The Protein-Protein Interactome of Saccharomyces Cerevisiae ABC

The ProteinProtein Interactome of Saccharomyces cerevisiae ABC Transporters Nft1p, Pdr10p, Pdr18p and Vmr1p

Asad Hanif

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto

The ProteinProtein Interactome of Saccharomyces cerevisiae ABC Transporters Nft1p, Pdr10p, Pdr18p and Vmr1p

Asad Hanif Master of Science Graduate Department of Molecular Genetics University of Toronto 2012

Abstract

The Membrane Yeast TwoHybrid (MYTH) technology was used in this study to find proteinprotein interactors of Saccharomyces cerevisiae ATP binding cassette (ABC) transporters Nft1p, Pdr10p, Pdr18p and Vmr1p. There were 23 interactors for Nft1p, 22 interactors for Pdr10p, 4 interactors for Pdr18p and 1 interactor for Vmr1p. The 43 unique interactors belong to a wide variety of functional categories. There were 11 interactors involved in metabolism, 9 interactors involved in transport, 8 interactors with unknown function, 4 interactors involved in trafficking and secretion, 3 interactors involved in protein folding, 2 interactors involved in stress response, and 1 interactor in each of the following categories: cell wall assembly, cytoskeleton maintenance, nuclear function, protein degradation, protein modification and protein synthesis. Follow up experiments also showed that Pdr15p and Pdr18p play an important role in zinc homeostasis because deletion of these ABC transporters results in sensitivity to zinc shock.

Acknowledgments

I would like to thank my supervisor, Dr. Igor Stagljar for his help and support over the years. I would also like to thank my supervisory committee members, Dr. Leah Cowen and Dr.

Christine Bear for their help and support towards my research project. I also want to thank Dr.

Charlie Boone, Dr. Reinhart Reithmeier and Dr. Andy Fraser for being a part of my examination committee for my Master’s defense exam.

I would also like to thank everyone in the Stagljar lab for their support. I would like to especially thank Dr. Jamie Snider for helping me with my project and research, and answering countless questions. I also want to thank Analyn Yu, Victoria Wong, Dr. Julia Petschnigg,

Mehrab Ali and Dr. Mandy Lam for helping me with various aspects of my research project. I want to thank Mike Cox from Dr. Andrews’s lab for helping me with confocal microscopy. I want to thank Christoph Kurat from Dr. Andrews’s lab for helping me with qRTPCR experiments and proving reagents for my experiments. I want to thank BryanJoseph San Luis from Dr. Boone’s lab for proving single and double deleted mutant strains for my experiments. I want to thank Simon Alfred from Dr. Nislow’s lab for helping me setup Tecan growth experiments.

Finally, I want to thank my parents, brothers and family for their support. This was not possible without your encouragement.

iii

Table of Contents

Abstract ...... ii Acknowledgments ...... iii List of Tables ...... ix List of Figures ...... xi List of Appendices ...... xiii Abbreviations ...... xiv Chapter 1: Introduction ...... 1 1.1: Research Objectives ...... 2 1.2: ABC Proteins ...... 2 1.2.1: Function of ABC Proteins ...... 2 1.2.2: Structure of ABC Transporters ...... 4 1.2.3: ABC Transporters, Human Diseases and Multidrug Resistance ...... 7 1.2.4: Human ABC Subfamilies ...... 9 1.3: ABC Transporters in S. cerevisiae ...... 12 1.3.1: ABCC (MRP/CFTR) Subfamily in S. cerevisiae ...... 13 1.3.1.1: Nft1p ...... 14 1.3.1.2: Vmr1p ...... 15 1.3.2: ABCG (PDR5) Subfamily in S. cerevisiae ...... 18 1.3.2.1: Pdr10p ...... 19 1.3.2.2: Pdr15p ...... 23 1.3.2.3: Pdr18p ...... 24 1.3.3: Other ABC Subfamilies in S. cerevisiae ...... 26 1.4: ProteinProtein Interactions, Model Organism, and Research Tools ...... 28 1.4.1: Importance of ProteinProtein Interactions ...... 28 1.4.2: S. cerevisiae as a Model System ...... 29 1.4.3: Yeast TwoHybrid (Y2H) ...... 31 1.4.4: Membrane Yeast TwoHybrid (MYTH) ...... 34 1.4.5: Tandem Affinity Purification (TAP) and Mass Spectrometry ...... 37 1.5: Zinc Homeostasis in S. cerevisiae ...... 38 1.5.1: Importance of Zinc ...... 39 1.5.2: Zap1p Transcription Factor ...... 40 1.5.3: Zinc Transporters ...... 42 iv

1.6: Thesis Rationale ...... 46 Chapter 2: Materials and Methods ...... 48 2.1: General Experimental Protocols ...... 49 2.1.1: PCR Amplification ...... 49 2.1.2: DNAAgarose Gel Electrophoresis ...... 49 2.1.3: Standard Lithium Acetate Yeast Transformation ...... 50 2.1.4: DTT Method for Yeast Transformation ...... 51 2.1.5: Yeast Integration Transformation ...... 51 2.1.6: Yeast and E. coli Miniprep ...... 52 2.1.7: Yeast and E. coli Miniprep in a 96well Format ...... 53 2.1.8: Genomic DNA ...... 53 2.1.9: Competent E. coli Preparation Using Inoue Method ...... 53 2.1.10: E. coli Transformation ...... 54 2.1.11: Glycerol Stock Preparation for Yeast and E. coli ...... 55 2.1.12: Sequencing DNA from TCAG/BioBasic ...... 55 2.1.13: FM464 Staining for Fluorescence Microscopy ...... 55 2.2: Bait Generation ...... 55 2.2.1: Primer Design for Baits ...... 55 2.2.2: Cutting AMBV and AMBVYFP Plasmids with Restriction Enzymes ...... 57 2.2.3: ORF Amplification, Gap Repair Homologous Recombination and ORF Sequencing ...... 57

2.3: Bait Validation: N ub G/N ub I Test ...... 59 2.4: Bait Localization using Fluorescence Microscopy ...... 59 2.5: Testing Bait Function ...... 60 2.6: Large Scale MYTH Transformation with cDNA and Genomic Libraries ...... 60 2.7: Bait Dependency Test ...... 62 2.8: Prey Sequencing and Identification ...... 63 2.9: Confirmation of Deletion Mutants ...... 63 2.10: Estimating Free Zinc Ion Concentration in ZincReplete and ZincLimited Media ...... 64 2.11: Zinc Shock Assay ...... 64 2.12: qRTPCR Experimental Protocol ...... 65 2.12.1: RNA Isolation ...... 65 2.12.2: cDNA Synthesis from RNA ...... 66 2.12.3: qRTPCR Primers, Program and Setup ...... 66 2.13: Localization of Zrc1p and Zrt1p ...... 68 v

2.13.1: Integration of MYTH Tag Downstream of ZRC1 and ZRT1 ORF ...... 68 2.13.2: Fluorescence Live Microscopy for Zrc1p, Zrt1p ...... 69 2.14: Western Blot Protocol ...... 70 2.14.1: Protein Extraction...... 70 2.14.2: Measuring Protein Concentration Using Bradford Assay ...... 71 2.14.3: 10% Resolving and 5% Stacking SDSPolyacrylamide Gel ...... 72 2.14.4: Gel Electrophoresis, Transfer and Western Blot ...... 72 2.14.5: Scanning Western Blot Films and Measuring Pixel Density with Image J Software ...... 73 Chapter 3: Results ...... 75

3.1: MYTH Baits were Successfully Validated Using the N ub G/N ub I Control Test ...... 76 3.2: Proper Subcellular Localization of Nft1p, Pdr10p, and Vmr1p Validated Using Fluorescence Microscopy ...... 77 3.3: Fusion of the MYTH Tag does not Affect ABC Transporter Function ...... 79 3.4: ProteinProtein Interactome of Nft1p, Pdr10p, Pdr18p and Vmr1p from MYTH ...... 81 3.5: Studying Interactions of Zrt1p and Zrc1p with ABC Transporters ...... 92 3.5.1: Deletion of PDR15 and PDR18 Causes Sensitivity to Zinc Shock ...... 94 3.5.2: Deletion of PDR15 and PDR18 Causes Changes in ZRC1 and ZRT1 mRNA Levels ...... 96 3.5.3: Deletion of PDR18 Causes Changes in Zrc1p and Zrt1p Protein Levels...... 98 3.5.4: Zrc1p and Zrt1p Properly Localize in pdr15 ∆ and pdr18 ∆ strains ...... 102 Chapter 4: Discussion ...... 110 4.1: Analysis of ABC Transporter ProteinProtein Interactome ...... 111 4.1.1: Metabolism ...... 112 4.1.2: Sphingolipid Biosynthesis ...... 114 4.1.3: Ergosterol Biosynthesis and Transport ...... 116 4.1.4: ABC Transporter Interactors Involved in Transport Function ...... 117 4.1.4.1: ABC Transporter Complexes ...... 118 4.1.4.2: Possible Role of ABC Transporters In Osmoregulation ...... 119 4.1.5: Cell/Spore Wall Assembly and Maintenance ...... 121 4.2: Analysis of Zinc Shock Phenotype for pdr15 ∆ and pdr18 ∆ strains...... 124 4.2.1: Alterations in Zinc Homeostasis in pdr15 ∆ strain ...... 125 4.2.2: Alterations in Zinc Homeostasis in pdr18 ∆ strain ...... 131 4.3: Future Directions ...... 133 4.3.1: Confirmation of ProteinProtein Interactions and Mapping of Interaction Sites ...... 133 4.3.2: ABC Transporters and Zinc Homeostasis ...... 134

4.4: Summary and Conclusion ...... 135 Appendix 1...... 137 A1.1: Strains, Plasmids, Prey Libraries and Antibodies ...... 138 A1.2: Media Recipes ...... 139 A1.2.1: 10X Amino Acid and Nucleotide Dropout Solution (1 L) ...... 139 A1.2.2: LB Medium (Liquid or Solid, with or without Antibiotic) (1 L) ...... 140 A1.2.3: Synthetic Dropout (SD) Medium (Liquid or Solid, with or without Antibiotic) (1 L) ...... 140 A1.2.4: Synthetic Dropout (SD) + XGal Medium (Solid) (1 L) ...... 141 A1.2.5: Terrific Broth (TB) Liquid Medium (with or without Antibiotic) (1 L) ...... 141 A1.2.6: YPAD Medium (Liquid or Solid, with or without Antibiotic) (1 L) ...... 141 A1.2.7: 2X YPAD (Liquid) (1 L) ...... 142 A1.2.8: ZincLimited Medium (500 mL) ...... 142 A1.2.9: ZincReplete Medium (500 mL) ...... 142 A1.3: Antibiotics ...... 143 A1.3.1: 100 mg/mL Ampicillin 1000X Stock (10 mL) ...... 143 A1.3.2: 200 mg/mL Geneticin (G418) 1000X Stock (10 mL) ...... 143 A1.3.3: 50 mg/mL Kanamycin 1000X Stock (10 mL) ...... 143 A1.3.4: 100 mg/mL Nourseothricin 1000X Stock (10 mL) ...... 143 A1.4: Chemical Solution Recipes ...... 143 A1.4.1: 10% Ammonium Persulfate (1 mL) ...... 143 A1.4.2: Cell Wall Disruption Solution for 96well Yeast Miniprep ...... 143 A1.4.3: 1 M Dithiothreitol (DTT) (10 mL) ...... 144 A1.4.4: 0.5 M Ethylenediaminetetraacetic Acid (EDTA), pH 8.0 ...... 144 A1.4.5: 6X Gel Loading Dye for Agarose Gels ...... 144 A1.4.6: 80% Glycerol (100 mL) ...... 144 A1.4.7: Inoue Buffer for Competent E. coli Preparation ...... 145 A1.4.8: 1 M and 2 M Lithium Acetate for Yeast Transformation (1 L) ...... 145 A1.4.9: 5% Milk Blocking Solution for Western Blot (100 mL) ...... 145 A1.4.10: Phosphate Solution for Xgal Medium (1 L) ...... 145 A1.4.11: 50% Polyethylene Glycol (PEG) 3350 for Yeast Transformation (50 mL) ...... 146 A1.4.12: 0.1% Ponceau S for Western Blot (100 mL) ...... 146 A1.4.13: 2 mg/mL Salmon Sperm DNA (ssDNA) Solution for Yeast Transformation ...... 146 A1.4.14: 2X Sample Buffer for Proteins (50 mL) ...... 146 A1.4.15: 0.9% Sodium Chloride (100 mL) ...... 147 vii

A1.4.16: 1 M Sodium Citrate, pH 4.2 (200 mL) ...... 147 A1.4.17: 10% Sodium Dodecyl Sulfate (SDS) ...... 147 A1.4.18: 1X and 10X SDS Gel Running Buffer (2 L) ...... 147 A1.4.19: 2 M Sodium Hydroxide (100 mL) ...... 148 A1.4.20: 1 M Sorbitol (1 L) ...... 148 A1.4.21: 1X and 50X TAE Buffer for DNAAgarose Electrophoresis (1 L) ...... 148 A1.4.22: 10X TBS, pH 7.5 for Western Blot (1 L) ...... 148 A1.4.23: 1X TBST Solution for Western Blot (1 L) ...... 149 A1.4.24: 1X and 10X Transfer Buffer for Western Blot (2 L)...... 149 A1.4.25: 50% Trichloroacetic Acid (100 mL) ...... 149 A1.4.26: 1.0 M Tris, pH 6.8, 7.5 or 8.0 (1 L) ...... 149 A1.4.27: 1.5 M Tris, pH 8.8 (1 L) ...... 149 A1.4.28: 10X TrisEDTA (TE) Solution for MYTH Large Scale Transformation (1 L) ...... 150 A1.4.29: 100 mg/mL Xgal Solution (1 mL) ...... 150 A1.4.30: 40 mM Zinc Chloride Stock Solution for Zinc Shock Assay (10 mL) ...... 150 Appendix 2...... 151 References...... 156

viii

List of Tables

Table Description Page Number

Table 1: Primer Sequences for Amplification of ORF of Baits for Cloning into 56 AMBV and AMBVYFP Plasmids

Table 2: Primer Sequences for Verifying ORF of Baits 58

Table 3: Primer Sequences for Confirmation of Deletion Mutants 64

Table 4: Primer Sequences for qRTPCR 66

Table 5: Primer Sequences for Amplifying MYTHYFP Tag for Integrating 68 Downstream of ZRC1 and ZRT1

Table 6: Primer Sequences for MYTH Tag Integration Confirmation Downstream 69 of ZRC1 and ZRT1 ORF

Table 7: Description and Localization from the Saccharomyces cerevisiae Database 81 (SGD) for the 43 Interactors from the MYTH Screening of Nft1p, Pdr10p, Pdr18p and Vmr1p Table 8: Human Homologs of Preys According to the InParanoid Database, and 91 Associated Diseases from OMIM Database

Table 9: Summary of qRTPCR, Western Blot and Fluorescence Microscopy 108 Results for Zrc1p and Zrt1p in the pdr15 ∆, pdr18 ∆ and Wildtype (Y7092) Strains

Table 10: List of Yeast Strains Used in the Experiments 138

Table 11: Amino Acids and Nucleotides in 10X Dropout Solution 139

Table 12: List of Ykr103wp Interactors from the BioGRID Database 152

Table 13: List of Ykr104wp Interactors from the BioGRID Database 152

Table 14: List of Vmr1p Interactors from the BioGRID Database 153

153 Table 15: List of Pdr10p Interactors from the BioGRID Database

Table 16: List of Pdr15p Interactors from the BioGRID Database 154

Table 17: List of Pdr18p Interactors from the BioGRID Database 154

List of Figures

Figure Description Page Number Figure 1: A Schematic of Prototypical Full Length ABC Transporter 4

Figure 2: Overview of the Nucleotide Binding Domain Motifs in the ABC Protein 5

Figure 3: Overview of ABC Transporters in Saccharomyces cerevisiae 12

Figure 4: Overview of Membrane Yeast TwoHybrid 37

Figure 5: Overview of Zinc Transporters in Saccharomyces cerevisiae 44

Figure 6: Structure of ZIP Transporters 45

Figure 7: Structure of CDF Transporters 46

Figure 8: N ub G/N ub I Control Test for Nft1p, Pdr10p, Pdr18p and Vmr1p Baits 77

Figure 9: Localization of Nft1p and Vmr1p Baits 78

Figure 10: Localization of Pdr10p and Pdr18p Baits 79

Figure 11: Testing of Nft1p and Vmr1p Bait Function 80

Figure 12: Proteinprotein Interactome of Nft1p, Pdr10p, Pdr18p and Vmr1p from 87 MYTH Figure 13: Overlay of Previously Known Genetic and Physical Interactions on the 88 ProteinProtein Interactome of Nft1p, Pdr10p, Pdr18p and Vmr1p from MYTH Figure 14: GO Annotation Enrichment Analysis for Nft1p, Pdr10p, Pdr18p and 90 Vmr1p ProteinProtein Interactors from MYTH Using the Funspec Database Figure 15: Overview of ProteinProtein Interactions Between ABC Transporters and 93 Zinc Transporters Figure 16: Overview of Zrc1p Fragments that Interacted with Pdr10p and Pdr18p 93 Baits in MYTH Figure 17: Overview of Zrt1p Fragments that Interacted with Pdr5p, Pdr10p and 94 Pdr18p Baits in MYTH Figure 18: pdr15 ∆, pdr18 ∆, zrc1 ∆ and Wildtype Strains in Zinc Shock Assay 96

Figure 19: ZRC1 mRNA Levels in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in 97 Zincreplete and Zinclimited Media Figure 20: ZRT1 mRNA Levels in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in 98 Zincreplete and Zinclimited Media Figure 21: Zrc1p Protein Levels in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in 99 Zincreplete Medium

Figure 22: Zrc1p Protein Levels in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in 100 Zinclimited Medium Figure 23: Zrt1p Protein Levels in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in 101 Zincreplete Medium Figure 24: Zrt1p Protein Levels in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in 102 Zinclimited Medium Figure 25: Localization of FM464 Dye and Zrc1p Fused to C ub YFPVP16LexA 103 Tag Figure 26: Zrc1p Localization in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in Zinc 105 replete and Zinclimited Media Figure 27: Localization of FM464 dye and Zrt1p Fused to C ub YFPVP16LexA 105 Tag Figure 28: Zrt1p Localization in the pdr15 ∆, pdr18 ∆ and Wildtype Strains in Zinc 108 replete and Zinclimited Media Figure 29: pdr5 ∆, pdr10 ∆, zrc1 ∆ and Wildtype Strains in Zinc Shock Assay 155

xii

List of Appendices

Appendix Appendix Content Page Number Number Appendix 1 List of Strains, Plasmids, Prey Libraries and Antibodies 137 Media Recipes Chemical Solution Recipes Appendix 2 ProteinProtein Interactors of Nft1p, Pdr10p, Pdr18p and 151 Vmr1p from the BioGRID Database Results from zinc shock assay for pdr5 ∆ and pdr10 ∆ strains

xiii

Abbreviations

2,4D = 2,4dichlorophenoxyacetic acid ABC = ATP Binding Cassette AD = Activating Domain ATP = Adenosine Triphosphate BCRP = Breast Cancer Resistance Protein BD = Binding Domain BP = Binding Protein CaCdr1p = Candida Drug Resistance Protein 1 Cub = Cterminal half of ubiquitin CDF = Cation Diffusion Facilitator CFTR = Cystic Fibrosis Transmembrane Regulator DBD = DNA Binding Domain DRM = Detergent Resistance Membrane DTT = Dithiothreitol DUB = Deubiquitinating enzyme ER = Endoplasmic Reticulum Fe/S = IronSulfur HDL = High Density Lipoprotein HOG = High Osmolarity Glycerol iMYTH = Integrated Membrane Yeast TwoHybrid LiOAc = Lithium Acetate MAPK = Mitogen Activated Protein Kinase MCPA = 2methyl4chlorophenoxyacetic acid MCS = Membrane Contact Site MDR = Multidrug Resistance MIP = Major Intrinsic Protein MRP1 = Multidrug Resistance Protein 1 xiv

MSD = Membrane Spanning Domain MXR = Mitoxantrone Resistance Protein MYTH = Membrane Yeast TwoHybrid NBD = Nucleotide Binding Domain NTE = N Terminal Extension Nub = Nterminal half of Ubiquitin NubG = Mutant Nterminal half of Ubiquitin NubI = Wildtype Nterminal half of Ubiquitin OABP = Oligoadenylate Binding Protein ORF = Open Reading Frame PCR = Polymerase Chain Reaction PDR = Pleiotropic Drug Resistance PEG = Polyethylene Glycol qRTPCR = Quantitative Real Time Polymerase Chain Reaction SGD = Saccharomyces cerevisiae Database TAP = Tandem Affinity Purification TEV = Tobacco Etch Virus TF = Transcription Factor tMYTH = Traditional Membrane Yeast TwoHybrid WT = Wildtype Y2H = Yeast TwoHybrid YFP = Yellow Fluorescent Protein ZIP = Zrt, Irtlike Protein ZRE = Zinc Responsive Element

Chapter 1: Introduction

1.1: Research Objectives

The purpose of this research was to find the proteinprotein interactors of four

Saccharomyces cerevisiae ATPbinding cassette (ABC) transporters using Membrane Yeast

TwoHybrid (MYTH). This research is part of a larger project focused on developing a protein protein interactome of all nonmitochondrial S. cerevisiae ABC transporters. In addition, this research has also investigated the role of ABC transporters (Pdr15p and Pdr18p) in zinc homeostasis.

