The Role of Hepatocyte Nuclear Factor 4A in Renal Proximal Tubule Development

The Role of Hepatocyte Nuclear Factor 4a in Renal Proximal Tubule Development

A dissertation submitted to the Graduate School of the University of Cincinnati

in partial fulfillment of the requirements for the degree of

Doctor of Philosophy

in the Molecular and Developmental Biology Graduate Program

University of Cincinnati College of Medicine

2020

Sierra S. Marable

B.S. Valdosta State University, 2012

Committee Chair: Joo-Seop Park, PhD

Elif Erkan, MD

S. Steven Potter, PhD

Katherine Yutzey, PhD

Aaron Zorn, PhD

i Abstract

Nephron segmentation is a poorly understood process that forms four distinct regions of the nephron: the renal corpuscle, the proximal tubule, the loop of Henle, and the distal tubule. Each segment has a specialized function necessary for proper renal filtration.

The proximal tubule is the main site of active reabsorption in the nephron, responsible for approximately 65% of total reabsorption. Proximal tubule dysfunction has been implicated in many nephrology disorders, such as renotubular acidosis and Fanconi renotubular syndrome (FRTS), which can lead to chronic kidney disease in adulthood.

In order to provide better treatments, it is necessary to understand the molecular mechanisms underlying proximal tubule development. The goal of this dissertation is to determine the molecular mechanisms regulating proximal tubule development.

Hepatocyte nuclear factor 4 alpha (Hnf4a) is a transcription factor that is only expressed in the proximal tubules of the kidney. A heterozygous mutation in the HNF4A gene has been identified in patients with FRTS. FRTS is defined as generalized proximal tubular dysfunction characterized by polyuria, polydipsia, glucosuria, proteinuria, and phosphaturia. This suggests that Hnf4a is a key regulator of proximal tubule development and function. However, the role of Hnf4a in proximal tubule development is unknown and there was no mouse model for kidney-specific Hnf4a deletion.

Therefore, to investigate the role of Hnf4a in the kidney, we generated two mouse models of nephron-specific Hnf4a deletion. The first mouse model studied featured mosaic deletion of Hnf4a in Six2-expressing nephron progenitors. In this model, Hnf4a mutant mice showed a paucity of proximal tubules in the developing kidney. This paucity led to mutant mice developing FRTS-like symptoms. Hnf4a mutant cells were

ii unable to mature into LTL-high proximal tubules cells, indicating that Hnf4a is required for proximal tubule maturation. In the second mouse model, we investigated the results of complete deletion of Hnf4a in the Osr2-expressing proximal portion of the nephron. In this model, there was complete loss of LTL-high mature proximal tubules causing early postnatal lethality in the mutant mice. These mutant mice showed arrested proximal tubule development with an increase in Cdh6+ progenitors. Transcriptomic and genomic analyses identified transporters genes and metabolism genes are the primary targets of

Hnf4a in the kidney. Overall, these results showed that Cdh6+ cells in the developing kidney are proximal tubule progenitors and that Hnf4a is required for the transition of the

Cdh6+ progenitors to LTL-high mature proximal tubules. Hnf4a regulates this differentiation via expression of transporter and fatty acid metabolism genes.

iii

iv Acknowledgements

I would first like to thank my advisor, Joo-Seop Park PhD, for guiding me over the course of my graduate education. Your open-door policy and willingness to listen and discuss have been essential to my progress. Thank you to the members of the Park lab,

Eunah Chung PhD and Patrick Deacon, who helped me design and troubleshoot experiments. Thanks to the members of the Reddy Lab, Pramod Reddy MD, Elizabeth

Mann PhD, and Melissa Mogle, for their invaluable insights. I also am very grateful for the assistance of my thesis committee, for their constructive advice and their roles in my development as a scientist. I must also acknowledge previous mentors who have helped me along my journey to graduate school, especially Mark Blackmore PhD,

Thomas Manning PhD, and Colin Bishop PhD.

Many thanks to my fellow MDB students, especially Talia, Kelsey, Alex, Marshall,

Joe, Sandra, and Valeria, who have been with me on this graduate journey from the beginning. I also thank the MDB program for the education I have received as graduate student.

Last and most important, I must thank my family and friends for their unwavering love and support throughout the years. I come from a large extended family and it is wonderful to come from such a supportive group of people. To my best friends Jeana and Lacey, thank you for your support over the many years of our friendship. Thank you to my grandmothers for always spoiling me. And finally, thank you to my mother, Ginny, for your unconditional love and for everything you taught me. Though you are gone, your love and wisdom live on within me.

Table of Contents

Abstract ...... ii

Acknowledgements ...... v

List of Tables and Figures ...... 3

CHAPTER 1: INTRODUCTION ...... 4 Kidney Anatomy and Function...... 4 Kidney Development ...... 4 Nephrogenesis ...... 6 The Proximal Tubule ...... 7 Hepatocyte Nuclear Factor 4 Alpha (Hnf4a) ...... 11 Rationale ...... 12 Scope of Dissertation ...... 13

CHAPTER 2: Hnf4a deletion in the mouse kidney phenocopies Fanconi renotubular syndrome ...... 18 Abstract ...... 19 Introduction ...... 20 Results ...... 21 Discussion ...... 29 Methods...... 32 Acknowledgments ...... 37 Figures ...... 38

CHAPTER 3: Hnf4a-mediated regulation of proximal tubule progenitors in the mouse kidney ...... 47 Abstract ...... 48 Significance ...... 49 Introduction ...... 50 Methods...... 52 Results ...... 55 Discussion ...... 62 Author contributions ...... 66 Acknowledgments ...... 66 Figures ...... 67

1 CHAPTER 4: SUMMARY AND CONCLUSION ...... 75 Summary of Findings ...... 75 Discussion ...... 76 Future Directions ...... 77 Significance ...... 80 Conclusions ...... 82 Figures ...... 83

REFERENCES ...... 86

2 List of Tables and Figures

Chapter 1: Introduction Figure 1. Mouse kidney development...... 15 Figure 2. Reciprocal interactions between the metanephric mesenchyme and the ureteric bud...... 16 Figure 3. Nephrogenesis and nephron patterning...... 17

Chapter 2: Hnf4a deletion in the mouse kidney phenocopies Fanconi renotubular syndrome Figure 1. Hnf4a is expressed in the developing nephron...... 39 Figure 2. Deletion of Hnf4a by Six2GFPcre leads to a defect in proximal tubule (PT) formation...... 39 Figure 3. Hnf4a is dispensable for the formation of presumptive PT (LTL-low) cells but required for the formation of differentiated PT (LTL-high) cells...... 3 Figure 4. Deletion of Hnf4a by Six2GFPcre results in decreased expression of PT-specific genes...... 41 Figure 5. Hnf4a mutant mice recapitulate Fanconi renotubular syndrome phenotypes...... 42 Figure 6. Adult Hnf4a mutant has disorganized PTs and nephrocalcinosis...... 43

Supplemental Figure 1 ...... 44 Supplemental Figure 2 ...... 45 Supplemental Figure 3 ...... 46

Chapter 3: Hnf4a-mediated regulation of proximal tubule progenitors in the mouse kidney Figure 1. Hnf4a deletion by Osr2Cre leads to loss of mature proximal tubule (PT) cells...... 67 Figure 2. Loss of mature proximal tubules leads to postnatal lethality in Hnf4a mutant mice...... 68 Figure 3. High Cdh6 expression is persistent in the Hnf4a mutant kidney...... 69

Figure 4. Cdh6 lineage tracing shows that Cdh6+ cells are PT progenitor cells ...... 70

Figure 5. Cdh6high PT progenitor cells have a higher proliferation rate than Cdh6low mature PT cells...... 71 Figure 6. Genome-wide mapping of Hnf4a binding sites in the newborn mouse kidney ...... 72 Figure 7. Intersection of Hnf4a ChIP-seq peaks with differentially expressed genes in the Hnf4a mutant kidney identified direct target genes of Hnf4a...... 73

Table 1. Hnf4a target genes that were downregulated in the Hnf4a mutant kidney ...... 74

Chapter 4: Summary and Conclusions Figure 1. Proximal tubule development is arrested in the absence of Hnf4a...... 83 Figure 2. Hnf4a regulates expression of metabolism and transporter genes in the proximal tubule...... 84

Table 1. Kidney organoid differentiation protocols...... 85

3 CHAPTER 1: INTRODUCTION

Kidney Anatomy and Function The kidneys are the main excretory organ of the body. They filter the blood, regulate blood pressure, maintain homeostatic balance of tissue fluids, and metabolize drugs [1]. The functional unit of the kidney is the nephron, which is composed of four distinct segments: The renal corpuscle, the proximal tubule, the loop of Henle, and the distal tubule. Each segment of the nephron has distinct morphology and physiological functions. The renal corpuscle is the blood filtering compartment of the nephron and is composed of the glomerulus and the Bowman’s capsule (podocytes and parietal epithelium) [2]. The proximal tubule reabsorbs approximately 65% of the glomerular filtrate and is the primary site of active reabsorption and waste excretion [3-5]. The loop of Henle adjusts urine concentration [6]. The distal tubule regulates reabsorption of salt and calcium as well as pH balance [7]. The distal tubule connects to the collecting duct system, which transports urine through the ureters to the bladder. Nephron number among humans is highly variable, ranging from 200,000 to 2 million nephrons per kidney [8]. Low nephron number is associated with higher incidence of kidney disease

[9-12]. The murine kidney averages 14,000 nephrons per kidney [13, 14].

Kidney Development Kidney development starts at approximately 5 weeks of gestation in humans and embryonic day 10.5 (E10.5) in mice [15]. The intermediate mesoderm gives rise to the main components of the kidney [16, 17]. During mammalian renal development, 3 forms

4 of the kidneys appear sequentially: the pronephros, mesonephros, and metanephros

[18, 19]. The pronephros and mesonephros eventually degenerate during development.

The metanephric kidney is the permanent, functional kidney in mammals [15, 18].

Metanephric kidney development begins when the metanephric mesenchyme induces the adjacent nephric duct to bud into the metanephric mesenchyme (Figure

1A). The metanephric mesenchyme induces bud formation via GDNF/Ret signaling [20].

Localized expression of GDNF by the metanephric mesenchyme activates Ret receptors expressed in the nephric duct leading to bud formation and proliferation at the bud tips (Figure 2). The budding nephric duct, also known as the ureteric bud, bifurcates and the surrounding mesenchyme condenses around the ureteric bud tips. The outer layer cells of the condensed mesenchyme are Foxd1-expressing stoma progenitors and the core cells that surround the ureteric bud tips are Six2-expressing nephron progenitors, also known as the cap mesenchyme [21, 22]. Wnt9b signaling from the ureteric bud induces a subset of the nephron progenitor cells to undergo a mesenchymal to epithelial transition (MET) to initiate nephrogenesis (Figure 2) [23].

Reciprocal interactions between the ureteric bud tips and the cap mesenchyme cause reiterative branching and nephron formation starting at E11.5 [24-26]. By E15.5, multiple stages of kidney development are apparent, with a combination of nascent and mature structures (Figure 1B). The ureteric bud undergoes approximately 12 generations of branching and ceases approximately 2 days after birth in mice [13]. Nephrogenesis continues until approximately 3-4 days after birth in mice. In humans, nephrogenesis ceases at 36 weeks of gestation [13].

5 Nephrogenesis All epithelial segments of the nephron are derived from the Six2-expressing nephron progenitor cells [22]. Six2 is required for maintenance and proliferation of the nephron progenitors and downregulation of Six2 coincides with early differentiation of the nephron [22, 27]. Initiation of nephrogenesis begins with the mesenchymal-to- epithelial transition (MET) of the nephron progenitors to form the spherical renal vesicle.

Canonical Wnt/-catenin signaling is essential for MET (Figure 3A) [28, 29].

The renal vesicle has distinct gene expression domains along the proximal-distal axis, suggesting that patterning of the nephron segments begins at early differentiation stages [15, 30, 31]. The renal vesicle elongates into the S-shaped body (Figure 3A).

The S-shaped body is patterned along the proximal-distal axis [32]. The proximal segment of the S-shaped body expresses the Wt1 transcription factor and will become the parietal and visceral (podocytes) epithelium of the glomerulus. The medial segment of the S-shaped body is defined by expression of the Notch ligand Jag1 and presumptively becomes the proximal tubule and the loop of Henle [33]. The distal segment of the S-shaped body connects to the collecting duct, forming a luminal connection, and presumptively becomes the distal tubule [34]. Nephron differentiation appears to happen sequentially along the proximal-distal axis, with markers of the podocytes appearing very early, followed by markers of the proximal tubule, then the loop of Henle, and finally the distal tubule. Through poorly defined mechanisms the S- shaped body will expand and differentiate to eventually form a mature nephron (Figure

3B). Thus far, most studies in nephron segmentation have focused on podocyte development due to the strong connection to kidney disease. Wt1 is a master regulator of podocyte differentiation via complex gene regulatory network that regulates podocyte

6 morphology and function [35, 36]. There are overlapping expression domains of Pou3f3,

Hnf1b, and Irx1/2 among the proximal, medial, and distal segments of the S-shaped body [15, 30]. Distinct spatial overlap of these domains likely regulates precise nephron patterning along the proximal-distal axis, though the significance of these overlaps has not been thoroughly investigated.

To date, the molecular mechanisms of nephron patterning and functional segmentation of the nephron tubules are not well understood. Further fate mapping and genetic studies are needed to elucidate differentiation programs for each nephron tubule segment.

The Proximal Tubule The proximal tubule is the main site of active reabsorption and the most abundant cell type in the kidney [37]. The brush border, a distinctive feature of the proximal tubule, is composed of microvilli, which increase the apical surface area of the epithelial cells. Membrane-embedded channels, transporters, and endocytic receptors along the apical and basolateral surfaces of the proximal tubule cells facilitate the resorptive function of the proximal tubule. It reabsorbs the majority of the glomerular filtrate, including glucose, phosphate, amino acids, and water. Since reabsorption requires large amounts of energy, proximal tubule cells are highly active metabolically.

Active transport within the proximal tubule depends on sodium-potassium (Na+/K+-

ATPase) pumps on the basolateral surface of the cells. The cells contain many mitochondria and utilize fatty acid oxidation to meet their energy demands [38]. The

7 high metabolic activity of the proximal tubule makes this nephron segment highly susceptible to injury from hypoxia, drug toxicity, and infection.

Morphologically and functionally, the proximal tubule is divided into three segments: S1, S2, and S3. The S1 and S2 segments are located in the outer cortex of the kidney (known as the convoluted proximal tubule), while the S3 segment extends into the outer medullary region (known as the straight proximal tubule). The S2 and S3 segments show a similar gene expression profile, while the S1 segment has a distinct transcriptional signature [39]. In the S1 segment, glucose, phosphate, and amino acids are reabsorbed from the glomerular filtrate. In the S2 segment, citrate is reabsorbed, and urate is reabsorbed and secreted. In the S3 segment, drugs and metabolites are secreted [37].

In regard to proximal tubule development, the proximal tubule arises presumably from the Jag1-expressing medial segment of the S-shaped body during nephrogenesis

[30, 32]. It has been proposed that Notch signaling is required for specification of proximal tubule cells [40, 41]. However, more recent studies in mouse kidney development have shown that Notch signaling in required for downregulation of Six2 in nephron progenitors and therefore is required for differentiation of all nephron segments

[42, 43]. No definitive specifier of the proximal tubule cell fate has been identified.

Previous studies have suggested that Cdh6-expressing cells in the developing kidney are proximal tubule progenitor cells partially because Cdh6 is expressed in the medial segment of the S-shaped body, though no lineage analysis had been performed to validate this conclusion [44]. Identification and analysis of the progenitor population could give further insight into proximal tubule cell specification and differentiation. The

8 work presented in this dissertation will further investigate these presumptive progenitors. Specification, differentiation, and maturation of the proximal tubule cells are not well understood.

Fanconi Renotubular Syndrome (FRTS)

Generalized proximal tubule dysfunction is known as Fanconi renotubular syndrome (FRTS). Patients with FRTS present with urinary wasting of water, glucose, phosphate, and amino acids as well as proximal renal tubular acidosis [45]. FRTS can be an isolated disease or part of a systemic disorder, such as Lowe’s syndrome or

Dent’s disease [46]. In its isolated form, FRTS only affects the proximal tubule, not the other nephron segments. FRTS can be acquired or congenital [47]. Acquired FRTS can occur due to nephrotoxic injury, protein depositions caused by multiple myeloma, and immunological reactions [48-52]. Most forms of genetic/inherited FRTS are manifestations of metabolic disorders. The disease mechanism is usually associated with accumulation of toxic metabolites, disruption of energy production, or disruption of transport [46, 47]. Thus far, four genetic forms of FRTS have been identified, FRTS1-4.

FRTS1 is associated with chronic kidney disease and is linked to a locus on chromosome 15, though the underlying gene has not yet been identified [53]. FRTS1 patients develop symptoms of polydipsia, polyuria, glucosuria, phosphaturia, and aminoaciduria. FRTS2 is associated with phosphate wasting, hypercalciuria, and rickets and is linked to a homozygous in-frame duplication in SLC34A1, which encodes a sodium-phosphate transporter [54, 55]. Renal tubular acidosis and proteinuria was not observed in these patients. FRTS3 is associated with acidosis, phosphaturia

9 proteinuria, aminoaciduria, glucosuria, and hypercalciuria [56]. It is linked to a heterozygous missense mutation in EHHADH, which encodes a peroxisomal enzyme

[57]. This mutation causes mistargeting of the enzyme to the mitochondria, interfering with mitochondrial function [57, 58]. FRTS4 is associated with maturity-onset diabetes of the young (MODY) and is linked to a heterozygous R76W mutation in HNF4A, a transcription factor [59]. FRTS4 patients have symptoms of glucosuria, phosphaturia, proteinuria, and nephrocalcinosis.

Current treatment of FRTS is dependent on the disease mechanism [45, 60].

Acquired FRTS is generally treated by avoidance of the causative agent [61]. If the underlying cause is not well understood, especially in cases of congenital FRTS, treatment is directed at maintaining fluids and electrolyte balance by replacing the solutes lost in the urine [62, 63]. Generally, replacing glucose and amino acids are not necessary. FRTS displays a spectrum of severity that is not well understood. Prognosis depends on the severity of the renal manifestations. Severe FRTS can lead to chronic renal failure in adolescence and adulthood [53, 64-67].

