DOCSLIB.ORG

Enhanced Trehalose Production Improves Growth of Escherichia Coli Under Osmotic Stress† J

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Enhanced Trehalose Production Improves Growth of Escherichia Coli Under Osmotic Stress† J APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2005, p. 3761–3769 Vol. 71, No. 7 0099-2240/05/$08.00ϩ0 doi:10.1128/AEM.71.7.3761–3769.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Enhanced Trehalose Production Improves Growth of Escherichia coli under Osmotic Stress† J. E. Purvis, L. P. Yomano, and L. O. Ingram* Department of Microbiology and Cell Science, Box 110700, University of Florida, Gainesville, Florida 32611 Downloaded from Received 7 July 2004/Accepted 9 January 2005 The biosynthesis of trehalose has been previously shown to serve as an important osmoprotectant and stress protectant in Escherichia coli. Our results indicate that overproduction of trehalose (integrated lacI-Ptac-otsBA) above the level produced by the native regulatory system can be used to increase the growth of E. coli in M9-2% glucose medium at 37°C to 41°C and to increase growth at 37°C in the presence of a variety of osmotic-stress agents (hexose sugars, inorganic salts, and pyruvate). Smaller improvements were noted with xylose and some fermentation products (ethanol and pyruvate). Based on these results, overproduction of trehalose may be a useful trait to include in biocatalysts engineered for commodity chemicals. http://aem.asm.org/ Bacteria have a remarkable capacity for adaptation to envi- and lignocellulose (6, 7, 10, 28, 30, 31, 32, 45). Biobased pro- ronmental stress (39). A part of this defense system involves duction of these renewable chemicals would be facilitated by the intracellular accumulation of protective compounds that improved growth under thermal stress and by increased toler- shield macromolecules and membranes from damage (9, 24). ance to osmotic stress from high concentrations of sugars and Escherichia coli utilizes a variety of compounds for this pur- salts present in industrial feedstocks. Most prior E. coli studies pose, including proline, trehalose, betaine, and dimethylsulfo- concerning trehalose have focused primarily on cell survival niopropionate. Although glutamate and proline provide tran- under osmotic stress from NaCl or glucose or during desicca- on November 29, 2017 by UNIV OF NORTH CAROLINA sient relief from osmotic stress, allosteric control of proline tion. In this paper, we have constructed isogenic derivatives of biosynthesis in E. coli and the negative charge of glutamate E. coli K-12 to examine the importance of trehalose biosyn- limit their effectiveness. Recent studies have shown that the thesis for growth during stress (caused by salts, sugars, fermen- addition of betaine and dimethylsulfoniopropionate stimulated tation products, and environmental extremes) and the effect of the growth of and ethanol production by recombinant E. coli trehalose overproduction. (41). Betaine also improved the growth of Bacillus subtilis at elevated temperatures (20). However, neither of these protec- MATERIALS AND METHODS tive compounds can be synthesized de novo by E. coli.Inthe absence of supplements, trehalose serves as the primary pro- Bacteria, plasmids, and culture conditions. Strains and plasmids used in this study are listed in Table 1. Cultures were grown at 37°C in LB alone (2) or on LB tective osmolyte (22). Ϫ solidified with 1.5% agar during strain construction. Ampicillin (50 mg liter 1), Genes encoding trehalose biosynthesis are widely distrib- kanamycin (50 mg literϪ1), and tetracycline (12.5 mg literϪ1) were added as uted in nature (14, 35) and have been extensively studied in E. appropriate for selection. For studies of osmotic tolerance, cultures were grown coli and Saccharomyces spp. In E. coli, the trehalose biosyn- in M9 medium (pH 7.0) (2) containing 2% glucose (without antibiotics). Growth thetic operon (otsBA) is induced by osmotic shock (16), ex- in tube cultures was monitored spectrophotometrically at 550 nm using a Spec- tronic 70 spectrophotometer (Bausch & Lomb, Inc., Rochester, N.Y.). Growth in treme heat (13), extreme cold (23), desiccation (43), and entry shaken flasks was monitored at 550 nm by using a Beckman DU 640 spectro- into stationary phase (19). Two enzymes are unique to treha- photometer. lose biosynthesis: trehalose-6-phosphate synthase, encoded by Construction of strain JP10. Standard genetic methods were used during this otsA, and trehalose-6-phosphate phosphatase, encoded by otsB study (2). Strain JP10 was constructed by sequentially inserting deletions of the (Fig. 1). Mutations in these genes decreased tolerance to os- genes involved in trehalose biosynthesis and degradation (Fig. 1). Coding regions for treA, treC, and treF were each amplified from W3110 using the respective motic stress and decreased survival during storage. The treha- ORFmer primers (Sigma-Genosys, The Woodlands, TX) and cloned into lose biosynthetic operon (otsBA) from E. coli has been used to pCR2.1-TOPO. Coding regions for otsBA genes were amplified by PCR using the genetically engineer increased stress tolerance in plants (15) following primers: N terminus, 5ЈAAGGAGGAGAACCGGGTGACA3Ј, and C Ј Ј and in mammalian cells (18, 40). This operon has recently been terminus, 5 ACGCAGCGTGATGCATGAAG3 . An internal deletion was con- structed in the coding region of each trehalose catabolic gene and replaced with overexpressed in Corynebacterium glutamicum for the produc- a SmaI fragment from pLOI2065 containing a FRT (recognition target for re- tion of extracellular trehalose (33). combinase)-flanked tet gene from pLOI2065 (Table 1). Plasmid pLOI3621 was Recent interest in developing microbial biocatalysts for the cut with HpaI to remove the central coding region of treA. Similar excisions were production of commodity chemicals offers the potential to re- made for treF (pLOI3631) and treC (pLOI3641) using the restriction sites AgeI otsAB place petroleum feedstocks with renewable sugars from starch and PshAI, respectively. Deleted coding regions of genes (1,698-bp SspI deletion of pLOI3601) were replaced with a FRT-flanked kan gene from pLOI2511 (SmaI fragment). Resulting gene fragments with antibiotic markers were amplified by PCR. Chromosomal integration of amplification products was * Corresponding author. Mailing address: Dept. of Microbiology facilitated by pKD46 containing an arabinose-inducible red recombinase (11). and Cell Science, Bldg. 981 Museum Road, IFAS, P.O. Box 110700, Each deletion was sequentially integrated into W3110. The FRT-flanked antibi- University of Florida, Gainesville, FL 32611. Phone: (352) 392-8176. otic resistance genes were removed using FLP recombinase (27, 34). The Fax: (352) 846-0969. E-mail: ingram@ufl.edu. treA::FRT-tet-FRT mutation was inserted last to produce JP15. After deletion of † Florida Agricultural Experiment Station publication no. R-10904. the tet gene in JP15, the final construct was designated JP10 (⌬otsBA::FRT 3761 3762 PURVIS ET AL. APPL.ENVIRON.MICROBIOL. Downloaded from http://aem.asm.org/ FIG. 1. Trehalose metabolism in E. coli. Glucose is transported into the cell and activated by the phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS). The biosynthetic pathway for trehalose is indicated by the thicker arrows (double arrows, synthesis of UDP-glucose; filled arrows, condensation and dephosphorylation). Genes deleted in JP10 and JP20 are shown in black boxes. JP20 also contains a functional, regulated ots operon (lacI-Ptac-otsBA) integrated into the ampH gene. Trehalose is degraded by both periplasmic (TreA [4]) and cytoplasmic (TreF [21]) enzymes. Trehalose biosynthesis is also controlled by the synthesis of TreC, which dephosphorylates trehalose-6-phosphate (36). Stretch-activated proteins (SAP) in the plasma membrane facilitate the exit