered by synaptic activity. Nat Neurosci 4: 261-7 Hardingham GE, Bading H. 2010. Synaptic versus extrasynaptic NMDA receptor signalling: implications for neurodegenerative disorders. Nat Rev Neurosci 11: 682-96 Hardingham GE, Fukunaga Y, Bading H. 2002. Extrasynaptic NMDARs oppose synaptic NMDARs by triggering CREB shut-off and cell death pathways. Nature neuroscience 5: 405-14 Henriksson E, Jones HA, Patel K, Peggie M, Morrice N, et al. 2012. The AMPK-related kinase SIK2 is regulated by cAMP via phosphorylation at Ser358 in adipocytes. Biochem J 444: 503-14 Horvitz HR. 1999. Genetic control of programmed cell death in the nematode Caenorhabditis elegans. Cancer Res 59: 1701s-06s Hu YY, Li L, Xian XH, Zhang M, Sun XC, et al. 2017. GLT-1 Upregulation as a Potential Therapeutic Target for Ischemic Brain Injury. Curr Pharm Des 23: 5045-55 Ikonomidou C, Turski L. 2002. Why did NMDA receptor antagonists fail clinical trials for stroke and traumatic brain injury? Lancet Neurol 1: 383-6 Impey S, McCorkle SR, Cha-Molstad H, Dwyer JM, Yochum GS, et al. 2004. Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions. Cell 119: 1041-54 Jin Y, Blue EK, Dixon S, Hou L, Wysolmerski RB, Gallagher PJ. 2001. Identification of a new form of death-associated protein kinase that promotes cell survival. J Biol Chem 276: 39667-78 Kaang BK, Kandel ER, Grant SG. 1993. Activation of cAMP-responsive genes by stimuli that produce long-term facilitation in Aplysia sensory neurons. Neuron 10: 427-35 Kandel ER. 2001. The molecular biology of memory storage: a dialogue between genes and synapses. Science 294: 1030-8 Kauffman A, Parsons L, Stein G, Wills A, Kaletsky R, Murphy C. 2011. C. elegans positive butanone learning, short-term, and long-term associative memory assays. J Vis Exp
27 Kauffman AL, Ashraf JM, Corces-Zimmerman MR, Landis JN, Murphy CT. 2010. Insulin signaling and dietary restriction differentially influence the decline of learning and memory with age. PLoS Biol 8: e1000372 Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. 1993. A C. elegans mutant that lives twice as long as wild type. Nature 366: 461-4 Kenyon CJ. 2010. The genetics of ageing. Nature 464: 504-12 Kimura Y, Corcoran EE, Eto K, Gengyo-Ando K, Muramatsu MA, et al. 2002. A CaMK cascade activates CRE-mediated transcription in neurons of Caenorhabditis elegans. EMBO Rep 3: 962-6 Kitagawa K. 2007. CREB and cAMP response element-mediated gene expression in the ischemic brain. The FEBS journal 274: 3210-7 Kitagawa K. 2012. Ischemic tolerance in the brain: endogenous adaptive machinery against ischemic stress. J Neurosci Res 90: 1043-54 Koo SH, Flechner L, Qi L, Zhang X, Screaton RA, et al. 2005. The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437: 1109-11 Kovacs KA, Steullet P, Steinmann M, Do KQ, Magistretti PJ, et al. 2007. TORC1 is a calcium- and cAMP-sensitive coincidence detector involved in hippocampal long-term synaptic plasticity. Proc Natl Acad Sci U S A 104: 4700-5 Kulshrestha M, Vidyanand. 2013. An analysis of the risk factors and the outcomes of cerebrovascular diseases in northern India. J Clin Diagn Res 7: 127-31 Lai TW, Zhang S, Wang YT. 2014. Excitotoxicity and stroke: identifying novel targets for neuroprotection. Prog Neurobiol 115: 157-88 Lakhina V, Arey RN, Kaletsky R, Kauffman A, Stein G, et al. 2015. Genome-wide functional analysis of CREB/long-term memory-dependent transcription reveals distinct basal and memory gene expression programs. Neuron 85: 330-45 Lalmansingh AS, Karmakar S, Jin Y, Nagaich AK. 2012. Multiple modes of chromatin remodeling by Forkhead box proteins. Biochim Biophys Acta 1819: 707-15 Lamph WW, Dwarki VJ, Ofir R, Montminy M, Verma IM. 1990. Negative and positive regulation by transcription factor cAMP response element-binding protein is modulated by phosphorylation. Proceedings of the National Academy of Sciences of the United States of America 87: 4320-4 Laube B, Kuhse J, Betz H. 1998. Evidence for a tetrameric structure of recombinant NMDA receptors. J Neurosci 18: 2954-61 Lewerenz J, Maher P. 2015. Chronic Glutamate Toxicity in Neurodegenerative Diseases-What is the Evidence? Front Neurosci 9: 469 Li C, Timbers TA, Rose JK, Bozorgmehr T, McEwan A, Rankin CH. 2013. The FMRFamide- related neuropeptide FLP-20 is required in the mechanosensory neurons during memory for massed training in C. elegans. Learn Mem 20: 103-8 Lisman J, Schulman H, Cline H. 2002. The molecular basis of CaMKII function in synaptic and behavioural memory. Nat Rev Neurosci 3: 175-90 Lonze BE, Ginty DD. 2002. Function and regulation of CREB family transcription factors in the nervous system. Neuron 35: 605-23 Mabuchi T, Kitagawa K, Kuwabara K, Takasawa K, Ohtsuki T, et al. 2001. Phosphorylation of cAMP response element-binding protein in hippocampal neurons as a protective response after exposure to glutamate in vitro and ischemia in vivo. The Journal of neuroscience : the official journal of the Society for Neuroscience 21: 9204-13
28 Mair W, Morantte I, Rodrigues AP, Manning G, Montminy M, et al. 2011. Lifespan extension induced by AMPK and calcineurin is mediated by CRTC-1 and CREB. Nature 470: 404- 8 Mano I, Driscoll M. 2009. Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity. Journal of neurochemistry 108: 1373-84 Mano I, Straud S, Driscoll M. 2007. Caenorhabditis elegans glutamate transporters influence synaptic function and behavior at sites distant from the synapse. The Journal of biological chemistry 282: 34412-9 Mano I, Teichberg VI. 1998. A tetrameric subunit stoichiometry for a glutamate receptor- channel complex. Neuroreport 9: 327-31 Mantamadiotis T, Lemberger T, Bleckmann SC, Kern H, Kretz O, et al. 2002. Disruption of CREB function in brain leads to neurodegeneration. Nat Genet 31: 47-54 Mayr B, Montminy M. 2001. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nature reviews. Molecular cell biology 2: 599-609 McLaughlin CN, Broihier HT. 2017. Keeping Neurons Young and Foxy: FoxOs Promote Neuronal Plasticity. Trends Genet Mellem JE, Brockie PJ, Zheng Y, Madsen DM, Maricq AV. 2002. Decoding of polymodal sensory stimuli by postsynaptic glutamate receptors in C. elegans. Neuron 36: 933-44 Meller R, Minami M, Cameron JA, Impey S, Chen D, et al. 2005. CREB-mediated Bcl-2 protein expression after ischemic preconditioning. J Cereb Blood Flow Metab 25: 234-46 Menzies FM, Fleming A, Caricasole A, Bento CF, Andrews SP, et al. 2017. Autophagy and Neurodegeneration: Pathogenic Mechanisms and Therapeutic Opportunities. Neuron 93: 1015-34 Mizushima N, Levine B, Cuervo AM, Klionsky DJ. 2008. Autophagy fights disease through cellular self-digestion. Nature 451: 1069-75 Montminy MR, Bilezikjian LM. 1987. Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Nature 328: 175-8 Montminy MR, Sevarino KA, Wagner JA, Mandel G, Goodman RH. 1986. Identification of a cyclic-AMP-responsive element within the rat somatostatin gene. Proc Natl Acad Sci U S A 83: 6682-6 Moskowitz MA, Lo EH, Iadecola C. 2010. The science of stroke: mechanisms in search of treatments. Neuron 67: 181-98 Murphy SL, Kochanek KD, Xu J, Arias E. 2015. Mortality in the United States, 2014. NCHS Data Brief: 1-8 Nishida Y, Sugi T, Nonomura M, Mori I. 2011. Identification of the AFD neuron as the site of action of the CREB protein in Caenorhabditis elegans thermotaxis. EMBO Rep 12: 855- 62 Nishijima S, Maruyama IN. 2017. Appetitive Olfactory Learning and Long-Term Associative Memory in Caenorhabditis elegans. Front Behav Neurosci 11: 80 Niswender CM, Conn PJ. 2010. Metabotropic glutamate receptors: physiology, pharmacology, and disease. Annu Rev Pharmacol Toxicol 50: 295-322 Parker D, Jhala US, Radhakrishnan I, Yaffe MB, Reyes C, et al. 1998. Analysis of an activator:coactivator complex reveals an essential role for secondary structure in transcriptional activation. Mol Cell 2: 353-9
29 Ravikumar B, Sarkar S, Davies JE, Futter M, Garcia-Arencibia M, et al. 2010. Regulation of mammalian autophagy in physiology and pathophysiology. Physiol Rev 90: 1383-435 Riddle DL. 1978. The genetics of development and behavior in Caenorhabditis elegans. J Nematol 10: 1-16 Rossi DJ, Oshima T, Attwell D. 2000. Glutamate release in severe brain ischaemia is mainly by reversed uptake. Nature 403: 316-21 Sakamoto K, Karelina K, Obrietan K. 2011. CREB: a multifaceted regulator of neuronal plasticity and protection. J Neurochem 116: 1-9 Sasaki T, Takemori H, Yagita Y, Terasaki Y, Uebi T, et al. 2011. SIK2 is a key regulator for neuronal survival after ischemia via TORC1-CREB. Neuron 69: 106-19 Satterlee JS, Ryu WS, Sengupta P. 2004. The CMK-1 CaMKI and the TAX-4 Cyclic nucleotide- gated channel regulate thermosensory neuron gene expression and function in C. elegans. Curr Biol 14: 62-8 Schwarz EM, Kato M, Sternberg PW. 2012. Functional transcriptomics of a migrating cell in Caenorhabditis elegans. Proc Natl Acad Sci U S A 109: 16246-51 Seeburg PH, Higuchi M, Sprengel R. 1998. RNA editing of brain glutamate receptor channels: mechanism and physiology. Brain Res Brain Res Rev 26: 217-29 Sheng M, McFadden G, Greenberg ME. 1990. Membrane depolarization and calcium induce c- fos transcription via phosphorylation of transcription factor CREB. Neuron 4: 571-82 Sheng M, Thompson MA, Greenberg ME. 1991. CREB: a Ca(2+)-regulated transcription factor phosphorylated by calmodulin-dependent kinases. Science 252: 1427-30 Shivers RP, Pagano DJ, Kooistra T, Richardson CE, Reddy KC, et al. 2010. Phosphorylation of the conserved transcription factor ATF-7 by PMK-1 p38 MAPK regulates innate immunity in Caenorhabditis elegans. PLoS Genet 6: e1000892 Siegel GJ. 2006. Basic neurochemistry : molecular, cellular, and medical aspects. Amsterdam ; Boston: Elsevier. xxiv, 992 p. pp. Soderling TR. 1999. The Ca-calmodulin-dependent protein kinase cascade. Trends Biochem Sci 24: 232-6 Sonntag T, Moresco JJ, Vaughan JM, Matsumura S, Yates JR, 3rd, Montminy M. 2017. Analysis of a cAMP regulated coactivator family reveals an alternative phosphorylation motif for AMPK family members. PLoS One 12: e0173013 Suo S, Kimura Y, Van Tol HH. 2006. Starvation induces cAMP response element-binding protein-dependent gene expression through octopamine-Gq signaling in Caenorhabditis elegans. J Neurosci 26: 10082-90 Takemoto-Kimura S, Suzuki K, Horigane SI, Kamijo S, Inoue M, et al. 2017. Calmodulin kinases: essential regulators in health and disease. J Neurochem 141: 808-18 Tehrani N, Del Rosario J, Dominguez M, Kalb R, Mano I. 2014. The insulin/IGF signaling regulators cytohesin/GRP-1 and PIP5K/PPK-1 modulate susceptibility to excitotoxicity in C. elegans. PLoS One 9: e113060 Timbers TA, Rankin CH. 2011. Tap withdrawal circuit interneurons require CREB for long-term habituation in Caenorhabditis elegans. Behav Neurosci 125: 560-6 Traynelis SF, Wollmuth LP, McBain CJ, Menniti FS, Vance KM, et al. 2010. Glutamate receptor ion channels: structure, regulation, and function. Pharmacol Rev 62: 405-96 Tzingounis AV, Wadiche JI. 2007. Glutamate transporters: confining runaway excitation by shaping synaptic transmission. Nat Rev Neurosci 8: 935-47
30 Vanden Berghe T, Linkermann A, Jouan-Lanhouet S, Walczak H, Vandenabeele P. 2014. Regulated necrosis: the expanding network of non-apoptotic cell death pathways. Nat Rev Mol Cell Biol 15: 135-47 Vowels JJ, Thomas JH. 1992. Genetic analysis of chemosensory control of dauer formation in Caenorhabditis elegans. Genetics 130: 105-23 Walton M, Woodgate AM, Muravlev A, Xu R, During MJ, Dragunow M. 1999. CREB phosphorylation promotes nerve cell survival. J Neurochem 73: 1836-42 Walton MR, Dragunow I. 2000. Is CREB a key to neuronal survival? Trends Neurosci 23: 48-53 Wang Z, Takemori H, Halder SK, Nonaka Y, Okamoto M. 1999. Cloning of a novel kinase (SIK) of the SNF1/AMPK family from high salt diet-treated rat adrenal. FEBS Lett 453: 135-9 Watkins JC. 2000. l-glutamate as a central neurotransmitter: looking back. Biochem Soc Trans 28: 297-309 Wayman GA, Lee YS, Tokumitsu H, Silva AJ, Soderling TR. 2008. Calmodulin-kinases: modulators of neuronal development and plasticity. Neuron 59: 914-31 Wegener S, Gottschalk B, Jovanovic V, Knab R, Fiebach JB, et al. 2004. Transient ischemic attacks before ischemic stroke: preconditioning the human brain? A multicenter magnetic resonance imaging study. Stroke; a journal of cerebral circulation 35: 616-21 West AE, Chen WG, Dalva MB, Dolmetsch RE, Kornhauser JM, et al. 2001. Calcium regulation of neuronal gene expression. Proc Natl Acad Sci U S A 98: 11024-31 White JG, Southgate E, Thomson JN, Brenner S. 1986. The structure of the nervous system of the nematode Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci 314: 1-340 Xing L, Gopal VK, Quinn PG. 1995. cAMP response element-binding protein (CREB) interacts with transcription factors IIB and IID. J Biol Chem 270: 17488-93 Xu L, Ash JD. 2016. The Role of AMPK Pathway in Neuroprotection. Adv Exp Med Biol 854: 425-30 Yu YV, Bell HW, Glauser D, Van Hooser SD, Goodman MB, Sengupta P. 2014. CaMKI- dependent regulation of sensory gene expression mediates experience-dependent plasticity in the operating range of a thermosensory neuron. Neuron 84: 919-26 Zhang S-J, Zou M, Lu L, Lau D, Ditzel DAW, et al. 2009. Nuclear calcium signaling controls expression of a large gene pool: identification of a gene program for acquired neuroprotection induced by synaptic activity. PLoS Genet 5: e1000604 Zhang SJ, Steijaert MN, Lau D, Schutz G, Delucinge-Vivier C, et al. 2007. Decoding NMDA receptor signaling: identification of genomic programs specifying neuronal survival and death. Neuron 53: 549-62 Zhang X, Odom DT, Koo SH, Conkright MD, Canettieri G, et al. 2005. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc Natl Acad Sci U S A 102: 4459-64 Zhou Y, Wu H, Li S, Chen Q, Cheng XW, et al. 2006. Requirement of TORC1 for late-phase long-term potentiation in the hippocampus. PLoS One 1: e16 Zubenko GS, Jones ML, Estevez AO, Hughes HB, 3rd, Estevez M. 2009. Identification of a CREB-dependent serotonergic pathway and neuronal circuit regulating foraging behavior in Caenorhabditis elegans: a useful model for mental disorders and their treatments? Am J Med Genet B Neuropsychiatr Genet 150B: 12-23
31 1.20 Supplemental
A) Alignment of canonical CREB with C. elegans CRH-1 encoded by different transcripts
Supplemental Figure 1 Alignment of canonical human CREB with C. elegans CRH-1 and its transcripts. The KID and bZip domains are highlighted in yellow.
32
Chapter 2
Non-canonical Mechanism of CREB Activation in Nematode Excitotoxicity
A manuscript (in revision)
1,2 1,2 3 3 K. Genevieve Feldmann , Ayesha Chowdhury , Jessi Becker , N’Gina McAlpin , Taqwa 4 3 4 4 5 Ahmed , Syed Haider , Jian X. Richard Xia , Karina Diaz , Monal G. Mehta , and Itzhak 1,2,4,CA Mano
1 Department of Molecular, Cellular and Biomedical Sciences, CDI Cluster on Neural Development and Repair, The CUNY School of Medicine, City College (CCNY), The City University of New York (CUNY)
2 3 The CUNY Neuroscience Collaborative PhD Program, CUNY Graduate Center 4 Undergraduate Program in Biology, CCNY, CUNY The Sophie Davis BS/MD program, 5 CUNY School of Medicine Robert Wood Johnson Medical School, Rutgers – The State University of New Jersey
CA Corresponding Author: Itzhak Mano, Ph.D. Department of Molecular, Cellular and Biomedical Sciences Center for Discovery & Innovation, Cluster on Neural Development and Repair The CUNY School of Medicine at City College & The CUNY Graduate Center The City University of New York CDI building room 3-382 85 St. Nicholas Terrace, New York, NY 10031
Authors’ contributions
KGF, AC, & IM designed the project and the experiments, analyzed the data and wrote the paper. KGF, AC, JB, N’GM, and TA collected the data. SH, JXX, KD and MGM helped in strain creation.