1.2: ABC Proteins

1.2.1: Function of ABC Proteins

The ABC protein superfamily is conserved in all life forms from prokaryotes to eukaryotes.

All members of the ABC superfamily share a highly conserved adenosine triphosphate (ATP) hydrolyzing domain, also referred to as the nucleotide binding domain (NBD) or the ABC (for

ATPbinding cassette) (Borst and Elferink 2002). ABC transporters are members of the ABC superfamily of proteins. ABC transporters are large integral membrane proteins that transport diverse substrates across the plasma and organellar membranes by utilizing energy from ATP binding and nucleotide hydrolysis (Paumi, Chuk et al. 2009).

Prokaryotic organisms possess two distinct structural types of ABC transporters: ABC importers and ABC exporters. ABC importers play an essential role in the uptake of nutrients including ions, amino acids, peptides, sugars and other hydrophilic substrates. ABC exporters are responsible for the extrusion of physiological substrates, toxins and drugs out of the cell through the plasma membrane, or compartmentalization of the substrates into different organelles for storage and detoxification (Schmitt and Tampe 2002). Eukaryotic organisms only possess transporters from ABC exporter structural class. Many proteins in the ABC superfamily

3 do not function as transporters due to the lack of membrane spanning domain (MSD). Instead, these ABC proteins play an essential role in other cellular processes by providing energy from

ATP hydrolysis. For example, elongation factor 3 is a cytosolic ABC protein required by the fungal ribosomes for protein synthesis (Chakraburtty 2001), and UvrA is an ABC protein involved in the nucleotide excision repair in Eubacteria (Goosen and Moolenaar 2001).

Additionally, some ABC transporters do not function as real transporters. For example, the human cystic fibrosis transmembrane regulator (CFTR or ABCC7) protein is a chloride ion channel and the human sulfonylurea receptors (SUR1/ABCC8 and SUR2/ABCC9) are ATP sensing subunits of a complex potassium channel (Borst and Elferink 2002; Paumi, Chuk et al.

2009).

ABC transporters play a critical part in various cellular processes. Bacterial ABC transporters play an important role in viability, virulence and pathogenicity (Davidson, Dassa et al. 2008). For example, the iron ABC uptake system is an important effector of virulence in

Vibrio cholerae (Henderson and Payne 1994) and the chvEgguAB operon, which encodes a glucose and galactose importer, is involved in virulence in Agrobacterium tumefaciens

(Cangelosi, Ankenbauer et al. 1990; Kemner, Liang et al. 1997). MsbA is an ABC transporter in

Escherichia coli and is involved in lipid transport and phospholipid biosynthesis (Zhou, White et al. 1998). ABC transporters also play important physiological roles in eukaryotic organisms.

The human CFTR protein is found in the epithelial cells of several organs including the lung, liver, pancreas, digestive tract, reproductive tract and skin, and is involved in the movement of chloride and thiocyanate ions out of the epithelial cells to the surrounding mucus to maintain an electrolyte balance. ABC transporters are also critical to liver function in humans because they are involved in excretory functions of bile salts (via BSEP protein), phospholipids (via MDR3 protein), bilirubin (via MRP2 protein) and organic anions (via MRP2 protein) (Borst and

Elferink 2002). Human Pglycoprotein (also called MDR1) is concentrated in three drug barriers: the gut mucosa, the bloodbrain barrier and the maternalfetal barrier, and is a key player in eliminating amphipathic toxins from the cells (Borst and Elferink 2002).

1.2.2: Structure of ABC Transporters

A prototypical full length ABC transporter consists of two homologous halves, each consisting of a MSD and a NBD (see Figure 1) (Dean, Hamon et al. 2001). Each MSD typically contains about 6 to 11 membranespanning alpha helices and acts as both the substrate binding site and a determinant of substrate specificity (Dean, Rzhetsky et al. 2001). The primary sequence of MSDs is not very well conserved among the ABC transporters. The two MSDs in a protein interact to form the translocation pore through the membrane (Jones, O'Mara et al. 2009).

Figure 1: A prototypical full length ABC transporter consists of two homologous halves, each consisting of a Membrane Spanning Domain (MSD) and a Nucleotide Binding Domain (NBD)/ABC cassette. Each MSD typically contains 6 membranespanning alpha helices and provides the substrate binding site and determines specificity for the substrate. The NBD is the site of ATP binding and hydrolysis.

The cytoplasmic NBD is the site for ATP binding and hydrolysis, and the resultant energy is used to power the transport of substrate. The primary sequence of the NBD is highly

5 conserved among ABC transporters in all forms of life. Each NBD is approximately 200 residues in length (Paumi, Chuk et al. 2009), and contains conserved Walker A (GxxGxGKS/T, where x is any amino acid) and Walker B motifs (ϕϕϕϕDE, where ϕ is a hydrophobic residue), which are also found in other nucleotide binding proteins (see Figure 2) (Snider and Houry

2008). However, the NBD of the ABC protein also contains a unique domain called the Cloop or signature motif (LSGGQ) (Jones, O'Mara et al. 2009). The Walker A and Walker B motifs are separated by approximately 90 to 120 amino acids, and the signature C motif is located just upstream of the Walker B motif (Dean, Rzhetsky et al. 2001). The two NBDs interact with each other in headtotail fashion, where the Walker A and B motifs of one NBD interact with the C motif of the other NBD (Paumi, Chuk et al. 2009). There is one highly conserved glutamine residue found in the Qloop and a highly conserved histidine residue in the Hloop (also called the switch region), which are important for interaction of the NBD with the γphosphate of ATP.

There is also the Dloop which makes contact with the Walker A motif of the other monomer.

The region between the Qloop and the signature motif consists of a helical domain (also referred to as a structurally diverse region (SDR)). The SDR contains residues that are important for the interaction of the NBD with the transmembrane part of the ABC transporter (Davidson,

Dassa et al. 2008).

Figure 2: Overview of the Nucleotide Binding Domain (NBD) motifs in the ABC protein. Each NBD is approximately 200 residues in length. The NBD contains conserved Walker A (GxxGxGKS/T, where x is any amino acid) and Walker B (ϕϕϕϕDE, where ϕ is a hydrophobic residue) motifs, which are also found in other nucleotide binding proteins. The NBD of an ABC protein also contains a unique domain called the Cloop or signature motif (LSGGQ), upstream of Walker B motif. The Walker A and Walker

B motifs are separated by approximately 90 to 120 amino acids. There is one highly conserved glutamine residue found in the Qloop and a highly conserved histidine residue in the Hloop (also called the switch region). There is also the Dloop which makes contact with the Walker A motif of the other monomer. The region between the Qloop and the signature motif constitutes a helical domain or structurally diverse region (SDR). This figure is adapted from (Davidson, Dassa et al. 2008).

The global phylogenetic analysis of ABC proteins found that they can be divided into three major functional and structural classes (Dassa and Bouige 2001). Class 1 consists of ABC proteins that have fused MSDs and NBDs encoded by a single polypeptide, and contain mostly

ABC exporters. MSDs and NBDs can be fused either in normal configuration (MSDNBD

MSDNBD), where the MSD is at amino terminus or reverse configuration (NBDMSDNBD

MSD), where the NBD is at amino terminus. Additionally, some class 1 ABC transporters (e.g.,

Pxa1p in S. cerevisiae ) are halftransporters and contain a single MSD and NBD. These half transporters must homo or heterodimerize to form a full length functional ABC transporter. The majority of ABC proteins in eukaryotes are Class 1 ABC transporters. Interestingly, Class 1

ABC transporters are underrepresented in the genomes of bacteria and virtually absent in the genomes of archaea (Dassa and Bouige 2001; Davidson, Dassa et al. 2008).

Class 2 ABC proteins consist of proteins that have two repeated NBDs and no MSDs.

The class 2 ABC proteins do not function as transporters, but are involved in other cellular processes, such as DNA repair (e.g., UvrA protein), translation elongation (e.g., EF3 subfamily) and antibiotic resistance (e.g., ARE subfamily). Class 2 ABC proteins are found in the genomes of all life forms (Bouige, Laurent et al. 2002; Davidson, Dassa et al. 2008).

Class 3 ABC proteins are mainly ABC importers where the NBDs and MSDs are carried by independent polypeptide chains. The majority of Class 3 ABC transporters are binding protein (BP) dependent importers that depend on the presence of a separate extracellular substrate BP that recognizes substrates with high affinity. However, there are also BP

7 independent class 3 importers. Another subclass of class 3 ABC transporters are ABC exporters that mediate the export of peptides, proteins, drugs and polysaccharides and play an important role in drug and antibiotic resistance, and the biogenesis of extracellular polysaccharides. Class

3 transporters are mainly found in prokaryotic genomes and mostly absent in eukaryotic organisms, although incomplete class 3 transporters are present in the genomes of plants and algae (Dassa and Bouige 2001; Davidson, Dassa et al. 2008).

1.2.3: ABC Transporters, Human Diseases and Multidrug Resistance

Lossoffunction mutations and polymorphisms in the ABC transporter genes are linked to a number of inherited human diseases. Mutations in the human CFTR (also called ABCC7 ) gene cause cystic fibrosis, one of the most common fatal childhood diseases. The most common mutation for cystic fibrosis is the deletion of three base pairs resulting in the loss of a phenylalanine residue (∆F508). Patients with cystic fibrosis have inadequate secretion of pancreatic enzymes, which leads to nutritional deficiencies, bacterial infections in lungs, and male infertility due to the obstruction of the vas deferens (Rowe, Miller et al. 2005). The cholesterol transport disorder Tangier’s disease is caused by mutations in the ABCA1 gene in humans. There is a severe reduction in the amount of high density lipoprotein (HDL) due to the inability of mutant ABCA1 protein to transport cholesterol and phospholipids from inside the cell into bloodstream, where they combine with Apolipoprotein A1 to form HDL (Rust, Rosier et al. 1999). Adrenoleukodystrophy leads to brain damage, failure of the adrenal glands and eventually death. Adrenoleukodystrophy patients have an accumulation of unbranched, saturated very long fatty acids due to a defective ABCD1 gene (Dean, Rzhetsky et al. 2001). The

ABCA4 protein is exclusively expressed in photoreceptors where it transports retinol (vitamin A) derivatives from the photoreceptor outer segment disks into the cytoplasm. Mutations in the

ABCA4 gene are associated with multiple eye disorders that lead to loss of vision, including

8 retinitis pigmentosa, Stargardt disease and agerelated macular degeneration (Dean, Rzhetsky et al. 2001). The ABCC8 protein modulates potassium channels and insulin release. Mutations in

ABCC8 are linked to the familial persistent hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder that causes unregulated insulin secretion, and noninsulin dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion (Dean, Rzhetsky et al. 2001). There are many other inherited diseases linked to the

ABC transporters including progressive familial intraheptic cholestasis, pseudoxanthoma elasticum, DubinJohnson syndrome and Xlinked sideroblastosis and anemia (Dean, Rzhetsky et al. 2001; Borst and Elferink 2002; Paumi, Chuk et al. 2009).

ABC transporters also play an essential role in the development of multidrug resistance

(MDR) in human cancers and pathogenic microorganisms. In MDR, cells become resistant to several drugs in addition to an initial compound to which they have been exposed. MDR is a major challenge in cancer chemotherapy and use of therapeutics against pathogenic fungi and bacteria. Cells can develop MDR through several mechanisms including decreased uptake, increased detoxification, alteration of target proteins, and/or increased excretion. ABC transporters are responsible for increased excretion of the drug in MDR. In humans, ABCB1

(also called Pglycoprotein and MDR1), ABCC1 (also called MRP1 for Multidrug Resistance

Protein 1), ABCG2 (also called BCRP for Breast Cancer Resistance Protein, MXR for

Mitoxantrone Resistance protein or ABCP) are the three most well studied ABC transporters involved in MDR in cancer cells. These ABC transporters play an important physiological role in preventing uptake of toxic compounds from the gut into body. They are essential for protecting important structures in the body including the brain, cerebrospinal fluid and testes.

For example, Pglycoprotein is found in the bloodbrain barrier, placental trophoblasts, maternalfeat barrier, testes, bone marrow, gut, liver and kidneys. These transporters also play a

9 role in other cellular processes. For instance, Pglycoprotein can transport cytokines, while

MRP1 can transport leukotrienes, both of which are important signalling molecules. Mutations, polymorphisms, and changes in expression levels of Pglycoprotein, MRP1 and BCRP all play a significant role in multidrug resistance in cancer (Dean, Rzhetsky et al. 2001; Borst and Elferink

2002).

The importance of ABC transporters in the MDR of parasites, fungi and bacteria is also wellstudied. ABC transporters are important in the antiseptic resistance of Staphylococcus aureus , and fluoroquinolone resistance of both Staphylococcus aureus and Streptococcus pneumoniae (Li and Nikaido 2004). ABC transporters are also involved in MDR in parasitic protozoa (Ouellette, Legare et al. 2001). Mutations and increased copy number of ABC transporters, such as PfMDR1, are important reasons for therapeutic failure in the treatment of

Plasmodium falciparum infection in malaria (Koenderink, Kavishe et al. 2010). Botrytis cinerea is a major fungal pathogen that affects commercial crops and fruits worldwide in agriculture.

Recently, it was found that AtrB, an ABC transporter in Botrytis cinerea plays a major role in the fungicide resistance (Kretschmer, Leroch et al. 2009). Overexpression of the Candida drug resistance protein 1 (CaCdr1p), which is an ABC transporter, is one of the most important contributors of MDR in Candida albicans (Sharma and Prasad 2011).

1.2.4: Human ABC Subfamilies

The human genome contains 48 ABC protein genes, which are divided into seven subfamilies based on similarity in gene structure, order of the domains, and sequence homology in the NBDs and MSDs. The seven human subfamilies include: ABCA (ABC1), ABCB

(MDR/TAP), ABCC (CFTR/MRP), ABCD (ALD), ABCE (OABP), ABCF (GCN20) and

ABCG (White). ABC proteins belonging to a particular subfamily tend to have overlapping

10 physiological and biochemical functions, but this is not always the case and there may be considerable variability in function (Dean, Rzhetsky et al. 2001).

The ABCA subfamily can be subdivided into two subgroups. The first subgroup includes seven genes found on six different chromosomes. The second subgroup includes five genes arranged in a cluster on chromosome 17q24. The ABCA family contains some of the largest

ABC transporters in humans. Well studied ABCA genes are ABCA1, which is involved in disorders of cholesterol transport and highdensity lipoproteins biosynthesis, and ABCA4, which transports vitamin A derivatives in the outer segments of photoreceptor cells (Dean,

Rzhetsky et al. 2001).

The ABCB subfamily includes four full length transporters and seven half transporters.

ABCB1 (MDR1) was the first human ABC transporter cloned and it is involved in the MDR phenotype in cancer cells. ABCB1 is found in the bloodbrain barrier and liver and protects cells from toxic compounds. The ABCB4 and ABCB11 proteins are involved in secretion of bile acids in liver. The ABCB2 and ABCB3 are half transporters that form a heterodimer to transport peptides into endoplasmic reticulum. ABCB6, ABCB7, ABCB8 and ABCB10 are involved in iron metabolism and transport of Fe/S protein precursors in the mitochondria (Dean, Rzhetsky et al. 2001).

ABCC subfamily members are distinguished from members of other ABC subfamilies by two primary features. Firstly, most members of ABCC subfamily contain an additional N terminal extension (NTE), which consists of a MSD (called MSD0) with five transmembrane spans and a short cytosolic loop (called L0). Secondly, most ABCC proteins transport their substrates (e.g., xenobiotic compounds and toxic metabolites) conjugated to glutathione, glucuronide or sulfate, rather than in an unmodified state (Paumi, Chuk et al. 2009). The human

ABCC subfamily includes 12 full transporters with a variety of functions including ion transport,

11 serving as cell surface receptors and secreting toxins. For example, the CFTR protein, mutations of which lead to cystic fibrosis, is a chloride ion channel. ABCC1, ABCC2 and ABCC3 are involved in glutathione conjugated drug and organic anion transport. ABCC8 and ABCC9 proteins bind sulfonylurea and regulate potassium channels involved in modulating insulin secretion (Dean, Rzhetsky et al. 2001).

The ABCD subfamily contains 4 members in humans. All of the ABCD subfamily genes encode half transporters that are located in the peroxisome, where they homo or heterodimerize to transport very long chain fatty acids (Dean, Rzhetsky et al. 2001).

Members of the ABCE and ABCF subfamilies have NBDs but lack MSDs, and therefore, are not involved in transport function. The ABCE human subfamily only contains oligo adenylate binding protein (OABP) that recognizes oligoadenylate produced in response to infection by certain viruses. OABP is only found in multicellular eukaryotes and plays a part in innate immunity (Dean, Rzhetsky et al. 2001). There are three proteins in ABCF subfamily, and each protein contains a pair of NBDs. ABCF1 is associated with the ribosome and its S. cerevisiae homolog GCN20 protein mediates the activation of the eIF2 alphakinase (Dean,

Rzhetsky et al. 2001).

The human ABCG subfamily consists of six reverse half transporters where the NBD is at the amino terminus. The human ABCG1 is involved in cholesterol transport regulation,

ABCG2 in drug resistance, ABCG4 is expressed in liver and has unknown function, and

ABCG5 and ABCG8 are involved in sterol transport in the liver and intestine. Mutations in

ABCG5 and ABCG8 are linked to sitosterolemia, which causes elevated levels of plant sterols in plasma and tissues (Dean, Rzhetsky et al. 2001; Borst and Elferink 2002).

1.3: ABC Transporters in S. cerevisiae

S. cerevisiae is an excellent model to study ABC proteins because 6 of 7 human subfamilies are present in S. cerevisiae ; only the ABCA subfamily is absent in yeast (Paumi,

Chuk et al. 2009). There are total of 30 ABC proteins in S. cerevisiae, 22 of which contain

MSDs and are true ABC transporters (see Figure 3). The remaining 8 ABC proteins contain no

MSDs and thus carry out nontransport function inside the cell. Two ABC genes ( CAF16 and

YDR061w ) do not belong to any human subfamily and comprise their own category (Paumi,

Chuk et al. 2009).

Figure 3: Overview of ABC transporters in S. cerevisiae . There are total of 22 ABC transporters in the yeast. There are 4 transporters in the ABCB subfamily, 6 transporters in the ABCC subfamily, 2 transporters in the ABCD subfamily and 10 transporters in the ABCG subfamily. Mitochondrial ABC transporters Mdl1p, Mdl2p and Atm1p cannot be screened in the Membrane Yeast TwoHybrid assay because they are not accessible to cytoplasmic deubiquitinating enzymes. This figure is adapted from (Paumi, Chuk et al. 2009).

1.3.1: ABCC (MRP/CFTR) Subfamily in S. cerevisiae

The ABCC (MRP/CFTR) subfamily in S. cerevisiae contains 6 transporters: Bpt1p,

Vmr1p, Nft1p, Ybt1p, Ycf1p, and Yor1p. All ABCC transporters except Yor1p contain an extra

NTE domain. All ABCC transporters in S. cerevisiae are localized to the vacuolar membrane, except Yor1p, which is localized to the plasma membrane. There is overlapping substrate specificity between many ABCC transporters, and several ABCC transporters transport substrates conjugated to glutathione, glucuronate or sulfate (Paumi, Chuk et al. 2009).

Ycf1p (for Yeast Cadmium Factor) transports glutathione conjugated substrates into the vacuole. It plays a crucial role in detoxifying xenobiotic substrates and heavy metals including cadmium, mercury and arsenite. It can also transport unconjugated bilirubin and oxidized glutathione. Interestingly, MRP1 protein (a human homolog of Ycf1p) heterologously expressed in ycf1 ∆ strain can complement cadmium sensitivity and restore glutathione transport activity into yeast vacuoles. The YCF1 gene is under the control of the Yap1p transcription factor, which is one of the most important transcriptional regulators in defending cells against oxidative stress

(Li, Szczypka et al. 1996; Paumi, Chuk et al. 2009).