of trehalose under hypotonic conditions (37). on November 29, 2017 by UNIV OF NORTH CAROLINA ⌬treA::FRT ⌬treC::FRT ⌬treF::FRT). At each step, the strains were tested for was assayed for trehalose by thin-layer chromatography as described previously appropriate antibiotic resistance. Mutations were verified by analysis of the PCR (46). After being visualized with N-(1-naphthyl)ethylenediamine reagent, rela- products. tive amounts of trehalose were determined by densitometry using Quantity One Construction of JP20, JP21, JP22, JP23, and JP24. A conjugative transposon software (Bio-Rad). For estimates of intracellular trehalose concentrations, a vector (pLOI3650) was constructed to integrate a 6.1-kb fragment containing a volume of 2 ml per gram of dry cells was assumed. regulated ots operon (lacI-Ptac-otsBA-FRT-kan-FRT) into JP15. This construct Tolerance assays. Tolerance was evaluated by measuring growth (defined as was based on the ␭pir-dependent transposase vector designed by de Lorenzo et final cell mass after 24 h) in M9 minimal medium containing 2% glucose (M9-2% al. (12). The kanamycin gene in the mini Tn5 Km2 plasmid was replaced with a glucose). The MIC was defined as the concentration (interpolated) at which PacI linker by digestion with SfiI and Klenow treatment prior to ligation. The growth was restricted to less than two doublings (fourfold increase in OD) in NotI site was eliminated (NotI, Klenow treatment, and self-ligation) to produce 24 h. For these tests, cells from a fresh plate were resuspended in M9 medium pLOI3469 (Fig. 2). The kan gene was also inactivated in pLOI3601 containing containing 2% glucose and used as the inoculum (initial level of 0.03 OD550 nm). otsBA (StyI, Klenow treatment, and self-ligation) to produce pLOI3604. A SmaI Cultures were incubated in 13- by 100-mm capped tubes (37°C water bath, fragment from pLOI2511 containing the FRT-flanked kan gene
Load more

Recommended publications
  • Fermentation of Glucose and Xylose to Hydrogen in the Presence of Long Chain Fatty Acids
    University of Windsor Scholarship at UWindsor Electronic Theses and Dissertations Theses, Dissertations, and Major Papers 2009 Fermentation of Glucose and Xylose to Hydrogen in the Presence of Long Chain Fatty Acids Stephen Reaume University of Windsor Follow this and additional works at: https://scholar.uwindsor.ca/etd Recommended Citation Reaume, Stephen, "Fermentation of Glucose and Xylose to Hydrogen in the Presence of Long Chain Fatty Acids" (2009). Electronic Theses and Dissertations. 92. https://scholar.uwindsor.ca/etd/92 This online database contains the full-text of PhD dissertations and Masters’ theses of University of Windsor students from 1954 forward. These documents are made available for personal study and research purposes only, in accordance with the Canadian Copyright Act and the Creative Commons license—CC BY-NC-ND (Attribution, Non-Commercial, No Derivative Works). Under this license, works must always be attributed to the copyright holder (original author), cannot be used for any commercial purposes, and may not be altered. Any other use would require the permission of the copyright holder. Students may inquire about withdrawing their dissertation and/or thesis from this database. For additional inquiries, please contact the repository administrator via email ([email protected]) or by telephone at 519-253-3000ext. 3208. Fermentation of Glucose and Xylose to Hydrogen in the Presence of Long Chain Fatty Acids by Stephen Reaume A Thesis Submitted to the Faculty of Graduate Studies through the Environmental Engineering Program in Partial Fulfillment of the Requirements for the Degree of Master of Applied Science at the University of Windsor Windsor, Ontario, Canada 2009 © 2009 Stephen Reaume AUTHORS DECLARATION OF ORIGINALITY I hereby certify that I am the sole author of this thesis and that no part of this thesis has been published or submitted for publication.