33 2.1 Abstract
Excitotoxicity is caused by hyperstimulation of glutamate receptors (GluRs) and is a major cause of neurodegeneration in several neurodegenerative diseases including brain ischaemia and Huntington’s disease. However, the specific mechanism of excitotoxicity subsequent to hyperstimulation of GluRs remains elusive. In addition to cell death, GluR activity can also turn on neuroprotective pathways, including the activation of transcription factor CREB.
The most prevalent mechanism of CREB activation is a canonical mechanism that depends on its phosphorylation in the nucleus and its association with histone acetyltransferase, CBP. This mechanism is operative in CREB’s protection from neuronal apoptosis following target deprivation. However, much of the effect of CREB in excitotoxicity is seen in necrosis.
Furthermore, CREB is non-specific as it is expressed in all tissues, can be activated by hundreds of stimuli, and has thousands of downstream target genes. Thus, questions remain as to how
CREB is activated in context-specific conditions in excitotoxicity-induced neuroprotection. In recent years, a non-canonical mechanism of CREB activation (which is independent of its phosphorylation and involves CREB-regulated coactivator, CRTC) has been proposed in some cases. To differentiate between these mechanisms, we use a C. elegans model of excitotoxic necrosis. We find that CREB’s role in neuroprotection is conserved and its effect is most noticeable in neurons exposed to milder levels of Glu. Importantly, the canonical mechanism of
CREB activation is not important in this form of neurodegeneration; rather we have found that
CREB activation instead depends on CRTC and its upstream regulators, independent of phosphorylation. Understanding a core conserved mechanism of CREB activation in neuroprotection might help us to narrow-down the most important transcriptional targets of
CREB in excitotoxicity, which might serve as targets of future therapies in ischemia.
34 2.2 Introduction
As I described above, excitotoxicity is caused by the hyperstimulation of the postsynaptic glutamate receptors (GluRs), allowing for excessive and toxic calcium influx, causing necrotic cell death. However, there is a large body of evidence that suggests that GluR signaling can also activate cell survival pathways by turning on CREB and transcription of neuroprotective genes
(Ikonimidou and Turski 2002). Finding the molecules responsible for CREB activation is an attractive approach in stroke/brain ischemia because targeting them might offer effective treatment even hours after stroke onset.
However, there are many mechanisms to activate the ubiquitously expressed transcription factor, CREB and there are thousands of different gene targets, dependent on context. The context of CREB activation is likely to specify which subsets of target genes are turned on
(Zhang et al. 2005; Lakhina et al. 2015). Several studies have focused on CREB phosphorylation as being the determining factor of increased transcriptional response (Mayr and
Montminy, 2001). However, recent studies suggest that, at least under certain contexts, CREB activation is phosphorylation and PKA-independent, and instead hinges on CRTC (Conkright et al. 2003; Zhang et al. 2005). Nonetheless, the exact mechanism of CREB activation and the identity of its target genes in excitotoxicity remain unclear.
2.2.1 Neurons are differentially susceptible to damage in response to various insults
An additional intriguing aspect of excitotoxicity and excitotoxicity-induced neuroprotection is the issue of differential susceptibility to excitotoxicity. In many cases, susceptibility to damage seems correlated with the extent of the insult. For example, cells in the stroke’s penumbra (where damage is moderate) are salvageable compared to the stroke’s core.
35 However, in other cases some neuron populations show special sensitivity under seemingly uniform excitotoxicity conditions (e.g., in global brain ischemia) (Pulsinelli 1985; Pellegrini-
Giampietro et al. 1992). In addition, researchers have shown that the hippocampal neurons in
CA1 are more susceptible to ischemic insult, even compared to neurons in the CA3 region (Ordy et al. 1993). Thus it is not clear if differential susceptibility involves differences in glutamatergic signaling (i.e., the extent of insult), levels of CREB (or other neuroprotective modulators), and/or other factors.
2.2.2 Structure and function of NMDARs and AMPARs determine their role in excitotoxicity: Crucial differences between mammals and C. elegans
The role of NMDARs in mammalian excitotoxicity has been heavily studied. Some researchers suggest that activation of specific NMDARs, based on being synaptic or extrasynaptic NMDARs (Hardingham and Bading 2002; Kaufman et al. 2012; Wroge et al.
2012), and/or NMDAR subunit composition (NR2A vs. NR2B) lead to different outcomes
(Hardingham and Bading 2010) in neuronal death and neuronal survival. However, each of these has been heavily disputed (von Engelhardt et al. 2007; Thomas et al. 2006) and thus the role of specific GluR subunits (or their locations) in CREB activation in excitotoxicity still remains unclear. However, a significant consideration for this project is that mammalian NMDARs rely on the presence of AMPARs for depolarization, and are thus are colocalized with AMPARs
(Kharazia et al. 1996; Newpher and Ehlers, 2008; Antal et al. 2008; MacGillavry and
Hoogenraad, 2015). In the context of cell death and cell survival, these mammalian NMDARs also conduct calcium (which can activate CaM/CaMK signaling) and can induce apoptosis and/or activate CREB. Mammalian NMDARs also have a large cytoplasmic tail, allowing for
36 crucial post-synaptic protein interaction (Hansen et al. 2017). Mammalian AMPARs are also tetrameric but typically do not conduct calcium, and therefore cannot trigger this type of cell signaling. Therefore, in mammals, NMDARs are primarily responsible for calcium signaling, synaptic plasticity and CREB activation. The activity of these NMDARs is also important in the regulation of apoptosis, and CREB activation mitigates this effect (Hardingham and Bading,
2010).
In contrast, C. elegans’ AMPARs mediate most of the complex behaviors and synaptic plasticity, which correlates with their ability to conduct calcium (Mellem et al. 2002). Therefore, the calcium-conducting properties of the AMPARs are likely to be responsible for inducing a necrotic phenotype. Our excitotoxic model relies on AMPARs, encoded by the glr genes (Mano et al. 2009). C. elegans AMPARs do not dictate the opening/closing of NMDARs through depolarization and there is little colocalization of AMPARs and NMDARs (Brockie et al. 2001).
Another difference between other studies of CREB activation in neuroprotection and our study is that these studies looked at apoptotis-inducing conditions, not conditions that induce necrosis. Regardless of the specific GluR localization, subtype and subunit composition, all models agree on the influx of Ca2+ through GluRs as the mediator of CREB activation in neuroprotection (Walton and Dragunow, 2000; Ikonomidou and Turski, 2002; Cohen and
Greenberg, 2008; Lai et al. 2014).
2.2.3 Deciphering between canonical and non-canonical mechanisms of CREB activation
Of the several possible mechanisms of CREB activation, we separated them into canonical and non-canonical mechanisms (Figure 5). The canonical mechanism of activation involves the hyperstimulation of GluRs and influx of Ca2+. Calcium then binds CaM, which
37 associates with CaMKK and triggers activation of CaMKIV. CaMKIV can then go onto phosphorylate CREB at Ser133 (equivalent to Ser29 in C. elegans’ crh-1). Phosphorylation leads to recruitment of CBP and enhances CREB-mediated gene activation. Interestingly, it has also been shown that though CaMKK is not needed for basal CaMKIV activity, CaMKK greatly enhances CaMKIV and CREB activation (Kimura et al. 2002; Wayman et al. 2008).
Importantly the focus of canonical activation relies on the requirement of CREB phosphorylation
(Mayr and Montminy, 2001). This canonical mechanism has been shown to play a role in several scenarios, such as synaptic plasticity and neuroprotection. Studies of neuronal apoptosis following target deprivation also found pCREB to be neuroprotective (Hardingham and Bading,
2010), and this condition was suggested to be a good model to study anti-apoptotic CREB targets in excitotoxicity (Zhang et al. 2009; Zhang et al. 2011).
On the other hand, the non-canonical mechanism, involving CREB’s coactivator CRTC, has been shown to be involved in a few studies (Takemori et al. 2007), even in excitotoxicity
(Sasaki et al. 2011). According to the non-canonical model, under basal conditions, SIK2/AMPK is active, and phosphorylates and inactivates CRTC. Phosphorylated CRTC is bound by 14-3-3 proteins, which causes CRTC to be sequestered in the cytoplasm (Figure 4). Under stimulated or excitotoxic conditions, Ca2+ enters the cell, and binds to calmodulin. Calmodulin binds to
CaMKI in the cytoplasm, which in turns phosphorylates SIK2/AMPK. SIK2/AMPK is sent to degradation, which allows for the phosphatase calcineurin to act upon, and dephosphorylate,
CRTC. The unphosphorylated form of CRTC can translocate to the nucleus and bind the bZIP domain of CREB. The binding of CRTC to CREB allows for enhanced transcription of prosurvival genes. Importantly, CRTC binding to CREB is independent of CREB phosphorylation. The CRTC::CREB complex has been shown to form in synaptic plasticity
38 (Kovacs et al. 2007; Ch’ng et al. 2012, Nonaka et al. 2014, Briand et al. 2015; Uchida et al.
2017; Parra-Damas et al. 2017) as well as in Huntington’s disease (Jeong et al. 2011). Based on the studies that show CRTC::CREB complex is important in synaptic plasticity, we hypothesize that CREB activation via CRTC is crucial for protection against excitotoxicity.
Figure 5 Deciphering between the mechanisms of CREB activation. The canonical mechanism involves activation of CaMKK and CBP. The non-canonical mechanism involves CaMKI/SIK2/CRTC cascade.
The mechanism of CREB activation determines a context-dependent transcriptional response. Most importantly, the exact mechanism of CREB activation in excitotoxic necrosis is unknown, therefore we set out to investigate exactly which mechanism, canonical and/or non- canonical, is important for protection against excitotoxic necrosis.
2.3 Results
2.3.1 CREB’s role in neuroprotection is conserved in nematodes
To test whether CREB’s role in neuroprotection is evolutionarily conserved and holds true in excitotoxic necrosis, we combined a knockout (KO) of crh-1(tz2)III, which consists of a
39 deletion of the CREB bZip domain, with our excitotoxic strain, glt-3;nuIs5 to create crh-1;glt-
3;nuIs5. We quantified the levels of neurodegeneration in freely moving animals, across all life stages, by counting the number of necrotic vacuole-looking structures under DIC. The absence of CREB/crh-1 significantly enhances the levels of neurodegeneration compared to glt-3;nuIs5
(N=82-150 worms, ANOVA one-way, ***p<0.001) (Figure 6). We confirmed those results in a separate triple mutant generated in an independent cross (data not shown). These data suggest that 1) CREB’s role in neuroprotection is conserved in nematodes and 2) CREB activation is important to protect against necrotic cell death.
N2 10 glt-3;nuIs5 **** 9 crh-1;glt-3;nuIs5 8
7 **** 6 **** 5 4
3 *** 2 1 Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A Developmental Stage N=82-150, ***p<0.001 Figure 6 CREB is crucial for neuroprotection. A KO of CREB with crh-1(tz2) in excitotoxicity (glt-3;nuIs5) shows significant increases in the levels of neurodegeneration. (N=82-150, Error bars represent ±SEM, ANOVA two-way, ***p<0.001). N2 shows no neurodegeneration across all life stages (N=32, each life stage). In this and all subsequent bar graphs: Error bars represent SEM; Asterisks represent statistical significance of the difference between the indicated groups, where * indicates p<0.05 ; ** indicates p<0.01 ; *** indicates p<0.001).
2.3.2 CREB protects neurons receiving milder Glutamate insults
Although the pattern of dying neurons observed in glt-3;nuIs5 appears different between individual animals (i.e., it is non-stereotypic), we suspected that even if it is not completely
40 fixed, there might be an increased tendency of some neurons to die more frequently than others.
We therefore set out to identify which neurons were dying and also answer the question of which neurons is CREB’s protection effect most evident. To do this, we imaged L3 worms using DIC and GFP fluorescence (63X objective) in nuIs5 (Supplemental Figure 2), glt-3;nuIs5, and crh-
1;glt-3;nuIs5 (Figure 7 A & B). We compared the location and morphology of the necrotic vacuoles and their labeling by GFP expression (as nuIs5 is a transgene that contains also Pglr-1-
::GFP) to the known identity of glr-1 expressing neurons (Brockie et al. 2001) (details in
Methods section). Generally, there was high variability in the cell death of glr-1 expressing neurons, but we also noticed a general pattern. Figure 7A breaks the data down by individual neurons, while Figure 7B shows compiled data where individual neurons were grouped by neuron type.
A) 0.4 Sensory Motor Neurons Interneurons Other
glt-3;nuIs5 (N=43)
0.3 crh-1;glt-3;nuIs5 (N=30)
0.2
0.1
Average Degeneration Frequency Degeneration Average 0.0
AVG Other AIBL/R RIML/R RMDL/R AVAL/RAVEL/RAVBL/RAVDL/RRIGL/R URYDL/RURYVL/R RMDDL/RRMDVL/RSMDDL/RSMDVL/R Individual Neurons
41
Figure 7 CREB preferentially B) glt-3;nuIs5 (N=43) protects interneurons compared to 0.3 motor and sensory neurons. A) The crh-1;glt-3;nuIs5 N=30) * average frequency of degeneration, by neuron. The ‘Other’ category encompasses non-glr-1 expressing neurons. B) Compiled average 0.2 frequencies according to neuron type: sensory, motor, and *** interneurons. (ANOVA, *p<0.05)
0.1
Average Degeneration Frequency Degeneration Average 0.0
Motor Sensory Interneurons Neuron Type *p<0.05
Overall, we found that over 95% of the neurons dying in glt-3;nuIs5 and crh-1;glt-
3;nuIs5 worms are expressing GFP and are therefore glr-1-expressing neurons. We found that
the sensory neurons (URY type) and the motor neurons of the RMD/SMD groups often die even
in the presence of CREB (sensory neurons dying slightly more in crh-1 mutants, *p<0.05).
However, the absence of CREB significantly increases the probability of interneurons (such as
AIB, AVA) to die (***p<0.001, N=43 and N=30 worms, in glt-3;nuIs5 and crh-1;glt-3;nuIs5
respectively) (Figure 7B). These data suggest two main points: 1) Since the dying neurons are
almost always expressing GFP, excitotoxicity seems to work cell-autonomously in our system,
and cause neurodegeneration only in these glr-1-expressing cells; the presence of a few non-
green dying neurons can be attributed to the degradation of GFP in late stages of
neurodegeneration. 2) some neurons (such as the interneurons AVA, AVB, etc.) are potentially
42 preferentially protected by CREB. It is not clear if this is due to a reduced insult (that leaves
CREB room to provide protection) or increased resilience in these neurons.
2.3.3 CREB does not seem to protect neurons by decreasing GluR activity
A reasonable explanation for the increased resilience in the neurons would be that CREB modulates GluR activity. To test this, we performed both spontaneous mobility (Brockie et al.
2001) and nose touch (NOT) assays (Kaplan and Horvitz, 1993; Hart et al. 1995), which have been shown to be highly sensitive measurements of GluR activity. We used the normal controls,
N2 and nmr-1;glr-1;glr-2, and examined the effects of crh-1 and crtc-1 single mutations. In the spontaneous mobility assay, both crtc-1 and crh-1 mutations significantly reduced time of forward movement (Welch test ***p=0.001 and p=0.018, respectively) (Figure 8A) compared to control. The Nose Touch (NOT) assay shows decreased responsiveness in both crh-1 and crtc-1 mutants (N=90, p<0.001) (Figure 8B).
A) Spontaneous Mobility B) Nose Touch
100 n.s. 140 90 120 80 *** *** *** 100 70 60 80 50 60 40 n.s. 40 30 Average Duration (s) Duration Average Percent Responsive 20 20 10 **** ** * 0 0
N2 N2 crh-1 crtc-1 crh-1 N=90 crtc-1 N=90
nmr-1;glr-1;glr-2 nmr-1;glr-1 glr-2
Figure 8 Spontaneous Mobility and Nose Touch Assays show decreased GluR activity in the absence of CREB/crh-1 and CRTC. Error bars represent SEM. A) inset significance * compared to N2. ANOVA and Welch tests ***p<0.001.
43 These data suggest that mutations in crh-1 and crtc-1 decrease GluR activity compared to control. Therefore, although GluR activity is reduced when CREB is knocked out (Figure 8), the absence of CREB still makes these neurons more likely to die (Figures 6, 7). These observations suggest the neuroprotective effect of CREB activity is not mediated by reducing
GluR activity. To further look at mechanisms of resilience, we studied the process of CREB activation.
2.3.4 Canonical Activators, CaMKK/ckk-1 and CBP/cbp-1 do not play a significant role in nematode excitotoxic necrosis
We set out to examine which mode of CREB activation is important in neuroprotection against necrotic cell death. To do this, we tested the effect of two main canonical CREB activators in our model of excitotoxicity (Figure 5). We first examined the role of
Ca2+/Camodulin-dependent Kinase Kinase (CaMKK/ckk-1). Although CaMKK is not absolutely required for CaMKIV activation, CaMKK has been shown to greatly enhance the activity of
CaMKIV and increases CREB phosphorylation in both mammals and worms (Kimura et al.
2002). We combined a KO ckk-1(ok1033) III with glt-3;nuIs5 and quantified the levels of neurodegeneration. A KO of ckk-1 did not affect the levels of neurodegeneration in our excitotoxic model (N>30) (Figure 9) (Del Rosario et al. 2015).
44 8 glt-3;nuIs5 ckk-1;glt-3;nuIs5 7
6
5
4
3
2
1 Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A Developmental Stage N=19-104
Figure 9 CaMKK/ckk-1 does not play a role in nematode excitotoxicity. Loss of ckk-1(ok1033) shows no changes in the levels of neurodegeneration across all life stages. (ANOVA one-way, N=19-104).