Rodent models of specific types of FRTS have been reported [47]. Clcn5 knockout mice presented with FRTS associated with Dent’s disease [68-70]. Rat and mice administered cadmium and lead presented with heavy metals induced FRTS [51,

52]. Megalin (Lrp2) knockout mice showed partial FRTS, specifically proteinuria [71].

Hnf1a knockout mice displayed symptoms of FRTS, specifically glucosuria and phosphaturia [72, 73]. There is an in vitro model of FRTS3 in which LLC-PK1 cells are stably transfected with EHHADHMUT cDNA using the Tet-On inducible system [58]. This model showed that the FRTS3 mutation caused mistargeting of Ehhadh to the

10 mitochondria. Prior to our studies, a FRTS4 Hnf4a mouse model had not been reported.

Models of FRTS4 could be used to examine the pathology of proximal tubule disorders and test potential treatments.

Hepatocyte Nuclear Factor 4 Alpha (Hnf4a) Hnf4a, a member of the nuclear receptor superfamily of ligand-dependent transcription factors (NR2A1), was first identified in rat liver nuclear extracts [74]. Hnf4a is a highly conserved transcription factor across species [75]. The Hnf4a gene is approximately 60kb long and consists of 12 exons. It has 2 promoters (P1 and P2) and at least 9 isoforms [76]. P1-driven transcription is prevalent in the adult liver and kidney, while P2-driven transcription is mostly associated with the embryonic liver and pancreas

[77]. Interestingly, P1 transcriptional activity is stronger than P2, due to the lack of the

AF-1 domain (activation function domain) in P2 isoforms [77, 78]. Hnf4a has a ligand- binding domain and a DNA-binding domain [79]. The ligand-binding domain of Hnf4a binds fatty acids and its endogenous ligand is linoleic acid in the liver [80]. However, it is unclear whether ligand binding is necessary for Hnf4a activity. Hnf4a predominantly functions as a homodimer to activate transcription, although it is able to heterodimerize with Hnf4g [81].

Hnf4a is expressed in multiple organs in vertebrate animals. It is expressed in the hepatocytes of the liver, the beta cells of the pancreas, the intestines, and the proximal tubules of the kidney [77, 82]. In the liver, Hnf4a is a master regulator of the hepatocyte differentiation program and is required for liver function [83]. In vitro, Hnf4a can induce microvilli formation in a hepatocellular carcinoma cell line [84]. Hnf4a is highly

11 expressed in the proximal tubules of the nephron and regulates expression of multiple transporter genes and drug-metabolizing enzymes, though its role in proximal tubule differentiation has been unclear [85, 86].

Hnf4a-null embryos showed early embryonic lethality due to gastrulation defects, well before kidney development begins [87]. Knockdown of Hnf4a in mouse kidney explants caused apoptosis in the cap mesenchyme [88]. Inhibition of Hnf4a by an antagonist in rat kidney explants showed that Hnf4a regulates expression of genes encoding transporters and drug metabolizing enzymes [85]. Prior to our studies, a kidney-specific Hnf4a knockout mouse model had not been reported. Therefore, the role of Hnf4a in kidney development has not been well defined. In humans, HNF4A mutations cause multiple diseases such as maturity on-set diabetes (MODY) and

Fanconi renotubular syndrome [59, 89, 90].

Rationale As previously discussed, the proximal tubule in the most abundant cell type in the kidney and is highly sensitive to hypoxic and nephrotoxic injury. Many kidney diseases are linked to proximal tubule dysfunction [64, 91-93]. However, little is known about the development of this critical cell type. Better understanding proximal tubule development will aid in development of cellular replacement therapies as well as therapeutic strategies to treat proximal tubule disorders.

Previous studies have shown that Hnf4a expression in the adult rat kidney is restricted to the proximal tubule and that Hnf4a regulates expression of multiple drug transporter genes during rat kidney development [85, 86]. A mutation in HNF4A causes generalized proximal tubule dysfunction in patients, suggesting that proper Hnf4a

12 expression is critical for proximal tubule function [59]. Therefore, Hnf4a is a good candidate as a master regulator of proximal tubule development. We set out to elucidate the role of Hnf4a in kidney development, hypothesizing that Hnf4a is required for proximal tubule specification and differentiation. The results from these studies enhance our understanding of proximal tubule development, the etiologies of proximal tubule dysfunction, and the role of the proximal tubule in the pathophysiology of kidney disease.

Scope of Dissertation The overall objective of the studies described in this dissertation is to elucidate the molecular mechanisms of Hnf4a-mediated regulation of proximal development. The studies utilize a mouse model of nephron-specific deletion of Hnf4a during kidney development.

In chapter 2, we investigated the effects of mosaic deletion of Hnf4a in nephron progenitor cells on proximal tubule formation and function. This work revealed that mosaic deletion of Hnf4a leads to a FRTS-like phenotype in mice. This study also demonstrated that loss of Hnf4a only affected proximal tubule development; the other nephron segments formed normally. Loss of Hnf4a caused reduced expression of multiple transporter genes encoding glucose transporters, phosphate transporters, and water channels. However, the Hnf4a mutant kidney was a chimera of wild-type and mutant cells, leading to difficulties in determining the molecular targets of Hnf4a and whether proximal tubules were necessary for postnatal survival.

13 In chapter 3, we further investigated the molecular mechanisms underlying Hn4a- mediated maturation of proximal tubules and characterized the phenotype for complete

Hnf4a knockout in the murine kidney. Transcriptomic analysis of the Hnf4a mutant and genome-wide analysis of Hnf4a binding sites identified the downstream targets of Hnf4a in the kidney. This work revealed that complete deletion of Hnf4a led to complete loss of mature proximal tubules and that mature proximal tubules were required for postnatal survival. Our studies also demonstrated that Cdh6-expressing cells are proximal tubule progenitor cells and that Hnf4a is required for the transition of Cdh6-expressing proximal tubule progenitors to more mature proximal tubule cells.

In chapter 4, we present the conclusions of our studies and future directions to further elucidate the role of Hnf4a in proximal tubule maturation as well as the molecular mechanisms of proximal tubule development and function.

Figure 1. Mouse kidney development. (A) Mouse metanephric kidney development starts at E11.5 with budding of the nephric duct into the metanephric mesenchyme. (B) The late embryonic kidney is a mosaic of nephrons at different stages development and maturation. Panel A is adapted from McMahon, 2016 [15]. Panel B is adapted from McMahon et al, 2016 [94].

A B

E15.5

Figure 1. Mouse kidney development.

15 Figure 2. Reciprocal interactions between with the metanephric mesenchyme and ureteric bud during mammalian kidney development. Adapted from Nishinakamura, 2019 [95].

Figure 2. Reciprocal interactions between the metanephric mesenchyme and the ureteric bud.

16 Figure 3. Nephrogenesis and nephron patterning. (A) Nephron progenitors undergo MET to form the polarized renal vesicle. The renal vesicle elongates into the patterned S-shaped body. (B) The S-shaped body will develop into the segments of the nephron. Figure from McMahon, 2016 [15].

Figure 3. Nephrogenesis and nephron patterning.

17 CHAPTER 2: Hnf4a deletion in the mouse kidney phenocopies Fanconi renotubular syndrome

Sierra S. Marable1,2, Eunah Chung1, Mike Adam2, S. Steven Potter2, and Joo-Seop

Park1,2,*

1Division of Pediatric Urology, Cincinnati Children’s Hospital Medical Center, 3333

Burnet Avenue, Cincinnati, OH 45229, USA

2Division of Developmental Biology, Cincinnati Children’s Hospital Medical Center, 3333

Burnet Avenue, Cincinnati, OH 45229, USA

The authors have declared that no conflict of interest exists.

*Corresponding author:

Joo-Seop Park

TEL: 513-803-7871

Email: [email protected]

Keywords: Development, Nephrology

Keywords: Embryonic development, Genetic diseases, Organogenesis

JCI Insight. 2018 Jul 26; 3(14): e97497.[96]

Published online 2018 Jul 25. doi: 10.1172/jci.insight.97497

18 Abstract Different nephron tubule segments perform distinct physiological functions, collectively acting as a blood filtration unit. Dysfunction of the proximal tubule segment can lead to

Fanconi renotubular syndrome, whose major symptoms are excess excretion of water, glucose, and phosphate in the urine. It has been shown that a mutation in HNF4A is associated with Fanconi renotubular syndrome in humans and that Hnf4a is expressed specifically in proximal tubules in adult rat nephrons. However, little is known about the role of Hnf4a in nephrogenesis. Here, we find that Hnf4a is expressed in both presumptive and differentiated proximal tubules in the developing mouse kidney. We show that Hnf4a is required for the formation of differentiated proximal tubules but is dispensable for the formation of presumptive proximal tubules. Furthermore, we show that loss of Hnf4a decreased the expression of proximal tubule-specific genes. Adult

Hnf4a mutant mice presented with Fanconi renotubular syndrome-like symptoms, including polyuria, polydipsia, glycosuria, and phosphaturia. Analysis of the adult Hnf4a mutant kidney also showed proximal tubule dysgenesis and nephrocalcinosis. Our results demonstrate the critical role of Hnf4a in proximal tubule development and provide mechanistic insight into the etiology of Fanconi renotubular syndrome.

19 Introduction Fanconi renotubular syndrome (FRTS) is caused by proximal tubule dysfunction leading to impaired reabsorption of water and organic solutes, such as glucose, amino acids, and phosphate [37, 45, 60]. The proximal tubule is responsible for approximately 65% of all reabsorption in the nephron, including 70% of water, 99-100% of glucose, and 85% of phosphate [3, 46, 97]. In FRTS, impaired reabsorption results in excessive excretion of these solutes and water in the urine. In recent years, it was shown that single gene mutations are associated with hereditary FRTS. In a subset of patients, a heterozygous mutation in the HNF4A gene has been found [59]. FRTS only affects the proximal tubule, not other segments of the nephron, implying that the function of HNF4A is important specifically in the proximal tubule [46].

HNF4A encodes a member of the nuclear receptor superfamily of ligand- dependent transcription factors [74]. Hnf4a is at the center of a complex regulatory network that controls metabolism and hepatocyte differentiation [98, 99]. However, its role in the kidney is poorly understood. An analysis of gene expression in the developing mouse kidney identified Hnf4a as a candidate anchor gene within the proximal tubule, suggesting that its expression is specific to this segment of the kidney

[100]. In the adult rat nephron, Hnf4a is expressed specifically in proximal tubules [86].

A recent study has shown that Hnf4a regulates expression of drug transporters in the rat kidney [85], many of which are specifically expressed in the proximal tubules. These data suggest that Hnf4a plays an important role in the proximal tubule. Here, we examined the role of Hnf4a in proximal tubule development using a murine model of nephron-specific deletion of Hnf4a. We found that Hnf4a is required for the formation of differentiated proximal tubules but is not necessary for the formation of presumptive

20 proximal tubules. Due to the resulting paucity of proximal tubules, the Hnf4a mutant mice presented with Fanconi renotubular syndrome-like symptoms.

Results Hnf4a is expressed in both presumptive proximal tubules and differentiated proximal tubules. In order to investigate the role of Hnf4a in the developing nephron, we examined its spatial and temporal expression during nephrogenesis. We performed lineage tracing of the nephron progenitors by employing Six2GFPcre, which specifically targets mesenchymal nephron progenitors [22, 28]. We found that, when cells in the nephron lineage were labeled with an EYFP reporter [101], all Hnf4a+ cells were positive for EYFP (Supplemental Figure 1), suggesting that Hnf4a is expressed only in the nephron lineage in the kidney. In the nascent S-shaped body, whose medial segment expresses Jag1, no Hnf4a was detected (Figure 1A). However, in the more mature and extended S-shaped body, where the Jag1 expression domain was expanded, Hnf4a was detected in a subset of Jag1+ cells (Figure 1B). It is likely that

Hnf4a+ cells in the extended S-shaped body develop into proximal tubules.

Lotus tetragonolobus lectin (LTL) staining is widely used to detect proximal tubule cells. LTL strongly binds to carbohydrates of glycoproteins, which are abundant in the proximal tubule cells [102, 103]. We found that Hnf4a was expressed in LTL stain+ proximal tubules (Figure 1C). With close inspection, we found two populations of

LTL stain+ cells (LTL-low and LTL-high) in the kidney (Figure 1C). LTL-high cells showed strong LTL staining in their entire cell bodies. By contrast, LTL-low cells showed only weak LTL staining in their apical (luminal) membrane. Both LTL-high and LTL-low cells expressed Hnf4a. LTL-low cells are located more cortically where early

21 nephrogenesis occurs, suggesting LTL-low cells are nascent proximal tubule cells. LTL- high cells are located closer to the medullary region, suggesting a more differentiated state. Furthermore, the distance between Hnf4a+ nuclei was increased in LTL-high cells, suggesting that these cells were significantly larger than LTL-low cells (Figure

1C). It is therefore likely that LTL-low and LTL-high cells represent presumptive and differentiated proximal tubules, respectively.

Loss of Hnf4a in the nephron lineage causes a defect in proximal tubule formation.

Hnf4a-null mice exhibit early embryonic lethality due to gastrulation defects [87]. In order to investigate the role of Hnf4a during nephrogenesis, we conditionally deleted

Hnf4a [104] in the nephron lineage using Six2GFPcre. Hnf4a mutants

(Hnf4ac/c;Six2GFPcre) were collected at embryonic day 18.5 (E18.5). Littermate heterozygotes (Hnf4ac/+;Six2GFPcre) were used as controls. Although there was no apparent difference in kidney size at this stage, Hnf4a mutant kidneys exhibited a defect in proximal tubule formation (Figure 2A).

We found that the Hnf4a mutant kidney had both LTL-high and LTL-low cells.

However, the mutant kidney had significantly fewer LTL-high cells than its control

(Figure 2A). In the Hnf4a mutant kidney, although LTL-low cells were negative for

Hnf4a, LTL-high cells were still positive for Hnf4a, indicating that these cells had escaped Cre-mediated deletion of Hnf4a and still expressed Hnf4a. This result strongly suggests that the Hnf4a mutant nephron progenitors can form LTL-low cells but these

LTL-low cells fail to develop into LTL-high cells. These data are consistent with a model

22 where Hnf4a is required for presumptive proximal tubules (LTL-low cells) to develop into differentiated proximal tubules (LTL-high cells).

As implied by its specific expression in the proximal tubule, we found that the loss of Hnf4a did not affect the formation of the other segments of the nephron. We examined nephron segmentation in the Hnf4a mutant kidney and found that the formation of podocytes (Wt1+), loops of Henle (Slc12a1+), and distal tubules (Slc12a3+) was not affected by deletion of Hnf4a (Figure 2B). In order to quantify nephron segmentation of the Hnf4a mutant kidney, we performed quantitative reverse transcription PCR (RT-qPCR) of genes expressed in specific segments of the nephron

(Figure 2C). Our RT-qPCR data showed that proximal tubule-specific expression of

Slc34a1 was significantly decreased in the Hnf4a mutant kidney. Although expression of the marker genes for the other nephron segments (Nphs2: podocytes; Slc12a1: loop of

Henle; Slc12a3: distal tubule) was slightly upregulated in the Hnf4a mutant kidney, their upregulation was not statistically significant. Taken together, our data demonstrate that loss of Hnf4a specifically inhibits the formation of proximal tubules without affecting the formation of the other segments of the nephron.

Hnf4a is required for the formation of differentiated proximal tubule cells. To determine whether there is differential gene expression in LTL-low cells versus LTL-high cells, we looked at previously published single cell RNA-seq (scRNA-seq) data of the neonatal mouse kidney (Supplemental Figure 2) [39]. scRNA-seq analysis identified two distinct populations of proximal tubules cells, presumptive proximal tubule and differentiated proximal tubule. While presumptive proximal tubule cells, like differentiated proximal

23 tubule cells, express proximal tubule marker genes, their transcriptional profile is closer to that of epithelial nephron progenitors, as shown by the tSNE plot of our scRNA-seq

(Supplemental Figure 2A). We identified Lrp2 as a gene expressed in both presumptive proximal tubule cells and differentiated proximal tubule cells. Lrp2, also known as megalin, encodes an endocytic receptor that is important for uptake of macromolecules and is highly expressed in adult proximal tubules [71]. Presumptive proximal tubule cells express Lrp2 as well as low levels of Hnf4a. We also identified Ass1 as a gene that shows high expression in differentiated proximal tubule cells but little expression in presumptive proximal tubule cells. Ass1 encodes the enzyme argininosuccinate synthase 1, which is a component of the urea cycle [105]. Differentiated proximal tubule cells express Lrp2, Hnf4a, and Ass1 whereas presumptive proximal tubule cells express

Lrp2 and Hnf4a (Supplemental Figure 2, B-D). There is little expression of Ass1 in presumptive proximal tubule cells (Supplemental Figure 2D). This suggests that Ass1 is a marker for mature, differentiated proximal tubule cells. Based on these data, we hypothesized that LTL-low cells would express Lrp2 but not Ass1 and LTL-high cells would express both Lrp2 and Ass1. We used immunofluorescence staining of Lrp2 and

Ass1 to assess their expression in Hnf4a mutant and control kidneys (Figure 3). As predicted by scRNA-seq, in the control kidney, Lrp2 was expressed in LTL-low cells, consistent with the idea that LTL-low cells represent presumptive proximal tubule cells.

In the Hnf4a mutant kidney, LTL-low cells were Lrp2+ and Hnf4a-, suggesting that

Hnf4a is not required for Lrp2 expression or the formation of presumptive proximal tubule cells. In the control kidney, Ass1 was expressed in LTL-high cells with little to no expression in LTL-low cells (Figure 3B), indicating that Ass1 is a marker of differentiated

24 proximal tubule cells. In the Hnf4a mutant kidney, all Ass1+ cells were Hnf4a+, suggesting that these Ass1+ cells were actually un-recombined “escaper” cells and that

Hnf4a is required for Ass1 expression. This indicates that Hnf4a is required for the formation of differentiated proximal tubule but is dispensable for presumptive proximal tubule formation.