BPT1 is the closest homolog of YCF1 . Bpt1p (for Bile Pigment Transporter) has overlapping function with Ycf1p, including transport of unconjugated bilirubin and heavy metal detoxification via glutathione conjugates. Bpt1p can also transport bile pigment in vitro . Unlike

Ycf1p, Bpt1p does not appear to be regulated by the Yap1p transcription factor (Klein, Mamnun et al. 2002; Paumi, Chuk et al. 2009). Ybt1p (for Yeast Bile Transporter) was originally named

Bat1p (for Bile Acid Transporter). It is responsible for bile acid transport (Ortiz, St Pierre et al.

1997; Paumi, Chuk et al. 2009).

Yor1p (for Yeast Oligomycin Resistance) is the only ABCC transporter in S. cerevisiae located in the plasma membrane. Yor1p is a multidrug transporter involved in pleiotropic drug resistance (PDR) in S. cerevisiae. YOR1 gene expression is under the control of PDR transcription factors, Pdr1p and Pdr3p. It also transports organic anions including oligomycin

(Katzmann, Hallstrom et al. 1995; Decottignies, Grant et al. 1998; Paumi, Chuk et al. 2009).

1.3.1.1: Nft1p

Nft1p (for New Fulllength MRPtype Transporter) is a member of ABCC (MRP) subfamily in S. cerevisiae . No function is currently ascribed to Nft1p and it is localized to the vacuolar membrane. The NFT1 gene is located on chromosome XI. The NFT1 gene is composed of two adjacent open reading frames (ORFs) YKR103w and YKR104w separated by a nonsense codon in many S. cerevisiae strains, such as S288C and BY4741. In other strains, such as

SM1058, SM4643, SK1 and Σ1278b, this codon encodes a tyrosine residue, resulting in fusion of YKR103w and YKR104w into a single ORF encoding a fulllength Nft1p protein. Other species of yeast, such as Saccharomyces paradoxus and Saccharomyces mikatae also encode the fulllength NFT1 gene. The fulllength NFT1 gene product is probably the wildtype form in S. cerevisiae , with the truncated NFT1 gene product resulting from cultivation in the laboratory and unintentional selection against the presence of fulllength NFT1 . It was hypothesized that fulllength versus truncated NFT1 gene product might influence the activity of Ycf1p and may therefore account for differences in the phenotype of Ycf1p mutants observed in different strain backgrounds, however, no experimental evidence supporting this proposal has been provided

(Mason, Mallampalli et al. 2003; Paumi, Chuk et al. 2009).

Ykr103wp is 1218 amino acids long with a molecular weight of 137,995 Da. Ykr104wp is 306 amino acids long with a molecular weight of 34,652 Da. In the S288C background, a

YKR103w null mutant is viable (Giaever, Chu et al. 2002) and exhibits a decrease in mitophagy

(Kanki, Wang et al. 2009), increased competitive fitness in minimal medium (Breslow,

Cameron et al. 2008), and decreased hyperosmotic stress resistance to 1M sodium chloride

(Yoshikawa, Tanaka et al. 2009). In the SEY6210 background, a YKR103w null mutant exhibits decreased autophagy (Kanki, Wang et al. 2009). In the S288C background, a YKR104w null mutant is viable (Giaever, Chu et al. 2002) and exhibits decreased competitive fitness in minimal medium (Breslow, Cameron et al. 2008). There are 12 and 45 unique reported physical and genetic interactions for Ykr103wp and Ykr104wp, respectively, in the BioGRID database

(see Table 12 and Table 13 in Appendix 2) (Stark, Breitkreutz et al. 2011). The closest S. cerevisiae homologs of Nft1p are Ycf1p and Bpt1p (Wawrzycka, Sobczak et al. 2010). This suggests that Nft1p is probably involved in transport of multiple drugs and metals. MYTH screening will provide novel information about Nft1p because it will tell us the proteinprotein interactors of Nft1p, and the biological pathways where Nft1p may play an important role. This information will be valuable because it will provide new insight into the function of Nft1p inside the cell.

1.3.1.2: Vmr1p

Vmr1p (for Vacuolar Multidrug Resistance) is a member of ABCC (MRP) subfamily in

S. cerevisiae . Vmr1p is localized to the vacuolar membrane and it is involved in transport of multiple drugs and metals. Vmr1p protein levels are greater in ethanol/glycerol medium than in glucose medium (Wawrzycka, Sobczak et al. 2010). The VMR1 (YHL035C ) ORF is located on chromosome VIII. Vmr1p contains 1592 amino acids and it has a molecular weight of 180,924

Da. Vmr1p exhibits a typical MRP topology with 270 amino acids and five predicted transmembrane spans in the NTE (Wawrzycka, Sobczak et al. 2010). In S288C background, a

VMR1 null mutant is viable (Giaever, Chu et al. 2002) and exhibits decreased competitive fitness in minimal medium (Breslow, Cameron et al. 2008), decreased hyperosmotic stress

16 resistance to 1M sodium chloride (Yoshikawa, Tanaka et al. 2009) and decreased metal resistance to 2.5mM copper (II) sulfate (van Bakel, Strengman et al. 2005). In the FY167928c background, a VMR1 null mutant also shows a decrease in resistance to several drugs and metals including, cadmium dichloride, cycloheximide, 2,3,5triphenyltetrazolium chloride, polidocanol, 2,4dinitrophenol, 8hydroxyquinoline, 1,10phenanthroline, 4nitroquinoline N oxide, diuron, hygromycin B, 2,4dicholorophenoxy acetic acid, piperidine and mercury

(Wawrzycka, Sobczak et al. 2010). There are 14 unique reported physical and genetic interactions for Vmr1p in the BioGRID database (see Table 14 in Appendix 2) (Stark,

Breitkreutz et al. 2011).

According to phylogenetic analysis of NTE, Ybt1p and Vmr1p are paralogs that come from a common ancestral gene, which was duplicated during a whole genome duplication event.

However, vmr1 ∆ strain does not show sensitivity to the Ybt1p substrates taurocholic acid and glycochenodeoxycholic acid, which suggests that the two proteins possibly have non overlapping functions (Wawrzycka, Sobczak et al. 2010).

Interestingly, VMR1 deletion produces sensitivity to cadmium only in ethanol/glycerol medium, where the carbon source is nonfermentable. There were no differences in cadmium sensitivity between vmr1 ∆ strain and the parental strain on glucose medium. Ycf1p is another

ABCC type transporter in S. cerevisiae responsible for cadmium detoxification. Thus, it is hypothesized that Ycf1p and Vmr1p may interact, modulate each other's activity, and have overlapping function. It is thought that Ycf1p plays a major transport role in glucose medium

(fermentable carbon source), whereas, Vmr1p plays a major transport role in ethanol/glycerol medium (respiratory substrate). However, vmr1 ∆ strain was not sensitive to antimonite, which is another Ycf1p substrate. Like Ycf1p, Vmr1p also appears to transport substrates as glutathione

17 conjugates because VMR1 deletion caused a decreased in transport of 3H2,4dinitrophenylS glutathione conjugate in vacuolarenriched fractions of cells grown in ethanol/glycerol medium

(Wawrzycka, Sobczak et al. 2010).

The VMR1 promoter region contains a binding motif for the Aft1p transcription factor and expression of the VMR1 gene is upregulated in mac1 ∆ strains. Mac1p and Aft1p transcription factors play a key role in the regulation of copper and iron homeostasis. This suggests that Vmr1p may play a role in copper and iron homeostasis (De Freitas, Kim et al.

2004). However, another study found that VMR1 gene expression is not affected by addition of copper salts, and thus, they did not find any evidence that Vmr1p is involved in copper and iron homeostasis (Wawrzycka, Sobczak et al. 2010).

βgalactosidase reporter assays revealed that VMR1 expression is not under the control of the PDR transcriptional regulators, Pdr1p and Pdr3p. Additionally, VMR1 gene expression is not under the control of Yap1p, a transcription factor that is involved in oxidative stress and controls the expression of the YCF1 gene. Interestingly, VMR1 promoter activity is twofold greater in ethanol/glycerol medium than in glucose medium, and addition of cadmium, zinc sulfate, antimony potassium tartrate, sodium arsenite or sodium arsenate increases the promoter activity by twofold in both media (Wawrzycka, Sobczak et al. 2010).

The stimulation of the VMR1 promoter by the ethanol/glycerol medium and cadmium was not additive, which suggest two different mechanisms for induction. The VMR1 promoter contains binding sites for Msn2p, Msn4p, Gcn4p, Adr1p, Gcr1p and Afr1p transcription factors.

Deletion of genes that control heavymetal stress (MSN2 /MSN4 and GCN4 ) caused a loss of stimulation of VMR1 promoter by cadmium and zinc, but had no effect on the stimulation by the ethanol/glycerol medium. Deletion of the ADR1 gene resulted in an over twofold increase in

VMR1 promoter activity and loss of the additional promoter stimulation by ethanol/glycerol

18 medium. Adr1p is a transcription factor necessary for glucose repression and it activates expression of several genes required for the ethanol/glycerol and fatty acid utilization.

Additionally, deletion of HAP4 , an activator of the glucoserepressed genes, did not affect

VMR1 expression in both glucose and ethanol/glycerol media in the presence of cadmium. The authors suggest that VMR1 gene expression is repressed by glucose and this is dependent on

Adr1p (Wawrzycka, Sobczak et al. 2010).

Rhodamine 6G, a substrate of Pdr5p, is also more actively extruded in the vmr1 ∆ strain.

The authors suggested that Vmr1p is responsible for the partial removal of rhodamine 6G from the cytoplasm to the vacuole, and the deletion of VMR1 results in an increase in activity of

Pdr5p and other pumps in order to remove the drug from the cytoplasm (Wawrzycka, Sobczak et al. 2010). Vmr1p was identified as a potential substrate for Cdc28p, which is the catalytic subunit of Cdk1p, a cyclindependent kinase in S. cerevisiae responsible for cell cycle control

(Ubersax, Woodbury et al. 2003).

1.3.2: ABCG (PDR5) Subfamily in S. cerevisiae

The ABCG (PDR5) subfamily in S. cerevisiae contains 9 full length transporters (Aus1p,

Pdr5p, Pdr10p, Pdr11p, Pdr12p, Pdr15p, Pdr18p, Snq2p, and YOL075cp) and 1 halftransporter

(Adp1p). All members of the ABCG subfamily are localized to the plasma membrane except

Adp1p, which is localized to the vacuolar membrane. All proteins in the ABCG subfamily display a reverse architecture: NBDs are on the amino terminus relative to the MSDs (Paumi,

Chuk et al. 2009).

Aus1p (for ABC protein involved in Uptake of Sterols) and Pdr11p (for Pleiotropic Drug

Resistance) are involved in the uptake of exogenous sterols at the plasma membrane under anaerobic growth (Kohut, Wustner et al. 2011). Pdr5p and Snq2p (for Sensitivity to 4

NitroquinolineNoxide) are multidrug transporters involved in the PDR network in S.

19 cerevisiae (Rogers, Decottignies et al. 2001) and cation resistance (Miyahara, Mizunuma et al.

1996). Pdr5p is also involved in lipid translocation (Decottignies, Grant et al. 1998). PDR5 and

SNQ2 gene expression is regulated by the Pdr1p and Pdr3p transcription factors (Balzi, Wang et al. 1994; Katzmann, Burnett et al. 1994; Mahe, ParleMcDermott et al. 1996). Pdr12p is a weak organic acid transporter and it is regulated by the War1p transcription factor, which controls weak acid stress response in the yeast (Piper, Mahe et al. 1998; Kren, Mamnun et al. 2003). The function of YOL075cp and Adp1p is currently unknown. Adp1p has an unusual structure because it has only one NBD between two MSDs. The first NBD is replaced by large soluble domain containing Epidermal Growth Factor (EGF) repeats (Kovalchuk and Driessen 2010).

1.3.2.1: Pdr10p

Pdr10p is a member of the ABCG subfamily in S. cerevisiae and it is localized to the plasma membrane. The PDR10 (YOR328W ) gene is located on chromosome XV. The Pdr10p protein contains 1,564 amino acids and it has a molecular weight of 176,459 Da. There are 17 unique reported physical and genetic interactions for Pdr10p in the BioGRID database (see

Table 15 in Appendix 2) (Stark, Breitkreutz et al. 2011). In a S288C background, a PDR10 null mutant is viable (Giaever, Chu et al. 2002) and exhibits increased competitive fitness in minimal medium (Breslow, Cameron et al. 2008) and increased resistance to nickel sulfate (Arita, Zhou et al. 2009). In the W303 background, a PDR10 null mutant exhibits increased mitotic recombination, increased protein/peptide distribution (Alvaro, Lisby et al. 2007), increased chitin deposition, decreased resistance to calcofluor white and congo red, and increased resistance to potassium sorbate, dodecyl phosphocholine and dodecyl maltoside (Rockwell,

Wolfger et al. 2009). Interestingly, the PDR10 gene was found to be a mutational hotspot (Fay and Benavides 2005), which suggests that different lineages of yeast may have adapted to cope with different demands for Pdr10p function (Rockwell, Wolfger et al. 2009).

Pdr10p is implicated in the PDR network because the transcription of PDR10 gene is controlled by the Pdr1p and Pdr3p transcription factors, which also control the transcription of other genes in the yeast PDR network (Wolfger, Mahe et al. 1997). Additionally, Pdr10p is a close homolog of Pdr5p, which is a multidrug transporter that plays an essential role in the PDR network, and Pdr15p, which is an ABC transporter involved in general stress response

(Rockwell, Wolfger et al. 2009). Pdr10p shows 65% and 62% amino acid identity to Pdr5p and

Pdr15p, respectively (Seret, Diffels et al. 2009). Unlike pdr5 ∆ strain , pdr10 ∆ strain is not sensitive to ketoconazole, rhodamine 6G or cycloheximide, and the pdr5 ∆pdr10 ∆ double mutant is also not different in sensitivity to these compounds compare to the pdr5 ∆ single mutant.

PDR10 deletion also has no effect on the toxicity of itraconazole, oligomycin, amphotericin B or

Crystal Violet with or without PDR5 deletion. Therefore, unlike Pdr5p, Pdr10p does not appear to contribute significantly to the capacity of the cell to export growth inhibitory compounds. In the W303 background, pdr10 ∆ cells did exhibit resistance to detergents containing C 12 alkyl chains, including dodecyl maltoside and dodecyl phosphocholine (Rockwell, Wolfger et al.

2009).

Pdr10p expression is highest during the stationary phase. The transcription of PDR10 is induced when cells undergo the diauxic shift from fermentative to nonfermentative growth as glucose becomes limiting (Roberts and Hudson 2006) and when cells are treated with rapamycin, which mimics conditions of nutrient limitation (Huang, Zhu et al. 2004). This suggests that

Pdr10p plays an important role in stress regulation because the demand for Pdr10p is greatest when cells are undergoing the stress of maintaining viability as growth rate slows down

(Rockwell, Wolfger et al. 2009).

Moreover, overexpression of the carotenogenic genes in S. cerevisiae from the yeast

Xanthophyllomyces dendrorhous results in membrane stress (Verwaal, Jiang et al. 2010).

Interestingly, the PDR10 gene is upregulated in the carotenoid producing S. cerevisiae strain, in addition to other genes involved in the PDR network including FLR1 , GRE2 , PDR3 , PDR5 ,

PDR15 , SNQ2 and TPO1 . This suggests that these multidrug transporters may play a role in relieving membrane stress caused by the accumulation of carotenoids by binding, removing, and secreting carotenoids from the membranes. Deletion of the PDR10 gene also resulted in decreased growth and carotenoid production levels in the carotenoidproducing S. cerevisiae strain, and a decrease in the transformation efficiency of the carotenogenic plasmid. These results suggest that absence of Pdr10p results in increased sensitivity to carotenoid synthesis and membrane stress in S. cerevisiae (Verwaal, Jiang et al. 2010).

Pdr10p may also have an important role in yeast cell wall maintenance. The yeast cell wall is composed of three types of polymers: mannoproteins, glucan and chitin. Deletion of

PDR10 results in sensitivity to two chitin binding agents, Calcofluor White and Congo Red

(Rockwell, Wolfger et al. 2009). However, a pdr10 ∆chs3 ∆ double mutant is not sensitive to calcofluor white. Chs3p is the chitin synthase responsible for producing the majority of the chitin in yeast. The pdr10 ∆ strain is sensitive to Calcofluor white due to abnormally high amounts of chitin produced by Chs3p. Pdr10p is required for normal endocytic trafficking of

Chs3p because endocytosis of Chs3p was less efficient in pdr10 ∆ cells than in wildtype cells.

However, the partial block in Chs3p endocytosis is not a general effect on all endocytic processes because endocytic uptake of two fluorescent dyes, Lucifer Yellow and FM464 is normal in the pdr10 ∆ strain. Additionally, deletion of PDR10 has no effect on actin localization and polarization. Taken together, the results suggest that Pdr10p plays a role in endocytosis of

Chs3p (Rockwell, Wolfger et al. 2009).

In addition, pdr10 ∆ cells exhibit a weak resistance to sorbate, a weak organic acid

(Rockwell, Wolfger et al. 2009). This sensitivity was due to the function of Pdr12p because the modest sorbate resistance was eliminated in the pdr10 ∆pdr12 ∆ double mutant. Pdr12p is located in the plasma membrane and it is responsible for the transport of weak organic acids.

Interestingly, pdr10 ∆ cells exhibited a twofold increase in the amount of Pdr12p relative to the wildtype cells. The level of PDR12 mRNA in pdr10 ∆ cells was not different from the wildtype.

This suggests that the increase in Pdr12p protein levels was not due to changes in transcription or a faster rate of synthesis, but likely from a reduced rate of turnover. Moreover, 60% of the total pool of Pdr12p was associated with the detergent resistant membrane (DRM) fractions in membranes from pdr10 ∆ strain, whereas, in wildtype cells only onethird of Pdr12p was present in DRM fraction and more than 50% was present in detergent soluble fraction. DRMs are suggested to signify specialized microdomains within the plasma membrane that compartmentalize cellular processes such as signalling, and protein trafficking. Pdr10p is present in both detergentsoluble and DRM fractions. Taken together, the data suggests a novel role of Pdr10p as a negative regulator of the incorporation of Pdr12p into the DRM fraction and proper lateral segregation of Pdr12p in the plasma membrane. Pdr10p must regulate the local environment of Pdr12p in some manner that alters its solubilization properties in the presence of detergent (Rockwell, Wolfger et al. 2009).

Interestingly, Pdr10p function requires a complex interaction between Pdr10p, Pdr5p,

Pdr12p, Lem3p and sphingolipids (Rockwell, Wolfger et al. 2009). Lem3p is a membrane protein found in the plasma membrane and endoplasmic reticulum, where it interacts with the phospholipid translocase Dnf1p and is involved in the translocation of phospholipids and alkylphosphocholine drugs across the plasma membrane. lem3 ∆ strain is not resistant to sorbate, but LEM3 deletion eliminates the modest sorbate resistance conferred by the pdr10 ∆ strain. This

23 suggests that the increase in Pdr12p action found in cells lacking Pdr10p requires the presence of functional Lem3p. In addition, deletion of PDR12 eliminates the Calcofluor white sensitivity of the pdr10 ∆ strain (Rockwell, Wolfger et al. 2009).

Similarly, deletion of genes required for synthesis of mature sphingolipid head groups

(SUR1 and IPT1 ) eliminated the Calcofluor white sensitivity, increase in chitin levels, and sorbate resistance in the pdr10 ∆ strain (Rockwell, Wolfger et al. 2009). However, deletion of the PDR10 gene does not result in significant changes in either the level of total phosphosphingolipids or in the composition of phosphosphingolipids. Furthermore, PDR5 deletion also resulted in elimination of both the Calcofluor white sensitivity and mild sorbate resistance in the pdr10 ∆ strain. Taken together, the epistasis results suggest that Pdr10p function requires Pdr5p, Pdr12p, Lem3p and mature sphingolipids (Rockwell, Wolfger et al. 2009).