Furthermore, we tested the effect of histone acetyltransferase and CREB cofactor, CBP.
As CBP/cbp-1 null mutant is embryonically lethal, we used a CBP strain whose HAT activity is increased 7-fold, cbp-1(ku258) III (Eastburn and Han, 2005). We found that cbp-1(gf);glt-
3;nuIs5 showed no changes in the levels of neurodegeneration when compared with glt-3;nuIs5
(N>30 worms, each life stage, ±SEM) (Figure 10).
45 8 glt-3;nuIs5 7 cbp-1;glt-3;nuIs5
6
5
4 *** 3
2
1 Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A Developmental Stage N=31-48, ***p<0.001
Figure 10 Hyperactive form of CBP/cbp-1 does not change the levels of neurodegeneration. N>30 worms, each life stage. Possible significance in L1 due to phenotype of cbp-1 mutation alone. (ANOVA one-way for each life stage, ***p<0.001)
These data show that canonical activators, CaMKK and CBP, do not play a significant role in neuroprotection in our model of nematode excitotoxicity, suggesting an alternative mechanism is at play.
2.3.5 Non-canonical activators, CaMKI/IV/AMPK/CRTC, mediate neuroprotection in excitotoxicity
Next we turned our attention to examine the possibility that a non-canonical mechanism of CREB activation involving a CaMKI/AMPK/CRTC cascade is important for protection against necrotic neurodegeneration (Figure 5). We first examined the role of CaMKI in neuroprotection; mammalian CaMKI and CaMKIV are very similar (Wayman et al. 2008), and they can activate CREB directly, through the canonical pathway, or indirectly through the non- canonical pathway. In the canonical pathway, mostly nuclear CaMKIV can activate CREB directly by its phosphorylation on S133. In the non-canonical pathway, mostly cytoplasmic
46 CaMKI activates CREB indirectly by its inhibition of SIK2/AMPK and thereby activation of
CRTC.
In C. elegans, CaMKI/IV is encoded by a single gene, cmk-1, that functions in both in the cytoplasm and nucleus (Eto et al. 1999), and can therefore play a role in either mechanism. In combining a deletion allele cmk-1(ok287) IV with glt-3;nuIs5, we find that the loss of cmk-1 significantly increases the levels of neurodegeneration (Figure 11) (ANOVA ***p<0.001).
10 glt-3;nuIs5 cmk-1;glt-3;nuIs5 9 8 *** 7
6 *** 5 *** ***
4 *** 3 2 1 Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A Developmental Stage N=31-39, ***p<0.001
Figure 11 CaMKI/IV/cmk-1 plays a role in excitotoxicity. A KO of cmk-1(ok287) in glt-3;nuIs5 shows a significant increase in neurodegeneration. (N=31-39, Error bars represent ±SEM, ANOVA ***p<0.001).
However, as nematode CMK-1 functions as both CaMKI and CaMKIV, and because the effect of CaMKI/IV KO would be expected to be neurodestructive in both scenarios (either because CREB is not activated by phosphorylation, or because CREB is not activated by CRTC, since unregulated SIK/AMPK over-inhibits CRTC), this result does not distinguish between the two models. Therefore we looked at molecules further downstream of CaMKI, and examine the role of SIK2 homolog, aak-2 (Lanjuin and Sengupta, 2002; Mair et al. 2011). It has been
47 suggested that SIK2 homolog, aak-2, works to phosphorylate and inhibit CRTC. Therefore, we hypothesized that SIK2/AMPK promotes cell death. Indeed, a loss of SIK2/AMPK (using aak-
2(ok524) X) resulted in a significant increase in neuroprotection (decreased neurodegeneration), across all life stages (Figure 12) (ANOVA one-way, ***p<0.001).
10 glt-3;nuIs5 9 glt-3;nuIs5;aak-2 8 7 6 *** 5 *** 4 *** *** 3 * 2 1 Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A Developmental Stage N=52-75, ***p<0.001
Figure 12 A KO of SIK2/aak-2 significantly decreases levels of neurodegeneration across all life stages. (N=50-70, Error bars SEM, ANOVA one-way ***p<0.001)
Finally, we examined the role of CRTC, whose activity and binding enhances CREB transcription. We examined the effect KO allele of CRTC, crtc-1(tm2869) I, on levels of neurodegeneration and found that the loss of CRTC significantly increases the levels of neurodegeneration (Figure 13) (***p<0.001) across each life stage.
48 10 glt-3;nuIs5 *** crtc-1;glt-3;nuIs5 9 8 *** 7 *** *** 6
5 *** 4 3 2 1 Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A Developmental Stage N=35-53, ***p<0.001
Figure 13 CRTC plays a crucial role in neuroprotection. Loss of CRTC under excitotoxicity significantly increases the levels of neurodegeneration. (N=32-53, SEM, ANOVA *p<0.05)
These results suggest that the non-canonical activation via the CaMK/AMPK/CRTC cascade is important in excitotoxicity-induced neuroprotection against necrosis.
2.3.6 CRTC/crtc-1 works in the same pathway and downstream of AMPK
The question still remained whether or not CaMK, AMPK, and CRTC function in the order suggested in Figure 5, or if the order is different in excitotoxicity. Furthermore,
SIK2/AMPK has also been suggested to function in a different pathway that could also affect neuroprotection: studies of nematode longevity suggested that the AMPK/AAK-2 functions upstream of, and inhibits CRTC activity (Mair et al. 2011), while studies in metabolism demonstrate that AMPK/AAK-2 works in a different pathway, to activate FOXO/daf-16 (Tullet et al. 2014). The second option is less likely in our model because we would expect loss of aak-2 to abrogate the neuroprotective effect of DAF-16 and further enhance neurodegeneration, in contrast to the neuroprotective effect that we see associated with the aak-2 KO. Nonetheless, to
49 address the issue of signaling pathways, we performed an epistatic analysis to test whether
SIK2/AAK-2 and CRTC work in the same or different pathways and whether SIK2/AMPK is upstream of CRTC in excitotoxicity. If AAK-2 and CRTC work in different pathways, we expect the combined elimination of both AAK-2 and CRTC (all in the nematode excitotoxicity background) to result in levels of neurodegeneration that are in between those of AAK-2 and
CRTC; in contrast, if AAK-2 and CRTC are in the same pathway we expect to see a combined mutant phenotype that corresponds only to the one where the most downstream factor is mutated
(in terms of neurodegeneration levels). In Figure 12 we showed decreased levels of neurodegeneration with a loss of aak-2, while in Figure 13 we show that a loss of CRTC significantly enhanced levels of neurodegeneration. We now observe that the combination of the two mutations, eliminating both CRTC and AAK-2 in glt-3;nuIs5 animals, resulted in a neurodegeneration phenotype similar to the levels of eliminating CRTC (Figure 14) (N > 30,
***p<0.001). This observation suggests that in excitotoxicity (similar to studies in longevity),
CRTC is epistatic to and works downstream of AMPK in a common excitotoxicity pathway.
Figure 14 Epistatic analysis shows that CRTC functions 10 glt-3;nuIs5 downstream of aak-2 in excitotoxicity. The 9 glt-3;nuIs5;aak-2 combination of crtc- 8 crtc-1;glt-3;nuIs5 1(tm2869) and aak-2(ok524) crtc-1;glt-3;nuIs5;aak-2 in excitotoxicity shows the 7 loss of CRTC phenotype 6 (N>30) ANOVA, no significance between crtc- 5 1;glt-3;nuIs5 and crtc-1;glt- 3;nuIs5;aak-2. 4 3 2
1 Avg Dying Head Neurons/Animal Head Dying Avg 0 L1 L2 L3 L4 A Developmental Stage N=31-35
50 2.3.7 CRTC is expressed in glr-1 expressing neurons
The activity and inactivity of CRTC depends on its phosphorylation state, which dictates its cellular localization (Screaton et al, 2004). Under basal conditions, CRTC is phosphorylated and sequestered by 14-3-3 proteins and is found in the cytoplasm. However, synaptic activity can cause dephosphorylation of CRTC and allow its nuclear translocation. We hypothesized that under excitotoxic conditions, CRTC would translocate to the nucleus more than in basal conditions. We used a strain expressing WT CRTC under its native promoter fused to RFP (Pcrtc-
1::WT CRTC::RFP) (Mair et al. 2011) and combined it with our excitotoxicity strain. Due to the small size of neurons and weak signal from CRTC::RFP, we did not succeed in quantifying the nucleocytoplasmic ratio of WT CRTC in individual neurons. However, it appears that under basal conditions, WT CRTC is expressed mostly in the cytoplasm under basal (WT) conditions.
Under excitotoxicity, however, WT CRTC appears to move into the nucleus in at least some of the glr-1-expressing neurons, as shown with arrows in the merged image (Figure 15). These images also show that that CRTC is expressed in the right place to protect these particular neurons in excitotoxicity.
Figure 15 CRTC is found in glr-1 expressing neurons. WT CRTC::RFP is expressed in glr-1 neurons and can therefore work to protect these neurons in excitotoxicity. Dashed outline indicates pharynx. Arrow heads indicate ‘empty’ nuclei emphasizing cytoplasmic CRTC expression; arrows in the merged image indicate nuclear CRTC expression in glr-1-expressing cells. (Confocal images, 63X objective)
51 2.3.8 Nonphosphorylatable (S76A, S179A) active CRTC is sufficient to induce neuroprotection
Thus far, our data suggest that CRTC is crucial for neuroprotection against excitotoxic necrosis. Figure 4 schematic shows that dephosphorylated CRTC is expected to be nuclear and therefore active, as it binds CREB’s bZip domain. As the loss of CRTC enhances neurodegeneration, we asked if over-activity of CRTC has the opposite effect. To test this, we first determined the effect of CRTC over-activity using a strain with an integrated transgene over-expressing WT CRTC (fused to RFP) under its native promoter (generally expression from a transgene results in over-expression; a chromosomally integrated construct ensures expression in all cells) (Mair et al. 2011). We found that overexpression of WT CRTC provided significant neuroprotection (N > 30, **p<0.01) (Figure 16). We further asked whether a non- phosphorylatable (which is therefore expected to be constitutively active and nuclear) CRTC would be enough to confer neuroprotection. To address this we used a strain containing an unphosphorylatable (S76A, S179A) CRTC (Mair et al. 2011). However, in this strain the transgene is extra-chromosomal, so that different cells contain or do not contain the transgene at random, and overall expression is expected to be lower than the integrated WT CRTC transgene overexpression. We crossed the (S76A, S179A) CRTC strain with glt-3;nuIs5. We show that although its expression is limited, the unphosphorylatable CRTC is (partially) sufficient to induce neuroprotection (Figure 16) (N > 30 each life stage, ANOVA ***p<0.001) to a level similar to that of the widely expressed WT CRTC.
52
8 rol-6;glt-3;nuIs5
7 glt-3;nuIs5; Is WT crtc-1;rol-6 glt-3;nuIs5; Ex NonPhosph crtc-1;rol-6
6 5 *** 4 * 3 **
2 ***
1
Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A
Developmental Stage N=30-62, ***p<0.001 Figure 16 Constitutively active, unphosphorylatable CRTC is sufficient to protect against neurodegeneration. (ANOVA two-way ***p<0.001)
2.3.9 CREB phosphorylation is not important in excitotoxicity-induced neuroprotection in
C. elegans
To this point, our data suggest that non-canonical CREB activation via CRTC is crucial for neuroprotection in our excitotoxicity model. However, the most distinguishing and crucial question remains about whether or not CREB phosphorylation is important for neuroprotection.
Phosphorylation of mammalian CREB at S133 (equivalent to S29 in CRH-1) is the main common target phosphorylation site for several kinases (often studied in canonical activation) and the definitive event in CREB activation in this model. To directly test this question, we tested the ability of WT or S29A phosphorylation mutant CRH-1 to rescue the neurodestructive effect of crh-1 KO in our excitotoxicity model. To that end, we created two constructs in which the promoter of glr-1 is driving the expression of WT or S29A phosphorylation mutant CRH-1.
Using extrachromosomal transgenes, we saw that the introduction of WT CREB into crh-1;glt-
3;nuIs5 worms partially but significantly rescued the levels of neurodegeneration towards the
53 levels of glt-3;nuIs5 (Figure 17). These data suggest that indeed CREB is responsible for neuroprotection, working cell-specifically in glr-1-expressing neurons. Most crucially, when we expressed mutant CREB (S29A), we found that mutant CREB rescues the levels of neurodegeneration to a level similar to that of WT CREB (Figure 14) (N>50 worms, each life stage, ANOVA two-way, ***p<0.001).
glt-3;nuIs5 crh-1;glt-3;nuIs5 10 crh-1;glt-3;nuIs5;Ex[crh-1(wt)] *** 9 crh-1;glt-3;nuIs5;Ex[crh-1(S29A)]
8
7 *** 6
5 *** *** 4
3 ***
2
Avg Dying Head Neurons/Animal Head Dying Avg 1
0
L1 L2 L3 L4 A Developmental Stage N=51-88, *p<0.001
Figure 17 CREB phosphorylation is not necessary for excitotoxicity-induced neuroprotection. Introducing WT CREB and phosphorylation mutant CREB significantly decreased the levels of neurodegeneration. ANOVA two-way, ***p<0.001)
Therefore, in contrast to previous studies, our data suggest that CREB phosphorylation at Ser29 is not necessary to protect against excitotoxic necrosis.
54 2.4 Conclusions and Discussion
Since its discovery, a uniform mechanism for CREB activation has been suggested, based on its phosphorylation in its transactivation domain, and was proposed to be operative in contexts such as response to environmental stimuli and cell proliferation outside the CNS, and in learning and memory and cell survival/neuroprotection in the CNS (Kandel 2001). However,
CREB’s functions are numerous and its expression is ubiquitous; these qualities make CREB a rather non-specific transcription factor. In combination with a uniformed activation mechanism it is not clear how CREB can activate different targets in different contexts. There are at least 300 ways activate by CREB phosphorylation. To address this issue, we performed an in-depth examination of the exact mechanism of CREB activation in a context-specific, excitotoxicity- induced neuroprotection, dividing CREB activation into two main categories: canonical versus non-canonical activation (Figure 5). Canonical activation involves the Ca2+/CaM activated cascade CaMKK/CaMKIV, resulting in CREB phosphorylation at S133 and CBP recruitment.
Studies showing this activation cascade include neuroprotection, synaptic activity and apoptotic- inducing stimuli among others. The non-canonical model involves activation of the cytoplasmic
CaMK/SIK2/CRTC cascade, with coactivator CRTC being crucial to directly binding and enhancing CREB’s activity. In spite of the vast body of data on the use of the canonical mechanism for CREB activation, the non-canonical mode of activation has been shown in recent years to be also important in synaptic plasticity, later stages of learning and memory, and
Huntington’s disease.
First, we established that CREB is crucial in neuroprotection in C. elegans (Figure 6) and therefore is a key conserved molecule with a conserved neuronal function across evolution. We
55 further asked which neuron types are most affected by the presence of CREB to relate it to the different susceptibility of neurons that die/survive in stroke models. It is possible that crh-1 could somehow inhibit apoptosis, however, when we block apoptosis, we see a slight increase in neurodegeneration (Del Rosario et al. 2014). In this latter case, it is possible that there could be additional glr-1 neurons. But, we see that sensory (URY) and motor (RMD) neurons die under regular excitotoxicity conditions, while CREB KO causes interneurons (AVA, AVB) to die more frequently (Figure 7).
The different susceptibility can be caused by differences in the levels of injury or levels of neuroprotection. Addressing a possible difference in protection levels, it is possible that the pattern of cell susceptibility that we see could be attributed to differences in the expression levels of CREB and/or CRTC in the postsynaptic cell. However, these two proteins are expressed in most head neurons at relatively low levels (Kimura et al. 2002). Very few neurons, like AFD,
ASE, AWC in thermosensation (Chen et al. 2016) AIM and SIA in memory (Lakhina et al.
2015) express higher levels of CREB; however, those expressing higher level are not the neurons that show differential susceptibility in our studies.
Addressing the possibility that the differential rates of neurodegeneration are caused by a difference in the level of injury, we consider the possibility that cells susceptible to death inherently express more GluRs. However, the study by Brockie and Maricq (Brockie et al,
2001) suggests that the interneurons (such as AVA, AVB, AVD, AVE), which do not die frequently, express the highest levels of GluRs. We also considered another potential mechanism, where CREB may function indirectly to reduce GluR expression levels and thus provides neuroprotection. Indeed, Moss et al. (2015) have recently shown that GluR activity causes CREB to acts to decrease glr-1 transcription, an effect that is mediated through the
56 canonical activation of CREB. However, we could not confirm this effect, because our behavioral studies (measuring spontaneous forward mobility and nose touch sensitivity) suggest the opposite, showing that crh-1 null exhibit decreased glr-1 activity (Figure 8) as reflected by an increased duration of spontaneous forward movement and reduced nose touch sensitivity.
Addressing another possible source for difference in injury levels, we note that neurons could also die more frequently as a result of an increased number of glutamatergic inputs (Choi and Rothman 1990). In C. elegans, the number of synaptic inputs (as counted in EM reconstruction of the nervous system) is suggested to serve as an indication on the strength of signaling between these neurons (Gray et al. 2005; Leinwand and Chalasani, 2013). However, using the information from WormWeb.org (Supplemental Table 1), we did not find a correlation between the proposed strength of glutamatergic synaptic inputs and the tendency to die of excitotoxicity: RMDs (which die at high rates) and AVA (which die at low rates) both have >200 Glutamatergic synaptic inputs; SMD (which die at high rates) and AVB, AVD, &
AVE (which die at low rates) both have >100 Glutamatergic synaptic inputs. Therefore, we do not think the number of Glutamatergic inputs is a likely explanation for the difference in susceptibility to excitotoxicity.