Loss of Hnf4a causes downregulation of proximal tubule-specific genes. From previously published scRNA-seq data [39], we identified genes that are preferentially expressed in each nephron segment. We examined expression of these nephron segmentation marker genes in conventional RNA-seq analysis of Hnf4a mutant and control kidneys at E18.5. Our results revealed that the Hnf4a mutant kidneys showed a significant decrease in the expression of proximal tubule genes, with minimal changes in the expression of other nephron segment genes, reflecting the reduced number of proximal tubule cells (Figure 4A). Gene ontology (GO) analysis for biological processes showed that the expression of genes involved in metabolism and anion transport was decreased in the Hnf4a mutant kidney (Figure 4B). This is consistent with the fact that the proximal tubule is the major site of organic anion transport in the kidney and has a role in the metabolism of proteins and peptides [106-108]. GO analysis for cellular components showed that the expression of genes associated with the brush border membrane, a characteristic of the proximal tubule, was decreased in the Hnf4a mutant kidney (Supplemental Figure 3A). Loss of Hnf4a caused reduced expression of genes associated with abnormal renal absorption and abnormal urine homeostasis in mouse models (Supplemental Figure 3B), also reflecting the paucity of proximal tubule cells in

25 the Hnf4a mutant kidney. These findings are consistent with a role for Hnf4a in proper proximal tubule development.

Hnf4a mutant mice recapitulate an FRTS-like phenotype. To determine whether deletion of Hnf4a leads to characteristics of FRTS in mice, we examined the metabolic phenotype of the Hnf4a mutant mice. The Hnf4a mutant mice were viable, likely due to the nephron progenitors that escaped Cre-mediated deletion of Hnf4a. In order to assess renal function, urine was collected from two to three month-old Hnf4a mutant mice (Hnf4ac/c;Six2GFPcre) and their control littermates (Hnf4ac/+ or

Hnf4ac/+;Six2GFPcre). We measured water intake and urine volume over a period of 24 hours. We found that, similar to FRTS patients, the Hnf4a mutant mice drank more water (polydipsia) and excreted more urine (polyuria) than their control littermates

(Figure 5, A and B). Polydipsia can be attributed to polyuria caused by defective reabsorption of water in the proximal tubules [45]. To determine the cause of defective water reabsorption, we examined the expression of aquaporins (water transporters) that are known to function in the proximal tubule. Aqp1, Aqp7, and Aqp11 are expressed in the proximal tubules and are important for water reabsorption in the proximal tubule [3,

109, 110]. Aqp1 null mice exhibit polydipsia and polyuria, similar to the Hnf4a mutant mice [111]. Expression of proximal tubule aquaporins was decreased in the Hnf4a mutant, reflecting the decreased number of proximal tubule cells (Figure 5E). Reduced expression of aquaporin genes in the Hnf4a mutant kidneys most likely causes the polydipsia and polyuria phenotype.

26 Urinalysis showed that the Hnf4a mutant mice excreted more glucose

(glycosuria) and phosphate (phosphaturia) into their urine compared to control littermates (Figure 5, C and D). Since proximal tubule cells are responsible for reabsorption of glucose and phosphate, excess amounts of these solutes in the urine indicate proximal tubule dysfunction [37, 45]. The principal glucose transporters expressed in the proximal tubule are Slc5a1, Slc5a2, and Slc2a2 [112]. Slc5a1 and

Slc5a2 are sodium-dependent glucose transporters (SGLTs) responsible for glucose reabsorption in the proximal tubule [112, 113]. Mutations in SLC5A1 and SLC5A2 are associated with glucose-galactose malabsoprtion and familial renal glycosuria, respectively [113]. Slc2a2 is a facilitated glucose transporter (GLUT2) that is responsible for the transport of glucose through the basolateral membrane of proximal tubule cells [113, 114]. Slc2a2 knockout in mice induces glycosuria [115]. SLC2A2 deficiency is linked to Fanconi-Bickel syndrome, a glycogen storage disease [113].

Many of these patients also present with glycosuria [114, 116]. Since the Hnf4a mutants presented with renal glycosuria (Figure 5C), it is likely that they have a loss of glucose transporters. RNA-seq analysis showed that the expression of proximal tubule glucose transporters was decreased in the Hnf4a mutant (Figure 5E), implicating loss of glucose transporters as the cause of the renal glycosuria in the Hnf4a mutant.

The principal sodium-phosphate transporters expressed in the proximal tubule are Slc20a2, Slc34a1, and Slc34a3 [117, 118]. These phosphate transporters are located in the apical brush border membrane of the proximal tubule and loss of these transporters leads to phosphaturia [117]. RNA-seq analysis confirmed decreased expression of the proximal tubule phosphate transporters in the Hnf4a mutant (Figure

27 5E). This is consistent with the increased excretion of urinary phosphate in the Hnf4a mutant (Figure 5D). The amount of phosphate reabsorbed by the proximal tubules is dependent on the number of phosphate transporters [119], suggesting the loss of the proximal tubule cells in the Hnf4a mutant caused loss of phosphate transporters, leading to the phosphaturia phenotype. These data suggest that loss of transporters due to paucity of proximal tubule cells contributes to the FRTS-like phenotype in the

Hnf4a mutant mice.

Hnf4a mutant mice display renal tubular dysgenesis and nephrocalcinosis. In order to investigate the renal pathology of the FRTS phenotype, we examined the morphology of the Hnf4a mutant kidney. The kidneys of adult Hnf4a mutant mice were smaller than their controls (data not shown). The Hnf4a mutant kidney was highly disorganized with fewer proximal tubules (Figure 6A). All of the proximal tubule cells in the Hnf4a mutant kidney were positive for Hnf4a, indicating that these Hnf4a+ cells had escaped Cre- mediated deletion of Hnf4a. Patients with the R76W mutation in HNF4A are known to present with nephrocalcinosis [59]. Nephrocalcinosis refers to the deposition of calcium in the renal parenchyma. Loss of the phosphate transporter Slc34a1 has also been linked to nephrocalcinosis in mouse models [120]. The Hnf4a mutant had decreased expression of Slc34a1 (Figure 2C and 5E), suggesting that the Hnf4a mutant may have nephrocalcinosis. In order to examine calcium deposition in the mutant kidney, we performed Von Kossa staining on paraffin sections of 2 month-old adult kidneys. Hnf4a mutant kidneys showed calcium accumulation in the renal tubules, suggesting that the

28 loss of Hnf4a causes nephrocalcinosis (Figure 6B). This reaffirms that the Hnf4a mutant recapitulates the FRTS patient phenotype.

Discussion The nephron is segmented into the renal corpuscle, proximal tubule, loop of

Henle, and distal tubule along the proximal-distal axis. Different nephron tubule segments contain specific types of epithelial cells that carry out distinct physiological functions and collectively act as a blood filtration unit. It is still poorly understood how distinct segmental identities of the nephron are specified during nephrogenesis. Here we show that Hnf4a is a key transcription factor that controls the development of the proximal tubule segment.

Proximal tubules are the most abundant cell type present in the nephron. Its major function is reabsorption. Defective proximal tubule function causes FRTS, whose symptoms include impaired reabsorption of phosphate, amino acids, glucose, and other organic solutes [60]. Currently, treatment for FRTS is to replace the lost solutes by administering fluids and electrolytes [45, 60]. Even with treatment, FRTS can lead to chronic kidney failure in adolescence or adulthood [60]. Previous mouse models of

FRTS have utilized either knockout of endocytic genes, such as megalin and cubilin, or the administration of heavy metals to induce FRTS [47]. Our mouse model utilizes a gene that has been linked to inherited FRTS in human patients. A heterozygous R76W mutation in the HNF4A gene was identified in three family members with FRTS [59].

This mutation was subsequently identified in three unrelated carriers with FRTS [59].

From our findings, we can speculate that the HNF4A R76W mutation is a loss-of- function or hypomorphic mutation, likely causing paucity of proximal tubules. Since the

29 R76 residue is located in the DNA-binding domain of the HNF4A gene [121], it is likely that the R76W mutation interferes with the binding of Hnf4a to its target genes.

Considering the important roles of proximal tubules in renal function, a complete lack of proximal tubules would cause lethality. However, the mosaic expression of

Six2GFPcre in our mouse model causes a subset of nephron progenitor cells to

“escape” Cre-mediated deletion of Hnf4a in the mutant kidney, allowing most of the mutant mice to survive with significantly reduced numbers of proximal tubules. The paucity of proximal tubules caused the mutant mice to recapitulate FRTS phenotypes.

In addition to polyuria, polydipsia, glycosuria, and phosphaturia, the Hnf4a mutant mice exhibited nephrocalcinosis, highlighting the importance of proximal tubule function in renal regulation of calcium.

Our study shows that proximal tubule development is a multi-step process. By analyzing previously published scRNA-seq of the newborn mouse kidney [39], we identified two cell populations that represent different stages of proximal tubule development. Both presumptive proximal tubules and differentiated proximal tubules express Lrp2 and Hnf4a, two well-known proximal tubule marker genes. However, we observed that the expression of other proximal tubule marker genes, such as Slc34a1 and Ass1, is largely absent in presumptive proximal tubules, indicating their immature status. It appears that expression of these genes is activated after differentiated proximal tubules are formed. Our data strongly suggest that Hnf4a regulates the development of presumptive proximal tubules into differentiated proximal tubules.

Further investigation is required to characterize other regulators of proximal tubule development. The previous model of proximal tubule development suggested

30 that Notch signaling promotes the formation of the proximal tubule and represses the formation of the distal tubule segment [40, 41, 122]. However, we have recently shown that Notch signaling is required for the formation of all nephron segments and activation of Notch signaling in the developing nephron shows no effect on nephron segmentation in the mouse kidney [42, 43]. It has been shown that, in the zebrafish pronephros, retinoic acid signaling promotes the formation of proximal tubules and represses the formation of distal tubules [123, 124]. Considering the clear role of retinoic acid signaling in pronephros segmentation, it will be interesting to investigate potential interaction between retinoic acid signaling and Hnf4a in mammalian proximal tubule segmentation. It is possible that retinoic acid signaling may regulate proximal tubule development by activating the expression of Hnf4a, or alternatively Hnf4a and retinoic acid receptors may coordinate to promote the development of proximal tubules by regulating common target genes, as shown in human hepatocytes [99, 125].

31 Methods Mice. All mouse alleles used in this study have been previously published:

Six2tm1(tTA,tetO-EGFP/cre)Amc (Six2GFPcre) [22, 28]; Hnf4atm1Sad (Hnf4ac/c) [104];

Gt(ROSA)26Sortm3(CAG-EYFP)Hze (Rosa26EYFP) [101]. All mice were maintained in the

Cincinnati Children’s Hospital Medical Center (CCHMC) animal facility according to animal care regulations.

Immunofluorescence. Embryonic, neonatal, and adult murine kidneys were fixed in 4%

PFA/PBS, incubated overnight in 10% sucrose/PBS at 4°C, and imbedded in OCT

(Fisher Scientific). Cryosections (9μm) were incubated overnight with primary antibodies in 5% heat-inactivated sheep serum/PBST (PBS with 0.1% Triton X-100). We used the primary antibodies for GFP (1:500, Aves GFP-1020), Jag1 (1:20, DSHB TS1.15H), Wt1

(1:100, Santa Cruz sc-7385), Biotin-LTL (1:500, Vector Labs B-1325), FITC-LTL (1:200,

Vector Labs FL-1321), Slc12a1 (1:500, Proteintech 18970-1-AP), Slc12a3 (1:300,

Sigma HPA028748), Hnf4a (1:1000, Santa Cruz sc-8987X or 1:500, Abcam ab41898),

Lrp2 (1:100, Santa Cruz sc-515772), and Ass1 (1:500, Proteintech 16210-1-AP).

Fluorophore-labeled secondary antibodies were used for indirect visualization of the target. Images were taken with a Nikon Ti-E widefield microscope equipped with an

Andor Zyla camera and Lumencor SpectraX light source housed at the Confocal

Imaging Core (CIC) at CCHMC.

Quantitative reverse transcription PCR (RT-qPCR). Control or Hnf4a mutant embryonic kidneys at E18.5 were placed in RNAlater overnight at 4°C. Total RNA was extracted using the Qiagen RNeasy Micro Kit (Qiagen 74004) according to manufacturer’s

32 instructions for dissected animal tissues. RNA concentration was measured with

NanoDrop 2000c (Thermo Scientific). Using ~2 μg total RNA, reverse transcription was performed using the RevertAid cDNA Synthesis Kit (Thermo Scientific, K1621). qPCR was performed on an Applied Biosystems StepOne Plus (Thermo Scientific) using

Power SYBR Green PCR Master Mix (Thermo Scientific, 4368706). Oligonucleotide primers (5’-3’, forward and reverse) used were: Gapdh,

CAACTTTGTCAAGCTCATTTCCTG and CCTCTCTTGCTCAGTGTCCTT; Nphs2,

CTCTGGCCCTAACATCTCCA and TTCAGTGAGCAAGCAACCAG; Slc34a1,

TGCTGAGAGACACTCCGTTG and TATTGGGGTGGCAAATTCTC; Slc12a1,

AGCGGGCTCTCCTTAAGTTC and CTCAGGAGGCCAAGCAGAAT; Slc12a3,

AGCTGGAGAAGAGGCTTCAA and TGCAACTTCAAGGTCCAGAA. Two biological replicates of control kidneys and three biological replicates of Hnf4a mutant kidneys were used. Fold expression calculations were obtained using the ΔΔCt method.

Von Kossa staining. Adult murine kidneys were fixed in 4% PFA/PBS overnight, dehydrated in 50% ethanol/PBS and 70% ethanol/PBS and stored at 4°C in 70% ethanol/PBS before washing in xylene and embedding in paraffin. Von Kossa staining was performed on paraffin sections (5μm) by the CCHMC Pathology Research Core using standard protocols. Stained slides were imaged using a Nikon 90i upright widefield microscope.

RNA-seq. We isolated mRNA from 1 g total RNA using NEBNext Poly(A) mRNA

Magnetic Isolation Module (E7490, New England Biolabs) following manufacturer’s

33 instructions. Fragmentation of RNA followed by reverse transcription and second strand cDNA synthesis was done using NEBNext Ultra RNA Library Prep Kit for Illumina

(E7530, NEB) following manufacturer’s instructions. The resulting double-stranded cDNA’s were further processed to DNA sequencing libraries using ThruPLEX DNA-seq

12S Kit (R400428, Clontech Laboratories). Libraries were size-selected by gel purification for an average size of 350bp. Each purified library was quantified using a

Qubit fluorometer (Life Technologies) and equal amounts of each library were pooled and submitted for sequencing on the Illumina HiSeq 2500 by the DNA Sequencing and

Genotyping Core at CCHMC. All RNA-seq reads were aligned to mm9 using Tophat

(ver2.0.11) and the BAM files were generated using Samtools (ver0.1.19). Normalized gene expression values were calculated using Cufflinks (ver2.1.1). Data are available in

Gene Expression Omnibus under accession number GSE112828.

Gene ontology analysis. Gene ontology analysis was performed using DAVID

Bioinformatics Resources on differentially expressed genes identified from the RNA-seq analysis [126, 127].

Single cell RNA-seq data analysis. Single cell RNA-seq (Drop-seq) analysis of P1 mouse kidney cells (GSE94333) was previously described [39]. The cells from four drop-seq experiments were merged and batch effects were minimized using Seurat’s canonical correlation analysis. Cell-type clusters and markers genes were identified using the R3.4.1 library Seurat2.0.1. All clustering was unsupervised, without driver genes. The influence of the number of unique molecular identifiers was minimized using

34 Seurat’s RegressOut function. Initial cell filtering selected cells that expressed >1000 genes. Genes included in the analysis were expressed in a minimum of three cells. Only one read per cell was needed for a gene to be counted as expressed per cell. The resulting gene expression matrix was normalized to 10,000 molecules per cell and log transformed. Cells containing high percentages of mitochondrial, histone or hemoglobin genes were filtered out. Genes with the highest variability among cells were used for principal components analysis. Clustering was performed with Seurat’s t-SNE implementation using significant principal components determined by JackStraw plot.

Marker genes were determined for each cluster using Seurat’s FindAllMarkers function using genes expressed in a minimum of 10% of cells and fold change threshold of 1.3.

Over/under clustering was verified via gene expression heatmaps.

Urine analysis. Nine Hnf4a mutant mice and their control littermates (five males and four females) were placed individually in metabolic cages (Tecniplast, Cat No. 01-814-25,

Fisher Scientific). Mice were fed and received water ad libitum. Food and water consumption was measured for 24 hours. Urine was collected after 24 hours. Urine samples were centrifuged at 3000 RPM for 5 minutes at 4°C. The supernatant was stored at -80°C until testing. Glucose concentration tests and phosphate concentration tests were performed by Cincinnati Veterinary Laboratory, INC and IDEXX Laboratories.

Statistics. Box-and-whiskers plots show median (line in box), 25th and 75th percentile

(lower and upper edges of box, respectively), and minimum and maximum values

(whiskers). For the RNA-seq data, the whiskers are drawn to the 1st percentile and the

35 99th percentile. Comparisons between RNA-seq analysis of nephron segmentation markers were assessed using a one-way ANOVA with Tukey’s HSD post-hoc analysis.

Two-tailed Student’s t test was used for comparisons of RT-qPCR analysis between the control and mutant. Two-tailed Student’s t test was used for comparison of urinalysis results between the control and mutant groups. P values <0.05 were considered to be statistically significant.

Study approval. All experiments were performed in accordance with animal care guidelines and the protocol was approved by the Institutional Animal Care and Use

Committee of the Cincinnati Children’s Hospital Medical Center (IACUC2017-0037 and

IACUC2017-0011). We adhere to the NIH Guide for the Care and Use of Laboratory

Animals.

36 Author Contributions

SSM performed most of the experiments. EC performed conventional RNA-seq. MA and

SSP performed single cell RNA-seq analysis. SSM and JSP designed the experiments, analyzed the data, and co-wrote the manuscript.

Acknowledgments We thank Matt Kofron and the Confocal Imaging Core at CCHMC for help with microscopy and Elizabeth Mann for help with urinalysis. This work was supported by the

National Institutes of Health/NIDDK (R01 DK100315 to J.-S.P.) and the National

Institutes of Health/NHLBI (T32 HL007752 to S.S.M.).

37 Figures

A Hoechst Jag1 Hnf4a Jag1 Hnf4a

B Hoechst Jag1 Hnf4a Jag1 Hnf4a

C Hoechst LTL Hnf4a LTL Hnf4a

D M

Figure 1. Hnf4a is expressed in the developing nephron. (A) In nascent S-shaped body (SSB), Hnf4a is not detected. Representative image of n=3. Scale bar, 25μm. (B) Hnf4a is expressed in a subset of Jag1+ cells in the medial segment of the elongated SSB. Scale bar, 25μm. Image is representative of n=3. (C) Hnf4a is detected in presumptive proximal tubule (PT) cells and differentiated PT cells. Presumptive PT cells show weak LTL staining and are located more cortically, where early stages of nephrogenesis occur. Differentiated PT cells show strong LTL staining and are located closer to the medullary region. Image is representative of n=3. Scale bar, 100μm.