    [Show full text]
  • Acute and Chronic Effects of Dietary Lactose in Adult Rats Are Not Explained by Residual Intestinal Lactase Activity
    Nutrients 2015, 7, 5542-5555; doi:10.3390/nu7075237 OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journal/nutrients Article Acute and Chronic Effects of Dietary Lactose in Adult Rats Are not Explained by Residual Intestinal Lactase Activity Bert J. M. van de Heijning *, Diane Kegler, Lidewij Schipper, Eline Voogd, Annemarie Oosting and Eline M. van der Beek Danone Nutricia Research, PO Box 80141, TC Utrecht 3508, The Netherlands; E-Mails: [email protected] (D.K.); [email protected] (L.S.); [email protected] (E.V.); [email protected] (A.O.); [email protected] (E.M.B.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +31-30-2095-000. Received: 5 June 2015 / Accepted: 30 June 2015 / Published: 8 July 2015 Abstract: Neonatal rats have a high intestinal lactase activity, which declines around weaning. Yet, the effects of lactose-containing products are often studied in adult animals. This report is on the residual, post-weaning lactase activity and on the short- and long-term effects of lactose exposure in adult rats. Acutely, the postprandial plasma response to increasing doses of lactose was studied, and chronically, the effects of a 30% lactose diet fed from postnatal (PN) Day 15 onwards were evaluated. Intestinal lactase activity, as assessed both in vivo and in vitro, was compared between both test methods and diet groups (lactose vs. control). A 50%–75% decreased digestive capability towards lactose was observed from weaning into adulthood. Instillation of lactose in adult rats showed disproportionally low increases in plasma glucose levels and did not elicit an insulin response.
    [Show full text]
  • Xylose Fermentation to Ethanol by Schizosaccharomyces Pombe Clones with Xylose Isomerase Gene." Biotechnology Letters (8:4); Pp
    NREL!TP-421-4944 • UC Category: 246 • DE93000067 l I Xylose Fermenta to Ethanol: A R ew '.) i I, -- , ) )I' J. D. McMillan I ' J.( .!i �/ .6' ....� .T u�.•ls:l ., �-- • National Renewable Energy Laboratory II 'J 1617 Cole Boulevard Golden, Colorado 80401-3393 A Division of Midwest Research Institute Operated for the U.S. Department of Energy under Contract No. DE-AC02-83CH10093 Prepared under task no. BF223732 January 1993 NOTICE This report was prepared as an account of work sponsored by an agency of the United States government. Neither the United States government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, com­ pleteness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise does not necessarily con­ stitute or imply its endorsement, recommendation, or favoring by the United States government or any agency thereof. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States government or any agency thereof. Printed in the United States of America Available from: National Technical Information Service U.S. Department of Commerce 5285 Port Royal Road Springfield, VA22161 Price: Microfiche A01 Printed Copy A03 Codes are used for pricing all publications. The code is determined by the number of pages in the publication. Information pertaining to the pricing codes can be found in the current issue of the following publications which are generally available in most libraries: Energy Research Abstracts (ERA); Govern­ ment Reports Announcements and Index ( GRA and I); Scientific and Technical Abstract Reports(STAR); and publication NTIS-PR-360 available from NTIS at the above address.
    [Show full text]
  • Conversion of Carbohydrates to Furfural Via Selective Cleavage Of
    Electronic Supplementary Material (ESI) for Green Chemistry. This journal is © The Royal Society of Chemistry 2015 Conversion of carbohydrates to furfural via selective cleavage of carbon-carbon bond: cooperative effect of zeolite and solvent Jinglei Cui,ab Jingjing Tan,ab Tiansheng Deng,a Xiaojing Cui,a Yulei Zhu*ac and Yongwang Liac a State Key Laboratory of Coal Conversion, Institute of Coal Chemistry, Chinese Academy of Sciences, Taiyuan 030001, PR China. E-mail: [email protected]; Fax: +86-351-7560668. b University of Chinese Academy of Sciences, Beijing, 100049, PR China. c Synfuels China Co. Ltd., Beijing, PR China. 1. Materials Cellulose, inulin, starch, sucrose, maltose, D-glucose, D-fructose, D-xylose, D- arabinose, 5-hydromethylfurfural (HMF), formic acid (FA) and levulinic acid (LA) were purchased from Aladdin. γ-valerolactone (GVL), γ-butyrolactone (GBL), 1,4- dioxane, gluconic acid, H2SO4 (98%), Amberlyst-15, AlCl3 and γ-Al2O3 were purchased from Sinopharm Chemical Reagent Co., Ltd.. All the above agents were utilized without further purification. Hβ, HY, H-Mordenite and HZSM-5 zeolite were purchased from The Catalyst Plant of Nankai University. 2. Experiments 2.1 The computational formula The conversion of sugars and the yield of the products were quantified according to the following equations: 푚표푙 표푓 푠푢푔푎푟(푖푛푙푒푡)－푚표푙 표푓 푠푢푔푎푟(표푢푡푙푒푡) Conversion = 푚표푙 표푓 푠푢푔푎푟(푖푛푙푒푡) ×100% 푚표푙 표푓 표푛푒 푝푟표푑푢푐푡 푝푟표푑푢푐푒푑 Yield =푚표푙 표푓 푡ℎ푒표푟푒푡푖푐푎푙 푝푟표푑푢푐푡 푣푎푙푢푒×100% 2.2 Procedures for the catalyst recycling After the first run was completed, the reaction products were centrifuged for 10 min to separate the Hβ zeolite from the solutions.