Upon further examination of our other lab studies, we postulate that the differences seen in the frequency of degeneration can be correlated to the levels of glutamate to which these neurons are exposed in the specific context of elimination of glt-3, a GluT expressed on the canal cell that regulates Glu concentration in body fluids (Mano et al. 2007). Considering this hypothesis, we note that the URY sensory neurons are exposed to higher levels of Glu in the glt-
3 KO mutant due to their exposure to the internal environment of the worm
(www.wormatlas.org), which has increased Glu concentrations as a result of the specific GluT
57 KO (KO glt-3) (Lee, Chan & Mano, submitted). The higher Glu concentrations from this KO are also found in the fluid between the pharynx and the nerve ring, a region of the nerve ring where the synapses of the RMD and SMD motor neurons are located. It is possible that all the motor neurons that could die, already died in excitotoxicity, and therefore the absence of CREB cannot exacerbate their cell death. In contrast, the lower probability of cell death seen in the command interneurons (AVA, AVB, AVD) may be because their synapses are located more laterally, not in the immediate vicinity of the high Glu-containing body fluids of the glt KO animal. It seems that a more mild exposure Glu in this GluT KO allows these neurons to benefit from an increased protection from CREB. Therefore, these neurons may be ‘salvageable’ and more strongly activate cell survival pathways. We acknowledge that the cell death pattern in Figure 7 is just a snapshot of cell death in L3; cells that have died in previous life stages have been cleared away. However, we see the most significant effect of neurodegeneration in L3, and therefore we superficially relate this as a potential core/penumbra pattern of cell death.
We next examined the mechanism of CREB activation. In vast majority of studies of
CREB, researchers showed that a phosphorylated CREB (at S133) recruited other factors to bind, such as CBP, a histone acetyltransferase (HAT) that can unpack DNA and allow transcription.
We did not find any support for a role for this mechanism in CREB activation in nematode excitotoxicity. We found that a mutant with a hyperactive CBP does not affect the levels of neurodegeneration (Figure 10). We also showed that CaMKK does not influence nematode excitotoxicity (Del Rosario et al. 2015) (Figure 9). Although CaMKK is not required for
CaMKIV activation, it greatly enhances the activity of CaMKIV, which results in CREB phosphorylation (Wayman et al. 2008; Takemoto-Kimura et al. 2017). Therefore the lack of
58 effect of both CBP and CaMKK disruption argues strongly against a significant participation of canonical CREB activation in excito-protection.
We then tested the roles of non-canonical activators CaMK/AMPK/CRTC. We found that the KO CaMKI/IV, encoded by a single nematode gene cmk-1, enhances neurodegeneration
(Figure 11). However, this result does not distinguish between the canonical and non-canonical pathways: eliminating the function of either CaMKI (cytoplasmic, working in the non-canonical pathways) or CaMKIV (nuclear, working in the canonical pathway to phosphorylate CREB), could result in this increase. The role of the SIK2 homolog aak-2 in promoting CRTC activity is conserved in our model and is a point of distinction between the two models (Figure 12). We further found that CRTC plays a significant and conserved role in neuroprotection (Figure 13) and works in the same pathway and downstream of aak-2, in excitotoxicity (Figure 14), similar to the arrangement seen in studies of longevity. Unlike studies of mammalian neurons (Nakatsu et al. 2010; Ch’ng et al. 2012) or nematode intestinal cells (Mair et al. 2011) the small size of our neurons prevented us from measuring nucleocytoplasmic ratios of CRTC under excitotoxicity. However, confocal images show that CRTC is mostly cytoplasmic in basal conditions (Figure 15), and shows more nuclear expression in excitotoxic condition. This data suggest that hyperactive CRTC is indeed capable of protecting the dying glr-1-expressing neurons.
A further aspect of context-specific activation of CREB could also be associated with differential recruitment of coactivators and a difference in epigenetic modification. In studies of learning and memory, Uchida et al. (2017) showed that there was a context-dependent shift in histone acetylation profiles, due to CRTC::CREB recruitment of KAT5 (histone acetylase) that replaces CBP (H3K12) modification. While an early recruitment of CBP causes H3K14
59 acetylation, the later recruitment of KAT5 leads to the alternative histone modification, with acetylation at H4K12. It is therefore possible that the same happens in excitotoxicity.
Looking more closely at the molecular changes, we note that in nematode excitotoxicity we have shown that both CRTC and CREB are crucial in neuroprotection, but CBP is not. CBP is known to bind to p-CREB in its transactivation domain, which may be needed to activate
CREB in the canonical way. Ser133 (in mammals) /Ser29 (in worms) is a conserved residue, the site for PKA and CaMK/cmk-1 phosphorylation (Kimura et al. 2002), in C. elegans. We performed the most direct test of the requirement for CREB phosphorylation by expressing phosphorylation mutant (Ser29Ala) in our excitotoxic model.
These pinnacle experiments show that CREB activation in excitotoxicity-induced neuroprotection is independent of its phosphorylation at Ser29 (Figure 17). Our finding supports our results that show that CBP does not play a role and the responsible CaMKI is probably acting in the cytoplasm as proposed by Kitagawa et al. 2011. Interestingly, the Murphy lab has recently found that crh-1 has several isoforms generated by alternative splicing. While the full length, canonical “a” isoform (which we used for rescue) is expressed in low levels in all cells, the “g” isoform is highly enriched and exclusively expressed in head and tail neurons; this particular isoform does not have a conserved S29 residue, but still retains part of its KID domain and its bZip domain, where CRTC binds (Kaletsky et al. 2017). This finding further supports the notion that multiple neuronal functions of CREB do not require its canonical phosphorylation.
Taken together, we have shown that in the context of excitotoxic necrosis, the non- canonical mechanism of CREB activation through CAMKI/AMPK/CRTC is necessary to confer neuroprotection. This neuroprotection is independent of CREB phosphorylation, shown previously to protect from apoptosis. These results are significant in that they propose an
60 alternative method of activation in excitotoxic necrosis, that is likely to result in a non-canonical epigenetic signature and transcriptional activation profile (which might be similar to those observed in late phases of learning consolidation). Although previous studies have examined downstream targets of CREB in apoptosis-inducing conditions, we suggest that a different set of genes is regulated in conditions of excitotoxic necrosis.
2.5 Materials and Methods
Strains
Strains were maintained at 20°C according to Brenner (Brenner 1974), and grown on MYOB agar plates seeded with OP50 (Stiernagle 2006). All the major new strains were constructed twice from independent crosses, and data were verified to be similar. Strains used: WT: Bristol
N2; Excitotoxicity strain: ZB1102: glt-3(bz34) IV; nuIs5 V (Mano & Driscoll 2009); crh-1:
YT17: crh-1(tz2) III (Kimura et al. 2002); age-1: TJ1052: age-1(hx546) II (Friedman & Johnson
1988); cbp-1 hyperactivity: MH2430: cbp- 1(ku258) III (Eastburn & Han 2005); cmk-1: VC220: cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V (Satterlee et al. 2004); aak-2: RB754: aak-
2(ok524) X (Apfeld et al. 2004); crtc-1: crtc-1(tm2869) I (Mair et al. 2011); rol-6: HE1006: rol-
6(su1006) II, WT CRTC labeled with RFP: AGD418: uthIs205[Pcrtc-1::crtc-1::RFP::unc-54
3'UTR; rol- 6(su1006)] (Mair et al. 2011) Unphosphorylatable CRTC: AGD466: uthEx222[Pcrtc-1::crtc-1 cDNA(S76A, S179A)::tdTomato::unc-54 3'UTR; rol-6(su1006)]
Glutamatergic behavioral negative control: VM1268: nmr-1(ak4) II; glr-2(ak10) glr-1(ky176)
III. Some strains were obtained from C. elegans Genetic Center (CGC), Japanese National
Bioresource Project (NBRP) or from the original creators. Strains created in this study: crh-1
61 in excitotoxicity (by crossing YT17 and ZB1102) IMN36: crh-1(tz2) III; glt-3(bz34) IV; nuIs5 V; age-1 in excitotoxicity (by crossing TJ1052 and ZB1102) IMN37: age-1(hx546) II; glt-3(bz34)
IV; nuIs5 V; age-1 and crh-1 epistasis in excitotoxicity (by crossing IMN36 and IMN37)
IMN38: age-1(hx546) II; crh-1(tz2) III; glt-3(bz34) IV; nuIs5 V; cbp in excitotoxicity (by crossing MH2430 and ZB1102) IMN39: cbp-1(ku528) III; glt-3(bz34) IV; nuIs5 V; cmk-1 in excitotoxicity (by crossing VC220 and ZB1102) IMN40: cmk-1(ok287) IV; glt-3(bz34) IV; nuIs5
V aak-2 in excitotoxicity (by crossing RB754 and ZB1102) IMN41: glt-3(bz34) IV; nuIs5 V; aak- 2(ok524) X; crtc in excitotoxicity (by crossing crtc-1(tm2869) I and ZB1102) IMN42: crtc-
1(tm2869) I; glt-3(bz34) IV; nuIs5 V; crtc & aak-2 epistasis in excitotoxicity (by crossing
IMN41 and IMN42) IMN43: crtc-1(tm2869) I; glt-3(bz34) IV; nuIs5 V; aak- 2(ok524) X; roller phenotype control in excitotoxicity (by crossing HE1006 and ZB1102) IMN44 rol-6(su1006) II; glt-3(bz34) IV; nuIs5 V; WT CRTC overexpression in excitotoxicity (by crossing AGD418 and
ZB1102): IMN45 glt-3(bz34) IV; nuIs5 V; uthIs205[Pcrtc-1::crtc-1::RFP::unc-54 3'UTR; rol-
6(su1006)]; unphosphorylatable CRTC overexpression in excitotoxicity: (by crossing AGD466 and ZB1102) IMN46: glt-3(bz34) IV; nuIs5 V; uthEx222[Pcrtc-1::crtc-1 cDNA (S76S,
S179A)::tdTomato::unc-54 3'UTR; rol-6(su1006)]; WT CREB rescue: IMN47 crh-1(tz2) III; glt-3(bz34) IV; nuIs5 V; Ex[Pglr-1::crh-1 cDNA::dsRed; Pmec-4::mCherry]; Phosphorylation mutant CREB rescue IMN48: crh-1(tz2) III; glt-3(bz34) IV; nuIs5 V; Ex[Pglr-1::S29A crh-1 cDNA::dsRed; Pmec-4::GFP].
Genotyping via PCR and gel Electrophoresis
All strains were confirmed homozygous using PCR, gel electrophoresis, fluorescence or sequencing. Transgene nuIs5 was followed by examining the GFP expression in the nerve ring and tail using fluorescence microscopy.
62 Neurodegenerative Quantification
Neurodegeneration was quantified according to Mano et al. (2009). A chunk of agar, of mixed- aged worms, was placed upside down on a thin microscope slide. The neurodegeneration was quantified using inverted Nomarski Differential Interference Contrast (DIC). The necrotic neurons swell to about twice their normal size and thus appear as ‘vacuolar-like’ structures. The nuIs5 transgene, expressed in glr-1-expressing cells, causes about 30 neurons to be susceptible to dying, whereas two tail neurons die by nuIs5 alone (Berger et al. 1995). According to Del
Rosario et al. (2015), this neurodegeneration is independent of apoptosis. Life stages were determined by vulval development. Sample size for each strain at each life stage is N > 30 worms. .
Fluorescence Microscopy
Agarose gel pads (2%) were created on microscope slides. L3 worms were picked and placed in a drop of M9 to prevent desiccation. For imaging, 2ul of 10 mM sodium azide (NaN3) was used to immobilize the ZB1102 (Excitotoxic strain) and AGD418 (WT CRTC RFP) worms. Images were taken using the 100X objective oil lens using the Multidimensional Acquisition tool on the
Metamorph platform. Images were examined using ImageJ (NIH) and deconvolved using
Autoquant X3.
Cell Identification
Our excitotoxic strain (glt-3;nuIs5) and crh-1;glt-3;nuIs5 were imaged with DIC and fluorescence microscopy (AxioZeiss) with 63X objective. The worms were imaged at the L3 life stage, some treated with 10 mM Sodium azide, but confirmed trend without the use of NaN3. To identify the degenerating neuron the location of GFP-labeled cell body and the shape of the neuron’s processes to known location and shape were compared to of glr-1–expressing neurons
63 (Brockie and Maricq 2001, WormBook.org). Confocal images were taken using a Zeiss microscope, LSM880; images were analyzed using Fiji (NIH ImageJ). For Figure 7a the degeneration frequency is equal to the number of dying neurons (i.e., URYDL/R) divided by the total number of URYDL/R that could die in the appropriate sample size. For Figure 7b values are the sum of dying neurons for each neuron type (i.e., sensory neurons) divided by the sum total of those neurons that could die.
Molecular Biology
Two pENTR Gateway vectors expressing wildtype CREB/crh-1 cDNA and a separate plasmid with a single point mutation making a phosphorylation mutant (S29A) crh-1 cDNA were obtained (a gift from Hidehito Kuroyanagi, Kimura et al. 2002). In addition, Vector KP#889 (P- glr-1::dsRed) (gift from the Kaplan and Juo labs, Kowalski et al. 2011) was used as the destination vector. Plasmids expressing Pmec-4::mCherry and Pmec-4::GFP (gifts from the Driscoll lab, Royal et al. 2005; Toth et al. 2012) were used as coinjection markers.
Plasmid Construction
Using pENTR Gateway vectors, WT crh-1 DNA was amplified using primers with BamHI sites on 5’ and 3’ ends. WT crh-1 and SA crh-1 cDNA were ligated into the KP#889 vector to create final vectors of Pglr-1:: WT crh-1 cDNA::dsRed and Pglr-1:: S29A crh-1 cDNA::dsRed.
Transformation
The plasmids were transformed according to normal heat-shock transformation procedures
(Hanahan 1983). Plasmids were sequenced using a 5’ primer
CTTCGTCTCGGTCACTTCACTTCG for the KP#889 promoter of glr-1.
Microinjection
Strain crh-1;glt-3;nuIs5 worms (L4 or Young Adult) were injected using established protocols.
64 A plasmid consisting of Pglr-1::WT crh-1 cDNA::dsRed, unc-54 3’UTR was injected at 100 ng/ul with coinjection marker Pmec-4::mCh1 (100 ng/ul). A second plasmid of Pglr-1::S29A crh-1 cDNA::dsRed, unc-54 3’UTR (50 ng/ul) was coinjected with Pmec-4::GFP (50ng/ul) into crh-
1;glt-3;nuIs5 worms. The worms were allowed to recover in M9 buffer and placed on freshly seeded agar plates. Transgenics were screened using fluorescence microscopy and two independent lines were maintained for each wildtype and mutant strains.
Behavioral Assays
Spontaneous mobility assays were performed according to Mellem et al. (2002), Brockie et al.
(2001), and Zheng et al. (1999). Worms were synchronized to the L4/YA stage, according to
Stiernagle 2006. Freely moving L4/YA worms were observed moving forward; timer was started when the worm initiated a forward movement and the timer was stopped when the worm initiated a backward movement. The assay was performed in three separate sessions and strains were coded (i.e., blinded study). The strains used were N2, nmr-1; glr-1 glr-2, crh-1, and crtc-1 single mutants. The averages and SEM were calculated for each strain with N = 90.
Nose Touch Assay (NOT) was performed according to Kaplan and Horvitz, (1993). The assay was performed by placing an eyelash hair in the path of a freely moving worm and recorded whether the worms responded to this obstacle by stopping or reversing their movement. We tested each worm three times. The strains were coded and assay was performed on three separate days with independent samples. From this we calculated the average percentage of animals that responded. The same strains were used in the spontaneous mobility assay.
65 Statistical analysis
Using SPSS software, Levene tests were performed to determine the heterogeneity of variances.
Dependent on this, if the data presented as normal, a one-way ANOVA and/or Tukey test was performed at each life stage. Data that presented with an unequal variance, the Bonnferoni or
Welch test were performed. For the behavioral assays, a Welch test was performed due to unequal variances.
2.6 Acknowledgements
I would like to thank Ayesha Chowdhury for her instrumental role in the CREB/DAF-16 experiments. I thank Jessica Becker for imaging and neuronal identification experiments. I thank
Ji-Sup Yang for performing the microinjections. N’Gina and Taqwa imaged the WT CRTC RFP strains. I would also like to thank Adanna Alexander, Miruna Ghinia-Tegla, and Diego
Buenaventura in the Emerson lab for discussion and help with the molecular biology. I thank various undergrads for help with PCRs and gels and help in strain creation. I would also like to thank labs of Monica Driscoll (for Pmec-4::mCherry and Pmec-4::GFP) and Hidehito Kuryonagi (for pENTR Gateway vectors with wildtype CRH-1 and mutant SA CRH-1 constructs), and Juo &
Kaplan labs for the plasmid KP#889 (Pglr-1::DsRED).
