DOCSLIB.ORG

Apoptosis Caused by P53-Induced Protein with Death Domain (PIDD) Depends on the Death Adapter Protein RAIDD

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Apoptosis Caused by P53-Induced Protein with Death Domain (PIDD) Depends on the Death Adapter Protein RAIDD Apoptosis caused by p53-induced protein with death domain (PIDD) depends on the death adapter protein RAIDD Christina Berube*†, Louis-Martin Boucher*†‡, Weili Ma*†, Andrew Wakeham*†‡, Leonardo Salmena*†, Razqallah Hakem*†, Wen-Chen Yeh*†‡, Tak W. Mak*†‡§, and Samuel Benchimol*†§ *Ontario Cancer Institute͞Princess Margaret Hospital, 610 University Avenue, Toronto, ON, Canada M5G 2M9; ‡Campbell Family Institute for Breast Cancer Research, University Health Network, 620 University Avenue, Suite 706, Toronto, ON, Canada M5G 2C1; and †Department of Medical Biophysics, University of Toronto, Toronto, ON, Canada M5G 2M9 Contributed by Tak W. Mak, August 8, 2005 The p53 tumor suppressor promotes cell cycle arrest or apoptosis Recently, PIDD was found to be present in a large protein in response to diverse stress stimuli. p53-mediated cell death complex containing caspase-2 and the adapter protein receptor- depends in large part on transcriptional up-regulation of target interacting protein (RIP)-associated ICH-1͞CED-3 homolo- genes. One of these targets, P53-induced protein with a death gous protein with a DD (RAIDD) (8). The DD of PIDD was domain (PIDD), was shown to function as a mediator of p53- shown to interact with the DD of RAIDD, which, in turn dependent apoptosis. Here we show that PIDD is a cytoplasmic associated with caspase-2 through the caspase-recruitment do- protein, and that PIDD-induced apoptosis and growth suppression main (CARD). This study concluded that PIDD was involved in in embryonic fibroblasts depend on the adaptor protein receptor- the activation of caspase-2. The role of caspase-2 in apoptosis is interacting protein (RIP)-associated ICH-1͞CED-3 homologous pro- uncertain; caspase-2-deficient and wild-type cells (thymocytes tein with a death domain (RAIDD). We provide evidence that and B and T lymphoblasts) are equally sensitive to diverse PIDD-induced cell death is associated with the early activation of apoptotic stimuli (9), yet RNA interference experiments and caspase-2 and later activation of caspase-3 and -7. Our results also caspase-2 inhibitors have implicated caspase-2 in stress-induced show that caspase-2؊/؊, in contrast to RAIDD؊/؊, mouse embryonic apoptosis in some cell types (10, 11). Caspase-2 can act upstream fibroblasts, are only partially resistant to PIDD. Our findings sug- of the mitochondria by inducing Bid cleavage, Bax translocation gest that caspase-2 contributes to PIDD-mediated cell death, but to the mitochondria, and subsequent cytochrome c release that it is not the sole effector of this pathway. (10–12). It can also directly induce the release of cytochrome c from purified mitochondria (11, 12). Thus, it appears that under caspase-2 certain circumstances, caspase-2 activation may be an early event that engages the mitochondrial apoptotic pathway. The role of he tumor suppressor p53 is a sequence-specific transcription RAIDD in apoptosis is also uncertain. RAIDD was initially Tfactor that promotes cell cycle arrest or apoptosis in response identified as a death adapter protein capable of binding RIP and to cellular stress (1). Transcriptional activation of the p21WAF1 caspase-2 through its DD and CARD, respectively (13, 14). In cyclin-dependent kinase inhibitor plays a key role in the induc- the presence of RIP and TRADD, RAIDD was found to tion of cell cycle arrest by p53 (2). p53-dependent apoptosis is promote apoptosis by recruiting caspase-2 to TNF receptor 1. regulated, at least in part, by transcriptional activation of its Dominant negative forms of RAIDD, however, did not abrogate target genes (3), and this process highly depends on cytochrome TNF-mediated cell death (14). c release and the Apaf-1͞caspase-9 activation pathway (4, 5). In this study, we generated mice carrying