1.3.2.2: Pdr15p

Pdr15p is a member of the ABCG subfamily in S. cerevisiae . Pdr15p is localized to the plasma membrane. The PDR15 (YDR406W ) gene is located on chromosome IV. Pdr15p protein is 1,529 amino acids in length with a molecular weight of 172,254 Da. In the S288C background, a PDR15 null mutant is viable (Giaever, Chu et al. 2002), has decreased fitness in minimal medium (Breslow, Cameron et al. 2008), and decreased resistance to 2,4dichlorophenol

(Schuller, Mamnun et al. 2007). There are 11 unique reported physical and genetic interactions for Pdr15p in the BioGRID database (see Table 16 in Appendix 2) (Stark, Breitkreutz et al.

2011).

Pdr15p is the closest homologue of Pdr5p. Pdr15p is a multidrug transporter implicated in cellular detoxification and general stress response. Pdr15p is induced in adverse conditions including high osmolarity, heat shock, low pH, exposure to weak acids and starvation. This induction is dependent on Msn2p, a general stress response gene. Pdr15p confers resistance to

24 chloramphenicol and the detergent polyoxyethylene9lauryl ether. Pdr15p is important in protecting cells during suboptimal metabolic conditions, such as when cells exit the exponential growth phase (Wolfger, Mamnun et al. 2004). PDR15 gene expression is also regulated by the

PDR network transcription factors Pdr1p, Pdr3p and Pdr8p (Wolfger, Mahe et al. 1997).

1.3.2.3: Pdr18p

Pdr18p is a member of the ABCG subfamily in S. cerevisiae and it is localized to the plasma membrane (Cabrito, Teixeira et al. 2011). PDR18 (YNR070w ) is located on chromosome

XIV. Pdr18p contains 1,333 amino acids and it has a molecular weight of 149,749 Da. The

PDR18 null mutant is viable in the S288C background (Giaever, Chu et al. 2002). There are 6 unique reported genetic and physical interactions for Pdr18p in the BioGRID database (see

Table 17 in Appendix 2) (Stark, Breitkreutz et al. 2011). Pdr18p is implicated in the PDR due to similarity with other ABC transporters involved in the PDR network. For example, Pdr18p is a paralog of Snq2p, which is involved in the PDR network (Seret, Diffels et al. 2009).

A pdr18 ∆ mutant in the BY4741 strain is sensitive to 2,4dichlorophenoxyacetic acid

(2,4D) and has a longer 2,4Dinduced lagphase. Pdr18p is responsible for reducing the accumulation of the 2,4D inside the cell possibly by direct extrusion because there was a greater accumulation of [ 14 C]2,4D in the pdr18 ∆ strain compared to the parental strain (Cabrito,

Teixeira et al. 2011). Interestingly, a PDR18 homolog in the plant model organism Arabidopsis thaliana , AtPDR9 , also confers resistance to 2,4D by decreasing the accumulation of 2,4D in plant roots (Ito and Gray 2006). In addition, the pdr18 ∆ mutant is also sensitive to the herbicides

MCPA (2methyl4chlorophenoxyacetic acid) and barban, to the 2,4D degradation intermediate 2,4dichlorophenol, to the agricultural fungicide mancozeb, and to the metal cations zinc, manganese, copper and cadmium. However, PDR18 provides no protection

25 towards benomyl, cobalt (Co 2+), lead (Pb 2+), aluminum (Al 3+ ) and thallium (Tl 3+ ). PDR18 expression is upregulated about 8fold in yeast cells in response to 0.3mM 2,4D in unadapted

S. cerevisiae . The increase is then followed by a decrease in PDR18 transcription to basal values as cells adapt to grow in presence of 2,4D. These results suggest a role of Pdr18p in the period of adaptation to the herbicide and general stress defence (Cabrito, Teixeira et al. 2011).

The PDR18 promoter region contains binding sites for five transcription factors including Nrg1p, Pdr3p, Yap1p, Rap1p and Swi4p. The Nrg1p transcription factor mediates glucose repression, controls carbon source availability and stress responses. The Yap1p transcription factor is required for oxidative stress tolerance and MDR. The Pdr3p transcription factor is an activator of the PDR network and plays a role in stress defence. 2,4D induced up regulation of the PDR18 gene was eliminated in the nrg1 ∆ mutant, and reduced in the yap1 ∆ and pdr3 ∆ mutants, which suggests that these three transcription factors play an essential role in activation of the PDR18 gene. Additionally, sitedirected mutagenesis of the putative Nrg1p binding site in the PDR18 promoter region resulted in only a moderate effect on 2,4D induced upregulation of the PDR18 gene compared to the full elimination in the nrg1 ∆ mutant. This suggests that the action of the Nrg1p transcription factor on the PDR18 expression is indirect, occurring through the regulation of other genes and transcription factors. Rap1p was not studied because rap1 ∆ strain is unviable. Swi4p was not studied because its deletion causes growth defects (Cabrito, Teixeira et al. 2011).

PDR18 deletion resulted in 2fold accumulation of squalene and lanosterol (precursors of the ergosterol biosynthetic pathway) in the plasma membrane. In addition, PDR18 deletion also caused a 1.5fold reduction of ergostatetraenol and ergosterol (endproducts of the ergosterol biosynthetic pathway) in the plasma membrane. Exposing yeast to 2,4D alone leads

26 to changes in the membrane sterol composition similar to those caused by PDR18 deletion.

BY4741 wild type yeast exposed to 2,4D accumulated 5.5fold higher levels of squalene and

1.5fold less ergosterol in the plasma membrane compared to unstressed conditions, and PDR18 deletion further exacerbated this effect. In pdr18 ∆ yeast, 24D exposure caused a 4.3fold increase in squalene and a 5.2fold decrease in ergosterol levels in the plasma membrane. Taken together, these results suggest that Pdr18p plays an essential role in plasma membrane sterol incorporation and composition via a nonvesicular endoplasmic reticulum to plasma membrane transport mechanism (Cabrito, Teixeira et al. 2011). Additionally, changes in the lipid composition of the plasma membrane affect its biophysical properties, which may explain the role of Pdr18p in multidrug resistance. Interestingly, deletion of the PDR18 gene causes a strong depletion of the plasma membrane potential as shown by two different plasma membrane potential assays: methylammonium uptake and accumulation of fluorescent DiOC 6 (3) probe.

Overall, the data suggests that the physiological role of Pdr18p is to maintain ergosterol in the plasma membrane, which may affect drug partition and transport across cell membranes

(Cabrito, Teixeira et al. 2011).

1.3.3: Other ABC Subfamilies in S. cerevisiae

The ABCB (MDR) subfamily in S. cerevisiae contains 3 half transporters (Mdl1p,

Mdl2p, Atm1p) and one full length transporter (Ste6p). All 3 half transporters are located in the mitochondrial inner membrane and homodimerize to form a functional transporter. Mdl1p is involved in export of peptides generated from the proteolysis of mitochondrial proteins and plays a role in regulating resistance to oxidative stress (Young, Leonhard et al. 2001;

Chloupkova, LeBard et al. 2003). Mdl2p function is unknown. It may be required for respiratory growth at high temperature (Young, Leonhard et al. 2001) and largescale studies suggest that

Mdl2p may play a role in osmotic stress resistance and oleic acid sensitivity (Lockshon, Surface

27 et al. 2007). Interestingly, MDL1 and MDL2 belong to same subfamily as the human TAP1 and

TAP2 genes, which are involved in immune response to viral infections, and genetic diseases, such as bare lymphocyte syndrome and Wegenerlike granulomatosis (LankatButtgereit and

Tampe 2002). Atm1p transporter is essential for exporting mitochondrially synthesized precursors of ironsulfur clusters to the cytoplasm (Kispal, Csere et al. 1999), and plays a role in iron homeostasis (Kispal, Csere et al. 1997). Ste6p transporter is an exporter of afactor pheromone in MATa cells (Kuchler, Sterne et al. 1989).

The ABCD (ALDP) subfamily contains two half transporters: Pxa1p and Pxa2p. Pxa1p and Pxa2p form a heterodimer that transports longchain fatty acids into the peroxisomes

(Hettema, van Roermund et al. 1996). PXA1 and PXA2 are yeast homologs of the human

ABCD1 gene that is linked to adrenoleukodystrophy (Shani, Sapag et al. 1996).

The ABCE (RLI1) subfamily contains only one protein, Rli1p, which lacks the MSDs. It is an essential ironsulfur protein required for ribosome biogenesis and translation initiation and termination. Rli1p helps a multifactor complex of initiation factors to bind to the small ribosomal subunit (Dong, Lai et al. 2004; Kispal, Sipos et al. 2005).

The ABCF (YEF3) subfamily contains 5 proteins: Yef3p, Hef3p, New1p, Gcn20p and

Arb1p, all of which lack MSDs. Yef3p is the gamma subunit of translational elongation factor eFF1B and helps binding of aminoacyltRNA to the ribosomes (Qin, Moldave et al. 1987;

Kamath and Chakraburtty 1989). Hef3p is a translational elongation factor EF3 and helps EF1 alphadependent aminoacyltRNA binding to the ribosome (Maurice, Mazzucco et al. 1998).

New1p is required for biogenesis of the small ribosomal subunit (Li, Lee et al. 2009). Gcn20p forms a complex with Gcn1p and positively regulates the Gcn2p kinase activity, which is involved in translation (Kubota, Ota et al. 2001). Arb1p is involved in the biogenesis of 40S and

60S ribosome (Dong, Lai et al. 2005).

1.4: ProteinProtein Interactions, Model Organism, and Research Tools

1.4.1: Importance of ProteinProtein Interactions

Proteins inside the cell rarely function in isolation. Instead, proteins interact with other proteins and biomolecules as part of their function and regulation (Alberts 1998; Sardiu and

Washburn 2011). Therefore, a study of any given protein is not complete without investigation of its proteinprotein interactors. Many important molecular processes, such as DNA replication, transcription and translation are carried out by large protein complexes where multiple proteins interact to form a single biomolecular machine. An excellent example is human hemoglobin, which is an assembly of four globular protein subunits that associate with a nonprotein heme group. Many metabolic enzymes, such as pyruvate dehydrogenase, also form multi subunit proteins to carry out their catalytic functions (Phizicky and Fields 1995).

Transient proteinprotein interactions are important for posttranslational protein modifications, including interaction of protein kinases, protein phosphatases, glycosyl transferases, acyl transferases and proteases with their substrate proteins (Ozbabacan, Engin et al. 2011). Protein modifications and alterations are essential to many fundamental processes including cell growth, cell cycle, metabolism and signal transduction. Proteinprotein interactions are also important for recruitment of transcription factors to specific promoters, transport of proteins across membranes, protein trafficking inside the cell, folding of proteins by chaperones, and the breakdown and reformation of sub cellular structures during the cell cycle

(Phizicky and Fields 1995).

There are many advantages of completing biological processes using proteinprotein interactions instead of a single protein. Proteinprotein interactions can alter the kinetic properties of the reaction, and thus, provide a useful way to regulate the catalytic reaction and biological process. Proteinprotein interactions can also alter the specificity of a protein for its

29 substrate. Additionally, it is simpler and more economical to build large protein complexes from smaller subunits because smaller subunits can be part of multiple complexes. The use of smaller proteins also helps avoid the increased likelihood of errors associated with the translation of large proteins. Large protein complexes can use different combination of subunits to alter the magnitude or type of response, and provide redundancy in function (Phizicky and Fields 1995).

Given the importance of proteinprotein interactions, a large variety of tools have been developed to study them, including coimmunoprecipitation (Kaboord and Perr 2008), bimolecular fluorescence complementation (BiFC) (Ventura 2011), tandem affinity purification

(TAP) and mass spectrometry (Babu, Krogan et al. 2009), fluorescence resonance energy transfer (FRET) (Clegg 1995), proteinfragment complementation assays (PCA) (Shekhawat and Ghosh 2011), yeast twohybrid (Y2H) (Fields and Song 1989), and membrane yeast two hybrid (MYTH) (Snider, Kittanakom et al. 2010). Proteinprotein interactions play an important role in almost all cellular processes inside the cell. Proteinprotein interaction networks, thus, provide valuable knowledge about protein function and regulation. This in return will enable us to gain insight into diseases and provide the basis for new therapeutic approaches (Phizicky and

Fields 1995; Sardiu and Washburn 2011). We hope that investigating proteinprotein interactions of ABC transporters will provide new insights into their function and regulation.

1.4.2: S. cerevisiae as a Model System

The baker’s yeast S. cerevisiae is a unicellular eukaryotic organism possessing a number of features which makes it an invaluable as a research tool and model system for the study of complex biological phenomena, such as proteinprotein interactions of ABC transporters. Since many human proteins have S. cerevisiae homologs, experimental findings can be easily translated to human physiology and diseases. For example, 6 of 7 human ABC protein subfamilies are represented in S. cerevisiae . PXA1 and PXA2 are S. cerevisiae homologs of

30 human ABCD1 gene that is linked to adrenoleukodystrophy (Paumi, Chuk et al. 2009; Bleackley and Macgillivray 2011; Botstein and Fink 2011). Additionally, a subset of yeast ABC transporters mediate PDR, which is very similar clinically to the MDR, which occurs in mammalian cells, parasites, fungal pathogens and bacteria (Ernst, Klemm et al. 2005).

There are a number of other interesting traits about S. cerevisiae , which makes it an idea model organism. S. cerevisiae has a short generation time and can be easily cultured in a lab, a characteristic which allows researchers to carry out experiments and obtain results more quickly.

Moreover, S. cerevisiae can grow on a defined medium, which allows easy manipulation of both the chemical and physical environment for studying biochemical pathways. In addition, S. cerevisiae can be easily transformed with plasmids and homologous recombination allows a simple method for deletion and mutation of genes. Interestingly, the haploid form of S. cerevisiae allows simple creation of gene knockout strains. The introduction of mutations and deletions provide a simple method to study biochemical function of gene products and the biological consequence of failure of the genes to function. Furthermore, the S. cerevisiae genome is fully mapped and sequenced and it is easy to manipulate for classical genetics. Yeast is a better model organism than bacteria because S. cerevisiae shares complex internal cell structures, such as organelles, with plants and animals without the high percentage of introns

(noncoding DNA) that is usually found in higher organisms and can complicate experimental designs. The S. cerevisiae genome is very compact where 70% of the genome consists of ORFs, whereas coding sequences make up less than 5% of the human genome. Only 4% of yeast genes contain introns, and the compactness of the genome makes it easier to identify genes and investigate their function (Bleackley and Macgillivray 2011; Botstein and Fink 2011).

There are a number of molecular and biological tools, and highthroughput technologies available to study genetics, biochemistry and cell biology in S. cerevisiae . One of the most

31 useful tools is the systematic deletion library, which is a collection of strains containing genetic knockouts for over 95% of predicted ORFs in the yeast genome. The deletion library has aided in assigning function to previously uncharacterized ORFs and new functions for known genes.

Tools including classic Y2H and MYTH, allow researchers to study proteinprotein interaction of both yeast proteins and foreign proteins in a yeast host. There are also a large number of yeast databases, gene expression and regulatory networks, protein interaction networks and gene interaction networks available online to the entire research community, providing resources for integration of data with previous literature and assisting in the establishment of future directions for new research avenues.

The contribution of yeast research and the identification of homologous system in humans have greatly facilitated general understanding of cell biology and advances in the diagnosis and treatment of human diseases. Therefore, insights gained from generating a yeast ABC transporter proteinprotein interactome should be of great value and significantly improve our understanding of human ABC transporter functions and pathways (Bleackley and Macgillivray

2011; Botstein and Fink 2011).

1.4.3: Yeast TwoHybrid (Y2H)

Before discussing MYTH, it is important to understand the classic Y2H system and its limitations. Y2H is a molecular biology technique used to discover proteinprotein interactions in the host organism S. cerevisiae . It was developed by Stanley Fields and OkKyu Song in 1989

(Fields and Song 1989). The technique was later adapted to detect proteinDNA interactions and use of E. coli instead of S. cerevisiae as a host (Joung, Ramm et al. 2000).

The theory behind Y2H is that most eukaryotic transcription factors have a modular activating domain (AD) and a DNA binding domain (BD) that can function in close proximity

32 without direct binding. However, neither AD or BD can activate transcription on its own. A protein of interest (called the “bait”) is fused to the BD of the transcription factor and expressed from a plasmid. The BD domain targets the hybrid protein to transcription factor binding site but cannot activate the transcription of reporter genes due to the lack of the AD. The putative interacting protein (called the “prey”) is fused to the AD of the transcription factor, and is also expressed from a plasmid. The hybrid protein that contains the AD cannot activate the transcription of reporter genes on its own because it cannot bind to the upstream activation sequence of the reporter genes. A prey can be a either a single protein or a collection of proteins in a library. If the bait and prey proteins interact, the BD and AD of the transcription factor come in close proximity near the transcriptional start site, where the AD can activate the transcription of reporter genes. Reporter genes can be nutritional genes (e.g., HIS3 , LEU2 ) that allow yeast to grow on selective medium or colorimetric genes, such as E. coli lacZ gene, whose gene product turns medium containing Xgal into blue colour. If the two proteins do not interact, the transcription factor is not reconstituted, the reporter genes are not activated, and the yeast cannot grow on selective medium or the medium does not change its colour. The DNA BDs of

GAL4 and LexA, and the ADs of GAL4 and Herpes virus VP16 are commonly used in Y2H.

The BD and AD can be cloned at either the amino or carboxyl terminus (Fields and Sternglanz

1994).

Other uses of the Y2H assay include determination of sequences and domains within the protein crucial for interaction, drug and therapeutics discovery and determination of protein function. Y2H screening can help researchers find drugs or chemicals that disrupt or assist proteinprotein interactions involved in human diseases. Similarly, a list of proteinprotein interactors can help researchers in discovering new function of proteins and the pathways they are involved in. Interestingly, the twohybrid system can work in other organisms but the yeast

33 based system has numerous advantages including ease of transformation and retrieval of plasmids, availability of nutritional markers and well characterized reporter genes for selection.

Other advantages of Y2H include relative ease, automation and highthroughput scalability. An extension of twohybrid technology is the onehybrid system, which is used to identify proteins that bind a specific DNA sequence (Fields and Sternglanz 1994).

Although Y2H is one of the most revolutionary techniques in molecular biology, it has limitations. The Y2H assay is known to produce a high number of false positives. This is partially due to the overexpression of fusion proteins. Also, the assay artificially expresses both the bait and prey at the same time, whereas, under natural conditions, the two proteins might not be expressed at the same time and location. Another limitation of the Y2H assay is that the fusion of transcription factor to the protein may cause conformational changes, improper folding or steric hindrance that may inhibit certain physiological interactions, which then are not detected in the system. Additionally, some interactions are mediated by posttranslational modifications, such as phosphorylation, which might not occur in the fusion protein. Studying proteinprotein interactions from a foreign organism may also be challenging using a yeast host due to the absence of other native proteins which may play a role in mediating interactions.

Importantly, the proteinprotein interaction in Y2H needs to take place in the nucleus or the transcription factor needs to be transported to the nucleus. Therefore, proteinprotein interactions may not be detected in Y2H assay if the proteinprotein interaction takes place outside the nucleus and the reconstituted transcription factor cannot be imported into the nucleus.

This presents a serious limitation because the Y2H system cannot detect interactions involving extracellular proteins because the proteins are glycosylated and contain disulfide bonds that are not compatible with a nuclear environment. Therefore, Y2H is of limited used to study very important receptorligand interactions that occur outside the cell. Due to the weaknesses in Y2H

34 assay, novel interactions need to be reconfirmed using other proteinprotein interaction techniques, such as coimmunoprecipitation (Fields and Sternglanz 1994). A major limitation of the classic Y2H assay is that it is limited to soluble proteins because the reconstitution of the transcription factor needs to occur in the nucleus. Thus, it is impossible to study proteinprotein interactions of full length integral membrane proteins using the Y2H assay. Cells contain a larger number of integral membrane proteins that are involved in transport function, signal transduction and other important biological processes. The MYTH assay is based on split ubiquitin complementation and it is a very powerful technique to study proteinprotein interactions of full length membrane proteins in vivo (Snider, Kittanakom et al. 2010).

1.4.4: Membrane Yeast TwoHybrid (MYTH)

Although, the traditional Y2H is a powerful technique to study in vivo proteinprotein interactions, it is limited to the analysis of soluble proteins because the assay relies on the reconstitution of a transcription factor, as a result of a proteinprotein interaction, inside the nucleus of the cell. Therefore, in order to study the interactions of fulllength integral membrane proteins, a different system is required. One such system is MYTH, which takes advantage of the reconstitution of two halves of the ubiquitin molecule to act as a sensor of proteinprotein interactions (Paumi, Chuk et al. 2009; Snider, Kittanakom et al. 2010).