2.7 References
Antal M, Fukazawa Y, Eordogh M, Muszil D, Molnar E, et al. 2008. Numbers, densities, and colocalization of AMPA- and NMDA-type glutamate receptors at individual synapses in the superficial spinal dorsal horn of rats. J Neurosci 28: 9692-701 Apfeld J, O'Connor G, McDonagh T, DiStefano PS, Curtis R. 2004. The AMP-activated protein kinase AAK-2 links energy levels and insulin-like signals to lifespan in C. elegans. Genes Dev 18: 3004-9 Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94
66 Briand LA, Lee BG, Lelay J, Kaestner KH, Blendy JA. 2015. Serine 133 phosphorylation is not required for hippocampal CREB-mediated transcription and behavior. Learn Mem 22: 109-15 Brockie PJ, Mellem JE, Hills T, Madsen DM, Maricq AV. 2001. The C. elegans glutamate receptor subunit NMR-1 is required for slow NMDA-activated currents that regulate reversal frequency during locomotion. Neuron 31: 617-30 Brockie PJM, D.M.; Zheng, Y.; Mellem J.; Maricq, A.V. 2001. Differential Expression of Glutamate Receptor Subunits in the Nervous System of Caenorhabditis elegans and Their Regulation by the Homeodomain Protein UNC-42. The Journal of neuroscience : the official journal of the Society for Neuroscience 21: 1510-22 Ch'ng TH, Uzgil B, Lin P, Avliyakulov NK, O'Dell TJ, Martin KC. 2012. Activity-dependent transport of the transcriptional coactivator CRTC1 from synapse to nucleus. Cell 150: 207-21 Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, et al. 2016. A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling. Dev Cell 39: 209-23 Choi DW, Rothman SM. 1990. The role of glutamate neurotoxicity in hypoxic-ischemic neuronal death. Annu Rev Neurosci 13: 171-82 Cohen S, Greenberg ME. 2008. Communication between the synapse and the nucleus in neuronal development, plasticity, and disease. Annu Rev Cell Dev Biol 24: 183-209 Conkright MD, Canettieri G, Screaton R, Guzman E, Miraglia L, et al. 2003. TORCs: transducers of regulated CREB activity. Molecular Cell 12: 413-23 Del Rosario JS, Feldmann KG, Ahmed T, Amjad U, Ko B, et al. 2015. Death Associated Protein Kinase (DAPK) -mediated neurodegenerative mechanisms in nematode excitotoxicity. BMC Neurosci 16: 25 Eastburn DJ, Han M. 2005. A gain-of-function allele of cbp-1, the Caenorhabditis elegans ortholog of the mammalian CBP/p300 gene, causes an increase in histone acetyltransferase activity and antagonism of activated Ras. Mol Cell Biol 25: 9427-34 Friedman DB, Johnson TE. 1988. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics 118: 75-86 Gray JM, Hill JJ, Bargmann CI. 2005. A circuit for navigation in Caenorhabditis elegans. Proc Natl Acad Sci U S A 102: 3184-91 Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557-80 Hansen KB, Yi F, Perszyk RE, Menniti FS, Traynelis SF. 2017. NMDA Receptors in the Central Nervous System. Methods Mol Biol 1677: 1-80 Hardingham GE, Bading H. 2002. Coupling of extrasynaptic NMDA receptors to a CREB shut- off pathway is developmentally regulated. Biochim Biophys Acta 1600: 148-53 Hardingham GE, Bading H. 2010. Synaptic versus extrasynaptic NMDA receptor signalling: implications for neurodegenerative disorders. Nat Rev Neurosci 11: 682-96 Hart AC, Sims S, Kaplan JM. 1995. Synaptic code for sensory modalities revealed by C. elegans GLR-1 glutamate receptor. Nature 378: 82-5 Ikonomidou C, Turski L. 2002. Why did NMDA receptor antagonists fail clinical trials for stroke and traumatic brain injury? Lancet Neurol 1: 383-6
67 Jeong H, Cohen DE, Cui L, Supinski A, Savas JN, et al. 2011. Sirt1 mediates neuroprotection from mutant huntingtin by activation of the TORC1 and CREB transcriptional pathway. Nat Med 18: 159-65 Kaletsky R, Yao V, Williams A, Runnels AM, King SB et al. 2017. Transcriptome analysis of adult C. elegans cells reveals tissue-specific gene and isoform expression. bioRxiv doi: https://doi.org/10.1101/232728. Kandel ER. 2001. The molecular biology of memory storage: a dialogue between genes and synapses. Science 294: 1030-8 Kaplan JM, Horvitz HR. 1993. A dual mechanosensory and chemosensory neuron in Caenorhabditis elegans. Proc Natl Acad Sci U S A 90: 2227-31 Kaufman AM, Milnerwood AJ, Sepers MD, Coquinco A, She K, et al. 2012. Opposing roles of synaptic and extrasynaptic NMDA receptor signaling in cocultured striatal and cortical neurons. J Neurosci 32: 3992-4003 Kharazia VN, Phend KD, Rustioni A, Weinberg RJ. 1996. EM colocalization of AMPA and NMDA receptor subunits at synapses in rat cerebral cortex. Neurosci Lett 210: 37-40 Kimura Y, Corcoran EE, Eto K, Gengyo-Ando K, Muramatsu MA, et al. 2002. A CaMK cascade activates CRE-mediated transcription in neurons of Caenorhabditis elegans. EMBO Rep 3: 962-6 Kovacs KA, Steullet P, Steinmann M, Do KQ, Magistretti PJ, et al. 2007. TORC1 is a calcium- and cAMP-sensitive coincidence detector involved in hippocampal long-term synaptic plasticity. Proc Natl Acad Sci U S A 104: 4700-5 Kowalski JR, Dahlberg CL, Juo P. 2011. The deubiquitinating enzyme USP-46 negatively regulates the degradation of glutamate receptors to control their abundance in the ventral nerve cord of Caenorhabditis elegans. J Neurosci 31: 1341-54 Lai TW, Zhang S, Wang YT. 2014. Excitotoxicity and stroke: identifying novel targets for neuroprotection. Prog Neurobiol 115: 157-88 Lakhina V, Arey RN, Kaletsky R, Kauffman A, Stein G, et al. 2015. Genome-wide functional analysis of CREB/long-term memory-dependent transcription reveals distinct basal and memory gene expression programs. Neuron 85: 330-45 Leinwand SG, Chalasani SH. 2013. Neuropeptide signaling remodels chemosensory circuit composition in Caenorhabditis elegans. Nat Neurosci 16: 1461-7 Lonze BE, Ginty DD. 2002. Function and regulation of CREB family transcription factors in the nervous system. Neuron 35: 605-23 MacGillavry HD, Hoogenraad CC. 2015. The internal architecture of dendritic spines revealed by super-resolution imaging: What did we learn so far? Exp Cell Res 335: 180-6 Mair W, Morantte I, Rodrigues AP, Manning G, Montminy M, et al. 2011. Lifespan extension induced by AMPK and calcineurin is mediated by CRTC-1 and CREB. Nature 470: 404- 8 Mano I, Driscoll M. 2009. Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity. Journal of neurochemistry 108: 1373-84 Mano I, Straud S, Driscoll M. 2007. Caenorhabditis elegans glutamate transporters influence synaptic function and behavior at sites distant from the synapse. The Journal of biological chemistry 282: 34412-9 Mayr B, Montminy M. 2001. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nature reviews. Molecular cell biology 2: 599-609
68 Mellem JE, Brockie PJ, Zheng Y, Madsen DM, Maricq AV. 2002. Decoding of polymodal sensory stimuli by postsynaptic glutamate receptors in C. elegans. Neuron 36: 933-44 Nakatsu Y, Sakoda H, Kushiyama A, Ono H, Fujishiro M, et al. 2010. Pin1 associates with and induces translocation of CRTC2 to the cytosol, thereby suppressing cAMP-responsive element transcriptional activity. J Biol Chem 285: 33018-27 Newpher TM, Ehlers MD. 2008. Glutamate receptor dynamics in dendritic microdomains. Neuron 58: 472-97 Nonaka M, Fujii H, Kim R, Kawashima T, Okuno H, Bito H. 2014. Untangling the two-way signalling route from synapses to the nucleus, and from the nucleus back to the synapses. Philos Trans R Soc Lond B Biol Sci 369: 20130150 Ordy JM, Wengenack TM, Bialobok P, Coleman PD, Rodier P, et al. 1993. Selective vulnerability and early progression of hippocampal CA1 pyramidal cell degeneration and GFAP-positive astrocyte reactivity in the rat four-vessel occlusion model of transient global ischemia. Exp Neurol 119: 128-39 Parra-Damas A, Chen M, Enriquez-Barreto L, Ortega L, Acosta S, et al. 2017. CRTC1 Function During Memory Encoding Is Disrupted in Neurodegeneration. Biol Psychiatry 81: 111- 23 Pellegrini-Giampietro DE, Zukin RS, Bennett MV, Cho S, Pulsinelli WA. 1992. Switch in glutamate receptor subunit gene expression in CA1 subfield of hippocampus following global ischemia in rats. Proc Natl Acad Sci U S A 89: 10499-503 Pulsinelli WA. 1985. Selective neuronal vulnerability: morphological and molecular characteristics. Prog Brain Res 63: 29-37 Royal DC, Bianchi L, Royal MA, Lizzio M, Jr., Mukherjee G, et al. 2005. Temperature-sensitive mutant of the Caenorhabditis elegans neurotoxic MEC-4(d) DEG/ENaC channel identifies a site required for trafficking or surface maintenance. J Biol Chem 280: 41976- 86 Sasaki T, Takemori H, Yagita Y, Terasaki Y, Uebi T, et al. 2011. SIK2 is a key regulator for neuronal survival after ischemia via TORC1-CREB. Neuron 69: 106-19 Satterlee JS, Ryu WS, Sengupta P. 2004. The CMK-1 CaMKI and the TAX-4 Cyclic nucleotide- gated channel regulate thermosensory neuron gene expression and function in C. elegans. Curr Biol 14: 62-8 Screaton RA, Conkright MD, Katoh Y, Best JL, Canettieri G, et al. 2004. The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector. Cell 119: 61- 74 Serrano-Saiz E, Poole RJ, Felton T, Zhang F, De La Cruz ED, Hobert O. 2013. Modular control of glutamatergic neuronal identity in C. elegans by distinct homeodomain proteins. Cell 155: 659-73 Stiernagle T. 2006. Maintenance of C. elegans. WormBook: 1-11 Takemori H, Kajimura J, Okamoto M. 2007. TORC-SIK cascade regulates CREB activity through the basic leucine zipper domain. FEBS J 274: 3202-9 Takemoto-Kimura S, Suzuki K, Horigane SI, Kamijo S, Inoue M, et al. 2017. Calmodulin kinases: essential regulators in health and disease. J Neurochem 141: 808-18 Thomas CG, Miller AJ, Westbrook GL. 2006. Synaptic and extrasynaptic NMDA receptor NR2 subunits in cultured hippocampal neurons. J Neurophysiol 95: 1727-34
69 Toth ML, Melentijevic I, Shah L, Bhatia A, Lu K, et al. 2012. Neurite sprouting and synapse deterioration in the aging Caenorhabditis elegans nervous system. J Neurosci 32: 8778- 90 Tullet JM, Araiz C, Sanders MJ, Au C, Benedetto A, et al. 2014. DAF-16/FoxO directly regulates an atypical AMP-activated protein kinase gamma isoform to mediate the effects of insulin/IGF-1 signaling on aging in Caenorhabditis elegans. PLoS Genet 10: e1004109 Uchida S, Teubner BJ, Hevi C, Hara K, Kobayashi A, et al. 2017. CRTC1 Nuclear Translocation Following Learning Modulates Memory Strength via Exchange of Chromatin Remodeling Complexes on the Fgf1 Gene. Cell Rep 18: 352-66 von Engelhardt J, Coserea I, Pawlak V, Fuchs EC, Kohr G, et al. 2007. Excitotoxicity in vitro by NR2A- and NR2B-containing NMDA receptors. Neuropharmacology 53: 10-7 Walton MR, Dragunow I. 2000. Is CREB a key to neuronal survival? Trends Neurosci 23: 48-53 Wayman GA, Lee YS, Tokumitsu H, Silva AJ, Soderling TR. 2008. Calmodulin-kinases: modulators of neuronal development and plasticity. Neuron 59: 914-31 Wroge CM, Hogins J, Eisenman L, Mennerick S. 2012. Synaptic NMDA receptors mediate hypoxic excitotoxic death. J Neurosci 32: 6732-42 Zhang SJ, Buchthal B, Lau D, Hayer S, Dick O, et al. 2011. A signaling cascade of nuclear calcium-CREB-ATF3 activated by synaptic NMDA receptors defines a gene repression module that protects against extrasynaptic NMDA receptor-induced neuronal cell death and ischemic brain damage. J Neurosci 31: 4978-90 Zhang SJ, Zou M, Lu L, Lau D, Ditzel DA, et al. 2009. Nuclear calcium signaling controls expression of a large gene pool: identification of a gene program for acquired neuroprotection induced by synaptic activity. PLoS Genet 5: e1000604 Zhang X, Odom DT, Koo SH, Conkright MD, Canettieri G, et al. 2005. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc Natl Acad Sci U S A 102: 4459-64
70 2.8 Supplemental
0.15 nuIs5 (N=26)
0.10
0.05 Degeneration Frequency
0.00
AVG AIBL/R RIML/R RMDL/R AVAL/RAVEL/RAVBL/RAVDL/RRIGL/R URYDL/RURYVL/R RMDDL/RRMDVL/RSMDDL/RSMDVL/R Individual Neurons
Supplemental Figure 2 Degeneration frequency of individual neurons in nuIs5 animals. Error bars represent SEM, N=26 worms.
71
Supplemental Table 1: Counting glutamatergic inputs to glr-1 expressing neurons. Synapse numbers based on WormAtlas.org, Wormweb.org/neuralnet, glutamatergic identification based on Serrano-Saiz et al, 2013.
Neuron Glutamatergic Presynaptic Cells (# of Synapses) Total Sensory Neurons URYs IL1(2); OLL(2) 3 Motor Neurons RMDs ALM(2); IL1(56); OLL(26); OLQ(15); RIA(105); RIM(6); URY(34) 244 SMDs ADA(4); AIB(8); AIZ(1); OLL(19); RIA(69); RIM(12); URY(14) 127 Interneurons ADA(3); ADL(7); AIB(3); AQR(5); ASH(7); AUA(4); AWC(1); BAG(4); DVC(12); FLP(48); LUA(21); PHB(29); PHC(1); PLM(5); AVAs PQR(19); PVD(27); RIM(3); URY(1) 200 ADA(2); AIB(1); AIM(1); AIZ(11); ALM(1); ASH(3); AUA(7); AVEs BAG(9); FLP(6); IL1(4); OLL(37); RIG(5); URY(17) 104 ADA(5); ADL(18); AIN(2); AIZ(21); ASE(23); ASG(5); ASH(8); AIBs ASK(2); AWC(7); BAG(1); DVC(4); FLP(5); RIM(4) 105 ADA(18); ADL(7); AIB(8); AIM(2); AQR(7); ASH(9); AVM(12); AVBs DVC(1); FLP(15); PVQ(1); PVR(8); RIM(12); URY(1) 101 ADA(1); ADL(12); AIM(3); ALM(1); AQR(2); ASH(12); AUA(1); AVDs FLP(30); LUA(10); PHA(1); PHB(3); PLM(5); PQR(13) 94 RIMs ADA(8); AIB(32); AIZ(8); ASH(1) 49 RIGL/R AIB(1); AIZ(1); BAG(10); DVC(10) 22 Other AVG PHA(8); PQR(1) 9
72 Chapter 3
Examining the possible collaboration of CREB with transcription factor
FOXO/daf-16 and downstream targets of CREB/crh-1 in Neuroprotection
3.1 Abstract
Excitotoxicity is a major cause of neuronal damage and an underlying cause of neurodegenerative diseases. Hyperstimulation of GluRs is the cause of excitotoxicity, but treatment with GluR antagonists in clinical trials failed. These studies and others demonstrated that Glu can activate cell death as well as cell survival/neuroprotective pathways. One of those neuroprotective pathways results in activation of transcription factor CREB. However, transcription factors tend to work together in synergy to provide more specific and perhaps more potent responses. Therefore, we examined the potential cooperation of CREB with another neuroprotective transcription factor, FOXO/DAF-16. We hypothesize that CREB and DAF-16 converge to confer neuroprotection against excitotoxicity. In addition, we hypothesize further that their most highly regulated, common downstream targets may be the most effective genes for therapeutic intervention. We found using both genetic and pharmacological means that
CREB and DAF-16 work in parallel pathways but might still converge to mitigate neurodegeneration in excitotoxic conditions. An initial analysis of a few potential co-regulated genes is now in progress. The collaboration of these two transcription factors may further enhance the transcriptional response in excitotoxicity.
73 3.2 Introduction
In Chapter 2, we found that a non-canonical mechanism of CREB is important in neuroprotection against excitotoxic necrosis and suggest that its specific mechanism of activation is important to tailor the transcriptional response to excitotoxicity. However, for a more specific
CREB may work together with other transcription factors to confer specificity (Figure 18).
FOXO/DAF-16 is another neuroprotective transcription factor, which is activated upon inhibition of the IGF/Insulin Signaling Pathway. The insulin signaling pathway is important in modulating longevity (Murphy et al. 2003) and in excitotoxic neuroprotection in the nematode
(Mojsilovic-Petrovic et al. 2009; Tehrani et al. 2014). When the insulin pathway is active, this leads to the activation of PI3K/age-1, which then phosphorylates PIP2 to PIP3 and allows membrane recruitment and activation of AKT. AKT phosphorylates FOXO, causing its cytoplasmic retention (and therefore effectively inhibits its activity) via phosphorylation (Figure
18). In contrast, inhibition of the insulin pathway, i.e., inhibiting age-1, leads to the activation and nuclear translocation of DAF-16, as shown using genetic and pharmacological techniques.
Figure 18 Schematic of the possible collaboration of CREB and FOXO/DAF-16. AKT may crosstalk with CREB pathway to confer neuroprotection.
74 However, it is not clear if CREB and FOXO/DAF-16 control separate but additive/synergistic excito-protective pathways, or whether they function in a linear single pathway, as commonly proposed in mammalian studies that showed CREB phosphorylation by
Akt (Du and Montminy 1998). These studies were performed in collaboration with Ayesha
Chowdhury, a PhD student in our lab. One can examine the insulin cascade activity using genetic or even pharmacological approaches, such as employing the use of PI3K/age-1 antagonist LY294002 (Babar et al. 1999). It is therefore important to determine if CREB and
FOXO work in a unified, or parallel but interacting, pathways: If these two factors do indeed work in parallel pathways, then the common downstream targets may grant enhanced specificity of response in neuroprotection.