38 Figure 1. Deletion of Hnf4a by Six2GFPcre leads to a defect in proximal tubule (PT) formation.

A Hnf4ac/+;Six2GFPcre Hnf4ac/c;Six2GFPcre B Hnf4ac/+;Six2GFPcre Hnf4ac/c;Six2GFPcre LTL Hnf4a Wt1 Hoechst

LTL Slc12a1 Hoechst

Hnf4a Slc12a3 Hoechst

Hoechst C Nphs2 Slc34a1 * Slc12a1 Slc12a3 0 1 2 Fold Change (mutant/control)

Figure 2. Deletion of Hnf4a by Six2GFPcre leads to a defect in proximal tubule (PT) formation. (A) Loss of Hnf4a in the developing nephron inhibits the formation of differentiated PTs. Presumptive PTs show weak LTL staining at their apical side (marked by white arrowheads, LTL-low). Differentiated PTs have strong LTL staining (marked by yellow arrowheads, LTL-high). The Hnf4a mutant kidney (right column) has fewer LTL-high cells and these LTL-high cells still express Hnf4a, suggesting that they escaped Cre-mediated deletion of Hnf4a. Images are representative of n=3. (B) Deletion of Hnf4a does not affect formation of other nephron segments (WT1, podocytes; Slc12a1, loop of Henle; Slc12a3, distal tubule). Images are representative of n=4 Hnf4a mutants and n=2 controls. (C) RT-qPCR analysis of segment-specific markers shows that PT-specific expression of Slc34a1 is significantly lower in the Hnf4a mutant kidney compared to the control (Nphs2,podocyte; Slc34a1, proximal tubule; Slc12a1, loop of Henle; Slc12a3, distal tubule). n=3; Errors bars indicate standard deviation. *P-value < 0.05, determined by Student’s t test. Scale bars, 100μm.

39 Figure 2. Hnf4a is dispensable for the formation of presumptive PT (LTL-low) cells but A Hoechst LTL Lrp2 Hnf4a Lrp2 LTL Lrp2 Hnf4a

required for the formation of differentiated PT (LTL-high) cells.

;

n H

B Hoechst LTL Ass1 Hnf4a Ass1 LTL Ass1 Hnf4a

;

n H

Figure 3. Hnf4a is dispensable for the formation of presumptive PT (LTL-low) cells but required for the formation of differentiated PT (LTL-high) cells. (A) Lrp2 is detected in LTL- low (white arrowheads) and LTL-high cells. The Hnf4a mutant kidney has Lrp2+ Hnf4a- cells, indicating that Hnf4a is dispensable for the formation of presumptive PT cells. (B) Ass1 is detected in LTL-high cells but not in LTL-low cells (white arrowheads). In the Hnf4a mutant kidney, there are no Ass1+ Hnf4a- cells, suggesting that Hnf4a is required for the formation of differentiated PT cells. Scale bars, 100μm. Images are representative of n=4 Hnf4a mutant and n=2 control kidneys.

40 Figure 3. Deletion of Hnf4a by Six2GFPcre results in decreased expression of PT-specific genes.

A 3 3

2 2

)

l o

) *

o r

n 1 1

n n

a 0 0

(

2 2

g -1-1

L L

-2-2

-3-3

d T T o H Pod PT LOOH DT P L

B -log10p 0 2 4 6 8 10 12 14 16 18

organic acid metabolic process carboxylic acid metabolic process small molecule catabolic process anion transport oxoacid metabolic process organic anion transport

Figure 4. Deletion of Hnf4a by Six2GFPcre results in decreased expression of PT-specific genes. (A) RNA-seq analysis of E18.5 kidneys shows that loss of Hnf4a in the nephron lineage primarily affects expression of PT-specific nephron segmentation markers. Results are represented as box plots. The box boundaries represent the upper and lower quartiles, the horizontal line represents the median, the whiskers are drawn to the 1st and 99th percentile, the dots represent the outlier values. *P<0.0001, determined by one-way ANOVA. (Pod, podocyte; PT, proximal tubule; LOH, loop of Henle; DT, distal tubule) (B) Gene ontology analysis with PT- specific genes that are downregulated in the Hnf4a mutant kidney at E18.5 shows enrichment of genes associated with metabolism and transport.

41 Figure 4. Hnf4a mutant mice recapitulate Fanconi renotubular Water Consumption Urine Excretion syndromeA phenotypes. B 30 18 * * 16 25

14 )

Figure 5. Adult Hnf4a mutant has disorganized) PTs and L

20 L 12

m (

nephrocalcinosis.Figure 6. Hnf4a mutant( mice recapitulate

10 e

Fanconi renotubular15 syndrome phenotypes.e m

m 8

l o

10 o 6

V V 4 5 Figure 7. Adult Hnf4a mutant has disorganized2 PTs and nephrocalcinosis.0 0 Control Mutant Control Mutant

Urine Glucose Urine Phosphate

FigureC ) 8. Adult Hnf4a mutant has disorganizedD PTs and L 1400

m 6 *

nephrocalcinosis./ Figure 9. *Hnf4a mutant mice recapitulate g

d 1200

Fanconi( renotubular syndrome phenotypes. )

g n

o 1000

(

a 4 d r

t 800

n e Figuree 10. Adult Hnf4a mutant has disorganized PTs and

r 3 c

600 c

n x

nephrocalcinosis.o Figure 11. Hnf4a mutant mice recapitulate E

C 2

Fanconi4 renotubular00 syndrome phenotypes.4

s P

o 200 1

u l

G 0 0 Control Mutant Control Mutant

E Water Glucose Phosphate Transporters Transporters Transporters

2 1 3 1 1 2 2 a a a 1 7 1 a a a 0 4 4 p p p 5 5 2 2 3 3 q q q lc lc lc lc lc lc A A A S S S S S S

00.0.0

)

) l

o -0-0.5.5

n a

a -1-1.0.0

(

o L

L -1-1.5.5

-2-2.0.0

Figure 5. Hnf4a mutant mice recapitulate Fanconi renotubular syndrome phenotypes. Symptoms include polydipsia (A), polyuria (B), increased urine glucose concentration (C), and excessive phosphate excretion (D). Water and urine were measured for 24 hours. Results are represented as box plots. The box boundaries represent the upper and lower quartiles, the horizontal line represents the median, the whiskers represent the minimum and maximum values. Control = Hnf4ac/+;Six2GFPcre or Hnf4ac/+; Mutant = Hnf4ac/c;Six2GFPcre. n=9; *P-value < 0.05, determined by Student’s t test. (E) RNA-seq analysis of Hnf4a mutant kidneys at E18.5 shows decreased expression of genes encoding phosphate, glucose, and water transporters, consistent with the PT dysfunction phenotype. n=2, Errors bars indicate standard deviation.

42 Figure 12. Adult Hnf4a mutant Hnf4ac/+;Six2GFPcre Hnf4ac/c;Six2GFPcre has disorganized PTs and A nephrocalcinosis. Hnf4a LTL

Figure 13. Adult Hnf4a mutant has disorganized PTs and nephrocalcinosis.

Figure 14. Adult Hnf4a mutant has disorganized PTs and nephrocalcinosis.

Figure 15. Adult Hnf4a mutant has disorganized PTs and Hnf4a Hoechst nephrocalcinosis.

B Hnf4ac/+;Six2GFPcre Hnf4ac/c;Six2GFPcre

Figure 6. Adult Hnf4a mutant has disorganized PTs and nephrocalcinosis. (A) Representative immunofluorescence staining of two-month-old mouse kidney (n=3). Mutant kidney has fewer LTL stain + PTs. (B) Representative Von Kossa staining of two-month-old mouse kidney (n=3). Mutant kidney has calcium deposits in renal tubules. Scale bars, 100μm.

43 Rosa26EYFP/+;Six2GFPcre EYFP Hnf4a Hoechst

Supplemental Figure 1

Supplemental Figure 1. In the kidney, Hnf4a is expressed in the nephron lineage. Image is representative of (n=2) E18.5 kidneys. Scale bar, 100μm.

44 A

Differentiated Mesenchymal NP PT Epithelial NP Podocytes Presumptive Presumptive PT PT Differentiated PT Differentiated Loop of Henle PT Distal tubule Collecting duct Epithelial Stroma1 NP Stroma2 Stroma3 Endothelial Cell cycle

B Lrp2 C Hnf4a D Ass1

Supplemental Figure 2

Supplemental Figure 2. (A) Drop-seq (scRNA-seq) analysis of the mouse kidney at P1. Clustering of single cell expression profiles shows 13 kidney cell types. The plot shows a two- dimensional representation (tSNE, t-distributed Stochastic Neighbor Embedding) of global gene expression relationships. NP, nephron progenitors (B) Lrp2 is expressed in presumptive PT cells and differentiated PT cells. (C) Hnf4a is expressed at low levels in presumptive PT cells and expression increases in differentiated PT cells. (D) Ass1 is expressed in differentiated PT cells with little expression in presumptive PT cells.

A Cellular Component

-log10p 0 2 4 6 8 10 12 14 16 brush border cluster of actin-based cell projections brush border membrane apical part of cell apical plasma membrane

B Mouse Phenotype

-log10p 0 2 4 6 8 10 12 14 16 abnormal urine homeostasis abnormal renal/urinary system… renal/urinary system phenotype abnormal renal reabsorbtion increased urine phosphate level abnormal renal glucose reabsorption

Supplemental Figure 3

Supplemental Figure 3. GO analysis with proximal tubule-specific genes that are downregulated in the Hnf4a mutant kidney at E18.5. (A) Enrichment of genes associated with the brush border and apical membrane. (B) Enrichment of genes associated with abnormal renal function in mouse models.

46 CHAPTER 3: Hnf4a-mediated regulation of proximal tubule progenitors in the mouse kidney

Sierra S. Marable, Eunah Chung, and Joo-Seop Park

Division of Pediatric Urology and Division of Developmental Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH 45229, USA University of Cincinnati College of Medicine, Cincinnati, OH 45267, USA

Short title: Hnf4a in proximal tubule development

The authors declare no conflict of interest.

Corresponding author: Joo-Seop Park Cincinnati Children's Hospital Medical Center Location R1566, ML7007 3333 Burnet Avenue Cincinnati, OH 45229 TEL: 513-803-7871 Email: [email protected]

*Manuscript in revision with the Journal of the American Society of Nephrology

47 Abstract Background Hnf4a is a major regulator of renal proximal tubule (PT) development. In humans, a mutation in HNF4A is associated with Fanconi renotubular syndrome

(FRTS), which is caused by defective PT functions. In mice, mosaic deletion of Hnf4a in the developing kidney causes a paucity of PT cells, leading to FRTS-like symptoms.

The molecular mechanisms underlying the role of Hnf4a in PT development remain unclear.

Methods We generated a new Hnf4a mutant mouse model employing Osr2Cre, which effectively deletes Hnf4a in developing nephrons. We characterized the mutant phenotype by immunofluorescence analysis. We performed lineage analysis to test if

Cdh6+ cells are PT progenitors. We also performed genome-wide mapping of Hnf4a binding sites and differential gene analysis of Hnf4a mutant kidneys to identify direct target genes of Hnf4a.

Results Deletion of Hnf4a with Osr2Cre led to complete loss of mature PT cells, causing lethality in the Hnf4a mutant mice. We found that Cdh6high, LTLlow cells serve as

PT progenitors and that they show higher proliferation than Cdh6low, LTLhigh differentiated PT cells. We also found that Hnf4a is required for PT progenitors to develop into differentiated PT cells. Our genomic analyses revealed that Hnf4a directly regulates the expression of genes involved in transmembrane transport and metabolism.

Conclusion Our findings show that Hnf4a promotes the development of PT progenitors into differentiated PT cells by regulating the expression of genes associated with reabsorption, the major function of PT cells.

48 Significance Proximal tubule cells are the most abundant cell type in the mammalian kidney, and they perform the bulk of the renal reabsorption function. Despite their importance in kidney function, the molecular mechanisms of proximal tubule development and maturation are not well understood. Here we find that, in the developing mouse kidney,

Cdh6high, LTLlow cells act as proximal tubule progenitors and that Hnf4a is required for these cells to further develop into proximal tubules. Our genomic analyses show that

Hnf4a directly regulate the expression of genes required for reabsorption such as transmembrane transport genes and metabolism genes. This study advances our understanding of how kidney proximal tubule cells form during development.

49 Introduction The kidneys function to filter the blood, regulate osmotic levels, maintain electrolyte balance, and metabolize drugs. The functional unit of the kidney is the nephron, which is composed of the glomerulus, the proximal tubule, the loop of Henle, and the distal tubule [15]. Each segment of the nephron has distinct physiological functions and morphology. The proximal tubule cells are the most populous cell type in the kidney and they carry out the bulk of reabsorption in the nephron [128-130]. Under physiological conditions, proximal tubules reabsorb approximately two-thirds of glomerular-filtered water and sodium chloride as well as most of the filtered glucose and phosphate [3].

Proximal tubular reabsorption of water and metabolites is essential in the regulation of body fluid composition and volume. Numerous transporter and metabolism genes are expressed in the proximal tubules in order to facilitate the function and energy demands of these highly active renal epithelial cells [4, 5, 38, 39, 86, 131, 132]. Despite their importance in kidney function, the molecular mechanisms of proximal tubule development and maturation are not well understood.

Fanconi renotubular syndrome (FRTS) is defined as generalized proximal tubule dysfunction [37, 45]. Symptoms of FRTS include glucosuria, phosphaturia, proteinuria, polyuria, and polydipsia [45, 46]. These symptoms are consistent with a failure of the proximal tubules to reabsorb and transport filtered molecules, causing urinary wasting

[47, 133]. In humans, the heterozygous mutation R76W in the HNF4A gene causes

FRTS with nephrocalcinosis [59]. Since this mutation is located in the DNA-binding domain, it has been speculated that the mutation affects the interactions of HNF4A with regulatory DNA [59]. A recent study of the FRTS HNF4A mutation in Drosophila nephrocytes confirmed that the mutation reduced binding of Hnf4a to DNA and caused

50 nuclear depletion of Hnf4a in a dominant-negative manner, leading to mitochondrial defects and lipid accumulation [134].

We have previously shown that Hnf4a is expressed in developing proximal tubules in the mouse kidney and that Hnf4a is important for proximal tubule formation

[96]. Mosaic loss of Hnf4a in the murine nephron lineage caused Fanconi renotubular syndrome-like symptoms, including polyuria, polydipsia, glucosuria, and phosphaturia

[96]. Due to the mosaic expression of Six2GFPCre in mesenchymal nephron progenitor cells, the Hnf4a mutant kidney by Six2GFPCre was a chimera of wild-type and mutant proximal tubule cells [96]. This made it difficult to perform more rigorous differential gene expression analyses. In this study, we generated a new mouse model with thorough deletion of Hnf4a in the proximal segments of the nephron using Osr2IresCre and investigated the requirement of mature proximal tubules for postnatal survival [33].

We also performed lineage tracing to identify proximal tubule progenitor cells in the developing kidney. To further elucidate the role of Hnf4a in proximal tubule development, we performed genome-wide mapping of Hnf4a binding sites in the murine neonate kidney and transcriptomic analysis of the Hnf4a mutant kidney. We found that

Hnf4a is required for terminal differentiation of proximal tubule cells and that mature proximal tubules are required for postnatal survival. Cdh6high, LTLlow cells in the developing kidney are proximal tubule progenitor cells and loss of Hnf4a causes their developmental arrest. Our genomic analyses revealed that Hnf4a directly regulates expression of many mature proximal tubule genes, including transport and metabolism genes, consistent with the fact that active reabsorption is the major function of proximal tubules.

Methods Mice

All mouse alleles used in this study have been previously published: Osr2tm2(cre)Jian

(Osr2IresCre) [135]; Hnf4atm1Sad (Hnf4ac) [104]; Cdh6tm1.1(cre/ERT2)Jrs (Cdh6CreER) [136];

Gt(ROSA)26Sortm3(CAG-EYFP)Hze (Rosa26Ai3) [101]. All mice were maintained in the

Cincinnati Children’s Hospital Medical Center (CCHMC) animal facility according to animal care regulations. All experiments were performed in accordance with animal care guidelines and the protocol was approved by the Institutional Animal Care and Use

Committee of the Cincinnati Children’s Hospital Medical Center (IACUC2017-0037). We adhere to the NIH Guide for the Care and Use of Laboratory Animals.

Tamoxifen Treatment

Tamoxifen (T5648, Sigma) was dissolved in corn oil (C8267, Sigma) at a concentration of 20mg/ml. Pregnant female mice were injected with tamoxifen intraperitoneally

(4mg/40g body weight).

Immunofluorescence Staining

Embryonic, neonatal, and adult murine kidneys were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS), incubated overnight in 10% sucrose/PBS at 4°C, and imbedded in OCT (Fisher Scientific). Cryosections (8-9μm) were incubated overnight with primary antibodies in 5% heat-inactivated sheep serum/PBST (PBS with 0.1%

Triton X-100). We used primary antibodies for GFP (1:500, Aves GFP-1020), Jag1

52 (1:20, DSHB TS1.15H), Wt1 (1:100, Santa Cruz sc-7385), Biotin-LTL (1:500, Vector

Labs B-1325), FITC-LTL (1:200, Vector Labs FL-1321), Hnf4a (1:500, Abcam ab41898),

Hnf4a (1:500, Santa Cruz sc-8987), Lrp2 (1:100, Santa Cruz sc-515772), Ki67 (1:500,

BioLegend 652402), and Cdh6 (1:200, Sigma HPA007047). Fluorophore-labeled secondary antibodies were used for indirect visualization of the target. Images were taken with a Nikon Ti-E widefield microscope equipped with an Andor Zyla camera and

Lumencor SpectraX light source housed at the Confocal Imaging Core (CIC) at

CCHMC.

Histology

Mouse kidneys were harvested and fixed in 4% paraformaldehyde in PBS overnight.

Paraffin sections (5 m) were stained with hematoxylin and eosin or periodic acid-Schiff reagent (American MasterTech KTPAS). Images were taken with a Nikon Ti-E widefield microscope equipped with an Andor Zyla camera and Lumencor SpectraX light source housed at the Confocal Imaging Core (CIC) at CCHMC.