a null mutation in the Although a number of candidate p53-effector molecules have RAIDD gene. We report that RAIDD-deficient mice have nor- been reported, it is yet unclear whether each contributes a part mal development and lymphocyte populations, and that Ϫ Ϫ of the full response, or whether specific subsets of these genes are RAIDD / thymocytes are sensitive to various cytotoxic agents. Ϫ Ϫ required for death in different cell types or in response to RAIDD / mouse embryonic fibroblasts (MEFs) are sensitive to different signals (3). TNF and cycloheximide; thus, RAIDD is not necessary for Among the identified apoptotic effectors of p53, P53-induced TNF-mediated apoptosis in embryonic fibroblasts. To determine protein with a death domain (PIDD)͞leucine-rich DD (LRDD) the functional significance of the PIDD–RAIDD–caspase-2 is a 915-aa protein in mice (910 aa in humans) containing seven complex in promoting cell death, we examined the apoptotic Ϫ Ϫ Ϫ Ϫ tandem LR repeats in the N terminus and a DD in the C activity of PIDD in RAIDD / and caspase-2 / MEFs. We show terminus (6, 7). The dual domain structure of PIDD suggests that that PIDD-induced apoptosis and growth suppression depend it may function as a key adapter protein that links additional entirely on RAIDD. We provide evidence that PIDD-induced components of the p53 apoptosis pathway. Using the method of cell death is associated with the early activation of caspase-2 and differential display, PIDD was identified as a p53-up-regulated later activation of caspase-3 and -7. The early activation of gene in a p53-null Friend-virus-transformed mouse erythroleu- caspase-2 suggests that it may act as a proximal effector of the kemia cell line (DP16.1͞p53ts) that stably expresses a temper- apoptotic pathway initiated by PIDD and is consistent with ature-sensitive (ts) Trp-53 mutant allele. DP16.1͞p53ts cells recent evidence that caspase-2 functions as an initiator caspase Ϫ Ϫ undergo apoptosis after expression of the wild-type p53 confor- during apoptosis. Our results also show that caspase-2 / MEFs, mation at 32°C. PIDD mRNA is induced by ␥-irradiation in a p53-dependent manner, and the basal level of PIDD mRNA depends on p53 gene status. Overexpression of PIDD also Abbreviations: DD, death domain; PIDD, p53-induced protein with a DD; mPIDD, mouse PIDD; RAIDD, receptor-interacting protein-associated ICH-1͞CED-3 homologous protein inhibits cell growth in a p53-like manner by inducing apoptosis. with a DD; LRDD, leucine-rich DD; ts, temperature sensitive; MEF, mouse embryonic Antisense inhibition of PIDD expression was shown to attenuate fibroblast; FADD, Fas-associated DD; IRES, internal ribosome entry site. apoptosis in response to p53 activation and DNA damage, §To whom correspondence may be addressed. E-mail: [email protected] or suggesting that PIDD expression is required for p53-dependent [email protected]. death (7). © 2005 by The National Academy of Sciences of the USA 14314–14319 ͉ PNAS ͉ October 4, 2005 ͉ vol. 102 ͉ no. 40 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0506475102 Downloaded by guest on September 23, 2021 in contrast to RAIDDϪ/Ϫ MEFs, are only partially resistant to Immunoprecipitation, Immunoblot Analysis, and Caspase Activity As- PIDD, suggesting that, although caspase-2 contributes to PIDD- says. For details, see Supporting Text. mediated cell death, it is not the sole effector of this pathway. Subcellular Localization of PIDD by Immunofluorescence. Saos-2 cells Experimental Procedures were seeded onto Lab-Tek Chamber Slides (Invitrogen) at 2.4 ϫ Generation of RAIDD؊/؊ Mice. For details of targeting constructs 105 cells per chamber. The next day, cells were transfected with and generation of RAIDD-null mice, see Supporting Text, which pcDNA3.1-N-Myc͞his or pcDNA3.1-N-Myc͞his-mPIDD by us- is published, as supporting information on the PNAS web site. ing Lipofectamine2000. At 24 h after transfection, cells were fixed with 4% paraformaldehyde in PBS for 30 min at room Cell Culture. H460 cells were cultured in RPMI medium 