3.2.1 An examination of previously reported downstream genes regulated by both CREB and DAF-16 shows common targets that might be good candidate neuroprotective genes
Several previous studies have looked at downstream targets of CREB in mammalian and nematode models. Most of the mammalian studies looked at CREB targets relative to synaptic activity (Benito et al. 2011) and/or conditions that induce apoptosis (common targets such as
BDNF and PGC1) (Ghosh et al. 1994; Hardingham et al. 2002; Tan et al. 2012). However, no studies have looked at downstream targets in excitotoxic necrosis. In mammalian studies, FOXO is considered to be neurodestructive, though the effect was tested on the ability of mild NMDA stimulation to prevent apoptosis, not on Glu-induced necrosis (Soriano et al. 2006). We are not aware of an analysis of mammalian FOXO targets in excitotoxic neuroprotection.
In C. elegans, there are few studies in C. elegans examining CREB downstream targets in starvation and lifespan/longevity (Murphy et al. 2003; Mair et al. 2011) (though CREB’s role in
75 longevity) has been recently contested (Lakhina et al. 2015). There are also transcriptome studies that provide an in-depth look into CREB downstream targets in short-term associative memory (STAM), and longterm associative memory (LTAM) (Lakhina et al. 2015; Freytag et al.
2017) as well as studies examining downstream targets of DAF-16 (Kaletsky et al. 2016). Put together, these studies produced lists of target genes, in which some genes are differentially expressed in both conditions. By examining these lists, we found a few interesting potential common downstream targets that may be regulated in excitotoxicity. The theoretical common downstream targets of CREB & DAF-16 list includes but is not limited to genes involved in calcium signaling, cell death, fatty acid synthesis, and glutamine/glutamate signaling-related molecules. Importantly, the authors note that downstream targets found in basal conditions may or may not be enriched in STAM or LTAM and that the targets found in basal conditions are mainly expressed in nonneuronal tissues (Lakhina et al. 2015), further suggesting that CREB can cater its transcriptional response depending on context and even exhibit tissue-specificity.
3.2.2 Priority of Genes to examine in our study of candidate neuroprotective genes using qRT-PCR
While we are mostly interested in genes that share regulation patterns in excitotoxicity (a project that is now ongoing, led by a new member of our lab), we start by examining available information about common targets of CREB & DAF-16 in normal conditions (Supplementary
Table 2). We compared the lists of downstream targets of CREB and DAF-16 and prioritized a few genes to be tested. We are in the process of testing their mRNA expression levels using RT- qPCR, comparing the following conditions: wildtype, nuIs5, excitotoxicity, excitotoxicity in the absence of CREB (crh-1;glt-3;nuIs5, and age-1;glt-3;nuIs5 (active DAF-16). Examining the list
76 of candidate co-regulated genes (Supplementary Table 2) we focus on a few that seem potentially interesting. These genes include: dct-5 which is a zinc-finger transcription factor, acs-
1 which is important in fatty acid synthesis enzyme, and F13H8.5 which contains a Q/N-rich domain and is similar to pqn-41 (Michelitsch and Weissman, 2000).
a) The gene dct-5 (F07F6.5, chr II) is a DAF-16/FOXO Controlled germline Tumor-
affecting gene, and therefore participates in cell death decisions. It was originally
found in a microarray study of DAF-16 targets involved in longevity (Murphy and
Kenyon 2003) and a direct DAF-16 target found in ChIP studies (Oh et al. 2006).
dct-5 encodes a zinc-finger transcription factor (Pinkston-Gosse and Kenyon, 2007)
which is important for tumor suppression; its zinc finger domain is homologous to
human ovarian zinc-finger protein domain (HOZFP) in humans. dct-5 showed
increased expression in daf-16(mu86) mutants, but its expression can be differentially
regulated in a context-dependent manner (Pinkston-Gosse and Kenyon, 2007).
Additionally, dct-5 is a downstream target of CREB and its expression increases four-
fold in crh-1 null mutants (Mair et al. 2011) and five-fold in CREB-
induced/Longterm Associative Memory (LTAM) studies (Lakhina et al. 2015, 2017).
Therefore, dct-5 is a cell-fate determining gene and a common downstream target that
is normally inhibited by both DAF-16 and CREB, and may therefore play a role in
excitotoxicity.
b) Another gene of interest is acs-1, an ortholog of hACSF2, and a member of the fatty
acid CoA Synthetase family of mitochondrial fatty acid synthesizing enzymes. acs-1
is important in fatty acid biosynthesis and plays a role in metabolism, development
(Zhang et al. 2011) and lipid storage among other functions. In metabolism studies
77 the mammalian enzyme was shown to regulate and physically interact with-p53 and
play a role in apoptosis (Lee et al. 2009). acs-1 is expressed in the nervous system in
addition to the intestine and somatic gonad. Importantly, it has a malate
dehydrogenase (MDH) binding domain; human MDH has been found to be mutated
in three major neurodegenerative disorders: AD, PD, and ALS (Recabarren and
Alarcon 2017). Not only is acs-1 downstream of both DAF-16 and CREB, both of
these transcription factors downregulate its expression in lifespan and LTAM studies,
respectively (Pinkston-Gosse and Kenyon 2007; Oh et al. 2007; Lakhina et al. 2015;
Mair et al. 2011). Given the extensive involvement of mitochondria and metabolic
pathways in excitotoxic neurodegeneration (Galluzzi et al. 2009; Yang and Stockwell
2016; Dawson and Dawson 2017; Bakthavachalam and Shanmugam 2017),
examining the link between metabolism and neurodegeneration could provide
interesting insights into future treatments or perhaps suggest a link of metabolic
misregulation to susceptibility of degeneration.
c) A range of neurodegenerative diseases (that involve excitotoxicity as part of their
pathology) can be caused by expansion of naturally occurring CAG trinucleotide
repeats which encode glutamine (Q) or glutamine (Q) & asparagine (N), also denoted
polyQ (Paulson 2018). The expansion of the normally occurring short polyQ
sequence to a very long polyQ stretch, significantly affects the proteins in which these
sequences fail and cause aggregation, thereby inducing neurodegeneration. PolyQ
expansion is seen in Huntington’s disease and spinocerebellar ataxia (SCA), among
others diseases (Paulson 2018). We do not understand the mechanism of pathology in
these diseases, and the increased vulnerability of specific subgroups of neurons to
78 these toxic proteins. Although there are several polyQ (pqn)-containing genes in C.
elegans, a pqn-41-like protein (F13H8.5 on Chr II) is of particular interest. F13H8.5
is a member of the protein phospholipase family and contains a Q/N rich domain
(Michelitsch and Weissman 2000). F13H8.5 is activated by both DAF-16 (increased
100-fold in daf-2 mutants) (Kaletsky et al 2016) and CREB (increase two-fold in crh-
1 nulls) (Murphy et al. 2003; Mair et al, 2011; Lakhina et al. 2015). In addition,
F13H8.5 family member pqn-41 is important in linker cell death, works cell
autonomously, and exhibits a non-apoptotic form of cell death (Blum et al. 2012).
Therefore, it is possible that F13H8.5, as a Q/N domain containing protein, may play
a role in excitotoxic necrosis.
We suggest that examining common downstream targets of both neuroprotective transcription factors, CREB and DAF-16, specifically in excitotoxicity, will help elucidate genes that are most important for neuronal protection, against excitotoxicity. Our study tests a minute fraction of common targets and really serves as an initial or pilot investigation into the gene regulation of CREB and DAF-16 specifically in excitotoxic necrosis. However addressing this hypothesis is also important because CREB and DAF-16 both can activate gene programs in a context-dependent manner (Pinkston-Gosse and Kenyon, 2007; Lakhina et al. 2015) and may exert effects on the same genes in neuroprotection.
3.3 Results
3.3.1 CREB and DAF-16 corroborate to confer neuroprotection in nematode excitotoxicity
Previous studies, including our own, have shown the effects of CREB and DAF-16 on neuroprotection, separately. There are studies showing that Akt (part of the insulin pathway) can
79 also work through CREB and circumvent the need to work directly on DAF-16, at least in metabolic processing. However, since both CREB and DAF-16 are neuroprotective, we hypothesize that these two transcription factors work in separate pathways but converge to confer neuroprotection. To test this hypothesis, we used both genetic and pharmacological approaches. We exposed both glt-3;nuIs5 and crh-1;glt-3;nuIs5 worms to a potent chemical
PI3K/age-1 inhibitor LY294002 (10 mM in solvent) (Figure 19). We showed in Figure 6 that the absence of CREB enhanced levels of neurodegeneration, whereas a PI3K/age-1 mutation in excitotoxicity mitigates neurodegeneration (Mojsilovic-Petrovic et al. 2009).
glt-3;nuIs5 + Solvent crh-1;glt-3;nuIs5 + Solvent 8 glt-3;nuIs5 + LY294002 crh-1;glt-3;nuIs5 + LY294002 Figure 19 CREB and 7 DAF-16 work in parallel *** pathways and converge 6 to confer neuroprotection. 5 Pharmacological inhibition of PI3K/age-1, 4 at the L3 stage, shows an additional decrease in *** (L3 Stage) 3 neurodegeneration in crh-1 mutants in 2 excitotoxicity. N>30 worms. (ANOVA two- way ***p <0.001) 1 Avg Dying Head Neurons/Animal Head Dying Avg 0
+ Solvent CREB KO
+ Active DAF-16 glt-3;nuIs5
glt-3;nuIs5 CREB KO + Active DAF-16
If CREB and DAF-16 work in the same pathway, we would expect that the additional inhibition of insulin signaling would not have an effect on CREB mutants (because CREB is proposed to be downstream in the combined pathway); in contrast, if these factors work in two
80 separate but parallel pathways we expect that even in the absence of CREB, enhanced DAF-16 activity will decrease the levels of neurodegeneration. Our pharmacological study (where control treatment is with solvent only) demonstrated that indeed inhibiting AGE-1 with an antagonist reduced neurodegeneration even in the absence of CRH-1. To strengthen this result, we constructed the double mutant crh-1 and age-1 in the background of glt-3;nuIs5. Similar to the results of the pharmacological approach, we found that even in the absence of CREB, age-1 mutation that should activate DAF-16 significantly reduces levels of neurodegeneration (Figure
20).
*** glt-3;nuIs5 10 *** age-1;glt-3;nuIs5 9 crh-1;glt-3;nuIs5 8 age-1;crh-1;glt-3;nuIs5 7 6 *** *** 5 4 ** 3 2 1 Avg Dying Head Neurons/Animal Head Dying Avg 0
L1 L2 L3 L4 A Developmental Stage N=34-39, ***p<0.001
Figure 20 Epistatic analysis of combining mutations crh-1 and age-1 in excitotoxicity show that an active DAF-16 (age-1 mutants) confers additional neuroprotection in excitotoxicity. (N>30 worms, each life stage, ANOVA two-way, each life stage *p<0.05, **p<0.01, ***p<0.001).
Taken together these results suggest that CREB and DAF-16 work in separate but parallel pathways to confer neuroprotection.
The CREB and DAF-16 transcription factors exert their effects through regulation of gene transcription. We wanted to monitor changes in the expression level of mRNAs from specific
81 candidate genes. To increase the specificity of our analysis (Lakhina et al. 2015), we decided to harvest RNA specifically from glr-1 –expressing neurons (which are at risk of neurodegeneration). To that end we wanted to dissociate L3 animals into individual cells and isolate only glr-1 –expressing neurons.
The CREB and DAF-16 transcription factors exert their effects through regulation of gene transcription. In collaboration with Zelda Mendelowitz (a new PhD student in our lab), we sorted glr-1-expressing (GFP+) cells from glt-3;nuIs5, age-1;glt-3;nuIs5, and crh-1;glt-3;nuIs5
L3 worms. We examined the relative gene expression of our three initial candidate genes (acs-1, dct-5, and F13H8.5) using qRT-PCR on RNA preps from sorted neurons. We normalized relative expression levels to the housekeeping gene, lmn-1 (Figure 21). We computed ΔΔCt values from the Ct (cycle threshold) values of experimental and control genes, to indicate fold change.
The results are very preliminary and are brought here only as a tentative indication that this experiment can be performed if all the technical difficulties are ironed out. From parallel experiments performed by Zelda we found out that our sorting is successful: the relative expression of glr-1 in sorted cells vs. total cell prep jumped by 170 fold. This is reasonable, because our target neurons (30 neurons per a 1,000 cells animal) constitute 3% of the total cell number, and because the neurons are much smaller than other cells that are likely to contain much more RNA. Furthermore we found that when normalized to the lmn-1 control, expression of dct-5 goes down upon excitotoxicity (comparing N2 vs glt-3;nuIs5), remains low when DAF-
16-mediated protection is added (age-1 mutation), and increased over 3000-fold when CREB is eliminated.
82 120
) 100
glr-1
lmn-1 80 acs-1 dct-5 0.03 F13H8.5
0.02 (normalized to
Relative Gene Expression 0.01
0.00
N2
glt-3;nuIs5
age-1;glt-3;nuIs5 crh-1;glt-3;nuIs5
Figure 21 Relative gene expression of glr-1, acs-1, dct-5 and F13H8.5. dct-5 shows 3000-fold increase compared to control.
Although other changes in gene expression do not show differences in (Figure 21), the other comparisons show that glr-1 increases by 70-fold in age-1;glt-3;nuIs5, and 9000-fold in crh-1;glt-3;nuIs5 compared to N2 (Table 1). We also see that acs-1 and F13H8.5 are highly regulated in age-1 mutants and in the absence of crh-1. In our initial investigation it appears that these genes are regulated in a few of our conditions. Further experiments will determine if these are real changes.
Table 1 Preliminary comparisons of fold change of excitotoxic, neuroprotective, and neurodegenerative conditions to wildtype conditions, N2. (Calculation performed by dividing ddCt glr-1 experimental by ddCt N2 Wildtype conditions).
Strain glr-1 dct-5 acs-1 F13H8.5 glt-3;nuIs5 0.39 0.03 0.02 41.93 age-1;glt-3;nuIs5 70.03 0.09 56.89 263.20 crh-1;glt-3;nuIs5 9026.81 3821.70 19962.43 1175627.84
83 Further experiments must be performed to substantiate the results. These results are currently utterly inconclusive due to unreliable controls and the need for further replicates, and we plan to examine their regulation in future experiments.
3.4 Conclusions and Discussion
In the previous chapter, we showed that a non-canonical mechanism of CREB activation is important in excitotoxic necrosis and suggest that this mechanism spurs a specific transcriptional response by CREB. In addition to the activation, we surmise that the other transcription factors that may work together with CREB, and may also contribute to an even more specific transcriptional response. Therefore we turned our attention to neuroprotective transcription factor, FOXO/DAF-16. The roles of CREB and DAF-16 in neuroprotection have been studied in separate experiments, however we hypothesized that CREB and DAF-16 work together to confer neuroprotection. Importantly, we found that in the absence of CREB, the inhibition of insulin signaling/active DAF-16 still conferred neuroprotection. We provided evidence for this collaboration using pharmacological and genetic techniques (Figure 19 & 20).
Previous studies have shown an axis of AKT à CREB signaling in metabolism. However, our results suggest in excitotoxicity, this is not a major signaling pathway. If this was indeed the case, we would expect to see no additional protection of DAF-16-activating conditions (such as the age-1 mutation) in the absence of CREB in these conditions.
Based on this evidence, we hypothesized that common downstream targets of both CREB and DAF-16 might be the most interesting genes to consider in excitotoxicity. Comparing lists from previous DAF-16 and CREB studies looking downstream, we chose to examine three
84 common downstream targets: acs-1, dct-5, and F13H8.5 (pqn-41-like). Figure 21 shows increased expression of acs-1 and dct-5 in our cells from our CREB mutants.
However, there are many areas for improvement and many caveats to mention. Although we followed the dissociation protocols using Pronase along with mechanical disruption
(pipetting up and down), this step is incredibly crucial and efficiency has been achieved with other methods. We recently found out that homogenization is most successfully achieved using a dounce tissue grinder, rather than our previous methods and employing this method is likely to improve the samples for sorting (Menachem Katz, personal communication). We could possibly improve the cell sorting parameters. A crucial aspect is also to alter the gating parameters to cater to the size of C. elegans neurons in particular. C. elegans neurons are significantly smaller than mammalian cells and therefore our neurons get bypassed and discarded due to parameters optimized for mammalian cells. In addition, not all sets of these neurons were sorted into Egg
Buffer, therefore this was not standardized in this experiment. Unfortunately, the resultant expression levels are not dependable; even though we normalized to lmn-1 in our controls, we also saw expression levels and similar Ct values in our negative control (no reverse transcriptase). We might also need to increase the amount of cDNA into the qPCR, to even see basal levels of expression, in case the endogenous levels of expression are low. Therefore, there are several aspects of this experiment that need to be improved and further experiments need to be performed.
Despite these enormous caveats, just as a way of thought exercise, it is interesting to speculate on the possible regulation of dct-5 (if the current results were to be confirmed). It seems that dct-5 expression goes down upon excitotoxicity, and it does not recover upon DAF-
16 –mediated protection. However, elimination of CREB seems to dramatically increase its
85 expression level. One plausible interpretation of such a tentative observation would be that dct-5 expression is normally inhibited by CREB activation: we expect excitotoxicity to activate CREB and inhibit dct-5 expression, while CREB elimination unleashes a huge over-expression of this gene. Given that toxicity of extensive mitochondrial lipid synthesis (in a process called
Ferroptosis) is suggested to be a contributing factor in excitotoxicity (Yang and Stockwell 2016) such a result could potentially link CREB-mediated neuroprotection in excitotoxicity to reduced mitochondria-triggered toxicity.
Although our gene expression studies were inconclusive we have evidence that CREB and DAF-16 work in separate but parallel pathways to confer neuroprotection. This may be another mechanism to specify transcriptional response in neuroprotection.