ChIP-seq

ChIP-seq was performed as previously described [29]. Briefly, kidneys from newborn

(P0) mice were crosslinked with 1% paraformaldehyde, sonicated, incubated with Hnf4a antibody (Abcam ab41898) coupled Dynabeads Protein G (ThermoFisher). Eluted DNA was used for constructing sequencing libraries using the ThruPLEX DNA-seq kit

(Takara). Libraries were sequenced on an Illumina HiSeq 2500 by the DNA Sequencing and Genotyping Core at CCHMC. ChIP-seq reads were mapped to mm9 using

53 Bowtie.[137] We performed peak calling and motif analysis using HOMER [138]. Data are available at Gene Expression Omnibus under accession number GSE144824.

RNA-seq

RNA-seq was performed as previously described [96]. Briefly, 1 μg total RNA was isolated from P0 Hnf4a mutant and control kidneys using the RNeasy Plus Micro kit

(Qiagen 74034) followed by mRNA was isolation with NEBNext Poly(A) mRNA

Magnetic Isolation Module (E7490, NEB). Fragmentation of mRNA followed by reverse transcription and second strand cDNA synthesis was done using NEBNext Ultra RNA

Library Prep Kit for Illumina (E7530, NEB). Sequencing libraries were constructed using

ThruPLEX DNA-seq kit (Takara R400428). Sequencing was performed as described above. RNA-seq reads were mapped to mm9 using TopHat and normalized gene expression values were calculated using Cufflinks [139]. Genes that showed at least a

1.5-fold change in expression with a p-value ≤0.05 were considered differentially expressed. Data are available at Gene Expression Omnibus under accession number

GSE144772.

Genomic Regions Enrichment of Annotations Tool (GREAT) analysis

GREAT analysis was performed using the online program, version 3

(great.stanford.edu) [140]. To associate genomic regions with genes, gene regulatory domains were defined as minimum 5.0 kb upstream and 1.0 kb downstream of the TSS, and distally up to 1000 kb to the nearest gene’s basal domain (‘basal plus extension’ option). 10,417 genomic regions from the Hnf4a ChIP-seq dataset were entered into the

54 GREAT online program and Mouse Genome Informatics (MGI) Expression terms of genes associated with the genomic regions were assessed.

Gene Ontology Analysis

Gene ontology analysis was performed using DAVID Bioinformatics Resources

(david.ncifcrf.gov) on differentially expressed genes identified from the RNA-seq analysis [126].

Statistical Analyses

Statistical analysis of Kaplan-Meier survival curve was performed using GraphPad 8

Prism software. The Log-rank test was used for survival analysis. Student’s t test was performed using GraphPad 8 Prism software. P<0.05 was considered to be significant.

Results Hnf4a is required for mature proximal tubule formation

In our previous study, we utilized Hnf4a floxed alleles and Six2GFPCre to generate a mouse model with kidney-specific deletion of Hnf4a. However, Six2GFPCre displayed mosaic expression in nephron progenitor cells and allowed a subset of nephron progenitors to escape Cre-mediated recombination [42, 96, 141]. Therefore, our previous Hnf4a mutant kidney was a chimera of wild-type and mutant cells leading to the FRTS-like phenotype we observed. In order to thoroughly investigate the Hnf4a loss-of-function phenotype, we utilized a less mosaic Cre that specifically targets the proximal segments of the nephron. We generated a new mouse model with nephron-

55 specific deletion of Hnf4a using a mouse line expressing Cre recombinase under the

Osr2 promoter (Osr2IresCre) [135] bred with Hnf4a floxed mice (Hnf4ac/c) [104]. We have recently shown that Osr2IresCre is expressed in the proximal and medial segments of the

S-shaped body (SSB) of the developing nephron and that the medial segment of SSB develops into proximal tubules and loops of Henle [33]. This Cre, therefore, targets all nephron segments except for the distal tubule. Osr2IresCre achieved almost complete deletion of Hnf4a in the kidney (Figure 1A). Lotus Tetragonolobus Lectin (LTL) is known to bind to glycoproteins on the surface of the proximal tubules specifically [102, 103].

Deletion of Hnf4a in the nephron led to loss of differentiated proximal tubule cells with high LTL staining (LTLhigh) in postnatal day 0 (P0) kidneys (Figure 1A). The Hnf4a mutant kidneys showed a decrease in the level of Lrp2 (Low-density lipoprotein-related protein 2), a proximal tubule-specific endocytic receptor protein also known as Megalin

(Figure 1A) [96, 142]. A few LTLlow, Lrp2low cells persisted in the Hnf4a mutant kidney

(Figure 1A, yellow arrowheads). We reasoned that these cells might represent immature proximal tubules or proximal tubule progenitor cells. A distinctive feature of the mature proximal tubules is the apical brush border. The brush border is composed of microvilli which increase the surface area of the proximal tubule to facilitate reabsorption [4, 5,

92]. The absence of the proximal tubule brush border has been associated with proximal tubule dysfunction in patients, highlighting the importance of brush border formation [143]. We analyzed brush border formation using the Periodic acid-Schiff

(PAS) stain[144] and found that Hnf4a mutants showed a lack of brush border formation

(Figure 1B). Considering that brush border formation only occurs in post-mitotic,

56 differentiated cells[145], our result suggests that the Hnf4a mutant kidney lacks terminally differentiated proximal tubule cells.

Loss of Hnf4a in the nephron leads to postnatal lethality

To examine the effects of loss of LTLhigh differentiated proximal tubules on postnatal kidney development, we analyzed the histology of Hnf4a mutant kidneys at P0, P7, and

P14. At P0, the Hnf4a mutant kidney was similar in size to the control (Figure 2A). At

P7, the Hnf4a mutant kidney was slightly smaller with a thinner cortex than the control kidney (Figure 2B). At P14, the medullary region of the Hnf4a mutant kidney was severely damaged, cysts formed in the cortical region, and hydronephrosis was apparent (Figure 2C). Increased filtrate flow through the renal tubules can lead to renal pelvic dilation and nonobstructive hydronephrosis in nephrogenic diabetes insipidus

[146-148]. It is likely that hydronephrosis seen in the Hnf4a mutant kidney is caused by increased filtrate flow through the nephron tubules due to lack of reabsorption in the proximal tubule. Survival analysis of the Hnf4a mutant mice showed that ~60% of Hnf4a mutants were deceased by P14, likely due to kidney dysfunction (Figure 2D). No Hnf4a mutants survived to weaning age (P28). These results show that the lack of mature proximal tubules causes postnatal lethality, highlighting the importance of the mature proximal tubule function for survival.

Cdh6high, LTLlow cells in the developing kidney are proximal tubule progenitor cells

57 It has been previously suggested that Cdh6-expressing cells in the developing murine kidney are presumptive proximal tubule cells [44]. It was reported that, in the mouse embryonic kidney, Cdh6 was expressed in the medial segment of the SSB and that

LTL+ proximal tubules were still positive for Cdh6 although its expression was downregulated compared to Cdh6+ cells in the nephrogenic zone. Based on these observations, it was proposed that Cdh6-expressing cells in the nephrogenic zone were destined to become proximal tubules [44]. Consistent with this, we found that there were two distinct populations of Cdh6+ cells in the wild type developing murine kidney:

Cdh6high and Cdh6low cells (Figure 3A). The majority of Cdh6high cells were Hnf4a+ and had no or low LTL staining (red arrowheads and orange arrowheads, respectively, in

Figure 3A), suggesting that these Cdh6high, LTLlow cells are prospective, immature proximal tubule cells. Cdh6low cells were also positive for Hnf4a and had strong LTL staining (yellow arrowheads in Figure 3A), suggesting that these Cdh6low, LTLhigh cells are differentiated proximal tubule cells. We found that, in the Hnf4a mutant kidney,

Cdh6low, LTLhigh cells were absent and the number of Cdh6high, LTLlow cells were increased, suggesting that the loss of Hnf4a prevents Cdh6high, LTLlow cells from developing into Cdh6low, LTLhigh cells (Figure 3B).

In order to definitively test if Cdh6high cells are proximal tubule progenitor cells, we performed lineage analysis using a tamoxifen-inducible Cre recombinase under the

Cdh6 promoter (Cdh6CreER) and a Cre-inducible Rosa26Ai3 reporter [101, 136]. Pregnant dams were injected with tamoxifen at E14.5 or E16.5 to label Cdh6high cells and their descendant cells with the Rosa26Ai3 reporter. Embryos were harvested at E18.5. We found that all Rosa26Ai3 labeled cells were Hnf4a+ and most were also LTL+, indicating

58 that Cdh6high cells in the developing kidney are proximal tubule progenitor cells (Figure

4).

Hnf4a has been shown to inhibit proliferation in hepatocytes and promote terminal differentiation [149]. Many models of cellular differentiation show an inverse relationship between proliferation and differentiation [150-153]. Terminal differentiation commonly involves exiting the cell cycle and entering a postmitotic state [150, 154]. To determine whether the transition from Cdh6high, LTLlow proximal tubule progenitors to

Cdh6low, LTLhigh differentiated proximal tubule cells coincides with cell cycle exit, we examined Ki67 expression in Cdh6high and Cdh6low cell populations (Figure 5, A and B).

Ki67 is present in actively proliferating cells and absent in resting cells [155-158]. We found that Cdh6high proximal tubule progenitor cells were highly proliferative while only few Cdh6low cells showed Ki67 expression (Figure 5A). When quantified, Cdh6high cells had a 10-fold higher proliferative rate than Cdh6low cells, indicating an expansion of the progenitor cell population before they exit the cell cycle and undergo terminal differentiation into mature proximal tubule cells (Figure 5B). This suggests that the number of proximal tubule cells in the newborn kidney is largely determined by the proliferation of Cdh6high proximal tubule progenitor cells.

Hnf4a gene regulatory network reveals the roles of Hnf4a in regulating proximal tubule development

To further elucidate the role of Hnf4a in the proximal tubule transcriptional program, we performed chromatin immunoprecipitation followed by high-throughput sequencing

(ChIP-seq) with P0 murine kidneys to identify Hnf4a-bound genomic regions. Two

59 Hnf4a ChIP-seq replicates yielded 10,417 reproducible binding sites (peaks)

(Supplemental Table 1). Our motif analysis showed high enrichment of the canonical

Hnf4a binding DNA sequence within these Hnf4a peaks (Figure 6A), indicating that

Hnf4a-bound genomic regions were successfully enriched in our ChIP-seq samples. We also found that DNA motifs for other nuclear receptors including the estrogen-related receptor alpha (ESRRA), the retinoid X receptor (RXR), the peroxisome proliferator- activated receptor (PPAR), and hepatocyte nuclear factor 1 beta (HNF1B) were also enriched within the Hnf4a-bound genomic regions, suggesting that these nuclear receptors share common target genes with Hnf4a to regulate proximal tubule development (Figure 6A). The majority of the Hnf4a peaks were found within 50kb of transcription start sites (TSS) (Figure 6B) and 30% of the peaks were located in promoter regions (Figure 6C). Genomic Regions Enrichment of Annotations Tool

(GREAT) analysis of MGI expression annotations of genes associated with Hnf4a binding sites showed enrichment within the developing renal proximal tubules (Figure

6D) [140], consistent with the fact that Hnf4a is specifically expressed in proximal tubules in the kidney. Multiple peaks were identified near the promoters of proximal tubule genes (Supplemental Table 1). In particular, we found Hnf4a peaks near genes such as Slc34a1 and Ehhadh, genes linked to FRTS in human patients (Figure 6E) [54,

57].

We conducted transcriptomic analysis (RNA-seq) of P0 Hnf4a mutant kidneys to complement our candidate target gene list with differential gene expression data

(Supplemental Table 2). In the Hnf4a mutant kidney, 442 genes showed a significant decrease in expression (fold change ≥ 1.5; p-value < 0.05), including Slc34a1, Ehhadh,

60 and Ass1, which are highly expressed in proximal tubules (Figure 7A, Supplemental

Table 2) [39, 86]. As previously mentioned, mutations in SLC34A1 and EHHADH are associated with FRTS in patients [54, 57]. Gene ontology (GO) analysis of these 442 downregulated genes showed enrichment of genes associated with metabolism and transport (Figure 7B). We found that 196 genes were significantly upregulated in the

Hnf4a mutant kidneys (fold change ≥ 1.5; p-value < 0.05), including Cdh6, the gene marking proximal tubule progenitors (Figure 7A, Supplemental Table 2). GO analysis of the 196 upregulated genes showed enrichment of genes associated with phospholipid homeostasis and cholesterol transport (Figure 7C). In order to determine which genes are directly regulated by Hnf4a, we compared the differentially expressed genes in the

Hnf4a mutant with the 7,823 genes associated with Hnf4a binding sites to find overlapping genes (Figure 7D, Supplemental Table 3). There were 245 genes in common between the significantly downregulated genes and the Hnf4a binding sites and 81 common genes between significantly upregulated genes and the Hnf4a binding sites (Figure 7D, Supplemental Table 3). GO analysis of the 245 downregulated genes showed enrichment of genes associated with transport and metabolism (Figure 7E). GO analysis of the 81 upregulated genes showed enrichment of genes associated with transport, metabolism, and response to thyroid hormone and ischemia (Figure 7F). Our genomic and transcriptomic analyses suggest that Hnf4a regulates proximal tubule maturation via activation of transport and metabolism genes, consistent with the functions of the proximal tubule.

61 Discussion

In our previous study, we identified two populations of LTL+ cells in the developing mouse kidney: LTLlow and LTLhigh. Based on our results, we concluded that these two populations represent presumptive proximal tubules and differentiated proximal tubules, respectively [96]. In order to further examine the presumptive proximal tubule population, we sought to identify a marker of proximal tubule progenitors. Previously,

Cdh6 had been proposed as a marker for prospective proximal tubule cells [44].

However, it had not been definitively shown that Cdh6+ cells develop into proximal tubule cells [44]. To address this, we performed lineage analysis of Cdh6+ cells in the developing kidney and found that these cells all became Hnf4a+ proximal tubule cells

(Figure 4). This experiment provides strong evidence that Cdh6+ cells are proximal tubule progenitors in the developing kidney. Cdh6+ proximal tubule progenitors are highly proliferative, while LTLhigh, Hnf4a+ proximal tubule cells proliferate less frequently

(Figure 5). This suggests that expansion of proximal tubule progenitors determines the number of proximal tubule cells. Identification of proximal tubule progenitors will allow us to further investigate the developmental mechanisms of proximal tubule development.

We have previously reported that mosaic deletion of Hnf4a by Six2GFPCre in the developing mouse kidney causes a significant reduction in proximal tubule cells, phenocopying FRTS [96]. The paucity of proximal tubules is consistent with reduced expression of proximal tubule genes, including the genes encoding glucose and phosphate transporters. However, it was unknown which genes were directly regulated by Hnf4a in proximal tubules. In this study, we performed Hnf4a ChIP-seq on newborn mouse kidneys and RNA-seq analysis of Hnf4a mutant kidneys by Osr2IresCre. From

62 intersection of the ChIP-seq and RNA-seq datasets, we identified 245 Hnf4a direct target genes that were downregulated in the Hnf4a mutant during kidney development

(Figure 7D). Among these 245 targets, the most enriched were genes associated with transmembrane transport, suggesting the role of Hnf4a in proximal tubule development correlates with the major function of the proximal tubule, active reabsorption (Figure 7E,

Table 1A). The genes associated with fatty acid metabolism were also enriched in these

245 direct target genes (Table 1B). Taking into account that proximal tubule cells are highly active in metabolism and their energy demands are primarily met by fatty acid oxidation[38, 159-161], our results suggest that Hnf4a regulates metabolic reprogramming during proximal tubule development. Interestingly, only 3% of the Hnf4a bound genes showed differential expression in the Hnf4a mutant kidney. Since many proximal tubule genes are upregulated postnatally [85, 162], it is possible that Hnf4a alone is not sufficient to induce expression of the majority of its target genes and co- factors are required.

Motif analysis of genomic regions bound by a given transcription factor provides a list of other transcription factors that physically or genetically interact with the target transcription factor, sharing common target genes. Known motif analysis of our Hnf4a

ChIP-seq datasets revealed that the DNA motifs for ESRRA, RXR, PPAR, and Hnf1b were enriched within the Hnf4a-bound genomic regions in the developing mouse kidney. The binding motifs of ESRRA and RXR are quite similar to the Hnf4a binding motif (Figure 6A), which could suggest that there is cooperative binding among these nuclear receptor transcription factors to activate a proximal tubule-specific transcriptional program. In contrast, similar binding motifs could imply competitive

63 binding, since overlapping DNA motifs can lead to competition between transcription factors to activate or repress context-specific transcriptional programs [163]. Recent studies in zebrafish have implicated retinoic acid signaling in the formation of proximal tubules, further supporting RXR as a potential co-regulator of proximal tubule development [123, 124]. Both PPARa/g and Hnf1a/b have been implicated in proximal tubule development and function, indicating that they are good candidate co-regulators of proximal tubule development [164-166]. PPAR transcription factors are known binding partners of RXR and one study predicted 17 common targets between Hnf4a and PPARa [85]. Hnf1b is expressed in all nephron segments [72, 73, 167-169] and

Hnf1b deficiency in the nephron lineage of the mouse kidney leads to defects in nephron formation, particularly the proximal tubules, loops of Henle, and distal tubules

[169, 170]. Hnf1b is known to interact with Hnf4a and regulate common target genes

[85, 99, 168]. It has also been shown that expression of Hnf1b and Hnf4a, along with

Emx2 and Pax8, can convert fibroblasts into renal tubular epithelial cells, strongly suggesting that Hnf1b is a co-regulator of proximal tubule development.[171] Further investigation is needed to elucidate the interactions among these transcription factors and their roles in proximal tubule development.

In conclusion, we examined the molecular mechanisms of Hnf4a-regulated proximal tubule development. We found that proximal tubule development was arrested in the absence of Hnf4a. The Hnf4a mutant kidney cannot generate mature proximal tubules. Loss of proximal tubule cells in the Hnf4a mutant mice caused postnatal lethality, highlighting the importance of functional proximal tubules for survival. In the

Hnf4a mutant kidney, there is an increase in Cdh6high, LTLlow presumptive proximal

64 tubule cells. We definitively showed that Cdh6+ cells in the developing kidney are proximal tubule progenitors. These results suggest that Hnf4a is required for proximal tubule progenitors to differentiate into mature proximal tubule cells. Genome-wide analysis of Hnf4a binding sites in the kidney and transcriptomic analysis of the Hnf4a mutant kidney indicate that Hnf4a directly regulates expression of multiple genes involved in transmembrane transport and metabolic processes in the proximal tubule.