1640 with temperature (RT). Fixed cells were washed with PBS and then 10% FCS. All other cells were maintained in DMEM with 10% permeabilized with 1% Triton X-100 in PBS for 10 min. The FCS. MEFs from RAIDDϪ/Ϫ, caspase-2Ϫ/Ϫ (9), and caspase-8Ϫ/Ϫ chambers were treated with anti-Myc monoclonal antibody (15) mice and their control littermates (ϩ͞ϩ) were transformed and͞or anti-PIDD polyclonal antibody, diluted in 3% BSA͞PBS by retroviral infection with pBABE-E1A͞Ras, a kind gift from for1hatRT.They were then washed twice with 0.02% Tween Maria Soengas (University of Michigan Comprehensive Cancer 20 and 1% BSA in PBS, followed by incubation with a Cy3- Center). The Fas-associated DD (FADD)Ϫ/Ϫ and corresponding conjugated anti-mouse and͞or FITC-conjugated anti-rabbit ϩ͞ϩ MEFs were established in culture using the 3T3 protocol (Jackson ImmunoResearch) for 30 min at RT. Cells were (16). The Apaf1Ϫ/Ϫ MEFs were transformed with Myc and Ras examined under a Zeiss LSM 410 laser-scanning fluorescence (4, 17). microscope. Antibody Production. Rabbits were immunized with a His-tagged Clonogenic Assays. For long-term colony assays, established Ϫ/Ϫ Ϫ/Ϫ Ϫ/Ϫ mouse PIDD fragment (residues 141–915) purified from BL-21 MEFs derived from RAIDD , FADD , caspase-2 , and Ϫ/Ϫ ϫ 5 (DE3) bacteria transformed with the construct pET 28a-mouse caspase-8 mice were plated at 3 10 cells per 10-cm plate. PIDD (mPIDD) (Invitrogen). Briefly, after induction with iso- The next day, MEFs were coinfected with pMIG-IRES-GFP or propyl-1-thio-␤-D-galactopyranoside, bacteria were collected by pMIG-PIDD-IRES-GFP together with pBabe-Hygro using viral centrifugation and lysed, and recombinant protein was purified supernatants at a volume ratio of 10:1. At 12 h after infection, on a resin of Ni2ϩ affinity by standard affinity purification media was replaced with DMEM with 10% FCS. After a procedures. The fractions containing purified recombinant recovery period of 12 h, selection in hygromycin (Invitrogen) was started.
Load more

Recommended publications
  • The Piddosome, DNA-Damage-Induced Apoptosis and Beyond
    Cell Death and Differentiation (2012) 19, 13–20 & 2012 Macmillan Publishers Limited All rights reserved 1350-9047/12 www.nature.com/cdd Review The PIDDosome, DNA-damage-induced apoptosis and beyond S Janssens*,1 and A Tinel*,2 P53-induced protein with a death domain (PIDD) was cloned as a death domain (DD)-containing protein whose expression is induced by p53. It was later described as the core of a molecular platform-activating caspase-2, named the PIDDosome. These first results pointed towards a role for PIDD in apoptosis, in response to DNA damage. Identification of new PIDDosome complexes involved in DNA repair and nuclear factor-jB signaling challenged this early concept. PIDD functions are growing as new complexes and new interaction partners are being discovered, and as additional functions are being revealed. A fascinating feature of PIDD lies within its complex and tight regulation mechanisms, which allow the molecule to fine-tune its different functions: from transcriptional regulation to the expression of different isoforms, and from the interaction with regulatory proteins to an ingenious post-translational cleavage mechanism generating various active fragments with specific functions. Further studies still need to be carried out to provide answers to many unresolved issues and to reconcile conflicting results. This review aims at providing an overview of the current PIDD knowledge status. Cell Death and Differentiation (2012) 19, 13–20; doi:10.1038/cdd.2011.162; published online 18 November 2011 Facts Is PIDD involved at all in caspase-2 activation (which is distinct from processing) in vivo? Are both proteins P53-induced protein with a death domain (PIDD) has operating in the same pathway or acting independently of been identified as a p53-inducible molecule implicated in each other? p53-dependent apoptosis.
    [Show full text]
  • The Genetics of Bipolar Disorder
    Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF.