Ubiquitin is a 76 amino acid protein that is ubiquitously expressed and highly conserved in all eukaryotic organisms. Ubiquitination is an ATPdependent posttranslational modification where ubiquitin is covalently attached to the lysine residues of the target proteins via its carboxyterminal glycine residue forming an isopeptide linkage. Ubiquitination is important for various cellular processes including protein trafficking, cellcycle regulation, DNA repair, apoptosis, signal transduction, and targeting proteins for degradation by the 26S proteasome.

Ubiquitination can be reversed by ubiquitin specific proteases, also called deubiquitinating enzymes (Kimura and Tanaka 2010). The ubiquitin molecule can be cleaved into two stable moieties (a Cterminal fragment and an Nterminal fragment). These two stable halves can reconstitute into a pseudoubiquitin molecule which can be recognized and cleaved by ubiquitin specific proteases (Johnsson and Varshavsky 1994).

In MYTH (see Figure 4), a protein of interest (called the “bait”) is fused to the C terminal half of ubiquitin (called “C ub ”) and an artificial transcription factor, which consists of the bacterial LexADNA binding domain and the Herpes simplex VP16 transactivator protein.

There are two variants of MYTH. In the traditional MYTH (or tMYTH), the bait is ectopically expressed from a plasmid. In integrated MYTH (or iMYTH), the bait is endogenously tagged within the yeast chromosome, which leaves the bait under the control of its native promoter and helps maintain normal protein expression. The putative interacting proteins (called “preys”) are fused to a modified form of the Nterminal half of ubiquitin. This modified fragment, called

“N ub G”, is produced by introducing an isoleucine (I) to glycine (G) substitution at position 13 of the wildtype "N ub I" fragment, which acts to prevent spontaneous reconstitution of the two halves of ubiquitin. Either specific individual preys or a library of preys derived from cDNA or genomic DNA can be used in MYTH (Snider, Kittanakom et al. 2010).

If a bait and prey interact with each other, the two halves of ubiquitin (N ub G and C ub ) reconstitute to form a fulllength pseudoubiquitin molecule, which is recognized by cytosolic ubiquitinspecific proteases. This results in cleavage of the transcription factor from the bait molecule, allowing it to enter the nucleus and activate reporter genes. For example, the

THY.AP4 and NMY51 yeast strains contain 3 reporter genes: lacZ , HIS3 , and ADE2 . Activation

36 of reporter genes allow yeast to grow on selective medium or change medium colour in presence of Xgal (Snider, Kittanakom et al. 2010).

Prior to use in the MYTH assay baits are validated to verify proper membrane localization and ensure that they do not activate the reporter system in the absence of interacting prey (“selfactivation”). Subcellular localization is determined using fluorescence microscopy.

A YFP (for Yellow Fluorescent Protein) tag can be integrated into the MYTH tag or a standard immunofluorescence protocol using the VP16 or LexA antibody can be used. Absence of self activation is verified using the “N ub G/N ub I” control test. In this test, the bait is transformed with both an interacting N ub I control prey (positive control) and a noninteracting N ub G control prey

(negative control) and grown on selective medium to test for interaction. To successfully pass the N ub G/N ub I test, the bait must interact with the N ub I prey, but should not interact with the

Nub G prey. The specific control prey used varies depending on where the bait is localized. For example, Ost1p fused to N ub G or N ub I is often used as a control prey for baits that go through the secretory pathway and are localized to the plasma or vacuolar membrane. Ost1p is a subunit of the oligosaccharyltransferase complex in the ER lumen, which catalyzes asparaginelinked glycosylation (Snider, Kittanakom et al. 2010).

After completion of MYTH screens, all interacting preys are tested in a bait dependency test to rule out false positives. All preys (or “hits”) are transformed back into the original bait strain of interest as well as into a strain expressing an artificial control bait, and retested for interaction on selective medium. The artificial bait consists of a singlepass transmembrane domain of human Tcell surface glycoprotein CD4, the Matα signal sequence to target it to the plasma membrane, and the MYTH bait tag (C ub VP16LexA). Only interactors that activate the

37 reporter system with the original bait but not with the artificial bait are considered real interactors and kept in the interactome (Snider, Kittanakom et al. 2010).

Figure 4: Overview of MYTH. In MYTH, a protein of interest (called the “bait”) is fused to the C terminal half of ubiquitin (called “C ub ”) and an artificial transcription factor (TF), which consists of the bacterial LexADNA binding domain and the Herpes simplex VP16 transactivator protein. The putative interacting proteins (called “prey”) are fused to a modified form of the Nterminal half of ubiquitin. This modified fragment, called “N ub G”, is produced by introducing an isoleucine (I) to glycine (G) substitution at position 13 of the wildtype "N ub I" fragment, which acts to prevent spontaneous reconstitution of the two halves of ubiquitin. If bait and prey interact with each other, the two halves of ubiquitin (N ub G and C ub ) reconstitute to form a fulllength pseudoubiquitin molecule, which is recognized by cytosolic ubiquitinspecific proteases (DUB). This results in cleavage of the transcription factor from the bait molecule, allowing it to enter the nucleus and activate reporter genes (e.g., HIS3 , ADE2 , lacZ ). This figure is adapted from (Snider, Kittanakom et al. 2010).

1.4.5: Tandem Affinity Purification (TAP) and Mass Spectrometry

Another valuable tool to study proteinprotein interactions of both integral membrane proteins and soluble proteins is Tandem Affinity Purification (TAP) followed by Mass

Spectrometry to characterize proteins (Babu, Krogan et al. 2009). One of the advantages of this method is that the entire collection of TAPtagged yeast strains is commercially available for

38 academic use. The TAP tag consists of two separate affinity purification tags. The first tag is a calmodulinbinding peptide, and the second tag is Staphylococcus aureus protein A. The two tags are separated by a tobacco etch virus (TEV) protease cleavage site. The two tags allow a twostage protein enrichment, which helps to reduce nonspecific bound proteins. The tagged proteins are first purified by binding to immobilized IgG beads. After cleavage with TEV protease, tagged proteins are purified by binding to immobilized calmodulin. The key to studying proteinprotein interactions of integral membrane proteins is to purify them with low concentrations of mild nonionic detergents, such as Triton X100, which solubilize the membrane proteins but do not disturb proteinprotein interactions. After TAP, members of protein complexes are identified by mass spectrometry (Babu, Krogan et al. 2009). We are currently collaborating with Dr. Jack Greenblatt’s lab at the University of Toronto to study proteinprotein interactions of ABC transporters and other integral membrane proteins in S. cerevisiae using TAPmass spectrometry method. The data from TAPmass spectrometry method will complement the proteinprotein interaction results from MYTH and this study.

1.5: Zinc Homeostasis in S. cerevisiae

The results from this thesis have suggested that ABC transporters (Pdr15p and Pdr18p) are possibly involved in zinc homeostasis in S. cerevisiae . Yeast is an excellent model to study zinc homeostasis. There are homologs of yeast zinc transporters in humans, which means that findings from yeast can be easily translated to human physiology and diseases. However, there is a slight difference in the mechanism of zinc storage between yeast and humans. In S. cerevisiae , excess zinc is transported to the vacuole for storage, and released later in zinc limited conditions. In humans, however excess zinc is stored by binding of zinc to cysteine rich proteins called metallothioneins. While there is a S. cerevisiae homolog of human metallothioneins, so far it has been shown to only function in copper tolerance, and not zinc. Despite these

39 differences, a S. cerevisiae model system has greatly enhanced the understanding of zinc homeostasis in humans (Bleackley and Macgillivray 2011).

1.5.1: Importance of Zinc

Zinc is essential to all forms of life and plays an important catalytic and structural role in the function of many proteins, including enzymes such Cu/Zn superoxide dismutase, alcohol dehydrogenase and nonenzymatic zinc finger proteins (Bleackley and Macgillivray 2011; Eide

2011). Recent studies have indicated that zinc may also act as a signalling molecule similar to calcium (Yamasaki, SakataSogawa et al. 2007). The cellular concentration of zinc ranges from

0.1 to 0.5 mM in organisms, which makes zinc the most prevalent trace metal found in the cytoplasm. The zinc ion (Zn 2+ ) is not redox active because it does not exist in multiple valences under physiological conditions. Due to the high electron affinity generated by the charge (2+) and the relatively small ionic radius, zinc ion is a strong Lewis acid (Bleackley and Macgillivray

2011).

Zinc plays an important role in human health and disease. At normal physiological conditions, zinc may play a protective role in Alzheimer’s disease by binding to amyloidβ peptide and causing a conformational change. This prevents the association of amyloidβ peptide with other metals, and stops oxidative damage caused by metal amyloidβ peptide complex. However, high levels of zinc are also dangerous because they may contribute to the formation of plaques in Alzheimer’s disease. Excess zinc may also cause other problems including symptoms of gastrointestinal irritation, fatigue, muscle pain and fever. Zinc is involved in variety of physiological processes and zinc deficiency can lead to various symptoms including alopecia, diarrhea, psychological impairment, male hypogonadism and neurosensory disorders. In addition, zinc plays an important role in the development of the immune system including growth and function of T and B cells, neutrophils, macrophages and natural killer cells.

Host resistance to infections by bacteria and virus can be drastically altered due to zinc deficiency (Bleackley and Macgillivray 2011).

Furthermore, zinc deficiency causes induction of the unfolded protein response, stress and heat shock response (Frey and Eide 2011; Wu, Frey et al. 2011). Zinc deficiency also causes alteration in metabolic pathways involved in phospholipid synthesis and cell wall function (Eide

2009). Zinc deficiency increases the production of reactive oxygen species and oxidative damage in mammalian cells and zinc deficiency may also play a role in progression of cancer.

Interestingly, S. cerevisiae also shows an increase in reactive oxygen species in zinclimiting conditions, and thus, is an excellent model to study zinc homeostasis. There are several mechanisms to control zinc levels inside the cell, which include zinc uptake, zinc efflux from the cell, sequestration within organelles, and zinc binding by proteins such as metallothionein

(Eide 2011).

1.5.2: Zap1p Transcription Factor

Zap1p is a transcription factor that plays an essential role in zinc homeostasis in S. cerevisiae . Zap1p is a zincresponsive transcriptional activator, which is active only in zinc limited cells and repressed in zincreplete cells. The activation domains of the Zap1p transcription factor bind zinc, which results in a conformational change and the inability of

Zap1p to recruit coactivator proteins for transcription initiation. Interestingly, Zap1p controls its own expression via positive autoregulation. The Zap1p protein is 880 amino acids long (Eide

2009).

Zap1p transcription factor contains seven zinc finger motifs, and it is made up of two independently regulated activating domains (AD) and a DNA binding domain (DBD) (Bird,

EvansGalea et al. 2000). Although there is no known zinc binding motif in AD1, it can bind zinc in vitro . It is suggested that binding of zinc to AD1 promotes an interaction of AD1 with

41 the DBD such that it inactivates the function of AD1 (Herbig, Bird et al. 2005). Similarly, zinc binding to two zinc fingers motifs in AD2 leads to an interaction between the two fingers and this prevents AD2 from recruiting coactivators for transcription activation (Wang, Feng et al.

2006). Interestingly, activation of specific genes by Zap1p can vary depending on zinc concentration and time. A given gene may be induced or not depending on the severity of zinc deficiency and duration. For example, under moderate zinc deficiency, Zap1p binds to the high affinity activating zinc responsive elements (ZREs) in the ZRT2 gene, which induces ZRT2 expression. However, if the zinc deficiency becomes more severe, Zap1p autoactivates itself resulting in higher levels of Zap1p and binding to low affinity repressive ZREs in the ZRT2 gene, which prevents ZRT2 expression (Eide 2009).

Zap1p regulates expression of more than 80 genes by binding to ZREs in the promoters of target genes. These target genes include zinc transporters responsible for uptake at the plasma membrane (Zrt1p, Zrt2p, Fet4p), transporters involved in vacuolar storage and release of zinc

(Zrc1p, Cot1p, Zrt3p), antioxidant enzymes ( TSA1 ), genes implicated in oxidative stress and resistance (UTH1 ), a cytosolic isoform of catalase ( CTT1 ), and genes involved in sulfate assimilation ( MET3 , MET14 , and MET16 ) (Eide 2011). Tsa1p and Ctt1p play an important role in protecting cells against reactive oxygen species produced under low zinc conditions (Eide

2009). Under low zinc conditions, repression of sulfate assimilation results in an increase in availability of NADPH for oxidative stress tolerance (Eide 2009). Overall, Zap1p plays an essential role in the zinc homeostasis, and in the proactive strategy of oxidative stress resistance inducing expression of antioxidant enzymes that protect the cell from the oxidative stress under zinc deficiency (Bleackley and Macgillivray 2011; Eide 2011).

Alcohol dehydrogenases are among the most abundant zincbinding proteins in the cell.

Two zincdependent alcohol dehydrogenase genes ( ADH1 and ADH3 ) are repressed by Zap1p

42 under lowzinc conditions, which provides substantial amounts of zinc for other purposes.

Zap1p also activates irondependent alcohol dehydrogenase gene ( ADH4 ) to conserve zinc for other biological processes. However, there is evidence that Adh4p may also bind zinc (Eide

2009). Zap1p also induces expression of UTH1 , which is a mitochondrial protein that plays an essential role in mitochondria degradation by autophagy. Degradation of mitochondria may aid by providing a source of zinc under zinclimiting conditions (Eide 2009). Interestingly, Zap1p targets several genes involved in cell wall function, which indicates that cell wall remodeling occurs in low zinc conditions. Zap1p also upregulates genes involved in vacuolar protein degradation to aid in the removal of damaged proteins that may accumulate in zinclimiting conditions (Eide 2009).

1.5.3: Zinc Transporters

S. cerevisiae has two specific zinc transporters at the plasma membrane responsible for zinc uptake. Zrt1p is the high affinity zinc transporter which is active in zinc deficient cells

(Zhao and Eide 1996). Zrt2p is a low affinity zinc transporter which is active in zinc replete cells and its expression is time, temperature and concentration dependent (Zhao and Eide 1996) .

In zinc replete conditions, Zrt1p levels drop rapidly via zincinduced endocytosis and the protein is degraded in the vacuole (Gitan, Luo et al. 1998). This rapid inactivation of Zrt1p protects cells from over accumulation of zinc during extreme shifts from low zinc to high zinc medium, whereas, the transcriptional control regulates the response to moderate shifts in zinc levels (Eide

2003). Fet4p is a low affinity iron transporter at the plasma membrane that plays a major role in iron, copper and zinc uptake (Waters and Eide 2002). Zap1p induces expression of ZRT1 , ZRT2 and FET4 under zinclimiting conditions. Zrt1p has the highest affinity for zinc and it is the major transporter in zinclimiting conditions (Eide 2009). Pho84p is a phosphate transporter that has also been suggested to uptake zinc in ZnPO 4 form (Jensen, AjuaAlemanji et al. 2003).

Additionally, Msc2p and Zrg17p are members of the cation diffusion facilitator (CDF) family of zinc transporters in S. cerevisiae . Both proteins form a heteromeric complex that transport zinc into the endoplasmic reticulum (ER) and play a major role in maintaining ER function. ZRG17 is induced under low zinc conditions by Zap1p transcription factor. ZnT5 and

ZnT6 (for zinc transporter) are human orthologues of MSC2 and ZRG17 and reside in the ER where they play an essential role in maintaining zinc levels in the secretory pathway (Wu, Frey et al. 2011).

The vacuole is a major site of zinc storage, and excess zinc in zincreplete conditions is stored in the yeast vacuole via the Zrc1p and Cot1p transporters located in the vacuolar membrane (MacDiarmid, Gaither et al. 2000; Simm, Lahner et al. 2007). The vacuolar membrane also contains Zrt3p, which in induced under low zinc conditions by Zap1p, to transport zinc from the vacuole into the cytoplasm (MacDiarmid, Gaither et al. 2000).

Interestingly, in zinc limited conditions, Zap1p also induces the expression of the ZRC1 gene as a proactive mechanism to protect cells against a possible massive influx of zinc ions (called zinc shock) resulting from the activation of Zrt1p (MacDiarmid, Milanick et al. 2003). Cot1p also plays an important role in tolerance against zinc shock (Simm, Lahner et al. 2007). Figure 5 shows localization of various zinc transporters in S. cerevisiae.

Figure 5: Overview of zinc transporters in S. cerevisiae . Zap1p is the transcription factor in the nucleus. Zrt1p and Zrt2p are members of ZIP family and are responsible for zinc uptake at the plasma membrane. Zrt3p is also a member of ZIP family and it transports zinc from vacuole into the cytoplasm. Zrc1p and Cot1p are members of CDF family and transport zinc from the cytoplasm into the vacuole for storage. Zrg17p and Msc2p form a heteromeric complex and transport zinc into the endoplasmic reticulum. Fet4p is an iron transporter at the plasma membrane that also transports zinc. Pho84p is a phosphate transporter at the plasma membrane that may also transport zinc. PM stands for Plasma Membrane, V for Vacuole, P for Peroxisome, M for Mitochondria, N for Nucleus, and ER for Endoplasmic Reticulum. This figure is adapted from (Eide 2006).

Zrt1p, Zrt2p and Zrt3p belong to the ZIP (Zrt, Irtlike Protein) family, which is named after the yeast Zrt1p zinc transporter and the Arabidopsis Irt1p iron transporter. This family of proteins is responsible for transport of zinc or other metal ions from the extracellular space or organelles into the cytoplasm. ZIP family transporters are found in all organisms. The structure of most ZIP family proteins is usually 8 transmembrane domains with both amino and carboxyl termini of the protein located on the extracytoplasmic face of the membrane (see Figure 6).

Most ZIP family proteins contain a long cytoplasmic loop region between transmembrane domains 3 and 4, which includes a histidine rich sequence. Although the function of this

45 cytoplasmic loop is unknown, this domain has the potential to serve as a metal binding site and may play a role in the regulation of the transporter. The mechanism of transport for ZIP family proteins is unknown, however, the transporter function of many ZIP proteins is energy dependent (Eide 2006).

Figure 6: Structure of ZIP transporters. There are 8 transmembrane domains (numbered on the figure). Both amino (N) and carboxyl (C) termini are in the extracellular space or lumen of the organelle. There is a cytoplasmic loop with a histidine rich domain between transmembrane domains 3 and 4 in most ZIP transporters. ZIP transporters transport zinc or other metal ions from the extracellular space or organelles into the cytoplasm. This figure is adapted from (Eide 2006).

Zrc1p, Cot1p, Msc2p and Zrg17p belong to the CDF (Cation Diffusion Facilitator) subfamily. The mammalian members of the CDF subfamily are named ZnT (for Zinc

Transporter). CDF subfamily proteins transport zinc or other metal ions from the cytoplasm into organelles or outside the cell. They work in opposition to ZIP family transporters. CDF family proteins are found in all life forms. Most CDF family proteins contain six transmembrane domains and many have a histidinerich motif in the cytoplasmic loop between transmembrane domains 4 and 5 (see Figure 7). The cytoplasmic domain has the ability to bind metals during

46 transport. Many CDF proteins function as homo or heteromeric complexes. For example,

Msc2p and Zrg17p form a heteromeric complex in the yeast. Most CDF transporters are secondary active transporters and use the gradient of other ions to transport zinc. For example, the yeast Zrc1p is a zincproton antiporter (Eide 2006).

Figure 7: Structure of CDF transporters. Most CDF family proteins contain six transmembrane domains. Additionally, many CDF proteins have a histidinerich motif in the cytoplasmic loop between transmembrane domains 4 and 5. CDF transporters transport zinc or other metal ions from the cytoplasm into organelles or outside the cell. This figure is adapted from (Eide 2006).

1.6: Thesis Rationale

ABC transporters play an important role in human physiology and disease. ABC transporters are also essential for multidrug resistance in certain cancers and pathogenic microorganisms. Therefore, it is crucial to understand the structure, mechanism of transport, function and regulation of ABC transporters. Investigating proteinprotein interactions of ABC transporters will provide new insight into the pathways and cellular processes in which ABC transporters are involved. S. cerevisiae is an excellent model to study the proteinprotein

47 interactions of ABC transporters because there are yeast homologs of ABC transporters linked to human diseases and multidrug resistance, and tools like MYTH are available to study the proteinprotein interactions of full length membrane proteins in vivo . The interactome of Nft1p,

Pdr10p, Pdr18p and Vmr1p described in this thesis is a subset of a larger proteinprotein interactome generated from screening all S. cerevisiae ABC transporters that could be screened using the MYTH technology. The proteinprotein interactome will provide new information about the function of S. cerevisiae ABC transporters that are not well studied, such as Nft1p.

Additionally, we hope the findings from the proteinprotein interactome of S. cerevisiae ABC transporters generated using MYTH will be easily translated into human physiology and diseases, and will provide new insight into development of new therapeutics.