    [Show full text]
  • The Fischer Proof of the Structure of (+)-Glucose Started in 1888, 12
    The Fischer proof of the structure of (+)-glucose Started in 1888, 12 years after the proposal that carbon was tetrahedral, and thus had stereoisomers. Tools: - melting points - optical rotation (determine whether a molecule is optically active) - chemical reactions Fischer knew: - (+)-glucose is an aldohexose. - Therefore, there are 4 stereocenters and 24 = 16 stereoisomers (8 D-sugars and 8 L-sugars) - At this time could not determine the actual configuration (D or L) of sugars - Fischer arbitrarily assigned D-glyceraldehyde the following structure. CHO H OH CH2OH - In 1951 Fischer was shown to have guessed correctly. CO2H CHO H OH HO H HO H CH2OH CO2H L-Tartaric acid L-glyceraldehyde Which of the 8 D-aldohexoses is (+)-glucose??? 1) Oxidation of (+)-glucose with nitric acid gives an aldaric acid, glucaric acid, that is optically active. Therefore (+)-glucose cannot have structures 1 or 7, which would give optically inactive aldaric acids. HNO3 (+)-glucose Glucaric acid Optically active CHO CO2H H OH H OH 1 H OH HNO3 H OH Mirror plane H OH H OH H OH H OH Since these aldaric CH2OH CO2H acids have mirror planes they are meso structures. CHO CO2H They are not optically H OH H OH active HO H HNO3 HO H 7 Mirror plane HO H HO H H OH H OH CH2OH CO2H 2) Ruff degradation of (+)-glucose gives (-)-arabinose. Oxidation of (-)-arabinose with nitric acid gives arabanaric acid, which is optically active. Therefore, (-)-arabinose cannot have structures 9 or 11, which would give optically inactive aldaric acids. If arabinose cannot be 9 or 11, (+)-glucose cannot be 2 (1 was already eliminated), 5 or 6, which would give 9 or 11 in a Ruff degradation.
    [Show full text]
  • Influence of Different Hydrocolloids on Dough Thermo-Mechanical Properties and in Vitro Starch Digestibility of Gluten-Free Steamed Bread Based on Potato Flour
    Accepted Manuscript Influence of different hydrocolloids on dough thermo-mechanical properties and in vitro starch digestibility of gluten-free steamed bread based on potato flour Xingli Liu, Taihua Mu, Hongnan Sun, Miao Zhang, Jingwang Chen, Marie Laure Fauconnier PII: S0308-8146(17)31191-3 DOI: http://dx.doi.org/10.1016/j.foodchem.2017.07.047 Reference: FOCH 21431 To appear in: Food Chemistry Received Date: 29 March 2017 Revised Date: 4 July 2017 Accepted Date: 10 July 2017 Please cite this article as: Liu, X., Mu, T., Sun, H., Zhang, M., Chen, J., Fauconnier, M.L., Influence of different hydrocolloids on dough thermo-mechanical properties and in vitro starch digestibility of gluten-free steamed bread based on potato flour, Food Chemistry (2017), doi: http://dx.doi.org/10.1016/j.foodchem.2017.07.047 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Influence of different hydrocolloids on dough thermo-mechanical properties and in vitro starch digestibility of gluten-free steamed bread based on potato flour Xingli Liu1,2, Taihua Mu1*, Hongnan Sun1, Miao Zhang1, Jingwang Chen1,2, Marie Laure Fauconnier2 1. Key Laboratory of Agro-Products Processing, Ministry of Agriculture; Institute of Food Science and Technology, Chinese Academy of Agricultural Sciences, 2 Yuanmingyuan west road, Haidian, Beijing 100193, P.R.