    [Show full text]
  • LRDD (PIDD1) (NM 145887) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG203713 LRDD (PIDD1) (NM_145887) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: LRDD (PIDD1) (NM_145887) Human Tagged ORF Clone Tag: TurboGFP Symbol: PIDD1 Synonyms: LRDD; PIDD Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 LRDD (PIDD1) (NM_145887) Human Tagged ORF Clone – RG203713 ORF Nucleotide >RG203713 representing NM_145887 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGCAACGGTGGAGGGGCCAGAGCTGGAGGCAGCTGCTGCCGCAGGAGATGCTTCAGAGGATTCGG ACGCAGGGTCCAGGGCGCTGCCTTTCCTGGGCGGCAACCGGCTGAGCTTGGACCTGTACCCCGGGGGCTG CCAGCAGCTGCTGCACCTGTGTGTCCAGCAGCCTCTGCAGCTGCTGCAGGTGGAATTCTTGCGTCTGAGC ACTCACGAGGACCCTCAGCTGCTGGAGGCCACCCTGGCCCAGCTGCCTCAGAGCCTGTCCTGCCTCCGCT CCCTGGTCCTCAAAGGAGGGCAACGCCGGGACACACTGGGTGCCTGTCTCCGGGGTGCCCTGACCAACCT GCCCGCTGGTCTGAGTGGCCTGGCCCATCTGGCCCACCTGGACCTGAGCTTCAACAGCCTGGAGACACTG CCGGCCTGTGTCCTGCAGATGCGAGGTCTGGGTGCGCTCTTGCTGTCTCACAACTGCCTCTCTGAGCTGC CTGAGGCTCTGGGGGCCCTCCCCGCCCTCACCTTCCTCACAGTGACACACAACCGCCTGCAGACGCTGCC CCCAGCACTGGGGGCCCTATCCACCCTGCAGCGCCTCGATCTCTCTCAGAATCTGCTGGACACGCTACCT
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]
  • The RNA Splicing Response to DNA Damage
    Biomolecules 2015, 5, 2935-2977; doi:10.3390/biom5042935 OPEN ACCESS biomolecules ISSN 2218-273X www.mdpi.com/journal/biomolecules/ Review The RNA Splicing Response to DNA Damage Lulzim Shkreta and Benoit Chabot * Département de Microbiologie et d’Infectiologie, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, QC J1E 4K8, Canada; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-819-821-8000 (ext. 75321); Fax: +1-819-820-6831. Academic Editors: Wolf-Dietrich Heyer, Thomas Helleday and Fumio Hanaoka Received: 12 August 2015 / Accepted: 16 October 2015 / Published: 29 October 2015 Abstract: The number of factors known to participate in the DNA damage response (DDR) has expanded considerably in recent years to include splicing and alternative splicing factors. While the binding of splicing proteins and ribonucleoprotein complexes to nascent transcripts prevents genomic instability by deterring the formation of RNA/DNA duplexes, splicing factors are also recruited to, or removed from, sites of DNA damage. The first steps of the DDR promote the post-translational modification of splicing factors to affect their localization and activity, while more downstream DDR events alter their expression. Although descriptions of molecular mechanisms remain limited, an emerging trend is that DNA damage disrupts the coupling of constitutive and alternative splicing with the transcription of genes involved in DNA repair, cell-cycle control and apoptosis. A better understanding of how changes in splice site selection are integrated into the DDR may provide new avenues to combat cancer and delay aging.
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]
  • PERP Expression Stabilizes Active P53 Via Modulation of P53-MDM2 Interaction in Uveal Melanoma Cells
    Citation: Cell Death and Disease (2011) 2, e136; doi:10.1038/cddis.2011.19 & 2011 Macmillan Publishers Limited All rights reserved 2041-4889/11 www.nature.com/cddis PERP expression stabilizes active p53 via modulation of p53-MDM2 interaction in uveal melanoma cells L Davies1, D Spiller2, MRH White2, I Grierson1 and L Paraoan*,1 The activation and regulation of target genes by the tumour-suppressor p53 dictates the fate of a cell, with cell cycle arrest or apoptosis being two distinct outcomes. PERP (p53 apoptosis effector related to PMP-22), a p53 transcriptional target, is induced specifically during apoptosis but not cell cycle arrest. Downregulation of PERP is associated with the aggressive, monosomy 3-type of uveal melanoma (UM), the most common primary intraocular tumour in adults, and increased PERP expression has a pro-apoptotic effect in UM cells. Here, we identify a novel effect of PERP expression, as elevated PERP protein positively influences active levels of its own transcriptional regulator, p53. Using fluorescent fusion proteins of PERP, p53 and MDM2, we demonstrate in single living UM cells that PERP expression significantly enhances p53 activity and its nuclear localization, increases p53-dependent transcription (including that of MDM2) while allowing oscillatory nucleo-cytoplasmic shuttling of p53/ MDM2 complexes. Phosphorylation of p53 serine residues that interfere with the interaction between p53 and its negative regulator MDM2 and enhance pro-apoptotic gene transcription also occurs subsequent to PERP expression. These results implicate a role for PERP in amplifying functional p53 levels that promote p53-dependent apoptosis, and reveal a potential target for exploitation in enhancing p53 activity.