65 Author contributions S.S.M. performed mouse experiments. S.S.M. and E.C. performed ChIP-seq. E.C. performed RNA-seq. S.S.M. and J.P. designed the experiments, analyzed the data, and cowrote the manuscript. S.S.M made the figures. All authors approved the final version of the manuscript.

Acknowledgments The authors thank Steve Potter for critically reading the manuscript. We also thank the

Confocal Imaging Core (CIC) and the DNA Sequencing and Genotyping Core (DSGC) at CCHMC. This work was supported by the National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health F31 DK120164 to S.S.M. and R01

DK120847 to J.P.

Disclosures

None.

Supplemental Material

Supplemental Table 1. Genome-wide mapping of Hnf4a binding sites in the mouse kidney at P0 (ChIP-seq)

Supplemental Table 2. Differential gene analysis of the Hnf4a mutant kidney at P0

(RNA-seq)

Supplemental Table 3. Intersection of ChIP-seq and RNA-seq

66 Figures Figure 1. Hnf4a deletion by Osr2Cre leads to loss of mature proximal tubule (PT) cells.

Figure 1. Hnf4a deletion by Osr2Cre leads to loss of mature proximal tubule (PT) cells. (A) Loss of Hnf4a in the nephron inhibits formation of LTLhigh, mature PT cells and causes a decrease in expression of Lrp2, a PT-specific gene in the newborn (P0) kidney. Yellow arrowheads mark LTLlow, Lrp2low cells that persist in the mutant. Image is representative of n=3. Scale bar, 100μm. (B) Periodic acid-Schiff (PAS) staining of control and Hnf4a mutant kidneys at P0 show Hnf4a mutants lack brush border. Black arrowheads mark brush border. Image is representative of n=3. Scale bar, 50μm.

67 Figure 2. Loss of mature proximal tubules leads to postnatal lethality in Hnf4a mutant mice.

Figure 2. Loss of mature proximal tubules leads to postnatal lethality in Hnf4a mutant mice. (A-C) Hematoxylin and eosin (H&E) staining of Hnf4a mutant kidneys at birth (P0), postnatal day 7 (P7), and postnatal day 14 (P14). Images are representative of n=4. Scale bar, 100μm. (D) Kaplan-Meier survival analysis of the Hnf4a mutants with heterozygous controls. *P-value < 0.0001, determined by Log-rank test.

68 Figure 3. High Cdh6 expression is persistent in the Hnf4a mutant kidney.

Figure 3. High Cdh6 expression is persistent in the Hnf4a mutant kidney. (A) In the P0 control kidney, Cdh6 expression is high in LTLneg and LTLlow, presumptive PT cells (red and orange arrowheads, respectively) and Cdh6 expression decreases as PT cells develop into LTLhigh, mature PT cells (yellow arrowheads). In the Hnf4a mutant kidney, Cdh6high,LTLlow cells are more abundant compared to the control and there are no Cdh6low, LTLhigh cells to be found. Scale bar, 100μm. Image is representative of n=3. (B) Quantification of Cdh6high and Cdh6low cells in the Hnf4a mutant and control kidney. *P-value < 0.01, determined by t test.

69 Figure 4. Cdh6 lineage tracing shows that Cdh6+ cells are PT progenitor cells

Figure 4. Cdh6 lineage tracing shows that Cdh6+ cells are PT progenitor cells. Lineage labeling of Cdh6+ cells with Ai3 after tamoxifen injection into pregnant dams at E14.5 or E16.5. All Ai3+ cells are Hnf4a+ and most are also LTL+ (yellow arrowheads) at E18.5. Images are representative of n=3. Scale bar, 100μm.

70 Figure 5. Cdh6high PT progenitor cells have a higher proliferation rate than Cdh6low mature PT cells.

Figure 5. Cdh6high PT progenitor cells have a higher proliferation rate than Cdh6low mature PT cells. (A) Representative immunostains for Ki67, Cdh6, and Hnf4a in the P0 kidney (n=4). Cdh6high (orange arrowheads); Cdh6low (yellow arrowheads). Scale bar, 50μm. (B) Quantification of Ki67 positive cells. *P- value < 0.01, determined by t test.

71 Figure 6. Genome-wide mapping of Hnf4a binding sites in the newborn mouse kidney

Figure 6. Genome-wide mapping of Hnf4a binding sites in the newborn mouse kidney (A) Analysis of known motifs from Hnf4a ChIP-seq. (B) Bar graph showing the percentage of region–gene associations according to genomic regions’ distance to TSS computed by Genomic Regions Enrichment of Annotations Tool (GREAT) (http://bejerano.stanford.edu/great/public/html/). (C) Pie chart representing the distribution of Hnf4a peaks within the annotated genome. (D) GREAT MGI Expression annotations of Hnf4a peaks showing top six enriched terms. (E) Genome browser view of Hnf4a ChIP-seq peaks near TSS of PT genes.

72 Figure 7. Intersection of Hnf4a ChIP-seq peaks with differentially expressed genes in the Hnf4a mutant kidney identified direct target genes of Hnf4a.

Figure 7. Intersection of Hnf4a ChIP-seq peaks with differentially expressed genes in the Hnf4a mutant kidney identified direct target genes of Hnf4a. (A) Differential expression analysis in the Hnf4a mutant versus the Hnf4a control kidney at P0. Red and blue points in the volcano plot mark genes with significantly decreased or increased expression, respectively, in the Hnf4a mutant. Vertical dash lines (x- axis) mark log2(1.5). Horizontal dash line (y-axis) marks -log10(0.05) (B) Gene ontology (GO) analysis of significantly downregulated genes in the Hnf4a mutant kidney showing top six enriched terms. (C) GO analysis of significantly upregulated genes in the Hnf4a mutant kidney showing top five enriched terms. (D) Venn diagram shows the overlap of genes associated with Hnf4a binding sites and differentially expressed genes in the Hnf4a mutant kidney. (E) GO analysis of Hnf4a-bound, downregulated genes showing top six enriched terms. (F) GO analysis of Hnf4a-bound, upregulated genes showing top six enriched terms.

73 Table 1. Hnf4a target genes that were downregulated in the Hnf4a mutant kidney A. Genes associated with transmembrane transport Gene symbol Gene name

Sfxn1 sideroflexin 1 Slc13a1 solute carrier family 13 (sodium/sulfate symporters), member 1 Slc16a4 solute carrier family 16 (monocarboxylic acid transporters), member 4 Slc16a9 solute carrier family 16 (monocarboxylic acid transporters), member 9

Slc2a2 solute carrier family 2 (facilitated glucose transporter), member 2 Slc2a5 solute carrier family 2 (facilitated glucose transporter), member 5 Slc22a6 solute carrier family 22 (organic anion transporter), member 6 Slc22a8 solute carrier family 22 (organic anion transporter), member 8 Slc22a12 solute carrier family 22 (organic anion/cation transporter), member 12

Slc22a1 solute carrier family 22 (organic cation transporter), member 1 Slc22a13 solute carrier family 22 (organic cation transporter), member 13 Slc22a2 solute carrier family 22 (organic cation transporter), member 2 Slc23a1 solute carrier family 23 (nucleobase transporters), member 1 Slc47a1 solute carrier family 47, member 1 Slc5a8 solute carrier family 5 (iodide transporter), member 8 Slc5a1 solute carrier family 5 (sodium/glucose cotransporter), member 1 Slc5a12 solute carrier family 5 (sodium/glucose cotransporter), member 12

B. Genes associated with lipid and fatty acid metabolism Gene symbol Gene name Hmgcs2 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 Gm2a GM2 ganglioside activator protein Acaa1b acetyl-Coenzyme A acyltransferase 1B Acsm1 acyl-CoA synthetase medium-chain family member 1 Dgat2 diacylglycerol O-acyltransferase 2 Elovl2 elongation of very long chain fatty acids -like 2 Ehhadh enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase Fads3 fatty acid desaturase 3 Hsd17b2 hydroxysteroid (17-beta) dehydrogenase 2 Nceh1 neutral cholesterol ester hydrolase 1 Pck1 phosphoenolpyruvate carboxykinase 1, cytosolic Pcx pyruvate carboxylase Slc27a2 solute carrier family 27 (fatty acid transporter), member 2 Amacr alpha-methylacyl-CoA racemase Cryl1 crystallin, lambda 1

74 CHAPTER 4: SUMMARY AND CONCLUSION

Summary of Findings In this dissertation, we utilized two mouse models of Hnf4a deletion in the developing nephron to illustrate the role of Hnf4a in proximal tubule development. The first model featured mosaic loss of Hnf4a in nephron progenitors by Six2Cre [96]. The experiments from this study demonstrated that Hnf4a is dispensable for formation of presumptive, LTL-low proximal tubule cells but required for formation of mature, LTL- high proximal tubule cells. Immunofluorescence and RNA-seq analysis of the mutant kidney showed that the proximal tubule was the only nephron segment that was significantly affected by loss of Hnf4a. Downregulated genes in the mutant kidney at P0 were associated with metabolism as well as transporting glucose, phosphate, and water. We found that mosaic loss of Hnf4a in the murine kidney phenocopies the renal phenotype of FRTS4 patients with the R76W HNF4A mutation. The mice with mosaic deletion of Hnf4a in their kidneys were viable, displaying polydipsia, polyuria, glucosuria, phosphaturia, and nephrocalcinosis.

Given the mosaic nature of the Hnf4a mutant by Six2Cre, we were unable to clearly define the molecular mechanisms of Hnf4a-mediated regulation of proximal tubule development. Nor were we able to verify the importance of the proximal tubule for survival. Based on our previous study, we hypothesized that complete loss of Hnf4a would cause complete loss of mature proximal tubules and that the complete absence of proximal tubule (and therefore proximal tubule function) would cause postnatal lethality. We also sought to validate a marker of the presumptive proximal tubule progenitors and identify direct target genes of Hnf4a in the kidney. The new Hnf4a mutant model featured complete loss of Hnf4a in the proximal part of the S-shaped

75 body by Osr2IresCre. Immunofluorescence analysis of the Hnf4a mutant by Osr2 IresCre showed efficient deletion of Hnf4a in the mutant and the mutants did not form mature,

LTL-high proximal tubules. Survival analysis showed postnatal lethality within three weeks after birth for the mutants. In this study, we definitively showed that Cdh6- expressing cells in the developing kidney are proximal tubule progenitors and that

Hnf4a is required for the differentiation of the progenitors to mature proximal tubule cells. ChIP-seq and RNA-seq analysis of P0 kidneys showed that Hnf4a directly regulates expression of transporter genes and genes involved in fatty acid metabolism.

The results of these studies showed that proximal tubule development is arrested in the absence of Hnf4a and that Hnf4a is required for functional and metabolic maturation of proximal tubule cells.

Discussion Taking all findings into consideration, we propose that the primary role of Hnf4a in proximal tubule development is to promote proximal tubule maturation by activating expression of transporter genes and lipid metabolism genes. Our model suggests that proximal tubule differentiation is a dynamic, multi-stage process featuring transcriptional, morphological, and metabolic changes. The first stage identified is

Cdh6+ cells in the medial portion of the S-shaped body. These Cdh6+ cells begin to express Hnf4a as the S-shaped body elongates and expands. Of note, neither Cdh6 nor

Hnf4a are required for S-shaped body formation. Subsequently, the Cdh6+, Hnf4a+ cells begin to show low LTL staining. In the next stage, Cdh6 expression is downregulated, the cells show high LTL staining and Hnf4a expression is maintained

76 (Figure 1). The cells also begin to express mature proximal markers, such as Ass1 and

Slc5a2. Further proximal tubule maturation occurs postnatally, implying there are more stages of proximal tubule development [85, 162, 172]. It would be interesting to determine whether Hnf4a is required for maintenance of the proximal tubule cell identity and function in adults.

Since renal vesicle and S-shaped body formation were not affected by loss of

Hnf4a, it is likely that the proximal tubule cell identity is specified my other transcription factors or signaling pathways. This implies that there are earlier stages of proximal tubule development that we have not identified. Future studies should focus on identifying transcriptional regulators of the proximal tubule cell fate and defining the additional stages of proximal tubule development utilizing transcriptomic analysis, genomic analysis, single-cell analysis, lineage tracing, and loss-of-function studies.

Future Directions The role of Hnf4a in the mature proximal tubule

Hnf4a expression is maintained in the proximal tubules of the adult metanephric kidney [86]. Most proximal tubule genes are upregulated postnatally [85, 162]. Many of these genes are Hnf4a target genes. Taken together, we could hypothesize that Hnf4a is required for the maintenance of the differentiated state of the proximal tubule. We could test this hypothesis by conditional deletion of Hnf4a in the adult kidney. SLC34a1-

GFPCreERT2[173] and Villin-Cre[174] target the proximal tubules in the adult murine kidney and can be crossed with the Hnf4ac/c mouse line. Loss of Hnf4a in differentiated, mature proximal tubules may lead to de-differentiation of the cells to a progenitor-like state, similar to acute injury response seen in mouse proximal tubules during repair

77 [173]. This could lead to symptoms of FRTS or even death in the mutant mice dependent on the efficiency of the Cre recombinase. These studies could elucidate to role of Hnf4a in maintaining differentiated proximal tubules and in proximal tubule injury.

Identification of other factors necessary of proximal tubule development

Previous studies have shown that Hnf4a is necessary, but not sufficient to induce expression of drug-metabolizing enzymes in the proximal tubule [85]. Therefore, it is important to identify other regulators of the proximal tubule in order to define the gene regulatory network of proximal tubule development. Motif analysis of our Hnf4a ChIP- seq data found binding motifs for ESRRA, RXR, PPAR, and Hnf1b within the Hnf4a- bound genomic regions. As previously discussed, motif analysis identified potential co- factors that may have a role in proximal tubule development. RXR (retinoid X receptor), in particular, is a good candidate co-factor given that retinoic acid signaling is a known regulator of proximal tubule formation in zebrafish [123]. Interestingly, the promoter region of the HNF4A gene contains a retinoic acid response element (RARE) in human hepatoma Hep3B cells [125]. It has also been shown that Hnf4a expression can be induced by retinoic acid [125]. However, studies utilizing RARE-lacZ reporter mice suggest that canonical retinoic acid signaling is not active in the murine nephron lineage, implying that it is unlikely that retinoic acid receptors (RARs) are involved in nephron formation [175]. RXRs are able to heterodimerize with nuclear receptors other than RARs (such as PPARs) and bind RAREs and similar hormone response elements to activate or repress transcription [176]. Interestingly, all isoforms of RXR are expressed in the rat nephron, primarily in the proximal tubules and distal tubules [177].

78 It is reasonable to hypothesize that RXR is a regulator of mammalian proximal tubule development. To test this hypothesis, we have obtained retinoid X receptor floxed alleles (Rxrac/c;Rxrbc/c) to cross with the Osr2IresCre mouse line. We will utilize immunofluorescence and transcriptomic analysis of the mutant kidneys to determine whether they phenocopy the Hnf4a mutant.

PPAR and Hnf1a are known to co-regulate common genes with Hnf4a and separately are known to be important in the proximal tubule [72, 85, 166]. PPAR signaling controls mitochondrial biogenesis and function and had been implicated in proximal tubule dysfunction and repair [164]. Hnf1a and Hnf1b are both expressed in the developing kidney. Hnf1a is primarily expressed in the proximal tubules, while Hnf1b is expressed in all nephron segments [72, 73, 167-169]. Hnf1b is required for proximal tubule and loop of Henle specification [169]. Hnf1a knockout mice show decreased renal expression of Lrp2 and Cubn, which are highly expressed in the proximal tubule

[178]. Loss of Hnf1a is also associated with FRTS in mice [72]. Co-immunoprecipitation assays could test direct protein-protein interactions of Hnf4a with the candidate co- factors. Integration of transcriptional and binding assays as well as cooperative interaction studies could provide a gene regulatory network for proximal tubule development.

Identification of early specifiers of proximal tubule identity

Our results currently suggest that Hnf4a is not an early specifier of the proximal tubule cell identity given the persistent expression of proximal tubule marker Lrp2 and low-LTL staining in the Hnf4a mutant. Renal vesicle and S-shaped body formation are

79 not affected by loss of Hnf4a and there appears to be no changes in proximal-distal segmentation in early stages of nephrogenesis. However, Hnf4a is expressed in proximal tubule progenitors. Therefore, in order to investigate the role of Hnf4a in proximal tubule progenitors, we will FACS-isolate Cdh6-expressing progenitors from the

Hnf4a mutant and control kidneys and perform bulk RNA-seq. If there are differential expression patterns between the mutant and control progenitors, it would suggest a role for Hnf4a in early proximal tubule cell identity. Furthermore, other transcription factors and signaling pathways required for early proximal tubule cell fate specification still need to be identified. Potential candidates could be determined by investigating differential gene expression of Cdh6-expressing progenitors versus mature proximal tubules. This could be achieved by isolating these two cell populations by FACS using

Cdh6 and LTL as markers and performing bulk RNA-seq. Genes that are highly expressed in the progenitors and downregulated in the mature proximal tubules could be regulators required for maintaining the progenitor state and/or specifiers of proximal tubule cell identity. The properties of the proximal tubule progenitors could prove relevant in regenerative approaches to treating proximal tubule dysfunction.

Significance

Kidney disease is the 9th leading cause of death in the USA [179]. 15% of adults

(~37 million people) are estimated to have chronic kidney disease. More than 600,000

Americans are suffering kidney failure and are on dialysis or living with a kidney transplant [179]. There is a critical shortage of kidneys for transplantation, with over

70,000 patients on the waiting list for a kidney in the USA [180]. The average waiting

80 time for a kidney transplant is 3-5 years. In 2017, approximately 33% of patients removed from the waitlist died or became too sick for surgery [181]. The number of people on the waiting list greatly outpaces the number of donors and transplants performed each year.