Chapter 2: Materials and Methods

2.1: General Experimental Protocols

List of yeast strains used during the experiments, media recipes, antibiotic recipes, and chemical solution recipes are listed in Appendix 1.

2.1.1: PCR Amplification

PCR amplifications were done with Phusion flash highfidelity PCR master mix from

Thermo Scientific/Finnzymes. The following were mixed for a single 50 L PCR reaction: 25

L of Phusion master mix, 22 L of sterile water, 1 L of 50 M forward primer, 1 L of 50 M reverse primer and 1 L of template. The reaction mixture was scaled up or down if more or less

PCR product was needed for downstream purposes. The PCR program included initial heating at

98 °C for 5 minute, followed by 35 cycles of denaturing (98 °C for 1 minute), annealing (55 °C for 1 minute), and extension (72 °C for 5 minutes). After 35 cycles, the final extension was done at 72 °C for 10 minutes and then the reaction was put on hold at 4 °C. The annealing temperature was adjusted if PCR failed or multiple PCR products were found in the reaction.

Following completion of PCR reaction, PCR products were visualized on 0.8% agarose gel.

2.1.2: DNAAgarose Gel Electrophoresis

0.8% agarose gel was made by adding 0.4 g of agarose in 50 mL 1X TAE solution and heating in the microwave till agarose dissolved (normally 1.5 minutes). 2.5 L of SYBR safe

DNA gel stain per 50 mL was added to the agarose solution to visualize the DNA. Normally, 5

L of DNA was mixed with 1 L of 6X loading dye and run on gel in 1X TAE solution for 35 minutes at 100 V. 3 L of Thermo Scientific GeneRuler DNA ladder Mix (usually SM0331) was loaded with samples. Afterwards, the gel was visualized under a UV source provided by

BioRad Gel Doc. The reaction was scaled up if more DNA needed to be run on gel (e.g., for purifying plasmid after cutting with restriction enzyme).

2.1.3: Standard Lithium Acetate Yeast Transformation

Previously published standard lithium acetate yeast transformation method was adapted in this study (Gietz and Woods 2006). A single colony of the appropriate strain was used to start a 4 mL overnight culture at 30 °C with shaking in the appropriate growth medium. The following day, OD 600 of the overnight culture was measured using a spectrophotometer. The overnight culture was diluted to OD 600 = 0.15 in 25 mL of appropriate growth medium. The diluted cells were then grown at 30 °C with shaking until OD 600 = 0.5 to 0.7. This normally took

4 to 6 hours.

The cells were spun down at 700 x g for 5 minutes, and the supernatant was removed.

The cell pellet was washed and gently resuspended in 40 mL of sterile doubledistilled water.

The cells were spun down again at 700 x g for 5 minutes, and the supernatant was removed. The cells were then resuspended in 1 mL of sterile doubledistilled water. 100 L of the resuspended cells, transformation master mix, and DNA were added to a sterile 1.5 mL microfuge tube.

Transformation master mix for a single transformation reaction consisted of 240 L 50% PEG

3350, 36 L 1M lithium acetate, and 25 L ssDNA. The volume of DNA differed depending on the source: 1 L of E. coli miniprep, 10 L of yeast miniprep, 10 L of PCR product, and 10 L of cut purified plasmid were used.

The cell, transformation master mix, and DNA content inside the microfuge were mixed by vortex and incubated in a 30 °C water bath for 30 minutes. Afterwards, the cells were heat shocked in a 42 °C water bath for 30 to 60 minutes. After heat shock, the cells were spun down at 3700 x g for 10 minutes. The supernatant was removed and the cell pellet was resuspended in

100 L of sterile doubledistilled water and plated onto appropriate selective medium. The cells

51 were then grown at 30 °C until colonies appeared (normally 3 days). The same protocol was adjusted for doing multiple yeast transformations in a 96well plate.

2.1.4: DTT Method for Yeast Transformation

A single colony of the appropriate strain was used to start a 3 mL overnight culture at 30

°C with shaking in the appropriate growth medium. For a single transformation, cell pellet from

250 L overnight culture, 10 L of 1 M DTT, 10 L of 2 M lithium acetate, 10 L of 2 mg/mL ssDNA, 80 L 50% PEG 3350, and appropriate volume of DNA were added to a sterile 1.5 mL microfuge tube. The volume of DNA differed depending on the source: 1 L of E. coli miniprep,

10 L of yeast miniprep, 5 L of PCR product, or 5 L of cut purified plasmid was used.

After mixing with vortex, cells were immediately heat shocked in a 42 to 45 °C water bath for 30 minutes. Afterwards, cells were spun down at 700 x g for 5 minutes. The supernatant was removed, and cells were resuspended in 100 L of sterile doubledistilled water or 0.9% sodium chloride solution. Resuspended cells were plated onto appropriate selection medium, and grown at 30 °C until colonies appeared (normally 3 days). The same protocol was adjusted for doing multiple yeast transformations in a 96well plate.

2.1.5: Yeast Integration Transformation

A colony of yeast strain of interest was grown overnight at 30 °C with shaking in 4 mL of appropriate growth medium. The following day, OD600 of the overnight culture was measured.

Cells were diluted to OD 600 = 0.15 in a 25 mL of appropriate growth medium. Cells were then grown at 30 °C with shaking until OD 600 = 0.5 to 0.8 (usually took 4 to 5 hours). After reaching the correct OD 600 , cells were spun down at 700 x g for minutes. The supernatant was removed, and the cell pellet was gently washed with 40 mL of sterile doubledistilled water. Cells were

52 spun down again at 700 x g for 5 minutes. The supernatant was removed, and the cells were resuspended in a 1 mL of sterile doubledistilled water.

For a single transformation, 100 L of cells, 20 L of PCR product, and 300 L of transformation master mix was added to a sterile 1.5 mL microfuge tube. Transformation master mix for a single transformation consisted of 240 L 50% PEG 3350, 36 L 1M lithium acetate, and 25 L ssDNA. Cell and transformation solution was mixed with vortex and incubated in a

30 °C water bath for 30 minutes. Afterwards, cells were heat shocked in a 42 °C water bath for

30 to 60 minutes. Cells were spun down at 3700 x g for 10 minutes. The supernatant was removed, and the cell pellet was resuspended in 1 mL of appropriate growth medium, and then transferred to a sterile 14 mL culture tube containing an additional 3 mL of appropriate growth medium. The cells were grown overnight at 30 °C with shaking. The following the day, cells were spun down at 700 x g for 5 minutes. The supernatant was removed, and the cell pellet was resuspended in 100 L of sterile doubledistilled water. The entire cell mixture was plated onto appropriate selective medium (e.g., YPAD + G418), and grown at 30 °C until colonies appear

(usually 3 to 4 days).

2.1.6: Yeast and E. coli Miniprep

A single colony of yeast strain carrying the plasmid of interest was grown overnight at

30 °C with shaking in 5 mL of appropriate selective medium. The following day, cells were spun down at 700 x g for 5 minutes. The supernatant was discarded, and the remaining pellet was resuspended in 100 L of resuspension buffer from Bio Basic Inc. miniprep kit in a sterile

1.5 mL microfuge tube. 100 L of fine glass beads were added to the cells, and cell beads mixture was vortexed at maximum speed for 5 minutes to disrupt the yeast cell wall. Afterwards, the standard miniprep protocol provided with Bio Basic Inc. miniprep kit was followed. If the

53 plasmid of interest was in a E. coli strain, the same protocol was used except the cells were grown at 37 °C with shaking, and the cell wall disruption step with the glass beads was omitted.

Miniprep was stored at 20 °C until further use.

2.1.7: Yeast and E. coli Miniprep in a 96well Format

1.2 mL of appropriate selective medium was added to each well of the sterile 96well block. A single colony of yeast was added to each well. The cells were grown at 30 °C with shaking for 2 days. The 96well block was spun down at 700 x g for 5 minutes. The supernatant was discarded, and 125 L of cell wall disruption solution was added to each well to resuspend the pellet. Cells were transferred to 37 °C incubator for 2 hours. Afterwards, the 96well block was spun down at 1000 x g for 10 minutes. The supernatant was removed, and the cell pellets were used for miniprep using the 96well miniprep kit from Nucleospin. The same protocol was used for E. coli miniprep in a 96well, except the cells were grown at 37 °C with shaking, and the cell wall disruption step was omitted. Miniprep was stored at 20 °C until further use.

2.1.8: Genomic DNA

A single colony of yeast of interest was grown overnight at 30 °C with shaking in 5 mL of appropriate growth (or selective) medium. The following day, cells were spun down at 700 x g for 5 minutes. The supernatant was discarded, and the remaining pellet was used for genomic prep using the Epicentre MasterPure Yeast DNA Purification Kit. Genomic prep was stored at

20 °C until further use.

2.1.9: Competent E. coli Preparation Using Inoue Method

Competent E. coli were prepared using the Inoue method (Inoue, Nojima et al. 1990). A fresh XL10 gold E. coli strain was streaked onto LB medium plate from glycerol stock, and grown overnight at 37 °C. The following day, a single colony was inoculated into 25 mL of LB

54 medium and grown at 37 °C for 6 hours. OD 600 of cell culture was measured using a spectrophotometer. Cells were diluted to OD 600 = 0.03 in a 250 mL LB culture, and grown overnight at 18 °C until OD 600 = 0.35 to 0.4. The cells were chilled on ice for 10 minutes, and then centrifuged at 3700 x g for 5 minutes at 4 °C. The supernatant was removed, and the pellet was resuspended in 80 mL of cold Inoue buffer and placed on ice for 5 minutes. Cells were centrifuged at 3700 x g for 5 minutes. The supernatant was removed, and pellet was gently resuspended in 20 mL of cold Inoue buffer. DMSO was added to a final concentration of 7%

(1.5 mL in 20 mL cell mixture) while gently swirling the cells. The cells were placed on ice for

10 minutes. Afterwards, cells were transferred to appropriate containers, flash freeze with liquid nitrogen, and stored at 80 °C.

2.1.10: E. coli Transformation

1 L of miniprep from E. coli , or 10 L of miniprep from yeast was added to 100 L of competent XL10 gold E. coli cells in a sterile 1.5 mL microfuge tube. The cells were placed on ice for 30 minutes. Afterwards, cells were heat shocked in the 42 °C water bath for 2 minutes.

Cells were then placed on ice for additional 2 minutes. 900 L of LB medium was added to the microfuge tube, and cells were placed in the 37 °C incubator with shaking for 1 to 3 hours for recovery. Cells were centrifuged at 10,000 x g for 5 minutes, and 900 L of supernatant was removed. The pellet was resuspended in the remaining medium, and all cells were plated onto the appropriate agar selection plate. The cells were placed in the 37 °C incubator for 1 day till colonies appeared. The same protocol was adapted to do multiple transformations at the same time in a sterile 96well plate.

2.1.11: Glycerol Stock Preparation for Yeast and E. coli

Overnight culture of the strain of interest was grown in the appropriate medium at 30 °C

(for yeast) or 37 °C (for E. coli ). 800 L of overnight culture, and 200 L of 80% glycerol was added to a 1 mL sterile tube. The final concentration of glycerol was 16%. The cell glycerol mixture was mixed by vortex, and stored at 80 °C.

2.1.12: Sequencing DNA from TCAG/BioBasic

For TCAG, 3 L of DNA ( E. coli miniprep OR PCR product), 4 L of sterile double distilled water, and 0.7 L Sequencing primers (dilute 50 M primer 1:7 in sterile double distilled water) were mixed together in a microfuge tube or a 96well plate. For BioBasic, 10 L

DNA and 1 L of sequencing primer were mailed in separate tubes. PCR products were first purified using Invitrogen PureLink PCR Purification Kit. The sequencing data was analyzed using NCBI Blast tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.1.13: FM464 Staining for Fluorescence Microscopy

4 L of 500 g/mL FM464 dye from Invitrogen (dissolved in water) was added to 100

L of live cells. The final concentration of the dye was 20 g/mL. Cells were incubated at 30 °C with shaking for 1 hour. Afterwards, cells were centrifuged and the pellet was washed twice with 100 L of fresh medium. Signal was visualized with a fluorescence confocal microscope.

2.2: Bait Generation

2.2.1: Primer Design for Baits

All MYTH related materials and methods, including primer design, are summarized in detail in a published article on MYTH protocols (Snider, Kittanakom et al. 2010). Primers were designed to amplify ORF of NFT1 , PDR10 , PDR18 , and VMR1 for cloning into AMBV and

AMBVYFP bait plasmids. The forward primer consisted of 3540 bases of plasmid homology

56 region at the 5’ end, followed by Kozak sequence (5’AACACA3’) for optimal translation, and then the first 1820 bases for gene of interest at the 3’ end. The reverse primer consisted of 35

40 bases of plasmid homology region at the 5’ end, and the reverse complement of the last 18

20 bases at 3’ end. However, the reverse primer omitted the natural stop codon of the gene of interest. The primers were double checked to ensure that after homologous recombination, the

Cub LexAVP16 MYTH tag was in frame with the gene of interest. For NFT1 , separate primers were designed to amplify YKR103W and YKR104W ORFs, such that the overlapping region from the two PCR products changed the natural stop codon (TAG) to tyrosine residue (TAT) at codon 1219 to clone the fulllength NFT1 gene on the AMBV bait plasmid after gaprepair homologous recombination. The primer sequences are listed in Table 1.

Table 1: Primer Sequences for Amplification of ORF of Baits for Cloning into AMBV and AMBVYFP Plasmids

ID Purpose Sequence (5’ to 3’) JS304 YKR103W TGCACAATATTTCAAGCTATACCAAGCATACAATCAACTCCAAGCAA Forward CACAATGATAAAAAATGGTACATGCCCC JS305 YKR103W CCCCGCTAGCCCCGCATCCAAATATGAGGCCTTCATTATGATC Reverse JS306 YKR104W GATCATAATGAAGGCCTCATATTTGGATGCGGGGCTAGCGGGG Forward JS307 YKR104W TCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGATTCTTTTAT Reverse TATCGAATGAGAC JS302 PDR10 TGCACAATATTTCAAGCTATACCAAGCATACAATCAACTCCAAGCAA Forward CACAATGTTGCAAGCGCCCTCAAG JS119 PDR10 TCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGATTTTCTTTA Reverse ATTTTTTGCTTTTC

JS303 PDR18 TGCACAATATTTCAAGCTATACCAAGCATACAATCAACTCCAAGCAA Forward CACAATGGAATGCGTTTCAGTAGAAG JS121 PDR18 TCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGATAATGAAA Reverse CCGAAGTTTCTCCATAAG JS301 VMR1 TGCACAATATTTCAAGCTATACCAAGCATACAATCAACTCCAAGCAA Forward CACAATGGGAACGGATCCCCTTATTATC JS117 VMR1 TCGACGGTATCGATAAGCTTGATATCGAATTCCTGCAGATTTTCATCA Reverse TCTTACTTGATT

2.2.2: Cutting AMBV and AMBVYFP Plasmids with Restriction Enzymes

E. coli strains carrying AMBV and AMBVYFP plasmids were streaked onto LB + kanamycin plates and grown overnight at 37 °C. The plasmids were isolated using E. coli miniprep protocol. Plasmids were cut using StuI restriction enzyme (5’ AGG^CCT 3’). 5 L of

10X Buffer B (Fermentas), 2 L of StuI restriction enzyme (Fermentas), 20 L of plasmid miniprep, and 23 L of sterile doubledistilled water were mixed in a sterile 1.5 mL microfuge tube. The DNA and restriction enzyme mixture was placed in the 37 °C incubator for about 4 to

5 hours.

The cut plasmid was then loaded and run on 0.8% DNA agarose gel. The DNA band was removed under a UV source, and placed in a new sterile 1.5 mL microfuge tube. Plasmid DNA was purified from gel using Invitrogen PureLink Quick Gel Extraction Kit.

2.2.3: ORF Amplification, Gap Repair Homologous Recombination and ORF Sequencing

Genomic DNA from wildtype L40 or THY.AP4 MYTH reporter strain was used as a template for amplification of NFT1 , PDR10 , PDR18 , and VMR1 for cloning into AMBV and

AMBVYFP plasmids. PCR products and purified cut AMBV or AMBVYFP plasmids were used in yeast transformation for gap repair homologous recombination to generate baits.

THY.AP4 strain was used for cloning Nft1p, Pdr18p and Vmr1p baits; and NMY51 strain was used for cloning Pdr10p bait. All YFP fused baits were cloned in NMY51 strain, except Pdr18p fused with YFP was cloned in three strains, THY.AP4, L40 and NMY51.

After yeast transformation, colonies were picked and grown overnight for glycerol stock preparation and yeast miniprep. Nft1p and Vmr1p baits were transformed into E. coli strain for plasmid amplification. Pdr10p and Pdr18p baits did not transform into E. coli strain, possibly due to toxicity. Nft1p and Vmr1p bait plasmids were isolated using E. coli miniprep, and

58 sequenced to verify the correct sequence of ORF. Pdr10p and Pdr18p bait plasmids were isolated using Yeast miniprep, amplified using PCR (JS12 and JS263 primers), and sequenced to verify the correct sequence of ORF. ORF sequences from SGD ( Saccharomyces cerevisiae database) (Cherry, Hong et al. 2012) were used as reference during the NCBI Blast analysis. 18 to 20 base pairs internal primers were designed to sequence the entire ORF of NFT1 , PDR10 ,

PDR18 , and VMR1 . The primer sequences are listed in Table 2.

Table 2: Primer Sequences for Verifying ORF of Baits

Gene ID Orientation Sequence (5’ to 3’) Common Primers JS12 Reverse GCCGTTAACGCTTTCATGC JS263 Forward GACTACACCAATTACACTGCCTC NFT1 JS34 Forward TCGTGCATCTAGAGAGTTGAAGAG JS59 Reverse GCTGGAGGTGATATGTAGCC JS88 Reverse GGAAAATCCTCCATCACCCACG JS89 Forward GACAGCTGGCATAAGAACAGAC JS92 Forward TAAGCGTGATTTATGGGCTG JS93 Forward GCTCGTCAGTAAAATCATTGC JS94 Forward CGTGTAATAAAGCTACTGGCATG JS95 Forward ATTCATGGAATCACACTGTCTC JS96 Forward TCTATAAGCTGCATCCCACAGG JS311 Reverse CAGGGATGCATATGAGTAAAACG PDR10 JS173 Reverse AGCATTGGCCAGTCCTACCG JS174 Reverse AATGGCCAGCATTTGATTCTG JS175 Reverse TGGCAGCTAACTCCACACC JS176 Reverse TTGAGACGCAGAAGATGAAG JS177 Reverse GCAAACCCAGTGTACATTGC JS178 Reverse AATGTTTGTTCACCTGCACC JS179 Reverse GACACCCTTGATTCGGTTCC JS180 Reverse ACTAGCGAAAATTGACCGGC PDR18 JS189 Reverse ACTTGACCTAGAGGCTTCGG JS190 Reverse TGTTGAACAGAAGCGGTGGC JS191 Reverse ACTAGCGTCCATTGGGAGAC JS192 Reverse TTCAAACCCAGGTCCAGAAG JS193 Reverse TTGCTCCCAATAAGAGACCG JS194 Reverse CACCTCCAGATACACCGCTG VMR1 JS181 Reverse GTACCTGCAAATAGAATAGGGTC JS182 Reverse GAATGCGCCAATCATGTCGAC JS183 Reverse TCATCCCTTTTAATGGCAGC JS184 Reverse ACTCGAATAAACAGCTCTCGCC JS185 Reverse ATTTGATAATTGATCCAGGGGTG JS186 Reverse AACAGCCTCCTACGTAAGCC JS187 Reverse TCTGTGAGGGTACATCATCG JS188 Reverse TGCGAAAATGCCAATTGAGG

2.3: Bait Validation: N ub G/N ub I Test

The bait strain was transformed individually with Ost1pNub I prey and Ost1pNub G prey plasmids, and grown on transformation selection medium (SDWL). After colonies appeared, three individual colonies from each transformation were resuspended in 100 L of sterile doubledistilled water. Cells were spotted on transformation selection medium (SDWL), interaction selection medium (SDWLAH), and interaction selection medium containing Xgal

(SDWLAH + Xgal) using either a pintool or multichannel pipette (2 L). The plates were put in the 30 °C incubator for 3 to 5 days. The growth of bait strain transformed with N ub I positive control was compared with the corresponding N ub G negative control. Baits were considered suitable for screening if they did not selfactivate the reporter system. A bait suitable for MYTH screening only grows on interaction selection medium when transformed with the positive N ub I prey, and does not grown on interaction selection medium when transformed with the negative

Nub G prey.