    [Show full text]
  • DNA Damage-Induced Apoptosis
    Oncogene (2004) 23, 2797–2808 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $25.00 www.nature.com/onc DNA damage-induced apoptosis Chris J Norbury1 and Boris Zhivotovsky*,2 1Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK; 2Institute of Environmental Medicine, Karolinska Institutet, Box 210, Nobels va¨g. 13, SE-171 77 Stockholm, Sweden Unicellular organisms respond to the presence of DNA phila melanogaster.The combination of data from these lesions by activating cell cycle checkpoint and repair genetically amenable models with those from mamma- mechanisms, while multicellular animals have acquired the lian and other vertebrate species has revealed conserva- further option of eliminating damaged cells by triggering tion of several key molecular mechanisms, as well as apoptosis. Defects in DNA damage-induced apoptosis species-specific variations on these themes. contribute to tumorigenesis and to the resistance of cancer Most of the morphological criteria that were first used cells to a variety of therapeutic agents. The intranuclear to distinguish apoptosis from necrosis relate to the mechanisms that signal apoptosis after DNA damage nucleus (Kerr et al., 1972). Degradation of chromoso- overlap with those that initiate cell cycle arrest and DNA mal DNA into oligonucleosome length fragments in repair, and the early events in these pathways are highly irradiated lymphoid tissues was reported as early as conserved. In addition, multiple independent routes have 1976 (Skalka et al., 1976). This observation was first recently been traced by which nuclear DNA damage can linked to endonuclease activation in 1980 (Wyllie, 1980) be signalled to the mitochondria, tipping the balance in and has since been used as a biochemical marker of favour of cell death rather than repair and survival.
    [Show full text]
  • PDF Output of CLIC (Clustering by Inferred Co-Expression)
    PDF Output of CLIC (clustering by inferred co-expression) Dataset: Num of genes in input gene set: 7 Total number of genes: 16493 CLIC PDF output has three sections: 1) Overview of Co-Expression Modules (CEMs) Heatmap shows pairwise correlations between all genes in the input query gene set. Red lines shows the partition of input genes into CEMs, ordered by CEM strength. Each row shows one gene, and the brightness of squares indicates its correlations with other genes. Gene symbols are shown at left side and on the top of the heatmap. 2) Details of each CEM and its expansion CEM+ Top panel shows the posterior selection probability (dataset weights) for top GEO series datasets. Bottom panel shows the CEM genes (blue rows) as well as expanded CEM+ genes (green rows). Each column is one GEO series dataset, sorted by their posterior probability of being selected. The brightness of squares indicates the gene's correlations with CEM genes in the corresponding dataset. CEM+ includes genes that co-express with CEM genes in high-weight datasets, measured by LLR score. 3) Details of each GEO series dataset and its expression profile: Top panel shows the detailed information (e.g. title, summary) for the GEO series dataset. Bottom panel shows the background distribution and the expression profile for CEM genes in this dataset. Overview of Co-Expression Modules (CEMs) with Dataset Weighting Scale of average Pearson correlations Num of Genes in Query Geneset: 7. Num of CEMs: 1. 0.0 0.2 0.4 0.6 0.8 1.0 Cks1b Skp2 Ccne1 Cul1 Skp1a Cdkn1b Cdk2 Cks1b Skp2
    [Show full text]
  • Exploring the Effect of Climate Change on Biological Systems
    Old Dominion University ODU Digital Commons Chemistry & Biochemistry Theses & Dissertations Chemistry & Biochemistry Spring 2015 Exploring the Effect of Climate Change on Biological Systems Nardos Sori Old Dominion University Follow this and additional works at: https://digitalcommons.odu.edu/chemistry_etds Part of the Biochemistry Commons, Bioinformatics Commons, and the Chemistry Commons Recommended Citation Sori, Nardos. "Exploring the Effect of Climate Change on Biological Systems" (2015). Doctor of Philosophy (PhD), Dissertation, Chemistry & Biochemistry, Old Dominion University, DOI: 10.25777/xktn-6654 https://digitalcommons.odu.edu/chemistry_etds/35 This Dissertation is brought to you for free and open access by the Chemistry & Biochemistry at ODU Digital Commons. It has been accepted for inclusion in Chemistry & Biochemistry Theses & Dissertations by an authorized administrator of ODU Digital Commons. For more information, please contact [email protected]. EXPLORING THE EFFECT OF CLIMATE CHANGE ON BIOLOGICAL SYSTEMS by Nardos Sori B.S. May 2006, Old Dominion University - Norfolk, VA A Dissertation Submitted to the Faculty of Old Dominion University in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY CHEMISTRY AND BIOCHEMISTRY OLD DOMINION UNIVERSITY May 2015 Approved by: Lesley Greene (Director) Jing He (Member) Patricia Pleban (Member) nnifer Poutsma (Member) ABSTRACT EXPLORING THE EFFECT OF CLIMATE CHANGE ON BIOLOGICAL SYSTEMS Nardos Sori Old Dominion University, 2015 Director: Dr. Lesley Greene The present and potential future effect of global warming on the ecosystem has brought climate change to the forefront of scientific inquiry and discussion. For our investigation, we selected two organisms, one from cyanobacteria and one from a cereal plant to determine how climate change may impact these biological systems.