The field of regenerative medicine seeks to address the issue of organ shortage through tissue engineering and stem cell therapies. One branch of regenerative medicine focuses on the differentiation of induced pluripotent stem cells to specific cell types and the generation of small, self-organizing 3D tissue cultures known as organoids for use in disease modeling, drug screening, and cellular replacement therapies. A number of differentiation protocols have been established to generate kidney-like organoids from induced pluripotent stem cells (Table 1) [17, 182-185]. The cells within the organoids show characteristics of podocytes, proximal tubules, loops of

Henle, distal tubules, and collecting duct epithelium. However, current protocols do not generate the full complement of renal cell types [95, 186]. These organoids are developmentally immature with limited functionality [187, 188]. Gene expression profiling of human kidney organoids showed similarity to first and second trimester fetal kidneys [17, 187, 189]. Selective induction of specific cell types in the kidney (e.g. proximal tubules) has not yet been established. Therefore, maturation of kidney organoids is a major challenge for their use in regenerative medicine. More basic science research in kidney development is needed to develop protocols for in vitro maturation.

Proximal tubule cells are of particular interest because they are the primary target of acute kidney injury (AKI) and nephrotoxic compounds due to the abundance of

81 xenobiotic transporters within the epithelium and their high metabolism [92, 190]. This can lead to chronic renal injury with approximately 41% of AKI patients requiring a kidney transplant [191, 192]. A deeper understanding of the molecular mechanisms of proximal tubule development and maturation will aid in designing new approaches to treat acute and chronic kidney disease, such as cell replacement therapies to improve renal function, nephrotoxic drug screening, and, eventually, transplantable bioartificial organs. The studies detailed in this dissertation may contribute to the generation of mature proximal tubules in kidney organoids, bringing biomedical research one step closer to viable cellular and tissue replacement therapies for the kidney disease.

Conclusions Overall, this dissertation aimed to uncover the requirement for Hnf4a in proximal tubule development. Based on our findings, we concluded that Hnf4a is required for the transition of Cdh6-expressing proximal tubule progenitors to mature proximal tubule cells (Figure 1). Hnf4a mediates this differentiation step via regulation of transporter genes and metabolic reprogramming (Figure 2). Altogether, this work provides evidence that Cdh6-expressing cells in the developing mammalian kidney are proximal tubule progenitor cells and that Hnf4a is a key regulator of proximal tubule development. This work also provides insight into the etiology of FRTS and offers a new mouse model for

FRTS4.

82 Figures

Figure 1. Proximal tubule development is arrested in the absence of Hnf4a.

Figure 2. Proximal tubule development is arrested in the absence of Hnf4a.

Figure 3. Proximal tubule development is arrested in the absence of Hnf4a.

Wild Type Hnf4a+ Hnf4a+ Figure 4. Proximal tubule developmentCdh6+ is arrestedCdh6 in the-high absence of Hnf4a.Cdh6 -low Cdh6+ Hnf4a+ LTL-low LTL-high

Hnf4a mutant

Figure 1. Proximal tubule development is arrested in the absence of Hnf4a.

Figure 5. Hnf4a regulates expression of metabolism and transporter genes in the proximal tubule.

Figure 2. Hnf4a regulates expression of metabolism and transporter genes in the proximal tubule. BioTapestry [193].

Table 1. Kidney organoid differentiation protocols.

Table 1. Kidney Organoid Differentiation Protocols. Adapted from Nishinakamura, 2019 [95].

85 REFERENCES

1. Koeppen, B.M.S., B.A., Renal Physiology. 2001, St. Louis, MO: Mosby. 2. Scott, R.P. and S.E. Quaggin, Review series: The cell biology of renal filtration. J Cell Biol, 2015. 209(2): p. 199-210. 3. Baum, M. and R. Quigley, Proximal tubule water transport-lessons from aquaporin knockout mice. Am J Physiol Renal Physiol, 2005. 289(6): p. F1193-4. 4. Curthoys, N.P. and O.W. Moe, Proximal tubule function and response to acidosis. Clin J Am Soc Nephrol, 2014. 9(9): p. 1627-38. 5. Zhuo, J.L. and X.C. Li, Proximal nephron. Compr Physiol, 2013. 3(3): p. 1079- 123. 6. Sands, J.M. and H.E. Layton, Advances in understanding the urine-concentrating mechanism. Annu Rev Physiol, 2014. 76: p. 387-409. 7. Subramanya, A.R. and D.H. Ellison, Distal convoluted tubule. Clin J Am Soc Nephrol, 2014. 9(12): p. 2147-63. 8. Bertram, J.F., et al., Human nephron number: implications for health and disease. Pediatr Nephrol, 2011. 26(9): p. 1529-33. 9. Hoy, W.E., et al., Reduced nephron number and glomerulomegaly in Australian Aborigines: a group at high risk for renal disease and hypertension. Kidney Int, 2006. 70(1): p. 104-10. 10. Hoy, W.E., et al., Distribution of volumes of individual glomeruli in kidneys at autopsy: association with physical and clinical characteristics and with ethnic group. Am J Nephrol, 2011. 33 Suppl 1: p. 15-20. 11. Puelles, V.G., et al., Glomerular number and size variability and risk for kidney disease. Curr Opin Nephrol Hypertens, 2011. 20(1): p. 7-15. 12. Walker, K.A., et al., High nephron endowment protects against salt-induced hypertension. Am J Physiol Renal Physiol, 2012. 303(2): p. F253-8. 13. Short, K.M., et al., Global quantification of tissue dynamics in the developing mouse kidney. Dev Cell, 2014. 29(2): p. 188-202. 14. Hinchliffe, S.A., et al., Human intrauterine renal growth expressed in absolute number of glomeruli assessed by the disector method and Cavalieri principle. Lab Invest, 1991. 64(6): p. 777-84. 15. McMahon, A.P., Development of the Mammalian Kidney. Curr Top Dev Biol, 2016. 117: p. 31-64. 16. Taguchi, A. and R. Nishinakamura, Nephron reconstitution from pluripotent stem cells. Kidney Int, 2015. 87(5): p. 894-900. 17. Takasato, M., et al., Kidney organoids from human iPS cells contain multiple lineages and model human nephrogenesis. Nature, 2015. 526(7574): p. 564-8. 18. Rehman, S. and D. Ahmed, Embryology, Kidney, Bladder, and Ureter, in StatPearls. 2020: Treasure Island (FL). 19. Ludwig, K.S. and L. Landmann, Early development of the human mesonephros. Anat Embryol (Berl), 2005. 209(6): p. 439-47. 20. Costantini, F. and R. Shakya, GDNF/Ret signaling and the development of the kidney. Bioessays, 2006. 28(2): p. 117-27.

86 21. Levinson, R. and C. Mendelsohn, Stromal progenitors are important for patterning epithelial and mesenchymal cell types in the embryonic kidney. Semin Cell Dev Biol, 2003. 14(4): p. 225-31. 22. Kobayashi, A., et al., Six2 defines and regulates a multipotent self-renewing nephron progenitor population throughout mammalian kidney development. Cell Stem Cell, 2008. 3(2): p. 169-81. 23. Carroll, T.J., et al., Wnt9b plays a central role in the regulation of mesenchymal to epithelial transitions underlying organogenesis of the mammalian urogenital system. Dev Cell, 2005. 9(2): p. 283-92. 24. Combes, A.N., J.A. Davies, and M.H. Little, Cell-cell interactions driving kidney morphogenesis. Curr Top Dev Biol, 2015. 112: p. 467-508. 25. Costantini, F. and R. Kopan, Patterning a complex organ: branching morphogenesis and nephron segmentation in kidney development. Dev Cell, 2010. 18(5): p. 698-712. 26. Little, M.H. and A.P. McMahon, Mammalian kidney development: principles, progress, and projections. Cold Spring Harb Perspect Biol, 2012. 4(5). 27. Self, M., et al., Six2 is required for suppression of nephrogenesis and progenitor renewal in the developing kidney. EMBO J, 2006. 25(21): p. 5214-28. 28. Park, J.S., M.T. Valerius, and A.P. McMahon, Wnt/beta-catenin signaling regulates nephron induction during mouse kidney development. Development, 2007. 134(13): p. 2533-9. 29. Park, J.S., et al., Six2 and Wnt regulate self-renewal and commitment of nephron progenitors through shared gene regulatory networks. Dev Cell, 2012. 23(3): p. 637-51. 30. Little, M., et al., Kidney development: two tales of tubulogenesis. Curr Top Dev Biol, 2010. 90: p. 193-229. 31. Georgas, K., et al., Analysis of early nephron patterning reveals a role for distal RV proliferation in fusion to the ureteric tip via a cap mesenchyme-derived connecting segment. Dev Biol, 2009. 332(2): p. 273-86. 32. Kopan, R., H.T. Cheng, and K. Surendran, Molecular insights into segmentation along the proximal-distal axis of the nephron. J Am Soc Nephrol, 2007. 18(7): p. 2014-20. 33. Deacon, P., et al., β-catenin regulates the formation of multiple nephron segments in the mouse kidney. Scientific Reports, 2019. 9(1): p. 15915. 34. Kao, R.M., et al., Invasion of distal nephron precursors associates with tubular interconnection during nephrogenesis. J Am Soc Nephrol, 2012. 23(10): p. 1682- 90. 35. Dong, L., et al., Integration of Cistromic and Transcriptomic Analyses Identifies Nphs2, Mafb, and Magi2 as Wilms' Tumor 1 Target Genes in Podocyte Differentiation and Maintenance. J Am Soc Nephrol, 2015. 26(9): p. 2118-28. 36. Kann, M., et al., Genome-Wide Analysis of Wilms' Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms. J Am Soc Nephrol, 2015. 26(9): p. 2097-104. 37. Walsh, S.B. and R.J. Unwin, Renal tubular disorders. Clin Med (Lond), 2012. 12(5): p. 476-9.

87 38. Kang, H.M., et al., Defective fatty acid oxidation in renal tubular epithelial cells has a key role in kidney fibrosis development. Nat Med, 2015. 21(1): p. 37-46. 39. Adam, M., A.S. Potter, and S.S. Potter, Psychrophilic proteases dramatically reduce single-cell RNA-seq artifacts: a molecular atlas of kidney development. Development, 2017. 144(19): p. 3625-3632. 40. Cheng, H.T., et al., Gamma-secretase activity is dispensable for mesenchyme- to-epithelium transition but required for podocyte and proximal tubule formation in developing mouse kidney. Development, 2003. 130(20): p. 5031-42. 41. Cheng, H.T., et al., Notch2, but not Notch1, is required for proximal fate acquisition in the mammalian nephron. Development, 2007. 134(4): p. 801-11. 42. Chung, E., et al., Notch signaling promotes nephrogenesis by downregulating Six2. Development, 2016. 143(21): p. 3907-3913. 43. Chung, E., P. Deacon, and J.S. Park, Notch is required for the formation of all nephron segments and primes nephron progenitors for differentiation. Development, 2017. 144(24): p. 4530-4539. 44. Cho, E.A., et al., Differential expression and function of cadherin-6 during renal epithelium development. Development, 1998. 125(5): p. 803-12. 45. Igarashi, T., Pediatric Fanconi Syndrome, in Pediatric Nephrology, E.D. Avner, et al., Editors. 2016, Springer Berlin Heidelberg: Berlin, Heidelberg. p. 1355-1388. 46. Klootwijk, E.D., et al., Renal Fanconi syndrome: taking a proximal look at the nephron. Nephrol Dial Transplant, 2015. 30(9): p. 1456-60. 47. Sirac, C., et al., Toward understanding renal Fanconi syndrome: step by step advances through experimental models. Contrib Nephrol, 2011. 169: p. 247-61. 48. Kramer, H.J. and H.C. Gonick, Experimental Fanconi syndrome. I. Effect of maleic acid on renal cortical Na-K-ATPase activity and ATP levels. J Lab Clin Med, 1970. 76(5): p. 799-808. 49. Maldonado, J.E., et al., Fanconi syndrome in adults. A manifestation of a latent form of myeloma. Am J Med, 1975. 58(3): p. 354-64. 50. Messiaen, T., et al., Adult Fanconi syndrome secondary to light chain gammopathy. Clinicopathologic heterogeneity and unusual features in 11 patients. Medicine (Baltimore), 2000. 79(3): p. 135-54. 51. Gonick, H., et al., Cadmium-induced experimental Fanconi syndrome. Curr Probl Clin Biochem, 1975. 4: p. 111-8. 52. Gonick, H.C., Nephrotoxicity of cadmium & lead. Indian J Med Res, 2008. 128(4): p. 335-52. 53. Lichter-Konecki, U., et al., Genetic and physical mapping of the locus for autosomal dominant renal Fanconi syndrome, on chromosome 15q15.3. Am J Hum Genet, 2001. 68(1): p. 264-8. 54. Magen, D., et al., A loss-of-function mutation in NaPi-IIa and renal Fanconi's syndrome. N Engl J Med, 2010. 362(12): p. 1102-9. 55. Tieder, M., et al., Elevated serum 1,25-dihydroxyvitamin D concentrations in siblings with primary Fanconi's syndrome. N Engl J Med, 1988. 319(13): p. 845- 9. 56. Tolaymat, A., A. Sakarcan, and R. Neiberger, Idiopathic Fanconi syndrome in a family. Part I. Clinical aspects. J Am Soc Nephrol, 1992. 2(8): p. 1310-7.

88 57. Klootwijk, E.D., et al., Mistargeting of peroxisomal EHHADH and inherited renal Fanconi's syndrome. N Engl J Med, 2014. 370(2): p. 129-38. 58. Assmann, N., et al., Renal Fanconi Syndrome Is Caused by a Mistargeting- Based Mitochondriopathy. Cell Rep, 2016. 15(7): p. 1423-1429. 59. Hamilton, A.J., et al., The HNF4A R76W mutation causes atypical dominant Fanconi syndrome in addition to a beta cell phenotype. J Med Genet, 2014. 51(3): p. 165-9. 60. Litzinger, M.H.J., et al., Fanconi Syndrome. US Pharmacist, 2011. 36(6): p. HS12-HS16. 61. Izzedine, H., et al., Drug-induced Fanconi's syndrome. Am J Kidney Dis, 2003. 41(2): p. 292-309. 62. Long, W.S., et al., Idiopathic Fanconi syndrome with progressive renal failure: a case report and discussion. Yale J Biol Med, 1990. 63(1): p. 15-28. 63. Wilmer, M.J., et al., Cystinosis: practical tools for diagnosis and treatment. Pediatr Nephrol, 2011. 26(2): p. 205-15. 64. Bokenkamp, A. and M. Ludwig, Disorders of the renal proximal tubule. Nephron Physiol, 2011. 118(1): p. p1-6. 65. Wen, S.F., A.L. Friedman, and T.D. Oberley, Two case studies from a family with primary Fanconi syndrome. Am J Kidney Dis, 1989. 13(3): p. 240-6. 66. Sheldon, W., J. Luder, and B. Webb, A Familial Tubular Absorption Defect of Glucose and Amino Acids. Arch Dis Child, 1961. 36(185): p. 90-5. 67. Luder, J. and W. Sheldon, A familial tubular absorption defect of glucose and amino acids. Arch Dis Child, 1955. 30(150): p. 160-4. 68. Wang, S.S., et al., Mice lacking renal chloride channel, CLC-5, are a model for Dent's disease, a nephrolithiasis disorder associated with defective receptor- mediated endocytosis. Hum Mol Genet, 2000. 9(20): p. 2937-45. 69. Piwon, N., et al., ClC-5 Cl- -channel disruption impairs endocytosis in a mouse model for Dent's disease. Nature, 2000. 408(6810): p. 369-73. 70. Devuyst, O., et al., Chloride channels and endocytosis: new insights from Dent's disease and ClC-5 knockout mice. Nephron Physiol, 2005. 99(3): p. p69-73. 71. Leheste, J.R., et al., Megalin knockout mice as an animal model of low molecular weight proteinuria. Am J Pathol, 1999. 155(4): p. 1361-70. 72. Pontoglio, M., et al., Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome. Cell, 1996. 84(4): p. 575-85. 73. Pontoglio, M., et al., HNF1alpha controls renal glucose reabsorption in mouse and man. EMBO Rep, 2000. 1(4): p. 359-65. 74. Sladek, F.M., et al., Liver-enriched transcription factor HNF-4 is a novel member of the steroid hormone receptor superfamily. Genes Dev, 1990. 4(12B): p. 2353- 65. 75. Sladek, F.M., What are nuclear receptor ligands? Mol Cell Endocrinol, 2011. 334(1-2): p. 3-13. 76. Hwang-Verslues, W.W. and F.M. Sladek, HNF4alpha--role in drug metabolism and potential drug target? Curr Opin Pharmacol, 2010. 10(6): p. 698-705.

89 77. Guo, S. and H. Lu, Novel mechanisms of regulation of the expression and transcriptional activity of hepatocyte nuclear factor 4alpha. J Cell Biochem, 2019. 120(1): p. 519-532. 78. Eeckhoute, J., et al., Hepatocyte nuclear factor 4 alpha isoforms originated from the P1 promoter are expressed in human pancreatic beta-cells and exhibit stronger transcriptional potentials than P2 promoter-driven isoforms. Endocrinology, 2003. 144(5): p. 1686-94. 79. Duda, K., Y.I. Chi, and S.E. Shoelson, Structural basis for HNF-4alpha activation by ligand and coactivator binding. J Biol Chem, 2004. 279(22): p. 23311-6. 80. Yuan, X., et al., Identification of an endogenous ligand bound to a native orphan nuclear receptor. PLoS One, 2009. 4(5): p. e5609. 81. Bogan, A.A., et al., Analysis of protein dimerization and ligand binding of orphan receptor HNF4alpha. J Mol Biol, 2000. 302(4): p. 831-51. 82. Kanazawa, T., et al., Expression of hepatocyte nuclear factor 4alpha in developing mice. Anat Histol Embryol, 2009. 38(1): p. 34-41. 83. DeLaForest, A., et al., HNF4A is essential for specification of hepatic progenitors from human pluripotent stem cells. Development, 2011. 138(19): p. 4143-53. 84. Chiba, H., et al., The nuclear receptor hepatocyte nuclear factor 4alpha acts as a morphogen to induce the formation of microvilli. J Cell Biol, 2006. 175(6): p. 971- 80. 85. Martovetsky, G., J.B. Tee, and S.K. Nigam, Hepatocyte nuclear factors 4alpha and 1alpha regulate kidney developmental expression of drug-metabolizing enzymes and drug transporters. Mol Pharmacol, 2013. 84(6): p. 808-23. 86. Lee, J.W., C.L. Chou, and M.A. Knepper, Deep Sequencing in Microdissected Renal Tubules Identifies Nephron Segment-Specific Transcriptomes. J Am Soc Nephrol, 2015. 26(11): p. 2669-77. 87. Chen, W.S., et al., Disruption of the HNF-4 gene, expressed in visceral endoderm, leads to cell death in embryonic ectoderm and impaired gastrulation of mouse embryos. Genes Dev, 1994. 8(20): p. 2466-77. 88. Kanazawa, T., et al., Hepatocyte nuclear factor 4 alpha is associated with mesenchymal-epithelial transition in developing kidneys of C57BL/6 mice. J Vet Med Sci, 2011. 73(5): p. 601-7. 89. Ellard, S. and K. Colclough, Mutations in the genes encoding the transcription factors hepatocyte nuclear factor 1 alpha (HNF1A) and 4 alpha (HNF4A) in maturity-onset diabetes of the young. Hum Mutat, 2006. 27(9): p. 854-69. 90. Yamagata, K., et al., Mutations in the hepatocyte nuclear factor-4alpha gene in maturity-onset diabetes of the young (MODY1). Nature, 1996. 384(6608): p. 458- 60. 91. Takaori, K., et al., Severity and Frequency of Proximal Tubule Injury Determines Renal Prognosis. J Am Soc Nephrol, 2016. 27(8): p. 2393-406. 92. Chevalier, R.L., The proximal tubule is the primary target of injury and progression of kidney disease: role of the glomerulotubular junction. Am J Physiol Renal Physiol, 2016. 311(1): p. F145-61. 93. Grgic, I., et al., Targeted proximal tubule injury triggers interstitial fibrosis and glomerulosclerosis. Kidney Int, 2012. 82(2): p. 172-83.