3.5 Materials and Methods
Strains
Strains used: ZB1102, crh-1;glt-3;nuIs5, age-1;glt-3;nuIs5 and crh-1;age-1;glt-3;nuIs5.
ZB1102, crh-1;glt-3;nuIs5, and age-1;glt-3;nuIs5 were used in the epistasis, pharmacological assays, and for the qRT-PCR studies.
Pharmacology
Inhibition of the insulin signaling pathway was achieved using 10mM LY294002 (Sigma) dissolved in ethanol and plated on a 6-well plates filled with agar; protocol was carried out according to Tehrani et al. (2014). Stage L4 worms were allowed to propagate. Each strain was also exposed to ethanol alone for control. Exposure to ethanol alone decreased levels of neurodegeneration for unknown mechanistic reasons.
86 Synchronization
Several full plates of gravid adults were collected with M9 into centrifuge tubes. Tubes were spun in the microfuge (Stiernagle 2006) and the pellet was washed 3-5x with M9. The pellet was finally resuspended in bleach solution. About 500ul of the eggs were placed onto large, seeded plates and allowed to dry. Worms were allowed to grow for 48 hours in 20° to obtain synchronized L3 stage.
Dissociation
Worms were dissociated using a combination of protocols set forth by David Miller (Zhang et al.
2011b; Zhang and Kuhn, 2012; Spencer et al. 2014), Coleen Murphy (Lakhina et al. 2015), and
Shai Shaham labs (Wallace et al. 2016). Worms were collected with cold M9, centrifuged for
2.5 minutes at 1500 rpm. Supernatant was removed, 10 ml M9 Buffer was added and worms were allowed to settle on ice for 30 minutes (Spencer et al. 2014). Worms were then exposed to lysis buffer (SDS-DTT) 2x amount of pellet, for 4 minutes. Egg Buffer (1X) was used to stop the reaction and washed 3-5 times. Pronase E (20 mg/ml) was then used to in conjunction with mechanical disruption, reaction was stopped with 1X Egg Buffer. Cells were filtered using a
5uM syringe filter into centrifuge tubes. GFP+ and GFP- cells were then sorted using BD Aria cell sorter. Cells were sorted into 750ul of TRIzol™ (or adjusted volumes depending on the number of sorted cells).
RNA Extraction
Chloroform was added to the cells in TRIzol to cause phase separation (according to TRIzol user guide). The RNA (aqueous phase) was placed into a separate tube and mixed with 70% Ethanol.
The QIAGEN RNeasy micro kit was used for RNA isolation, and eluted in 14ul RNase free water. RNA concentration and quality (based on Abs 260/280 values) were determined using
87 RT-qPCR
Applied Biosystems kit was used for reverse transcription. Random hexamer oligos were used for the RT. Thermoscientific TaqMan® kit was used for qPCR. Taqman assays were used for the genes of interest, lmn-1, glr-1, dct-5, acs-1, and F13H8.5. Lamin-1, lmn-1, was used as an endogenous control. glr-1 was used as a positive control as the sorted cells of interest have transgene nuIs5, Pglr-1::GFP, Pglr-1::GαS, which should be enriched in GFP+ sorted neurons.
Experiments were run in an Eppendorf Realplex Cycler (Kottmann lab, CCNY). ΔΔCt values were calculated to compare relative gene expression and normalized to lmn-1. For negative controls, we performed the RT without transcriptase, a control used to test gDNA contamination.
3.6 Acknowledgements
I would especially like to thank Ayesha Chowdhury for contribution to the epistasis project. I would also like to thank Zelda Mendelowitz for help with the dissociations, cell sorting, RNA prep and qPCR experiments. I thank the Shaham, Murphy, and Miller labs for their continued help with the RNA protocols. I would also like to thank the Kottmann lab for allowing us to use the qPCR machine.
3.7 References
Babar P, Adamson C, Walker GA, Walker DW, Lithgow GJ. 1999. P13-kinase inhibition induces dauer formation, thermotolerance and longevity in C. elegans. Neurobiol Aging 20: 513-9 Bakthavachalam P, Shanmugam PST. 2017. Mitochondrial dysfunction - Silent killer in cerebral ischemia. J Neurol Sci 375: 417-23
88 Benito E, Valor LM, Jimenez-Minchan M, Huber W, Barco A. 2011. cAMP response element- binding protein is a primary hub of activity-driven neuronal gene expression. J Neurosci 31: 18237-50 Blum ES, Abraham MC, Yoshimura S, Lu Y, Shaham S. 2012. Control of nonapoptotic developmental cell death in Caenorhabditis elegans by a polyglutamine-repeat protein. Science 335: 970-3 Dawson TM, Dawson VL. 2017. Mitochondrial Mechanisms of Neuronal Cell Death: Potential Therapeutics. Annu Rev Pharmacol Toxicol 57: 437-54 Du K, Montminy M. 1998. CREB is a regulatory target for the protein kinase Akt/PKB. J Biol Chem 273: 32377-9 Freytag V, Probst S, Hadziselimovic N, Boglari C, Hauser Y, et al. 2017. Genome-Wide Temporal Expression Profiling in Caenorhabditis elegans Identifies a Core Gene Set Related to Long-Term Memory. J Neurosci 37: 6661-72 Galluzzi L, Blomgren K, Kroemer G. 2009. Mitochondrial membrane permeabilization in neuronal injury. Nat Rev Neurosci 10: 481-94 Ghosh A, Ginty DD, Bading H, Greenberg ME. 1994. Calcium regulation of gene expression in neuronal cells. Journal of neurobiology 25: 294-303 Hardingham GE, Bading H. 2002. Coupling of extrasynaptic NMDA receptors to a CREB shut- off pathway is developmentally regulated. Biochim Biophys Acta 1600: 148-53 Kaletsky R, Lakhina V, Arey R, Williams A, Landis J, et al. 2016. The C. elegans adult neuronal IIS/FOXO transcriptome reveals adult phenotype regulators. Nature 529: 92-6 Lakhina V, Arey RN, Kaletsky R, Kauffman A, Stein G, et al. 2015. Genome-wide functional analysis of CREB/long-term memory-dependent transcription reveals distinct basal and memory gene expression programs. Neuron 85: 330-45 Lee SM, Kim JH, Cho EJ, Youn HD. 2009. A nucleocytoplasmic malate dehydrogenase regulates p53 transcriptional activity in response to metabolic stress. Cell Death Differ 16: 738-48 Mair W, Morantte I, Rodrigues AP, Manning G, Montminy M, et al. 2011. Lifespan extension induced by AMPK and calcineurin is mediated by CRTC-1 and CREB. Nature 470: 404- 8 Michelitsch MD, Weissman JS. 2000. A census of glutamine/asparagine-rich regions: implications for their conserved function and the prediction of novel prions. Proc Natl Acad Sci U S A 97: 11910-5 Mojsilovic-Petrovic J, Nedelsky N, Boccitto M, Mano I, Georgiades SN, et al. 2009. FOXO3a is broadly neuroprotective in vitro and in vivo against insults implicated in motor neuron diseases. The Journal of neuroscience : the official journal of the Society for Neuroscience 29: 8236-47 Murphy CT, McCarroll SA, Bargmann CI, Fraser A, Kamath RS, et al. 2003. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 424: 277-83 Oh SW, Mukhopadhyay A, Dixit BL, Raha T, Green MR, Tissenbaum HA. 2006. Identification of direct DAF-16 targets controlling longevity, metabolism and diapause by chromatin immunoprecipitation. Nat Genet 38: 251-7 Paulson H. 2018. Repeat expansion diseases. Handb Clin Neurol 147: 105-23 Pinkston-Gosse J, Kenyon C. 2007. DAF-16/FOXO targets genes that regulate tumor growth in Caenorhabditis elegans. Nat Genet 39: 1403-9
89 Recabarren D, Alarcon M. 2017. Gene networks in neurodegenerative disorders. Life Sci 183: 83-97 Soriano FX, Papadia S, Hofmann F, Hardingham NR, Bading H, Hardingham GE. 2006. Preconditioning doses of NMDA promote neuroprotection by enhancing neuronal excitability. J Neurosci 26: 4509-18 Spencer WC, McWhirter R, Miller T, Strasbourger P, Thompson O, et al. 2014. Isolation of specific neurons from C. elegans larvae for gene expression profiling. PLoS One 9: e112102 Stiernagle T. 2006. Maintenance of C. elegans. WormBook: 1-11 Tan YW, Zhang SJ, Hoffmann T, Bading H. 2012. Increasing levels of wild-type CREB up- regulates several activity-regulated inhibitor of death (AID) genes and promotes neuronal survival. BMC Neurosci 13: 48 Tehrani N, Del Rosario J, Dominguez M, Kalb R, Mano I. 2014. The insulin/IGF signaling regulators cytohesin/GRP-1 and PIP5K/PPK-1 modulate susceptibility to excitotoxicity in C. elegans. PLoS One 9: e113060 Wallace SW, Singhvi A, Liang Y, Lu Y, Shaham S. 2016. PROS-1/Prospero Is a Major Regulator of the Glia-Specific Secretome Controlling Sensory-Neuron Shape and Function in C. elegans. Cell Rep 15: 550-62 Yang WS, Stockwell BR. 2016. Ferroptosis: Death by Lipid Peroxidation. Trends Cell Biol 26: 165-76 Zhang J, Bakheet R, Parhar RS, Huang CH, Hussain MM, et al. 2011a. Regulation of fat storage and reproduction by Kruppel-like transcription factor KLF3 and fat-associated genes in Caenorhabditis elegans. J Mol Biol 411: 537-53 Zhang S, Banerjee D, Kuhn JR. 2011b. Isolation and culture of larval cells from C. elegans. PLoS One 6: e19505
90 3.8 Supplementary
Supplementary Table 2 Common downstream targets of CRH-1 & DAF-16.
Gene name Proposed Function Of the 16 genes activated by both CRH-1 & DAF-16 signaling Contains a glutamine/asparagine (Q/N)-rich ('prion') domain similar to F13H8.5 pqn-41 F15E11.1 Unknown, expression regulated by crt-1 F15E11.15 Unknown, similar to F15E11.1 (see above) Isoprenylcysteine carboxyl methyltransferase, targets proteins to the F21F3.3 membrane F28A12.4 Aspartyl protease F43D9.4/sip-1 Small heat shock protein, needed for survival Y19D10B.7 Unknown, similar to F15E11.1 Of the 6 Genes inhibited by both CRH-1 & DAF-16 signaling F46E10.1/acs-1 Synthetase of branched-chain fatty acid, controls growth & aggregation F55G11.5/dod-22 Unknown, contains CUB-like domain, expressed in intestine & neurons R13H4.3/pho-8 Histidine acid phosphatase Of the 33 Genes with mixed effects/unknown C54D10.1/cdr-2 A cadmium-response/osmoregulation membrane protein F07F6.5/dct-5 zinc-finger transcription factor that reduces tumor cell division F27C8.1/aat-1 Amino acid transporter K12G11.3/sodh-1 Sorbitol/alcohol dehydrogenase, stress response T03E6.7/cpl-1 Cathepsin L-like cysteine protease T24E12.5 Similar to Y47G7B.2, an X-ray/p53 induced gene
91 Chapter 4
Death Associated Protein Kinase (DAPK)-mediated neurodegenerative mechanism in nematode excitotoxicity
Del Rosario JS1,2, Feldmann KG3,4, Ahmed T5, Amjad U6, Ko B5,7, An J5, Mahmud T5, Salama M8, Mei S8, Asemota D13, Mano I14,15.
(published manuscript)
1 Department of Physiology, Pharmacology, and Neuroscience, Sophie Davis School of Biomedical Education (SBE), City College of New York (CCNY), The City University of New York (CUNY), New York, NY, USA. 2 MS program in Biology, CCNY, CUNY, New York, NY, USA. 3 Department of Physiology, Pharmacology, and Neuroscience, Sophie Davis School of Biomedical Education (SBE), City College of New York (CCNY), The City University of New York (CUNY), New York, NY, USA. 4 PhD program in Neuroscience, the CUNY Graduate Center, New York, NY, USA. 5 Undergraduate program in Biology, CCNY, CUNY, New York, NY, USA. 6 Undergraduate program in Biochemistry, CCNY, CUNY, New York, NY, USA. 7 MS program in Biology, CCNY, CUNY, New York, NY, USA. 8 Undergraduate program in Biology, CCNY, CUNY, New York, NY, USA. 9 Undergraduate program in Biology, CCNY, CUNY, New York, NY, USA. 10 Undergraduate program in Biology, CCNY, CUNY, New York, NY, USA. 11 BS/MD program, Sophie Davis SBE, CCNY, CUNY, New York, NY, USA. 12 BS/MD program, Sophie Davis SBE, CCNY, CUNY, New York, NY, USA. 13 BS/MD program, Sophie Davis SBE, CCNY, CUNY, New York, NY, USA. 14 Department of Physiology, Pharmacology, and Neuroscience, Sophie Davis School of Biomedical Education (SBE), City College of New York (CCNY), The City University of New York (CUNY), New York, NY, USA. [email protected]. 15 PhD program in Neuroscience, the CUNY Graduate Center, New York, NY, USA. [email protected].
92 4.1 Abstract
Excitotoxicity is the major cause of neuronal damage in neurological disorders.
Hyperstimulation of Glutamate receptors can activate several pathways including several cell death pathways, resulting in extensive cell death. However, we aim to elucidate the crucial molecules that regulate the excitotoxic events that occur hours and even days later. One such central regulator suggested to play a role in excitotoxicity is DAPK (Death Associated Protein
Kinase), which has been found to promote cell death. DAPK is suited well to perform this duty because it contains a death-domain, which is important for interacting with its downstream death-mediating substrates. We use a C. elegans model of excitotoxicity to examine the role of
DAPK and its partners and their role in nematode excitotoxicity. We find that DAPK does not seem to work through autophagy to mediate its effects; however, we find that DAPK/dapk-1 and its partner PIN1/pinn-1 play a conserved role in mediating cell death. Elucidating this mechanism may prove important in future studies of therapeutic intervention.
93 4.2 Introduction
Excitotoxicity is the cause of the majority of neurodegeneration, due to hyperstimulation of GluRs leading to excessive calcium influx activating several cellular pathways, including cell death pathways. However the mechanisms following Ca2+ influx are complex and largely unknown. In stroke, the early destructive insult starts with hyperstimulation of GluRs but later cellular events (hours and days) involve several understudied molecules. One suggested central mediator of excitotoxic neurodegeneration and activated by calcium is DAPK (Death Associated
Protein Kinase). Mammalian studies have shown that DAPK mediates neurodegeneration, but the mechanism by which it exerts its effects in excitotoxicity is disputed, as it has several substrates targeted in various contexts including, but not limited to, immune response and oncogenesis (Lin et al. 2010; Bialik & Kimchi. 2014).
Furthermore, Shamloo et al. (2005) demonstrated in stroke models (OGD and MCAO) that the active (non-phosphorylated) form of DAPK continues to accumulate twelve hours after the initial insult (Shamloo et al, 2005). These studies and others led investigators to investigate
DAPK as a potential therapeutic target (Schumacher et al, 2002). We set out to investigate the role of DAPK in excitotoxic necrosis and tried to elucidate downstream molecules important in excitotoxic necrosis.
We found that a KO in dapk-1 significantly decreased levels of neurodegeneration (Del
Rosario et al. 2015). The question remained, however, as to how DAPK is exerting its effects, as it has been shown to be involved in several processes including GluR activity, autophagy, synaptic release, and activation of CaMKK. In Chapter 2, we showed that one of DAPK’s proposed targets, CaMKK, did not play role in excitotoxic necrosis (Figure 10).
94 However, DAPK is shown to mediate several processes and effect change through acting on its substrates. Examining other ways for DAPK to exert its effects, previous lab member John del Rosario found that dapk-1 does not affect synaptic release (using Aldicarb assay), Glu synapse strength (using spontaneous mobility), or involve the activity of DANGER/mab-21. We further examined the DAPK its role in autophagy (using a Plgg-1::dsRED::LGG-1 reporter) and found that LGG-1 levels did not change under excitotoxicity. In the following experiments, we also examined the role of autophagy using pharmacological inhibition with the drug 3-MA, shown to be a potent inhibitor of the formation of autophagosomes (Takatsuka et al. 2004;
Samara et al. 2008), an essential step leading to the degradation of damaged cellular organelles.
Another possible way for DAPK to exert its effects is through another one of its partners,
PIN1/pinn-1, peptidyl-prolyl isomerase. PIN1 is an isomerase that can change the orientation of
Proline residues that neighbor phosphorylated serine or threonine residues (Zhou et al 1999).
This change in orientation can lead to a large conformational change in the protein, altering its function. PIN1 is also of interest because its activity has been shown to be modulated by glutamate signaling and play a role in neurodegeneration, in relation to tau and separately with
Alzheimer’s disease (Liou et al 2003; Pastorino et al, 2006; Sacktor 2010). Most importantly,
DAPK and PIN1 are involved in the days-later events of neurodegeneration, and are therefore potentially interesting pharmaceutical targets.
95 4.3 Results
4.3.1 Pharmacological inhibition of autophagy, using 3-MA, has a significant but small effect in excitotoxicity
We previously tested the role of autophagy by looking at the expression of LGG-1 and examining the effect of a deletion of autophagy regulator unc-51, which likely functions in the induction of autophagy (Melendez and Levine 2009) in excitotoxicity (Del Rosario et al. 2015).