    [Show full text]
  • Structural Features
    1 Structural features As defined by the International Union of Pure and Applied Chemistry gly- cans are structures of multiple monosaccharides linked through glycosidic bonds. The terms sugar and saccharide are synonyms, depending on your preference for Arabic (“sukkar”) or Greek (“sakkēaron”). Saccharide is the root for monosaccha- rides (a single carbohydrate unit), oligosaccharides (3 to 20 units) and polysac- charides (large polymers of more than 20 units). Carbohydrates follow the basic formula (CH2O)N>2. Glycolaldehyde (CH2O)2 would be the simplest member of the family if molecules of two C-atoms were not excluded from the biochemical repertoire. Glycolaldehyde has been found in space in cosmic dust surrounding star-forming regions of the Milky Way galaxy. Glycolaldehyde is a precursor of several organic molecules. For example, reaction of glycolaldehyde with propenal, another interstellar molecule, yields ribose, a carbohydrate that is also the backbone of nucleic acids. Figure 1 – The Rho Ophiuchi star-forming region is shown in infrared light as captured by NASA’s Wide-field Infrared Explorer. Glycolaldehyde was identified in the gas surrounding the star-forming region IRAS 16293-2422, which is is the red object in the centre of the marked square. This star-forming region is 26’000 light-years away from Earth. Glycolaldehyde can react with propenal to form ribose. Image source: www.eso.org/public/images/eso1234a/ Beginning the count at three carbon atoms, glyceraldehyde and dihydroxy- acetone share the common chemical formula (CH2O)3 and represent the smallest carbohydrates. As their names imply, glyceraldehyde has an aldehyde group (at C1) and dihydoxyacetone a carbonyl group (at C2).
    [Show full text]
  • Sugars Amount Per Serving Calories 300 Calories from Fat 45
    Serving Size 1 package (272g) Servings Per Container 1 Sugars Amount Per Serving Calories 300 Calories from Fat 45 % Daily Value* What They Are Total Fat 5g 8% Sugars are the smallest and simplest type of carbohydrate. They are easily Saturated Fat 1.5g 8% digested and absorbed by the body. Trans Fat 0g Cholesterol 30mg 10% There are two types of sugars, and most foods contain some of each kind. Sodium 430mg 18% Total Carbohydrate 55g 18% Single sugars (monosaccharides) Sugars that contain two molecules of Dietary Fiber 6g 24% are small enough to be absorbed sugar linked together (disaccharides) are Sugars 23g directly into the bloodstream. broken down in your body into single sugars. Protein 14g They include: They include: Vitamin A 80% Fructose Sucrose (table sugar ) = glucose + fructose Vitamin C 35% Calcium 6% Galactose Lactose (milk sugar) = glucose + galactose Iron 15% Glucose Maltose (malt sugar) = glucose + glucose * Percent Daily Values are based on a 2,000 calorie diet. Your Daily Values may be higher or lower depending on your calorie needs: Calories: 2,000 2,500 Total Fat Less than 65g 80g Where They Are Found Saturated Fat Less than 20g 25g Cholesterol Less than 300mg 300mg Sugars are found naturally in many nutritious foods and beverages and are also Sodium Less than 2,400mg 2,400mg Total Carbohydrate 300g 375g added to foods and beverages for taste, texture, and preservation. Dietary Fiber 25g 30g Naturally occurring sugars are found in a variety of foods, including: • Dairy products • Fruit (fresh, frozen, dried, and canned in 100% fruit juice) Sugars are a major source of daily calories for many people and can • 100% fruit and vegetable juice increase the risk of developing • Vegetables cavities.
