APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2005, p. 3761–3769 Vol. 71, No. 7 0099-2240/05/$08.00ϩ0 doi:10.1128/AEM.71.7.3761–3769.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. Enhanced Trehalose Production Improves Growth of Escherichia coli under Osmotic Stress† J. E. Purvis, L. P. Yomano, and L. O. Ingram* Department of Microbiology and Cell Science, Box 110700, University of Florida, Gainesville, Florida 32611 Downloaded from Received 7 July 2004/Accepted 9 January 2005 The biosynthesis of trehalose has been previously shown to serve as an important osmoprotectant and stress protectant in Escherichia coli. Our results indicate that overproduction of trehalose (integrated lacI-Ptac-otsBA) above the level produced by the native regulatory system can be used to increase the growth of E. coli in M9-2% glucose medium at 37°C to 41°C and to increase growth at 37°C in the presence of a variety of osmotic-stress agents (hexose sugars, inorganic salts, and pyruvate). Smaller improvements were noted with xylose and some fermentation products (ethanol and pyruvate). Based on these results, overproduction of trehalose may be a useful trait to include in biocatalysts engineered for commodity chemicals. http://aem.asm.org/ Bacteria have a remarkable capacity for adaptation to envi- and lignocellulose (6, 7, 10, 28, 30, 31, 32, 45). Biobased pro- ronmental stress (39). A part of this defense system involves duction of these renewable chemicals would be facilitated by the intracellular accumulation of protective compounds that improved growth under thermal stress and by increased toler- shield macromolecules and membranes from damage (9, 24). ance to osmotic stress from high concentrations of sugars and Escherichia coli utilizes a variety of compounds for this pur- salts present in industrial feedstocks. Most prior E. coli studies pose, including proline, trehalose, betaine, and dimethylsulfo- concerning trehalose have focused primarily on cell survival niopropionate. Although glutamate and proline provide tran- under osmotic stress from NaCl or glucose or during desicca- on November 29, 2017 by UNIV OF NORTH CAROLINA sient relief from osmotic stress, allosteric control of proline tion. In this paper, we have constructed isogenic derivatives of biosynthesis in E. coli and the negative charge of glutamate E. coli K-12 to examine the importance of trehalose biosyn- limit their effectiveness. Recent studies have shown that the thesis for growth during stress (caused by salts, sugars, fermen- addition of betaine and dimethylsulfoniopropionate stimulated tation products, and environmental extremes) and the effect of the growth of and ethanol production by recombinant E. coli trehalose overproduction. (41). Betaine also improved the growth of Bacillus subtilis at elevated temperatures (20). However, neither of these protec- MATERIALS AND METHODS tive compounds can be synthesized de novo by E. coli.Inthe absence of supplements, trehalose serves as the primary pro- Bacteria, plasmids, and culture conditions. Strains and plasmids used in this study are listed in Table 1. Cultures were grown at 37°C in LB alone (2) or on LB tective osmolyte (22). Ϫ solidified with 1.5% agar during strain construction. Ampicillin (50 mg liter 1), Genes encoding trehalose biosynthesis are widely distrib- kanamycin (50 mg literϪ1), and tetracycline (12.5 mg literϪ1) were added as uted in nature (14, 35) and have been extensively studied in E. appropriate for selection. For studies of osmotic tolerance, cultures were grown coli and Saccharomyces spp. In E. coli, the trehalose biosyn- in M9 medium (pH 7.0) (2) containing 2% glucose (without antibiotics). Growth thetic operon (otsBA) is induced by osmotic shock (16), ex- in tube cultures was monitored spectrophotometrically at 550 nm using a Spec- tronic 70 spectrophotometer (Bausch & Lomb, Inc., Rochester, N.Y.). Growth in treme heat (13), extreme cold (23), desiccation (43), and entry shaken flasks was monitored at 550 nm by using a Beckman DU 640 spectro- into stationary phase (19). Two enzymes are unique to treha- photometer. lose biosynthesis: trehalose-6-phosphate synthase, encoded by Construction of strain JP10. Standard genetic methods were used during this otsA, and trehalose-6-phosphate phosphatase, encoded by otsB study (2). Strain JP10 was constructed by sequentially inserting deletions of the (Fig. 1). Mutations in these genes decreased tolerance to os- genes involved in trehalose biosynthesis and degradation (Fig. 1). Coding regions for treA, treC, and treF were each amplified from W3110 using the respective motic stress and decreased survival during storage. The treha- ORFmer primers (Sigma-Genosys, The Woodlands, TX) and cloned into lose biosynthetic operon (otsBA) from