90 94. McMahon, A.P., et al., GUDMAP: the genitourinary developmental molecular anatomy project. J Am Soc Nephrol, 2008. 19(4): p. 667-71. 95. Nishinakamura, R., Human kidney organoids: progress and remaining challenges. Nat Rev Nephrol, 2019. 15(10): p. 613-624. 96. Marable, S.S., et al., Hnf4a deletion in the mouse kidney phenocopies Fanconi renotubular syndrome. JCI Insight, 2018. 3(14). 97. Blaine, J., M. Chonchol, and M. Levi, Renal control of calcium, phosphate, and magnesium homeostasis. Clin J Am Soc Nephrol, 2015. 10(7): p. 1257-72. 98. Hayhurst, G.P., et al., Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol, 2001. 21(4): p. 1393-403. 99. Hatzis, P. and I. Talianidis, Regulatory mechanisms controlling human hepatocyte nuclear factor 4alpha gene expression. Mol Cell Biol, 2001. 21(21): p. 7320-30. 100. Thiagarajan, R.D., et al., Identification of anchor genes during kidney development defines ontological relationships, molecular subcompartments and regulatory pathways. PLoS One, 2011. 6(2): p. e17286. 101. Madisen, L., et al., A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci, 2010. 13(1): p. 133-40. 102. Schulte, B.A. and S.S. Spicer, Histochemical evaluation of mouse and rat kidneys with lectin-horseradish peroxidase conjugates. Am J Anat, 1983. 168(3): p. 345-62. 103. Hennigar, R.A., B.A. Schulte, and S.S. Spicer, Heterogeneous distribution of glycoconjugates in human kidney tubules. Anat Rec, 1985. 211(4): p. 376-90. 104. Parviz, F., et al., Generation of a conditionally null allele of hnf4alpha. Genesis, 2002. 32(2): p. 130-3. 105. Engel, K., W. Hohne, and J. Haberle, Mutations and polymorphisms in the human argininosuccinate synthetase (ASS1) gene. Hum Mutat, 2009. 30(3): p. 300-7. 106. Dantzler, W.H., Renal organic anion transport: a comparative and cellular perspective. Biochim Biophys Acta, 2002. 1566(1-2): p. 169-81. 107. Nieskens, T.T., et al., A Human Renal Proximal Tubule Cell Line with Stable Organic Anion Transporter 1 and 3 Expression Predictive for Antiviral-Induced Toxicity. AAPS J, 2016. 18(2): p. 465-75. 108. Carone, F.A., et al., Renal tubular transport and catabolism of proteins and peptides. Kidney Int, 1979. 16(3): p. 271-8. 109. Nielsen, S., et al., Aquaporins in the kidney: from molecules to medicine. Physiol Rev, 2002. 82(1): p. 205-44. 110. Agarwal, S.K. and A. Gupta, Aquaporins: The renal water channels. Indian J Nephrol, 2008. 18(3): p. 95-100. 111. Schnermann, J., et al., Defective proximal tubular fluid reabsorption in transgenic aquaporin-1 null mice. Proc Natl Acad Sci U S A, 1998. 95(16): p. 9660-4. 112. Triplitt, C.L., Understanding the kidneys' role in blood glucose regulation. Am J Manag Care, 2012. 18(1 Suppl): p. S11-6.

91 113. Szablewski, L., Distribution of glucose transporters in renal diseases. J Biomed Sci, 2017. 24(1): p. 64. 114. Mueckler, M. and B. Thorens, The SLC2 (GLUT) family of membrane transporters. Mol Aspects Med, 2013. 34(2-3): p. 121-38. 115. Guillam, M.T., et al., Early diabetes and abnormal postnatal pancreatic islet development in mice lacking Glut-2. Nat Genet, 1997. 17(3): p. 327-30. 116. Santer, R., et al., Mutations in GLUT2, the gene for the liver-type glucose transporter, in patients with Fanconi-Bickel syndrome. Nat Genet, 1997. 17(3): p. 324-6. 117. Blaine, J., E.J. Weinman, and R. Cunningham, The regulation of renal phosphate transport. Adv Chronic Kidney Dis, 2011. 18(2): p. 77-84. 118. Lederer, E., Renal phosphate transporters. Curr Opin Nephrol Hypertens, 2014. 23(5): p. 502-6. 119. Forster, I.C., et al., Proximal tubular handling of phosphate: A molecular perspective. Kidney Int, 2006. 70(9): p. 1548-59. 120. Chau, H., et al., Renal calcification in mice homozygous for the disrupted type IIa Na/Pi cotransporter gene Npt2. J Bone Miner Res, 2003. 18(4): p. 644-57. 121. Chandra, V., et al., Multidomain integration in the structure of the HNF-4alpha nuclear receptor complex. Nature, 2013. 495(7441): p. 394-8. 122. Cheng, H.T. and R. Kopan, The role of Notch signaling in specification of podocyte and proximal tubules within the developing mouse kidney. Kidney Int, 2005. 68(5): p. 1951-2. 123. Wingert, R.A., et al., The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros. PLoS Genet, 2007. 3(10): p. 1922-38. 124. Li, Y., et al., Zebrafish nephrogenesis is regulated by interactions between retinoic acid, mecom, and Notch signaling. Dev Biol, 2014. 386(1): p. 111-22. 125. Qian, A., et al., Identification of retinoic acid-responsive elements on the HNF1alpha and HNF4alpha genes. Biochem Biophys Res Commun, 2000. 276(3): p. 837-42. 126. Huang da, W., B.T. Sherman, and R.A. Lempicki, Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc, 2009. 4(1): p. 44-57. 127. Huang da, W., B.T. Sherman, and R.A. Lempicki, Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res, 2009. 37(1): p. 1-13. 128. Boron, W.F., Acid-base transport by the renal proximal tubule. J Am Soc Nephrol, 2006. 17(9): p. 2368-82. 129. Nakamura, M., et al., Roles of renal proximal tubule transport in acid/base balance and blood pressure regulation. Biomed Res Int, 2014. 2014: p. 504808. 130. Alpern, R.J., Cell mechanisms of proximal tubule acidification. Physiol Rev, 1990. 70(1): p. 79-114. 131. Takenaka, M., et al., Isolation of genes identified in mouse renal proximal tubule by comparing different gene expression profiles. Kidney Int, 1998. 53(3): p. 562- 72.

92 132. Proctor, G., et al., Regulation of renal fatty acid and cholesterol metabolism, inflammation, and fibrosis in Akita and OVE26 mice with type 1 diabetes. Diabetes, 2006. 55(9): p. 2502-9. 133. Gonick, H.C., Pathophysiology of human proximal tubular transport defects. Klin Wochenschr, 1982. 60(19): p. 1201-11. 134. Marchesin, V., et al., Molecular Basis for Autosomal-Dominant Renal Fanconi Syndrome Caused by HNF4A. Cell Rep, 2019. 29(13): p. 4407-4421 e5. 135. Lan, Y., et al., A unique mouse strain expressing Cre recombinase for tissue- specific analysis of gene function in palate and kidney development. Genesis, 2007. 45(10): p. 618-24. 136. Kay, J.N., et al., Retinal ganglion cells with distinct directional preferences differ in molecular identity, structure, and central projections. J Neurosci, 2011. 31(21): p. 7753-62. 137. Langmead, B., et al., Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol, 2009. 10(3): p. R25. 138. Heinz, S., et al., Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell, 2010. 38(4): p. 576-89. 139. Trapnell, C., et al., Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat Biotechnol, 2013. 31(1): p. 46-53. 140. McLean, C.Y., et al., GREAT improves functional interpretation of cis-regulatory regions. Nat Biotechnol, 2010. 28(5): p. 495-501. 141. Surendran, K., et al., The contribution of Notch1 to nephron segmentation in the developing kidney is revealed in a sensitized Notch2 background and can be augmented by reducing Mint dosage. Dev Biol, 2010. 337(2): p. 386-95. 142. Christensen, E.I., et al., Endocytic receptors in the renal proximal tubule. Physiology (Bethesda), 2012. 27(4): p. 223-36. 143. Manz, F., et al., Idiopathic de Toni-Debre-Fanconi syndrome with absence of proximal tubular brush border. Clin Nephrol, 1984. 22(3): p. 149-57. 144. Longley, J.B. and E.R. Fisher, Alkaline phosphatase and the periodic acid Schiff reaction in the proximal tubule of the vertebrate kidney; a study in segmental differentiation. Anat Rec, 1954. 120(1): p. 1-21. 145. Wessely, O., et al., The bigger the better: determining nephron size in kidney. Pediatr Nephrol, 2014. 29(4): p. 525-30. 146. Zheng, K., Y. Xie, and H. Li, Congenital Nephrogenic Diabetes Insipidus Presented With Bilateral Hydronephrosis and Urinary Infection: A Case Report. Medicine (Baltimore), 2016. 95(22): p. e3464. 147. Sung, C.C. and S.H. Lin, Images in clinical medicine. Nonobstructive hydronephrosis with secondary polycythemia. N Engl J Med, 2011. 365(1): p. e1. 148. Jin, X.D., et al., Nephrogenic diabetes insipidus with dilatation of bilateral renal pelvis, ureter and bladder. Scand J Urol Nephrol, 2009. 43(1): p. 73-5. 149. Walesky, C. and U. Apte, Role of hepatocyte nuclear factor 4alpha (HNF4alpha) in cell proliferation and cancer. Gene Expr, 2015. 16(3): p. 101-8. 150. Ruijtenberg, S. and S. van den Heuvel, Coordinating cell proliferation and differentiation: Antagonism between cell cycle regulators and cell type-specific gene expression. Cell Cycle, 2016. 15(2): p. 196-212.

93 151. Sachs, L., Constitutive uncoupling of the controls for growth and differentiation in myeloid leukemia and the development of cancer. J Natl Cancer Inst, 1980. 65(4): p. 675-9. 152. Maione, R. and P. Amati, Interdependence between muscle differentiation and cell-cycle control. Biochim Biophys Acta, 1997. 1332(1): p. M19-30. 153. Walsh, K. and H. Perlman, Cell cycle exit upon myogenic differentiation. Curr Opin Genet Dev, 1997. 7(5): p. 597-602. 154. Marx, J., Cell biology. Cell cycle inhibitors may help brake growth as cells develop. Science, 1995. 267(5200): p. 963-4. 155. Gerdes, J., et al., Production of a mouse monoclonal antibody reactive with a human nuclear antigen associated with cell proliferation. Int J Cancer, 1983. 31(1): p. 13-20. 156. Gerdes, J., et al., Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol, 1984. 133(4): p. 1710-5. 157. Alison, M.R., Assessing cellular proliferation: what's worth measuring? Hum Exp Toxicol, 1995. 14(12): p. 935-44. 158. Scholzen, T. and J. Gerdes, The Ki-67 protein: from the known and the unknown. J Cell Physiol, 2000. 182(3): p. 311-22. 159. Balaban, R.S. and L.J. Mandel, Metabolic substrate utilization by rabbit proximal tubule. An NADH fluorescence study. Am J Physiol, 1988. 254(3 Pt 2): p. F407- 16. 160. Elhamri, M., et al., Substrate uptake and utilization by the kidney of fed and starved rats in vivo. Ren Physiol Biochem, 1993. 16(6): p. 311-24. 161. Weidemann, M.J. and H.A. Krebs, The fuel of respiration of rat kidney cortex. Biochem J, 1969. 112(2): p. 149-66. 162. Brunskill, E.W., et al., Single cell dissection of early kidney development: multilineage priming. Development, 2014. 141(15): p. 3093-101. 163. Hermsen, R., S. Tans, and P.R. ten Wolde, Transcriptional regulation by competing transcription factor modules. PLoS Comput Biol, 2006. 2(12): p. e164. 164. Casemayou, A., et al., Hepatocyte Nuclear Factor-1beta Controls Mitochondrial Respiration in Renal Tubular Cells. J Am Soc Nephrol, 2017. 28(11): p. 3205- 3217. 165. Ferre, S. and P. Igarashi, New insights into the role of HNF-1beta in kidney (patho)physiology. Pediatr Nephrol, 2019. 34(8): p. 1325-1335. 166. Izzedine, H., et al., Renal effects of PPARalpha-agonists. Minerva Urol Nefrol, 2004. 56(4): p. 339-42. 167. Lazzaro, D., et al., LFB1 and LFB3 homeoproteins are sequentially expressed during kidney development. Development, 1992. 114(2): p. 469-79. 168. Lau, H.H., et al., The molecular functions of hepatocyte nuclear factors - In and beyond the liver. J Hepatol, 2018. 68(5): p. 1033-1048. 169. Heliot, C., et al., HNF1B controls proximal-intermediate nephron segment identity in vertebrates by regulating Notch signalling components and Irx1/2. Development, 2013. 140(4): p. 873-85. 170. Massa, F., et al., Hepatocyte nuclear factor 1beta controls nephron tubular development. Development, 2013. 140(4): p. 886-96.

94 171. Kaminski, M.M., et al., Direct reprogramming of fibroblasts into renal tubular epithelial cells by defined transcription factors. Nat Cell Biol, 2016. 18(12): p. 1269-1280. 172. Gattineni, J. and M. Baum, Developmental changes in renal tubular transport-an overview. Pediatr Nephrol, 2015. 30(12): p. 2085-98. 173. Kusaba, T., et al., Differentiated kidney epithelial cells repair injured proximal tubule. Proc Natl Acad Sci U S A, 2014. 111(4): p. 1527-32. 174. el Marjou, F., et al., Tissue-specific and inducible Cre-mediated recombination in the gut epithelium. Genesis, 2004. 39(3): p. 186-93. 175. Rosselot, C., et al., Non-cell-autonomous retinoid signaling is crucial for renal development. Development, 2010. 137(2): p. 283-92. 176. Dawson, M.I. and Z. Xia, The retinoid X receptors and their ligands. Biochim Biophys Acta, 2012. 1821(1): p. 21-56. 177. Sugawara, A., et al., Retinoid X receptors in the kidney: their protein expression and functional significance. Endocrinology, 1997. 138(8): p. 3175-80. 178. Terryn, S., et al., Tubular proteinuria in patients with HNF1alpha mutations: HNF1alpha drives endocytosis in the proximal tubule. Kidney Int, 2016. 89(5): p. 1075-1089. 179. Centers for Disease Control and Prevention, Chronic Kidney Disease in the United States. 2019, US Department of Health and Human Services: Atlanta, GA. 180. Saran, R., et al., US Renal Data System 2018 Annual Data Report: Epidemiology of Kidney Disease in the United States. Am J Kidney Dis, 2019. 73(3 Suppl 1): p. A7-A8. 181. Hart, A., et al., OPTN/SRTR 2017 Annual Data Report: Kidney. Am J Transplant, 2019. 19 Suppl 2: p. 19-123. 182. Taguchi, A., et al., Redefining the in vivo origin of metanephric nephron progenitors enables generation of complex kidney structures from pluripotent stem cells. Cell Stem Cell, 2014. 14(1): p. 53-67. 183. Morizane, R., et al., Nephron organoids derived from human pluripotent stem cells model kidney development and injury. Nat Biotechnol, 2015. 33(11): p. 1193-200. 184. Freedman, B.S., et al., Modelling kidney disease with CRISPR-mutant kidney organoids derived from human pluripotent epiblast spheroids. Nat Commun, 2015. 6: p. 8715. 185. Taguchi, A. and R. Nishinakamura, Higher-Order Kidney Organogenesis from Pluripotent Stem Cells. Cell Stem Cell, 2017. 21(6): p. 730-746 e6. 186. Islam, M. and R. Nishinakamura, How to rebuild the kidney: recent advances in kidney organoids. J Biochem, 2019. 166(1): p. 7-12. 187. Wu, H., et al., Comparative Analysis and Refinement of Human PSC-Derived Kidney Organoid Differentiation with Single-Cell Transcriptomics. Cell Stem Cell, 2018. 23(6): p. 869-881 e8. 188. Little, M.H. and A.N. Combes, Kidney organoids: accurate models or fortunate accidents. Genes Dev, 2019. 33(19-20): p. 1319-1345. 189. Combes, A.N., et al., Single-cell analysis reveals congruence between kidney organoids and human fetal kidney. Genome Med, 2019. 11(1): p. 3.

95 190. De, S. and R. Nishinakamura, Kidney Development and Injury: A Road to Regeneration, in Acute Kidney Injury and Regenerative Medicine, Y. Terada, T. Wada, and K. Doi, Editors. 2020, Springer Singapore: Singapore. p. 371-381. 191. King, S.M., et al., 3D Proximal Tubule Tissues Recapitulate Key Aspects of Renal Physiology to Enable Nephrotoxicity Testing. Front Physiol, 2017. 8: p. 123. 192. Vaidya, V.S., M.A. Ferguson, and J.V. Bonventre, Biomarkers of acute kidney injury. Annu Rev Pharmacol Toxicol, 2008. 48: p. 463-93. 193. Longabaugh, W.J., BioTapestry: a tool to visualize the dynamic properties of gene regulatory networks. Methods Mol Biol, 2012. 786: p. 359-94.