    [Show full text]
  • Trehalose and Trehalose-Based Polymers for Environmentally Benign, Biocompatible and Bioactive Materials
    Molecules 2008, 13, 1773-1816; DOI: 10.3390/molecules13081773 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.org/molecules Review Trehalose and Trehalose-based Polymers for Environmentally Benign, Biocompatible and Bioactive Materials Naozumi Teramoto 1, *, Navzer D. Sachinvala 2, † and Mitsuhiro Shibata 1 1 Department of Life and Environmental Sciences, Faculty of Engineering, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016, Japan; E-mail: [email protected] 2 Retired, Southern Regional Research Center, USDA-ARS, New Orleans, LA, USA; Home: 2261 Brighton Place, Harvey, LA 70058; E-mail: [email protected] † Dedicated to Professor George Christensen, Department of Psychology, Winona State University, Winona, MN, USA. * Author to whom correspondence should be addressed; E-mail: [email protected]. Received: 13 July 2008 / Accepted: 11 August 2008 / Published: 21 August 2008 Abstract: Trehalose is a non-reducing disaccharide that is found in many organisms but not in mammals. This sugar plays important roles in cryptobiosis of selaginella mosses, tardigrades (water bears), and other animals which revive with water from a state of suspended animation induced by desiccation. The interesting properties of trehalose are due to its unique symmetrical low-energy structure, wherein two glucose units are bonded face-to-face by 1J1-glucoside links. The Hayashibara Co. Ltd., is credited for developing an inexpensive, environmentally benign and industrial-scale process for the enzymatic conversion of α-1,4-linked polyhexoses to α,α-D-trehalose, which made it easy to explore novel food, industrial, and medicinal uses for trehalose and its derivatives.
    [Show full text]
  • 406-3 Wood Sugars.Pdf
    Wood Chemistry Wood Chemistry Wood Carbohydrates l Major Components Wood Chemistry » Hexoses – D-Glucose, D-Galactose, D-Mannose PSE 406/Chem E 470 » Pentoses – D-Xylose, L-Arabinose Lecture 3 » Uronic Acids Wood Sugars – D-glucuronic Acid, D Galacturonic Acid l Minor Components » 2 Deoxy Sugars – L-Rhamnose, L-Fucose PSE 406 - Lecture 3 1 PSE 406 - Lecture 3 2 Wood Chemistry Wood Sugars: L Arabinose Wood Chemistry Wood Sugars: D Xylose l Pentose (5 carbons) CHO l Pentose CHO l Of the big 5 wood sugars, l Xylose is the major constituent of H OH arabinose is the only one xylans (a class of hemicelluloses). H OH found in the L form. » 3-8% of softwoods HO H HO H l Arabinose is a minor wood » 15-25% of hardwoods sugar (0.5-1.5% of wood). HO H H OH CH OH 2 CH2OH PSE 406 - Lecture 3 3 PSE 406 - Lecture 3 4 1 1 Wood Chemistry Wood Sugars: D Mannose Wood Chemistry Wood Sugars: D Glucose CHO l Hexose (6 carbons) CHO l Hexose (6 carbons) l Glucose is the by far the most H OH l Mannose is the major HO H constituent of Mannans (a abundant wood monosaccharide (cellulose). A small amount can HO H class of hemicelluloses). HO H also be found in the » 7-13% of softwoods hemicelluloses (glucomannans) H OH » 1-4% of hardwoods H OH H OH H OH CH2OH CH2OH PSE 406 - Lecture 3 5 PSE 406 - Lecture 3 6 Wood Chemistry Wood Sugars: D Galactose Wood Chemistry Wood Sugars CHO CHO l Hexose (6 carbons) CHO H OH H OH l Galactose is a minor wood D Xylose L Arabinose HO H HO H monosaccharide found in H OH HO H H OH certain hemicelluloses CH2OH HO H CHO CH2OH CHO CHO » 1-6% of softwoods HO H H OH H OH » 1-1.5% of hardwoods HO H HO H HO H HO H HO H H OH H OH H OH H OH H OH H OH CH2OH CH2OH CH2OH CH2OH D Mannose D Glucose D Galactose PSE 406 - Lecture 3 7 PSE 406 - Lecture 3 8 2 2 Wood Chemistry Sugar Numbering System Wood Chemistry Uronic Acids CHO 1 CHO l Aldoses are numbered l Uronic acids are with the structure drawn HO H 2 polyhydroxy carboxylic H OH vertically starting from the aldehydes.