2.4: Bait Localization using Fluorescence Microscopy

A single colony from the yeast strain expressing baitYFP plasmid was used to start a 3 mL overnight culture at 30 °C with shaking in SDL liquid medium. The following day, OD 600 of the overnight culture was measured using a spectrophotometer. The overnight culture was diluted to OD 600 = 0.15 in 5 mL of SDL. The diluted cells were then grown at 30 °C with shaking until OD 600 = 0.5 to 0.7. This normally took 4 to 6 hours. Strains expressing Nft1pYFP, and Vmr1pYFP plasmids were also stained with FM464 dye for vacuolar membrane staining.

Afterwards, 2 L of cells were spotted on the VWR Goldline microscope slide and covered with

VWR 22 X 50 mm micro glass. The fluorescence signal was visualized under a fluorescence confocal microscope equipped with GFP and RFP lasers using a 63X lens, and pictures were

60 taken in Zstack (9 slices of 0.3 m) with a microscope camera. Pictures were cropped and merged using GIMP 2 software.

2.5: Testing Bait Function

THY.AP4 strain was transformed with an empty AMBV plasmid. nft1 ∆ strain was transformed with either an empty AMBV plasmid or Nft1p bait. vmr1 ∆ strain was transformed with either an empty AMBV plasmid or Vmr1p bait. nft1 ∆ and vmr1 ∆ strains in THY.AP4 background were previously generated and confirmed by members of Dr. Stagljar’s lab.

3 colonies of each strain were spotted onto SD minus leucine medium with or without cadmium chloride (final concentration was 200 M cadmium chloride). Plates were transferred to 30 °C incubator for 3 to 4 days. Pictures were taken with a camera, and growth on medium with cadmium chloride was compared between strains to assess whether bait plasmid can complement the deletion mutant phenotype. SD minus leucine medium without cadmium chloride was a control for growth.

2.6: Large Scale MYTH Transformation with cDNA and Genomic Libraries

Previously published MYTH transformation protocol was followed in this experiment

(Snider, Kittanakom et al. 2010). Yeast expressing bait plasmids were streaked onto SDL medium plate, and grown at 30 °C incubator for 3 days. A single yeast colony was inoculated in

5 ml SDL medium, and grown overnight at 30 °C incubator with shaking. The following day

OD 600 was measured using a spectrophotometer. The cells were diluted to OD 600 = 0.15 in 20 mL of SDL medium and grown at 30 °C with shaking until approximately OD 600 = 0.6

(normally around 5 hours). Cells were diluted again to OD 600 = 0.00075 in 200 mL of SDL medium, and grown at 30 °C incubator overnight until OD 600 = 0.6.

The following day “lithium acetate/TE solution” was prepared by mixing 1.1 mL of 1 M lithium acetate, 1.1 mL of 10X TE pH 7.5, and 7.8 mL of sterile doubledistilled water. Also,

“PEG/LiOAc solution” was prepared by mixing 1.5 mL of 1 M lithium acetate, 1.5 ml of 10X

TE pH 7.5, and 12 mL of 50% PEG3350. The cell culture was divided into four 50 mL sterile falcon tubes. The cells were centrifuged at 700 x g for 5 min. The supernatant was removed, and the cell pellet was gently washed with 30 mL of sterile doubledistilled water. Cells were centrifuged again at 700 x g for 5 minutes. The supernatant was removed, and each cell pellet was resuspended in 1 mL of “lithium acetate/TE solution”.

Cells were centrifuged at 700 x g for 5 minutes. The supernatant was removed, and the cell pellet was resuspended in 600 L of “lithium acetate/TE solution”. The following were added to a sterile 50 mL falcon tube: 20 L of cDNA NubGx or genomic NubGx library (1 mg/mL), 100 L of ssDNA, 600 L resuspended cells, and 2.5 mL of “PEG/lithium acetate solution”. The cell solution was thoroughly mixed by vortex. Cells were incubated at 30 °C water bath for 45 minutes. Every 15 minutes, cells were mixed gently. Afterwards, 160 L of

DMSO was added to each falcon tube and mixed immediately by shaking. Cells were heat shocked in 42 °C water bath for 20 minutes.

Cells were spun down at 700 x g for 5 minutes. The supernatant was removed, and the cell pellet was resuspended in 3 mL of 2X YPAD. Cells from the four falcon tubes were pooled into a single sterile falcon tube. Cells were grown at 30 °C with shaking for 90 minutes for recovery. Cells were centrifuged at 700 x g for 5 minutes. The supernatant was removed, and the cell pellet was resuspended cells in 4.9 ml of 0.9% sodium chloride solution. 100 L of cells were removed and used to make 1:10, 1:100, and 1:1000 serial dilutions in 0.9% sodium chloride solution. 100 L from each serial dilution was plated onto two separate SDWL 10 cm

62 medium plates. The purpose of this step was to obtain the transformation efficiency of the library. The remaining 4.8 mL of cells were plated onto SDWLAH Qtrays (800 L cells per tray). All plated cells were grown at 30 °C until colonies appeared (usually 5 to 6 days).

Multiple rounds of large scale MYTH yeast transformations were done to obtain a total of at least 2 million transformants. Yeast colonies were picked from SDWLAH medium using an automatic robot, and grown in SDWL liquid medium in a 384 well plate at 30 °C incubator for 2 days. Then yeast colonies were spotted from liquid SDWL medium to solid SDWL medium, and grown for 2 days in the 30 °C incubator. Afterwards, yeast colonies were spotted on SDWLAH + XGal for another round of selection. Successful blue colonies were picked using an automatic robot, and grown on SDW solid medium at 30 °C incubator for 2 days.

Afterwards, colonies were grown in SDW liquid medium in a 96well block for 2 days at 30 °C with shaking for yeast miniprep. Plasmids were amplified by transforming them into E. coli strain. E. coli strains were grown in LB + kanamycin liquid medium for a 96well E. coli miniprep protocol.

2.7: Bait Dependency Test

The prey DNA constructs were transformed into both the original bait strain, and the artificial bait strain, and grown on transformation selection medium (SDWL) at 30 °C. Three individual colonies from each transformation were resuspended in 100 L of sterile double distilled water, and spotted onto transformation selection medium (SDWL), interaction selection medium (SDWLAH), and interaction selection medium with XGal (SDWLAH + X

Gal) using a pin tool or multichannel pipette (2 L). The plates were placed in 30 °C for 3 to 5 days. Plates were photographed with a camera. The growth of specific preys with the original bait versus the artificial bait on interaction selection medium was compared to remove spurious

63 hits. Spurious hits included preys that fail to reproduce growth and blue colour with the original bait strain, or produced growth with both the original and artificial bait. All the spurious hits were removed from the final interactome.

2.8: Prey Sequencing and Identification

All successful hits that passed the bait dependency test were sequenced by mailing DNA to BioBasic Inc. or TCAG sequencing. The hits were identified and checked whether they are in frame with the MYTH tag by Vira Ultimate software, which is a Blast analysis tool especially designed for MYTH screening by Dr. Jamie Snider in Dr. Stagljar’s lab.

The visual interactome was made in Cytoscape software (Smoot, Ono et al. 2011). GO

Analysis enrichment analysis was done using Funspec database (Robinson, Grigull et al. 2002).

Human homologs were found using InParanoid Database (Ostlund, Schmitt et al. 2010). If multiple human homologs existed, only the top homolog was listed in the results section. Online

Mendelian Inheritance in Man (OMIM) database was used to find if any human homologs are associated with a human disease (McKusick 1998). Previously reported physical and genetic interactions were found using BioGRID database (Stark, Breitkreutz et al. 2011) and SGD database (Cherry, Hong et al. 2012).

2.9: Confirmation of Deletion Mutants

pdr5 ∆, pdr10 ∆, pdr15 ∆ and pdr18 ∆ strains in Y7092 background, and zrc1 ∆ strain in

BY4741 background were obtained from Dr. Boone’s lab at University of Toronto. The deletion was confirmed using PCR. PCR primers homologous to upstream and downstream regions of the native ORF were designed to amplify the native ORF or the deletion cassette. The size of the

PCR product was used to determine whether the native ORF or the deletion cassette was present in the strain. The primer sequences are listed in Table 3.

Table 3: Primer Sequences for Confirmation of Deletion Mutants

Primer ID Gene/Orientation Sequence (5’ to 3’) JS202 PDR5 Forward ATGTCTCCGCGGAACTCTTC JS201 PDR5 Reverse AGACGGTTCGCCATTCGGAC JS334 PDR10 Forward GTACTACTACAGAATTGGTCGGCAT JS335 PDR10 Reverse TCACTGCAGATGTTAATAGATCCAA JS328 PDR15 Forward GAGGGAAAAGAATACTGCTACTGCT JS329 PDR15 Reverse GAATAATCCAGTTCGACTCTGAAAA JS716 PDR18 Forward GACGGCGATACGGAATTGAG JS717 PDR18 Reverse CACCTGCACCCATAGTATACC JS394 ZRC1 Forward CTGGTCAACCTTAAAGAAACAAAAA JS395 ZRC1 Reverse AGACATAAAAACGCTATTCTGGATG

2.10: Estimating Free Zinc Ion Concentration in ZincReplete and ZincLimited Media

Free zinc ion concentration was estimated using the MaxChelator program (available at http://www.stanford.edu/~cpatton/webmaxc/webmaxcS.htm ) (Patton, Thompson et al. 2004).

Temperature was set to 30 °C for both zincreplete and zinclimited media calculations. pH was set to 4.60 for zincreplete medium, and 4.63 for zinclimited medium. Ionic strength setting was not changed and kept at 0.1. Original total zinc concentration in zincreplete and zinc limited media was estimated from modified synthetic minimal glucose medium recipe from

Guide to Yeast Genetics and Molecular and Cell Biology book (Guthrie and Fink 2002).

2.11: Zinc Shock Assay

The strain of interest (e.g., pdr15 ∆) was streaked onto appropriate selective medium (e.g.,

YPAD + NAT) from glycerol stock and grown at 30 °C until colonies appeared. A single colony was inoculated and grown overnight at 30 °C with shaking in 2 mL of both zincreplete and zinclimited media. The following day OD 600 for overnight culture was measured using a spectrophotometer. Cells were diluted to OD 600 = 0.15 in 2 mL of same fresh medium. So, if cells were initially grown in zincreplete medium, they were also diluted in zincreplete medium.

And if cells were initially grown in zinclimited medium, they were also diluted in zinclimited medium. Cells were grown at 30 °C with shaking for 4 to 5 hours. OD 600 for day culture was

65 again measured using a spectrophotometer. Cells in zincreplete medium usually had much higher OD 600 than zinclimited medium, due to slow growth in zinclimited medium. Next, all cells were diluted to OD 600 = 0.0625 in 2 mL of zinclimited medium regardless of whether they were growing in zincreplete or zinclimited media. 95 L of cells were transferred per well to the sterile 96well plate. 5 L of appropriate zinc chloride stock solution or sterile double distilled water was added to each well to give a final volume of 100 L per well. For 2 mM final zinc concentration, 40 mM of zinc chloride stock solution was used. There was at least a duplicate of each condition in the 96well plate. After cells and zinc (or water) was added to all the wells, the 96well plate was covered with a clear breathable cover. The plate was transferred to Tecan GENios platereader to measure growth via Absorbance at 595 nm every 15 minutes with shaking at 30 °C for total of maximum 300 reads (Proctor, Urbanus et al. 2011).

After the growth run was complete, data was transferred from TECAN to Microsoft

Excel, where average and standard deviation was calculated for each duplicate (or triplicate) condition. The average growth of each condition was used to draw the growth curve in

GraphPad Prism 5.

2.12: qRTPCR Experimental Protocol

2.12.1: RNA Isolation

The strain of interest (e.g., pdr15 ∆) was streaked onto appropriate selective medium from glycerol stock (e.g., YPAD + NAT) and grown at 30 °C until colonies appeared. A single colony was inoculated and grown overnight at 30 °C with shaking in 2 mL of both zincreplete and zinclimited media. The following day OD 600 for overnight culture was measured using a spectrophotometer. Cells from zincreplete medium were diluted to OD 600 = 0.15 in 5 mL of fresh zincreplete medium. They were grown at 30 °C till OD 600 = 0.4 to 0.6, which took

66 approximately 4 to 5 hours. Cells from zinclimited medium were diluted to OD 600 = 0.05 (or

0.1) in 5 mL of fresh zinclimited medium. They were grown at 30 °C till OD 600 = 0.4 to 0.6, which normally took overnight because of slow growth in zinclimited medium. Once the cells reached the correct OD600 , they were spun down at 700 x g for 5 minutes. The supernatant was removed, and the pellet was flash frozen with liquid nitrogen and stored at 80 °C until RNA isolation step.

The cell pellet was thawed on ice for RNA isolation. Epicenter Masterpure Yeast RNA

Purification Kit was used for both RNA isolation, and removal of contaminating DNA with

DNase I treatment. Manufacturer’s protocol supplied with the kit was followed exactly.

2.12.2: cDNA Synthesis from RNA

RNA concentration was measured using a nanodrop spectrophotometer. 1 g of RNA was used for cDNA synthesis using Invitrogen SuperScript II Reverse Transcriptase.

Manufacturer’s protocol provided with the reverse transcriptase was followed exactly.

Invitrogen Oligo (dT) 1218 primers, and Fermentas dNTP Mix were used during cDNA synthesis.

Control reactions to check for DNA contamination were setup like normal, except no reverse transcriptase enzyme was added to the reaction mixture.

2.12.3: qRTPCR Primers, Program and Setup

The qRTPCR primers were designed to amplify approximately 200 base pairs segments from ZRC1 , ZRT1 , and ACT1 mRNA with a melting temperature around 50 °C. The primer sequences are listed in Table 4.

Table 4: Primer Sequences for qRTPCR

ID Purpose Sequence (5’ to 3’) JS1161 ZRC1 Forward AAAGCGGGAATAACGATTTG JS1162 ZRC1 Reverse GATTGTGGCAACACTTCACC

JS1163 ZRT1 Forward TCCTGCCATTATGCTAACGA JS1164 ZRT1 Reverse CAGCTGCAGTGTTTCTCACA JS1207 ACT1 Forward AGTGTGATGTCGATGTCCGT JS1208 ACT1 Reverse TGACCTTCATGGAAGATGGA

5 L of undiluted cDNA from each condition was pooled together into a single tube, and then serially diluted 1:10 four times in a sterile doubledistilled water to make total of 5 standards for qRTPCR reaction. qRTPCR reaction was setup in a 96well plate, and there was a triplicate for each condition. Dynamo Flash SYBR Green qPCR kit from Thermo Scientific was used. A single PCR reaction (each well) consisted of 10 L SYBR Green Master Mix, 2 L of 1:100 Rox dye, 0.5 L of 10 M forward primer, 0.5 L of 10 M reverse primer, 2 L 1:50 diluted cDNA template, and 5 L of sterile doubledistilled water. The final volume was 20 L.

A master mix of everything without the cDNA was prepared and added to the well. cDNA template was added individually to each well. There were two controls: “no template control”, and “no reverse transcriptase control”. “No template control” PCR reaction included everything except cDNA template (water was added instead). “No reverse transcriptase control” contained cDNA source from a reaction where only RNA was added and no reverse transcriptase enzyme was added. “No reverse transcriptase control” was run whenever possible to check for DNA contamination from RNA isolation.

Light Cycler 480 II qPCR machine from Roche was used for qRTPCR experiments.

The associated Light Cycler software was used to design the experiment and analyze the data.

The qRTPCR program consisted of a single preincubation cycle at 95 °C for 7 min. This was followed by 45 qPCR cycles, which included 95 °C for 10 seconds, 50 °C for 35 seconds, and

72 °C for 35 seconds. Lastly, a single dissociation cycle to generate melting curve for primers included 95 °C for 15 seconds, 60 °C for 1 min, and continuous 95 °C. The standards were given relative concentration from 10,000 to 1, which was used to draw a standard curve by the

Light Cycle software. This standard curve was used to find relative concentration in the actual samples using Microsoft Excel. ZRC1 or ZRT1 mRNA relative concentration was divided by

ACT1 mRNA relative concentration to standardize the data. Bar graphs of standardize average relative concentration were made using GraphPad Prism 5.

2.13: Localization of Zrc1p and Zrt1p

2.13.1: Integration of MYTH Tag Downstream of ZRC1 and ZRT1 ORF

L3 plasmid miniprep was used as a template to amplify C ub YFPLexAVP16 MYTH tag. Primers were designed to amplify C ub YFPLexAVP16 MYTH tag and integrate it downstream of ZRC1 and ZRT1 ORFs according to previously published guidelines (Snider,

Kittanakom et al. 2010). The forward primer consisted of 35 to 40 bases of homology to the end of gene of interest minus the stop codon at 5’ end, and the L3 forward priming site at 3’ end.

The reverse primer consisted of reverse complement of 35 to 40 bases of sequence downstream of gene of interest at the 5’ end, and L3 reverse priming site at 3’ end. The primer sequences are listed in Table 5.

Table 5: Primer Sequences for Amplifying MYTHYFP Tag for Integrating Downstream of ZRC1 and ZRT1

ID Purpose Sequence (5’ to 3’) JS1137 ZRC1 TGTATTGTAGATGACGCTGTAAACTGCAATACTTCCAATTGCCTGATG Forward TCGGGGGGGATCCCTCC JS1138 ZRC1 TCTCTGTAGAACCATGGGATAAATTCACCGACGGCTTCAGCCCTTAC Reverse TATAGGGAGACCGGCAGA JS1134 ZRT1 ACTCTTTTCGGTGCTGGTATCATGGCTTTGATCGGTAAGTGGGCTATG Forward TCGGGGGGGATCCCTCC JS1135 ZRT1 TAACTATAAAATATGAAATAGAATCTATATGGAACATGCAGAATTAC Reverse TATAGGGAGACCGGCAGA

PCR amplification was done using Phusion Flash Master Mix. The MYTHYFP tag was integrated downstream of ZRC1 or ZRT1 ORF in Y7092, pdr15 ∆ and pdr18 ∆ strains using

Yeast Integration Transformation Protocol. Successful colonies were grown in YPAD + G418 medium to prepare glycerol stocks, and for genomic preps. Genomic preps were used as a template in PCR to confirm the integration. The size of the PCR product was used to determine whether the native ORF was present, or the native ORF fused with MYTHYFP tag was present in the strain. The forward primers were homologous to ZRC1 or ZRT1 upstream region, or internal to ORF. The reverse primers were homologous to ZRC1 or ZRT1 downstream region, or internal to MYTHYFP tag. The presence of MYTHYFP was also confirmed via sequencing of

PCR product. The primer sequences for integration confirmation are listed in Table 6.

Table 6: Primer Sequences for MYTH Tag Integration Confirmation Downstream of ZRC1 and ZRT1 ORF

ID Description/Orientation Sequence (5’ to 3’) JS33 YFP internal, Reverse TTGTGCCCATTAACATCA CC JS111 LexA internal, Reverse GCATACCTGTCTGGCTGATG JS275 VP16 internal, Reverse CGTCAATTCCAAGGGCATCG JS394 ZRC1 Upstream, Forward CTGGTCAACCTTAAAGAAACAAAAA JS1139 ZRC1 internal, Forward GCAGGTGGTTCACCATCTTC JS395 ZRC1 Downstream, Reverse AGACATAAAAACGCTATTCTGGATG JS408 ZRT1 Upstream, Forward AAAACAATACACCCGTACTCTCTTG JS1136 ZRT1 internal, Forward GTGTGGCCATCGGTTTGG JS409 ZRT1 Downstream, Reverse TGAAGCAAACTAGGTCTGTTGTAGA

2.13.2: Fluorescence Live Microscopy for Zrc1p, Zrt1p

A single colony from each strain was inoculated in 2 mL of both zincreplete and zinc limited media and grown overnight at 30 °C with shaking. The following day, OD 600 was measured and cells were diluted in the same medium (zincreplete vs zinclimited). All cells grown in zincreplete medium were diluted to OD 600 = 0.15 in fresh 2 mL of zincreplete medium, and grown till OD 600 = 0.4 to 0.6 (usually took 5 to 6 hours) at 30 °C with shaking. All cells grown in zinclimited medium were centrifuged at 700 x g for 5 minutes, 2 mL of fresh zinclimited medium was added to the pellet, and cells were grown for 4 hours at 30 °C with shaking. These cells were not diluted because of extremely slow growth in zinclimited medium.