    [Show full text]
  • ITF2357 Interferes with Apoptosis and Inflammatory Pathways in the HL-60 Model: a Gene Expression Study
    ANTICANCER RESEARCH 30: 4525-4536 (2010) ITF2357 Interferes with Apoptosis and Inflammatory Pathways in the HL-60 Model: A Gene Expression Study SARA GALIMBERTI1, MARTINA CANESTRARO1, HAKAN SAVLI2, GIUSEPPE ALBERTO PALUMBO3, DANIELE TIBULLO3, BALINT NAGY4, SIMONA PIAGGI5, FRANCESCA GUERRINI1, NACI CINE2, MARIA RITA METELLI6 and MARIO PETRINI1 1Department of Oncology, Transplant and Advances in Medicine, Section of Hematology, and 5Department of Experimental Pathology, Pathology Section, University of Pisa, Italy; 2Department of Medical Genetics and Clinical Research Unit, Kocaeli University, Kocaeli, Turkey; 3Department of Biomedical Sciences, Section of Hematology, University of Catania, Italy; 4First Department of Obstetrics and Gynecology, Semmelweis University, Budapest, Hungary; 6Divison of Clinical Biochemistry, Azienda Ospedaliera Pisana, Pisa, Italy Abstract. Background: Cytotoxic and pro-apoptotic effects inflammatory pathways in HL-60 cells; this observation exerted by the histone deacetylase inhibitor ITF2357 have could have possible applications in clinical practice. been reported in acute myeloid leukemia HL-60 cells. In the current study, its mechanism of action was investigated at the Histone acetylation and deacetylation are reversible events molecular level. Materials and Methods: Cell proliferation involved in gene transcription regulation. Disturbance of the was evaluated by methyl thiazol tetrazolium bromide dynamic between histone acetyl-transferases (HATs) and reduction; apoptosis by annexin V, mitochondrial deacetylases (HDACs) can result in several hematological transmembrane potential by tetramethylrhodamine ethyl malignancies, such as acute leukemia (1, 2), and diffuse large ester. Functional experiments and gene expression B-cell lymphoma (3). Consequently, histone deacetylase evaluations were performed by flow cytometry, microarray, inhibitors (HDACIs) have been recently developed as and quantitative polymerase chain reaction. Results: promising anticancer drugs.
    [Show full text]
  • LRDD Antibody (C-Term) Blocking Peptide Synthetic Peptide Catalog # Bp13884b
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 LRDD Antibody (C-term) Blocking peptide Synthetic peptide Catalog # BP13884b Specification LRDD Antibody (C-term) Blocking peptide - LRDD Antibody (C-term) Blocking peptide - Background Product Information LRDD promotes apoptosis downstream of the Primary Accession Q9HB75 tumor suppressor as component of the DNA damage/stress response pathway that connects p53/TP53 to apoptosis. Associates LRDD Antibody (C-term) Blocking peptide - Additional Information with NEMO/IKBKG and RIP1 and enhances sumoylation and ubiquitination of NEMO/IKBKG which is important for activation of the Gene ID 55367 transcription factor NF-kappa-B. Associates with CASP2/caspase-2 and CRADD/RAIDD, and Other Names induces activation of CASP2 which an p53-induced death domain-containing important regulator in apoptotic pathways. protein 1, Leucine-rich repeat and death domain-containing protein, PIDD1, LRDD, PIDD Target/Specificity The synthetic peptide sequence used to generate the antibody AP13884b was selected from the C-term region of LRDD. A 10 to 100 fold molar excess to antibody is recommended. Precise conditions should be optimized for a particular assay. Format Peptides are lyophilized in a solid powder format. Peptides can be reconstituted in solution using the appropriate buffer as needed. Storage Maintain refrigerated at 2-8°C for up to 6 months. For long term storage store at -20°C. Precautions This product is for research use only. Not for use in diagnostic or therapeutic
    [Show full text]