We found that LGG-1 expression did not change and that the unc-51 mutation had a small but significant effect in L3 and L4 stages, decreasing the levels of neurodegeneration. In this experiment, we tested whether the effect we see with unc-51 is reproducible using a pharmacological approach. Compound 3-MA is a well-known autophagy inhibitor, which inhibits Vps34, a TypeIII PI3K, the function of which is important in the formation of the autophagosome. We exposed glt-3;nuIs5 and dapk-1;glt-3;nuIs5 worms to 10mM 3-MA. We found a significant decrease in neurodegeneration in L3 and L4 worms (*p<0.05) in worms treated with 3-MA. We further performed an epistatic analysis to determine whether autophagy and DAPK work in the same or different pathways, and determine whether autophagy functions downstream of DAPK. Treatment with 3-MA reproduced the effects of autophagy inhibition, with the levels of neurodegeneration in glt-3;nuIs5 (L2-A) and in dapk-1;glt-3;nuIs5 mutants
(L3, L4 stages) (N=30-53) (Figure 22).
96
Figure 22 Epistatic analyses of DAPK and autophagy (using 3-MA) in excitotoxicity. DAPK does not seem to work through autophagy nematode excitotoxicity. There are no significant differences between dapk-1;glt-3;nuIs5 and dapk- 1;glt-3;nuIs5 when autophagy is inhibited using 3MA.
Despite a slight decrease in neurodegeneration, this experiment does not conclusively show whether DAPK and autophagy work in the same or separate pathways. Since autophagy has a similar effect on nuIs5 alone (Samara et al. 2008), we concluded that the small effect of autophagy inhibition seen in our experiments could be attributed to the non-Glu-dependent portion of the neurodegenerative phenotype seen in glt-3;nuIs5. Therefore, we continued our search for other potential downstream effectors.
97 4.3.2 PINN-1 works upstream or in parallel with DAPK in nematode excitotoxicity
Conserved core mechanisms are considered a priority in modulating cellular activity.
Separately, we have found that both DAPK and PIN1 play a role in nematode excitotoxicity. A
KO of dapk-1 causes significant decrease in levels of neurodegeneration throughout all life stages, suggesting that DAPK plays a role in promoting cell death. PIN1 is one of several suggested DAPK substrates that has been show to modulate cell death in an age-dependent manner (Liou et al, 2003). A KO of pinn-1 in the excitotoxicity background showed a significant increase in the levels of neurodegeneration, suggesting that pinn-1 normally functions in suppressing neurodegeneration. However, neither of these results demonstrates the relationship between DAPK and PIN1 in excitotoxicity. To test whether these molecules work in the same or different pathways and/or upstream/downstream of one another, we performed an epistatic analysis of dapk-1 and pinn-1 under excitotoxicity.
We see a moderate but insignificant increase in neurodegeneration in dapk-1;pinn-1;glt-
3;nuIs5 compared to dapk-1;glt-3;nuIs5, in L1-L3 stages, but the increase is far less than the increase we see in pinn-1 mutants. We calculated an expected cumulative effect that would result from the two proteins working in parallel pathways, but our trend does not consistently match that either (Figure 23).
98
Figure 23 Epistatic analysis of DAPK/dapk-1 and PIN1/pinn-1 in excitotoxicity. (N=41-154). A mutation in pinn-1 significantly increases neurodegeneration, while a KO dapk-1 significantly decreases neurodegeneration.
However, since it is at least clear that PINN-1 does not work downstream of DAPK-1, we suggest that PINN-1 is acting upstream or in parallel to DAPK to mediate its effects on neurodegeneration.
4.4 Conclusions and Discussion
Excitotoxicity is a complex process by which hyperstimulation of GluRs leads to activation of cell death and cell survival signaling. Administration of GluR antagonists as therapy has failed, thus spurring the motivation to continue the search for therapeutic agents that mitigate damage in stroke. We have found that DAPK is a conserved mediator of excitotoxicity,
99 as the lack of DAPK decreases the levels of neurodegeneration in excitotoxicity. This suggests that its role in promoting cell death is conserved in excitotoxic necrosis. DAPK has many interacting partners, but we have recently found that it does not affect GluR activity by CaMKK or neurotransmitter release (Del Rosario et al. 2015). We also found that it does not exert its significant effects through autophagy (established by LGG-1 expression and the use of autophagy inhibitor, 3-MA (Figure 22)). Interestingly, however, we found that DAPK binding partner PIN1/pinn-1, a proline isomerase, promotes neuroprotection (Figure 23). Though previously found to act downstream of DAPK, our epistatic analysis suggests that PIN1 acts upstream or in parallel in excitotoxicity.
We believe that our study of conserved processes in excitotoxic necrosis is likely to illuminate particularly important mechanisms in ischemia-related neurodegeneration. As a general principle, evolutionarily conserved mechanisms are likely to represent the critical core of biological processes because they survived evolutionary drift. This also idea lends credence to the proposition that these molecules may be able to serve as effective therapeutic targets.
Another potential advantage of our studies is our focus on processes that can affect the outcome of an excitotoxic insult even hours after the onset of the degenerative process. It has been suggested that the reason for the failure of GluR antagonists is that administration of the drug was too late to stop the destructive effect of GluR hyperstimulation, which occurs almost immediately at the time of insult. However, neuroprotective mechanism can be activated later, and can be effective hours and even days later (Papadia et al. 2005), as is also seen in the case of
DAPK (Shamloo et al. 2005). Therefore, we propose that targeting the modulators of these later events may prove to be more reliable or effective therapeutic targets.
100 4.5 Materials and Methods
Strains
Strains used: ZB1102 glt-3;nuIs5, VC432 dapk-1(gk219)IV, pinn-1(tm2235)II, nuIs5(V). Some strains were obtained from the CGC others from Japanese National Bioresource Project (NBSP).
Excitotoxic strain ZB1102 (glt-3;nuIs5) was combined with each of the aforementioned strains by John del Rosario. Created strains: dapk-1(gk219); glt-3;nuIs5, pinn-1(tm2235);glt-3;nuIs5,
IMN30: pinn-1(tm2235); dapk-1(gk219);glt-3;nuIs5.
Experimental Conditions
Animals were grown on NGM agar plates seeded with E. coli OP50 at 20°C (Brenner 1974).
Pharmacological study conditions are noted below.
Pharmacological Studies 3-Methyladenine (3-MA)
Strains nuIs5, glt-3;nuIs5 and dapk-1(gk219);glt-3;nuIs5 were incubated overnight with 10mM
3-MA (Sigma; M9281) dissolved in 1% DSMO or alone. Worms were placed on plates containing E. coli OP50. Neurodegeneration levels were counted 20-24 hours after treatment.
Neurodegeneration Quantification
Neurodegeneration was quantified by methods originally used in Mano et al, 2009. Strains were coded and counting was performed blindly. Sample size N ≥ 30 for each life stage and each strain, unless otherwise noted.
Statistical Analysis z-test analyses were performed at each life stage. SEMs were calculated and are represented by the error bars on each figure. For the epistasis experiments, the expected number of dying neurons was calculated using the following formulas. Fold effects of mutations X and Y =
(average number of dying head neurons (of mutation X or Y) divided by average number of
101 dying head neurons in the excitotoxicity strain). Expected cumulative effect, if X and Y work independently and in parallel, was calculated by multiplying the fold change in X times the fold change in Y. The expected cumulative number of dying head neurons equals the average number of dying head neurons in excitotoxicity multiplied by fold change in X and fold change in Y.
4.6 Acknowledgements
I thank John del Rosario for allowing me to contribute to this work, which was part of his
Master’s thesis. We thank the CGC and Japanese KO Consortium for various strains as well.
4.7 References
Bialik S, Kimchi A. 2014. The DAP-kinase interactome. Apoptosis 19: 316-28 Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94 Del Rosario JS, Feldmann KG, Ahmed T, Amjad U, Ko B, et al. 2015. Death Associated Protein Kinase (DAPK) -mediated neurodegenerative mechanisms in nematode excitotoxicity. BMC Neurosci 16: 25 Lin Y, Hupp TR, Stevens C. 2010. Death-associated protein kinase (DAPK) and signal transduction: additional roles beyond cell death. FEBS J 277: 48-57 Liou YC, Sun A, Ryo A, Zhou XZ, Yu ZX, et al. 2003. Role of the prolyl isomerase Pin1 in protecting against age-dependent neurodegeneration. Nature 424: 556-61 Mano I, Driscoll M. 2009. Caenorhabditis elegans glutamate transporter deletion induces AMPA-receptor/adenylyl cyclase 9-dependent excitotoxicity. Journal of neurochemistry 108: 1373-84 Melendez A, Levine B. 2009. Autophagy in C. elegans. WormBook: 1-26 Pastorino L, Sun A, Lu PJ, Zhou XZ, Balastik M, et al. 2006. The prolyl isomerase Pin1 regulates amyloid precursor protein processing and amyloid-beta production. Nature 440: 528-34 Sacktor TC. 2010. PINing for things past. Sci Signal 3: pe9 Samara C, Syntichaki P, Tavernarakis N. 2008. Autophagy is required for necrotic cell death in Caenorhabditis elegans. Cell Death Differ 15: 105-12 Schumacher AM, Velentza AV, Watterson DM. 2002. Death-associated protein kinase as a potential therapeutic target. Expert Opin Ther Targets 6: 497-506
102 Shamloo M, Soriano L, Wieloch T, Nikolich K, Urfer R, Oksenberg D. 2005. Death-associated protein kinase is activated by dephosphorylation in response to cerebral ischemia. J Biol Chem 280: 42290-9 Takatsuka C, Inoue Y, Matsuoka K, Moriyasu Y. 2004. 3-methyladenine inhibits autophagy in tobacco culture cells under sucrose starvation conditions. Plant Cell Physiol 45: 265-74 Zhou XZ, Lu PJ, Wulf G, Lu KP. 1999. Phosphorylation-dependent prolyl isomerization: a novel signaling regulatory mechanism. Cell Mol Life Sci 56: 788-806
103 Chapter 5
Conclusions and Discussion
5.1 Conclusion
We set out to find the mechanism of CREB activation responsible for protection against excitotoxic necrosis and whether we can begin to find novel targets that may mitigate damage experienced in stroke. We approached this by investigating potential molecular modulators of neurodegeneration and neuroprotection in excitotoxicity.
In Chapter 2, we found that CREB’s role in neuroprotection is conserved in our C. elegans model of excitotoxicity (Figure 6). We also found that we can partially correlate
CREB’s role in neuroprotection with the extent of expected Glu insult, as it is correlated with the synaptic exposure to different levels of Glu. Our data suggests that CREB protects the neurons exposed to milder levels of Glu (Figure 7); we superficially relate this to the damage profile seen in stroke, with a likeness to the core and the penumbra.
Next we wanted to test what mechanism of CREB activation is important specifically in excitotoxicity. We categorized potential mechanisms into canonical and non-canonical mechanisms. First, we examined the roles of canonical activators CaMKK and CBP. We found that neither CaMKK (Figure 10) nor CBP-1 modulates excitotoxicity (Figure 9), suggesting a mechanism distinct from the canonical mechanism is important for CREB activation.
Therefore, we turned our attention to a less studied, non-canonical mechanism involving
CaMK/AMPK/CRTC cascade, ultimately leading to CRTC activation. We find that each of the tested molecules (CaMK (Figure 11), SIK2/AMPK (Figure 12) and especially CRTC (Figure
13)) play a role in excitotoxicity. CRTC is the most downstream molecule and is also the most
104 direct link to CREB activation. Importantly, mammalian CRTC binding is known to be independent of CREB S133 phosphorylation, which has been the prominent measure of CREB activity and is the penultimate focus of canonical activation. To address the importance of phosphorylation at this site, we introduced a wildtype CREB or a phosphorylation mutant CREB
(S29A) (corresponding to the conserved mammalian site Ser133) into crh-1;glt-3;nuIs5 animals
(i.e. CREB null). We find that WT CREB can cell-specifically rescue the neurodegenerative phenotype in glr-1 expressing neurons. Most excitingly, we found that CREB phosphorylation at Ser29 is not required for neuroprotection in excitotoxicity (Figure 17). Previous mammalian studies in synaptic activity and learning and memory have shown that CREB phosphorylation is not required (Kovacs et al. 2007; Ch’ng et al. 2012; Nonaka et al. 2014; Briand et al. 2015;
Uchida et al. 2017; Parra-Damas et al. 2017). However, few studies have shown that this holds true in neuroprotection (Jeong et al. 2011) and only one study has show this in excitotoxicity- induced neuroprotection (Sasaki et al. 2011).
Keeping the focus on cellular activity that lends specificity to cellular responses for neuroprotection, we examined another neuroprotective transcription factor, DAF-16 (using age-1 mutants), to test if DAF-16 works together with CREB. The increased neurodegeneration seen in the crh-1 background was decreased with the age-1 mutation (active DAF-16) (Figure 20).
These results suggest that CREB and DAF-16 work in separate but parallel pathways that converge to confer neuroprotection. Taking this into the account, we hypothesized that common downstream targets of both DAF-16 and CREB found in previous studies (other scenarios) may also be regulated in excitotoxicity. We examined the expression of acs-1, dct-5, and F13H8.5
(pqn-41-like protein) using RT-qPCR (Figure 21). Our pilot studies show increased expression
105 of dct-5 in the absence of CREB in excitotoxic conditions. However, further experiments must be performed to examine specific gene regulation more closely.
The ultimate goal of this research is to discover novel therapeutic targets important for neuroprotection in excitotoxicity. Thus far there are no effective therapeutic treatments, though billions of dollars have been invested to lessen stroke damage using GluR antagonists.
Completely blocking GluR signaling hastened and increased patient death compared to placebo treatments. We learned two major things from the clinical trials: 1) treatment was administered too late to stop the neurodestructive effect of GluR signaling, and 2) treatment blocked the activation of neuroprotective signaling. Thus, it was important to look for modulators downstream of GluRs and establish the mechanism by which the modulators work specifically in excitotoxicity; we hoped to uncover the details of events that occur after GluR activity. Upon examination of mediators of neurodegeneration, we recently found that DAPK plays a role in nematode excitotoxicity. Although we found that DAPK does not work through autophagy, we found that an interactor PIN1 plays a significant role in neurodegeneration. Most significantly, however, we found that DAPK and PIN1 are conserved mediators of neurodegeneration. DAPK has been proposed as a therapeutic target (Schumacher et al, 2002), but, given its involvement in many signaling pathways, elucidating this mechanism further is crucial to get the full picture of excitotoxic necrosis.
5.2 Future Experiments
Our future experiments will focus on the concept of specificity of the mechanisms of neuroprotection involving CREB, especially the downstream transcriptional targets. Our priority is to perform in-depth RNA-transcriptome studies in our excitotoxic necrosis model, comparing
106 the regulation in the absence and presence of CREB as well as the presence of active
FOXO/DAF-16 (neuroprotective scenario). Expanding upon our qRT-PCR experiments, we suggest that the most highly regulated genes by both CREB and FOXO/DAF-16 from the transcriptome studies will provide insight into the most important genes for the regulation of neuroprotection. Similar large-scale profiling experiments have identified uncharacterized human orthologs that are attributed to disease, lending great potential for these experiments. The information gained from these experiments can be translated to treatments for human stroke, with patients ultimately influencing the direction in which stroke treatments will proceed. In addition, we will explore the role of other transcription factors such as DREAM/ncs-1 and
Nrf/skn-1, which are involved in plasticity and neuroprotection, and test them in our model of excitotoxicity. We strongly believe that a specific combination of factors further specify a neuroprotective response. If these other factors do indeed play a role in excitotoxicity-induced neuroprotection, we will further investigate their regulatory role using transcriptomic analysis.
The goal of this research is and continues to be to find novel therapeutic targets that will provide neuroprotection in stroke and brain ischemia.
5.3 References
Briand LA, Lee BG, Lelay J, Kaestner KH, Blendy JA. 2015. Serine 133 phosphorylation is not required for hippocampal CREB-mediated transcription and behavior. Learn Mem 22: 109-15 Ch'ng TH, Uzgil B, Lin P, Avliyakulov NK, O'Dell TJ, Martin KC. 2012. Activity-dependent transport of the transcriptional coactivator CRTC1 from synapse to nucleus. Cell 150: 207-21 Jeong H, Cohen DE, Cui L, Supinski A, Savas JN, et al. 2011. Sirt1 mediates neuroprotection from mutant huntingtin by activation of the TORC1 and CREB transcriptional pathway. Nat Med 18: 159-65 Kovacs KA, Steullet P, Steinmann M, Do KQ, Magistretti PJ, et al. 2007. TORC1 is a calcium- and cAMP-sensitive coincidence detector involved in hippocampal long-term synaptic plasticity. Proc Natl Acad Sci U S A 104: 4700-5 Nonaka A, Toyoda T, Miura Y, Hitora-Imamura N, Naka M, et al. 2014. Synaptic plasticity associated with a memory engram in the basolateral amygdala. J Neurosci 34: 9305-9
107 Papadia S, Stevenson P, Hardingham NR, Bading H, Hardingham GE. 2005. Nuclear Ca2+ and the cAMP response element-binding protein family mediate a late phase of activity- dependent neuroprotection. J Neurosci 25: 4279-87 Parra-Damas A, Chen M, Enriquez-Barreto L, Ortega L, Acosta S, et al. 2017. CRTC1 Function During Memory Encoding Is Disrupted in Neurodegeneration. Biol Psychiatry 81: 111- 23 Sasaki T, Takemori H, Yagita Y, Terasaki Y, Uebi T, et al. 2011. SIK2 is a key regulator for neuronal survival after ischemia via TORC1-CREB. Neuron 69: 106-19 Schumacher AM, Velentza AV, Watterson DM. 2002. Death-associated protein kinase as a potential therapeutic target. Expert Opin Ther Targets 6: 497-506 Uchida S, Teubner BJ, Hevi C, Hara K, Kobayashi A, et al. 2017. CRTC1 Nuclear Translocation Following Learning Modulates Memory Strength via Exchange of Chromatin Remodeling Complexes on the Fgf1 Gene. Cell Rep 18: 352-66 Zhao H, Ren C, Chen X, Shen J. 2012. From rapid to delayed and remote postconditioning: the evolving concept of ischemic postconditioning in brain ischemia. Curr Drug Targets 13: 173-87
108