E. coli has been used to pCR2.1-TOPO. Coding regions for otsBA genes were amplified by PCR using the genetically engineer increased stress tolerance in plants (15) following primers: N terminus, 5ЈAAGGAGGAGAACCGGGTGACA3Ј, and C Ј Ј and in mammalian cells (18, 40). This operon has recently been terminus, 5 ACGCAGCGTGATGCATGAAG3 . An internal deletion was con- structed in the coding region of each trehalose catabolic gene and replaced with overexpressed in Corynebacterium glutamicum for the produc- a SmaI fragment from pLOI2065 containing a FRT (recognition target for re- tion of extracellular trehalose (33). combinase)-flanked tet gene from pLOI2065 (Table 1). Plasmid pLOI3621 was Recent interest in developing microbial biocatalysts for the cut with HpaI to remove the central coding region of treA. Similar excisions were production of commodity chemicals offers the potential to re- made for treF (pLOI3631) and treC (pLOI3641) using the restriction sites AgeI otsAB place petroleum feedstocks with renewable sugars from starch and PshAI, respectively. Deleted coding regions of genes (1,698-bp SspI deletion of pLOI3601) were replaced with a FRT-flanked kan gene from pLOI2511 (SmaI fragment). Resulting gene fragments with antibiotic markers were amplified by PCR. Chromosomal integration of amplification products was * Corresponding author. Mailing address: Dept. of Microbiology facilitated by pKD46 containing an arabinose-inducible red recombinase (11). and Cell Science, Bldg. 981 Museum Road, IFAS, P.O. Box 110700, Each deletion was sequentially integrated into W3110. The FRT-flanked antibi- University of Florida, Gainesville, FL 32611. Phone: (352) 392-8176. otic resistance genes were removed using FLP recombinase (27, 34). The Fax: (352) 846-0969. E-mail: ingram@ufl.edu. treA::FRT-tet-FRT mutation was inserted last to produce JP15. After deletion of † Florida Agricultural Experiment Station publication no. R-10904. the tet gene in JP15, the final construct was designated JP10 (⌬otsBA::FRT 3761 3762 PURVIS ET AL. APPL.ENVIRON.MICROBIOL. Downloaded from http://aem.asm.org/ FIG. 1. Trehalose metabolism in E. coli. Glucose is transported into the cell and activated by the phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS). The biosynthetic pathway for trehalose is indicated by the thicker arrows (double arrows, synthesis of UDP-glucose; filled arrows, condensation and dephosphorylation). Genes deleted in JP10 and JP20 are shown in black boxes. JP20 also contains a functional, regulated ots operon (lacI-Ptac-otsBA) integrated into the ampH gene. Trehalose is degraded by both periplasmic (TreA [4]) and cytoplasmic (TreF [21]) enzymes. Trehalose biosynthesis is also controlled by the synthesis of TreC, which dephosphorylates trehalose-6-phosphate (36). Stretch-activated proteins (SAP) in the plasma membrane facilitate the exit of trehalose under hypotonic conditions (37). on November 29, 2017 by UNIV OF NORTH CAROLINA ⌬treA::FRT ⌬treC::FRT ⌬treF::FRT). At each step, the strains were tested for was assayed for trehalose by thin-layer chromatography as described previously appropriate antibiotic resistance. Mutations were verified by analysis of the PCR (46). After being visualized with N-(1-naphthyl)ethylenediamine reagent, rela- products. tive amounts of trehalose were determined by densitometry using Quantity One Construction of JP20, JP21, JP22, JP23, and JP24. A conjugative transposon software (Bio-Rad). For estimates of intracellular trehalose concentrations, a vector (pLOI3650) was constructed to integrate a 6.1-kb fragment containing a volume of 2 ml per gram of dry cells was assumed. regulated ots operon (lacI-Ptac-otsBA-FRT-kan-FRT) into JP15. This construct Tolerance assays. Tolerance was evaluated by measuring growth (defined as was based on the ␭pir-dependent transposase vector designed by de Lorenzo et final cell mass after 24 h) in M9 minimal medium containing 2% glucose (M9-2% al. (12). The kanamycin gene in the mini Tn5 Km2 plasmid was replaced with a glucose). The MIC was defined as the concentration (interpolated) at which PacI linker by digestion with SfiI and Klenow treatment prior to ligation. The growth was restricted to less than two doublings (fourfold increase in OD) in NotI site was eliminated (NotI, Klenow treatment, and self-ligation) to produce 24 h. For these tests, cells from a fresh plate were resuspended in M9 medium pLOI3469 (Fig. 2). The kan gene was also inactivated in pLOI3601 containing containing 2% glucose and used as the inoculum (initial level of 0.03 OD550 nm). otsBA (StyI, Klenow treatment, and self-ligation) to produce pLOI3604. A SmaI Cultures were incubated in 13- by 100-mm capped tubes (37°C water bath, fragment from pLOI2511 containing the FRT-flanked kan gene