    [Show full text]
  • Multi-Enzymatic Cascades in the Synthesis of Modified Nucleosides
    biomolecules Article Multi-Enzymatic Cascades in the Synthesis of Modified Nucleosides: Comparison of the Thermophilic and Mesophilic Pathways Ilja V. Fateev , Maria A. Kostromina, Yuliya A. Abramchik, Barbara Z. Eletskaya , Olga O. Mikheeva, Dmitry D. Lukoshin, Evgeniy A. Zayats , Maria Ya. Berzina, Elena V. Dorofeeva, Alexander S. Paramonov , Alexey L. Kayushin, Irina D. Konstantinova * and Roman S. Esipov Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry RAS, Miklukho-Maklaya 16/10, 117997 GSP, B-437 Moscow, Russia; [email protected] (I.V.F.); [email protected] (M.A.K.); [email protected] (Y.A.A.); [email protected] (B.Z.E.); [email protected] (O.O.M.); [email protected] (D.D.L.); [email protected] (E.A.Z.); [email protected] (M.Y.B.); [email protected] (E.V.D.); [email protected] (A.S.P.); [email protected] (A.L.K.); [email protected] (R.S.E.) * Correspondence: [email protected]; Tel.: +7-905-791-1719 ! Abstract: A comparative study of the possibilities of using ribokinase phosphopentomutase ! nucleoside phosphorylase cascades in the synthesis of modified nucleosides was carried out. Citation: Fateev, I.V.; Kostromina, Recombinant phosphopentomutase from Thermus thermophilus HB27 was obtained for the first time: M.A.; Abramchik, Y.A.; Eletskaya, a strain producing a soluble form of the enzyme was created, and a method for its isolation and B.Z.; Mikheeva, O.O.; Lukoshin, D.D.; chromatographic purification was developed. It was shown that cascade syntheses of modified nu- Zayats, E.A.; Berzina, M.Y..; cleosides can be carried out both by the mesophilic and thermophilic routes from D-pentoses: ribose, Dorofeeva, E.V.; Paramonov, A.S.; 2-deoxyribose, arabinose, xylose, and 2-deoxy-2-fluoroarabinose.
    [Show full text]
  • Metabolic Shift from Glycogen to Trehalose Promotes Lifespan and Healthspan in Caenorhabditis Elegans
    Metabolic shift from glycogen to trehalose promotes lifespan and healthspan in Caenorhabditis elegans Yonghak Seoa, Samuel Kingsleya, Griffin Walkera, Michelle A. Mondouxb, and Heidi A. Tissenbauma,c,1 aDepartment of Molecular, Cell and Cancer Biology, University of Massachusetts Medical School (UMMS), Worcester, MA 01605; bDepartment of Biology, College of the Holy Cross, Worcester, MA 01610; and cProgram in Molecular Medicine, UMMS, Worcester, MA 01605 Edited by Gary Ruvkun, Massachusetts General Hospital, Boston, MA, and approved February 13, 2018 (received for review August 10, 2017) As Western diets continue to include an ever-increasing amount of dition of trehalose to the standard E. coli diet promotes longevity sugar, there has been a rise in obesity and type 2 diabetes. To avoid (27) in contrast to the toxicity caused by the addition of glucose metabolic diseases, the body must maintain proper metabolism, even (5–8). Furthermore, mutants have been identified that are long on a high-sugar diet. In both humans and Caenorhabditis elegans, lived and store increased trehalose (27). Therefore, an association excess sugar (glucose) is stored as glycogen. Here, we find that ani- between longevity and trehalose has been established. Mammals do mals increased stored glycogen as they aged, whereas even young not store sugar as trehalose but do possess the enzyme trehalase to adult animals had increased stored glycogen on a high-sugar diet. breakdown ingested trehalose (28). Further, oral supplementation Decreasing the amount of glycogen storage by modulating the C. of trehalose has been shown to improve glucose tolerance in in- elegans glycogen synthase, gsy-1, a key enzyme in glycogen synthe- dividuals at high risk for developing type 2 diabetes (29) and can sis, can extend lifespan, prolong healthspan, and limit the detrimental improve recovery from traumatic brain injury in mice (30).
    [Show full text]