2 L of cells were spotted on the VWR Goldline microscope slide and covered with

VWR 22 X 50 mm micro glass. Zrc1p and Zrt1p fluorescence signal was visualized under fluorescence microscopy using a 63X lens and GFP laser. FM464 signal was visualized using a

RFP laser. Z stack pictures with usually 9 slices (0.3 m per slice) were taken with microscopy camera. Pictures were cropped and merged using GIMP 2 software.

2.14: Western Blot Protocol

2.14.1: Protein Extraction

Cells with MYTH tag integrated downstream of ZRC1 ORF and grown in zinclimited medium were diluted to OD 600 = 0.1 (or 0.05) in fresh 26 mL zinclimited medium, and grown till OD 600

= 0.4 to 0.6 (usually ready the following morning) at 30 °C with shaking. Cells with MYTH tag integrated downstream of ZRT1 ORF and grown in zinclimited medium were centrifuged at

700 x g for 5 minutes, 3 to 5 mL of fresh zinclimited medium was added to the pellet, and cells were grown for 5 to 6 hours at 30 °C with shaking. These cells were not diluted because of extremely slow growth in zinclimited medium.

After cells reached the correct OD 600 , they were centrifuged at 3700 x g for 5 minutes.

The supernatant was discarded; the cell pellet was washed with 1 mL of sterile doubledistilled water, and transferred to 1 mL sterile microfuge tube. Cells were centrifuged again at 3700 x g for 5 minutes. The supernatant was removed, and the cell pellet was stored at 20 °C until

71 further use. The cell pellet was thawed on ice, and it was resuspended in 500 L of 0.2 M sodium hydroxide + 0.2% βmercaptoethanol (1 mL of 2 M sodium hydroxide + 9 mL of sterile doubledistilled water + 20 L βmercaptoethanol). The cells were placed on ice for 10 minutes.

Afterwards, 50 L of 50% trichloroacetic acid was added and cells were put on ice for another

10 minutes. Cell mixture was spun down at 18,000 x g for 10 minutes at 4 °C. The supernatant was discarded and the remaining trichloroacetic acid was removed with a pipette. The pellet was resuspended in 50 L of 2X sample buffer (with no bromophenol blue and no β mercaptoethanol). Pellet was mixed till it resuspended in the buffer. 1 L of protein sample was used for Bradford assay. The remaining protein sample was mixed with equal volume of 2X sample buffer which included bromophenol blue and βmercaptoethanol. Protein samples were stored at 20 °C until they were run on SDS gel electrophoresis.

2.14.2: Measuring Protein Concentration Using Bradford Assay

10 mg/mL bovine serum albumin stock solution from New England Biolabs was diluted in sterile doubledistilled water to make the following 6 standards (in mg/mL): 0, 0.2, 0.4, 0.6,

0.8, and 1. The final volume for standards was 100 L. Protein samples in 2X sample buffer

(with no bromophenol blue and no βmercaptoethanol) were diluted 1:50 in 2X sample buffer

(with no SDS, no bromophenolblue and no βmercaptoethanol). So, 1 L of protein sample was mixed in 49 L of buffer. BioRad Bradford reagent was diluted 1:5 in sterile doubledistilled water. 1 mL of diluted Bradford reagent and 20 L diluted protein sample or standard was added to the plastic cuvette. Samples were mixed with a pipette. After at least 5 minutes, absorbance was measured at 595 nm using a spectrophotometer. Absorbance from standards was used to draw a standard curve using Microsoft excel. The equation of line of best fit and absorbance of protein samples was used to calculate the approximate protein concentration.

2.14.3: 10% Resolving and 5% Stacking SDSPolyacrylamide Gel

Glass plates (1.0 mm spacing) from BioRad were washed, dried and assembled together in the BioRad gel cassette. 4 mL of sterile doubledistilled water, 3.3 mL of 30% acrylamide mix, 2.5 mL of 1.5 M Tris pH 8.8, 100 L 10% SDS, 100 L 10% ammonium persulfate, and 4

L of TEMED were mixed together for 10% resolving gel. Approximately 4 mL of gel solution was poured per gel between the glass plates until the stacking gel reached approximately 1 cm from the top. Immediately, 0.5 mL of isopropanol was added at the top of the gel to remove bubbles and ensure a flat interface between the resolving and stacking gel. After 30 minutes, isopropanol was discarded, and leftover isopropanol was removed using a filter paper.

3.4 mL of sterile water, 0.83 mL of 30% acrylamide mix, 0.63 mL of 1.0 M Tris pH 6.8,

50 L 10% SDS, 50 L 10% ammonium persulfate, and 5 L of TEMED were mixed for 5% stacking gel. Approximately 1.5 mL of stacking gel was poured on top of the resolving gel, and

1.0 mm 10well BioRad combs were added. The gel was allowed to solidify for 30 minutes. All gels were freshly made on the day they were used.

2.14.4: Gel Electrophoresis, Transfer and Western Blot

50 to 75 g of protein sample was loaded per well of the 10% resolving5% stacking

SDSpolyacrylamide gel. Each well of the same gel contained equal amount of protein. 5 L of

GeneDireX Prestained protein ladder was loaded in one of the wells of the gel. Protein samples were run at constant 115 V in 1X SDS running buffer until the samples reached the end of the gel (approximately 1 hour and 35 minutes). Protein samples were transferred to a nitrocellulose membrane using a wet BioRad transfer setup in 1X transfer buffer at constant 300 mA for 1 hour. Afterwards, membrane was stained with 0.1% Ponceau S to check if transfer worked correctly, and ensure equal loading between lanes. Ponceau S stain was removed by washing

73 membrane in approximately 15 mL of 1X TBST for 10 minutes. Membrane was blocked with

15 mL of 5% skim milk in 1X TBST for 1 hour. Membrane was briefly washed with 1X TBST.

Membrane was incubated overnight at 4 °C with primary antibody diluted in 7 ml of 5% skim milk in 1X TBST. Rabbit antiVP16 antibody was diluted 1:1000, and antihexokinase antibody was diluted 1:10,000. The following day, membrane was washed 3 times with 15 mL of 1X

TBST for 10 minutes each. Afterwards, membrane was incubated with secondary antibody diluted in 7 mL of 5% skim milk in 1X TBST for 1 hour at room temperature. The secondary antibody for antiVP16 membrane was antirabbit IgG linked to horseradish peroxidase, and it was diluted 1:5000. There was no secondary for antihexokinase, because the primary antibody itself was linked to horseradish peroxidase. After second antibody incubation, membrane was washed 3 times with 15 mL of 1X TBST for 10 minutes each. 1 mL of SuperSignal West Pico

Chemiluminescent substrate (from Thermo Scientific) was added to the membrane for 3 minutes.

Signal was developed using the high performance chemiluminescence film from GE healthcare.

Several exposures from 1 second to 1 minute depending on the signal strength were obtained.

2.14.5: Scanning Western Blot Films and Measuring Pixel Density with Image J Software

Western blot films were scanned using Epson dual lens V700 scanner. The following settings were used: positive film, 16 bit grayscale, and 600 dpi. Pixel density was calculated using ImageJ software. Image was first opened in the ImageJ software and changed to 8 bit by clicking “Image” on the top menu, and then selecting “Type” and “8bit”. Image was calibrated for pixel density by clicking on “Analyze”, and then selecting “Calibrate”. In the new popup window, “Uncalibrated OD” was selected in the “Function” tab, and “OK” was clicked to calibrate the image. Afterwards, integrated density function was turned on by clicking “Analyze” on the top menu and selecting “Set Measurements”. In the popup window, “Integrated Density” and “Area” were selected as measurements. Rectangular tool was used to draw a box around the

74 first band on the Western blot scan. The size of the rectangular box was adjusted to make sure that it fitted all the bands with no overlap from surrounding bands. The box was moved to the first band again, and integrated density was measured by clicking “Analyze” and then

“Measure”. The value was recorded. The box was then moved to the next band and measurement was repeated till the last band. Relative pixel density was calculated for each sample by dividing the VP16 integrated pixel density by hexokinase integrated pixel density.

Calculations and analysis were done in Microsoft Excel. Bar graphs were made in GraphPad

Prism 5.

Chapter 3: Results

3.1: MYTH Baits were Successfully Validated Using the N ub G/N ub I Control Test

Nft1p, Pdr10p, Pdr18p and Vmr1p baits were successfully generated for MYTH screening in the AMBV plasmid where the C ub VP16LexA MYTH tag was fused downstream and continuous with the ORF, and the native stop codon for the gene was deleted. NFT1 gene is present as two ORFs ( YKR103w and YKR104w ) separated by a nonsense codon in the yeast strains used during the experiments. Thus, YKR103w and YKR104w were merged, and the nonsense mutation was corrected to tyrosine residue to encode the full length Nft1p from

AMBV plasmid. The cloned ORFs for all 4 genes were sequence verified. The bait plasmids were transformed into the THY.AP4 reporter strain (for Nft1p, Pdr18p and Vmr1p baits) or the

NMY51 reporter strain (for Pdr10p bait) for validation and screening.

All four baits were validated for MYTH screening using the N ub G/N ub I control test.

Ost1p fused to the N ub G fragment was used as a noninteracting (negative) prey and Ost1p fused to the N ub I fragment was used as the interacting (positive) prey. The baits and prey were co transformed together and then transformed colonies were spotted in triplicate on both the control medium (SDWL) and the selective medium (SDWLAH). The control medium tests for the presence of both the bait and prey plasmids. The selective medium tests for the interaction between the bait and prey. All 4 MYTH baits (Nft1p, Pdr10p, Pdr18p and Vmr1p) successfully passed the Nub G/N ub I control test (Figure 8). This means that all baits activate the reporter system only in the presence of an interacting prey, whereas, the reporter genes are not activated in the absence of an interacting prey or presence of a noninteracting prey.

Figure 8: (A) Nft1p, (B) Pdr10p, (C) Pdr18p, and (D) Vmr1p successfully passed the N ub G/N ub I control test. Nft1p, Pdr18p and Vmr1p baits were expressed in the THY.AP4 reporter strain, whereas, Pdr10p bait was expressed in the NMY51 strain. Ost1p fused to the Nub G fragment was used as a noninteracting

(negative) prey and Ost1p fused to the N ub I fragment was used as the interacting (positive) prey. Baits and preys were cotransformed together and then transformed colonies were spotted in triplicate on both the control medium (SDWL) and the selective medium (SDWLAH). The control medium tests for presence of both the bait and prey plasmids, and bait strains containing both N ub I (positive) and N ub G (negative) control preys display growth as expected. The selective medium tests for the interaction between the bait and prey. Growth of the bait strains containing the N ub I control prey construct, but not the N ub G control prey construct, on selective medium demonstrates that activation of the reporter system occurs only in strains containing a baitprey interaction. The experiment was performed at least twice.

3.2: Proper Subcellular Localization of Nft1p, Pdr10p, and Vmr1p Validated Using

Fluorescence Microscopy

For localization of baits and live fluorescence microscopy, Nft1p, Pdr10p, Pdr18p and

Vmr1p baits were successfully generated in the YFPAMBV plasmid where the C ub YFPVP16

LexA MYTH tag was fused downstream and continuous with the ORF, and the native stop codon for the gene was deleted. For Nft1p, YKR103w and YKR104w were merged, and the nonsense mutation was corrected to tyrosine residue to encode the full length Nft1p. The YFP

78 bait plasmids for Nft1p, Pdr10p and Vmr1p were transformed into the NMY51 reporter strain.

The bait plasmid for Pdr18p was transformed into the L40, THY.AP4 and NMY51 reporter strains.

Nft1p and Vmr1p baits localized correctly to the vacuolar membrane (Figure 9). The expression of both Nft1p and Vmr1p baits colocalized with the FM464 dye, a marker for the vacuolar membrane.

Figure 9: (A) Nft1p, and (B) Vmr1p baits fused to C ub YFPVP16LexA and expressed from the AMBV plasmid in the NMY51 MYTH reporter strain correctly localized to the vacuolar membrane. The expression of both Nft1p and Vmr1p colocalized with the FM464 dye, a marker for the vacuolar membrane. The experiment was performed at least twice.

Pdr10p bait localized correctly to the plasma membrane, however signal for Pdr18p could not be detected, possibly due to low expression (Figure 10). Pdr18p signal was also not detected in the THY.AP4 and L40 reporter strains.

Figure 10 : (A) Pdr10p bait fused to C ub YFPVP16LexA and expressed from the AMBV plasmid in the

NMY51 MYTH reporter strain localized correctly to the plasma membrane. (B) Pdr18p bait fused to C ub YFPVP16LexA and expressed from the AMBV plasmid in the THY.AP4 MYTH reporter strain did not produce a detectable signal, possibly due to the low expression. The experiment was performed at least twice.

3.3: Fusion of the MYTH Tag does not Affect ABC Transporter Function

Growth phenotypes of ABC transporter deleted strain carrying either the bait plasmid or an empty plasmid were compared with the wildtype strain (THY.AP4) carrying an empty plasmid to investigate if the fusion of the MYTH tag hinders bait function. Nft1p and Vmr1p bait function was tested in solid SD minus leucine medium containing 200 M cadmium chloride. The results demonstrated that nft1 ∆ and vmr1 ∆ strains carrying an empty AMBV plasmid were sensitive to medium containing 200 M cadmium chloride (Figure 11). However, the wildtype strain carrying an AMBV plasmid, and nft1 ∆ and vmr1 ∆ strains carrying the corresponding bait plasmid were not sensitive to medium containing cadmium chloride (Figure

11). Overall, these results suggest that ABC transporter bait plasmid can complement ABC transporter delete phenotype, which means that fusion of MYTH tag to ABC transporter does not hinder ABC transporter function.

Figure 11 : MYTH tag fusion with ABC transporter does not interfere with ABC transporter function. (A) Wildtype (THY.AP4) strain carrying empty AMBV plasmid, and nft1 ∆ strain carrying Nft1p bait plasmid grow better than nft1 ∆ strain carrying empty AMBV plasmid on solid SDL medium containing 200 M cadmium chloride. (B) Wildtype (THY.AP4) strain carrying empty AMBV plasmid, and vmr1 ∆ strain carrying Vmr1p bait plasmid can grown better than vmr1 ∆ strain carrying empty AMBV plasmid on solid SDL medium containing 200 M cadmium chloride. Overall, the results suggest that ABC transporter bait plasmid can complement ABC transporter delete phenotype, which means that fusion of MYTH tag to ABC transporter does not hinder ABC transporter function. There were three biological replicates for each strain.

3.4: ProteinProtein Interactome of Nft1p, Pdr10p, Pdr18p and Vmr1p from MYTH

After all 4 baits (Nft1p, Pdr10p, Pdr18p and Vmr1p) were validated using the N ub G/N ub I control test and fluorescence microscopy, they were screened in the MYTH assay using both

Nub GX cDNA and N ub GX genomic libraries, where X represents the prey. The preliminary interacting preys (“hits”) identified were further tested for specificity in the bait dependency test.

In the bait dependency test, each of the hits is transformed back into the original bait strain, as well as into a strain expressing an artificial control bait. An interaction is deemed specific only if the prey interacts with the original bait, but not the artificial control bait. All hits that passed

the bait dependency test were sequenced with the N ub GX sequencing primer and BLAST analysis was used to determine their identity. Overall, there were 23 interactions for Nft1p, 22 interactions for Pdr10p, 4 interactions for Pdr18p and 1 interaction for Vmr1p. The description and localization from the Saccharomyces cerevisiae Database (SGD) for all 43 hits (preys) is summarized in Table 7 (Cherry, Hong et al. 2012).

Table 7: Description and Localization from the Saccharomyces cerevisiae Database (SGD) for the 43 Interactors from the MYTH Screening of Nft1p, Pdr10p, Pdr18p and Vmr1p

Interactor/Prey Bait Description Localization Gene Systematic Name Name AGP1 YCL025C Pdr10p Lowaffinity amino acid permease with Plasma membrane broad substrate range, involved in uptake of asparagine, glutamine, and other amino acids; expression is regulated by the SPS plasma membrane amino acid sensor system. COF1 YLL050C Nft1p Cofilin, promotes actin filament Actin cortical patch and depolarization in a pHdependent manner; plasma membrane binds both actin monomers and filaments and severs filaments; thought to be regulated by phosphorylation at SER4; ubiquitous and essential in eukaryotes. COS1 YNL336W Nft1p, Protein of unknown function, member of Vacuole and integral to Pdr10p the DUP380 subfamily of conserved, often membrane subtelomericallyencoded proteins. COS8 YHL048W Nft1p Nuclear membrane protein, member of the Nuclear membrane DUP380 subfamily of conserved, often subtelomericallyencoded proteins; regulation suggests a potential role in the

unfolded protein response. CPR6 YLR216C Nft1p Peptidylprolyl cistrans isomerase Cytoplasm (cyclophilin), catalyzes the cistrans isomerization of peptide bonds Nterminal to proline residues; binds to Hsp82p and contributes to chaperone activity. ERG9 YHR190W Nft1p, Farnesyldiphosphate farnesyl transferase Integral to membrane, Pdr10p (squalene synthase), joins two farnesyl microsome, endoplasmic pyrophosphate moieties to form squalene in reticulum and mitochondrial the sterol biosynthesis pathway. outer membrane ERG27 YLR100W Pdr10p 3keto sterol reductase, catalyzes the last of Endoplasmic reticulum, three steps required to remove two C4 endoplasmic reticulum methyl groups from an intermediate in membrane and mitochondrial ergosterol biosynthesis; mutants are sterol outer membrane auxotrophs. ERG28 YER044C Pdr10p Endoplasmic reticulum membrane protein, Endoplasmic reticulum may facilitate proteinprotein interactions membrane between the Erg26p dehydrogenase and the Erg27p 3ketoreductase and/or tether these enzymes to the ER, also interacts with Erg6p. FBA1 YKL060C Nft1p Fructose 1,6bisphosphate aldolase, Cytoplasm and mitochondria required for glycolysis and gluconeogenesis; catalyzes conversion of fructose 1,6 bisphosphate to glyceraldehyde3P and dihydroxyacetone P; locates to mitochondrial outer surface upon oxidative stress. FLC1 YPL221W Pdr10p Putative FAD transporter; required for Endoplasmic reticulum, uptake of FAD into endoplasmic reticulum; cellular bud neck, vacuole and involved in cell wall maintenance. integral to membrane FPS1 YLL043W Nft1p Plasma membrane channel, member of Plasma membrane major intrinsic protein (MIP) family; involved in efflux of glycerol and in uptake of acetic acid and the trivalent metalloids arsenite and antimonite; phosphorylated by Hog1p MAPK under acetate stress. FRT2 YAL028W Nft1p Tailanchored ER membrane protein, Endoplasmic reticulum interacts with homolog Frt1p; promotes membrane growth in conditions of high Na+, alkaline pH, or cell wall stress, possibly via a role in posttranslational translocation; potential Cdc28p substrate. GAS4 YOL132W Nft1p 1,3betaglucanosyltransferase, involved Cell wall and integral to with Gas2p in spore wall assembly; has membrane similarity to Gas1p; localizes to the cell wall. GET2 YER083C Pdr10p Subunit of the GET complex; involved in GET complex, endoplasmic insertion of proteins into the ER reticulum and integral to membrane; required for the retrieval of membrane HDEL proteins from the Golgi to the ER in an ERD2 dependent fashion and for meiotic nuclear division. GUP2 YPL189W Pdr10p Probable membrane protein with a possible Membrane role in proton symport of glycerol; member of the MBOAT family of putative membranebound Oacyltransferases;

Gup1p homolog. GUS1 YGL245W Nft1p GlutamyltRNA synthetase (GluRS), forms Cytoplasm a complex with methionyltRNA synthetase (Mes1p) and Arc1p; complex formation increases the catalytic efficiency of both tRNA synthetases and ensures their correct localization to the cytoplasm. HAP1 YLR256W Pdr10p Zinc finger transcription factor involved in Nucleus the complex regulation of gene expression in response to levels of heme and oxygen; the S288C sequence differs from other strain backgrounds due to a Ty1 insertion in the carboxy terminus. MRH1 YDR033W Pdr10p Protein that localizes primarily to the Plasma membrane plasma membrane, also found at the nuclear envelope; the authentic, nontagged protein is detected in mitochondria in a phosphorylated state; has similarity to Hsp30p and Yro2p. ORM2 YLR350W Pdr10p Evolutionarily conserved protein, similar to Endoplasmic reticulum, Orm1p, required for resistance to agents SPOTS complex, integral to that induce unfolded protein response; membrane Orm1p and Orm2p together control membrane biogenesis by coordinating lipid homeostasis with protein quality control. OST2 YOR103C Pdr10p Epsilon subunit of the Oligosaccharyltransferase oligosaccharyltransferase complex of the complex and integral to ER lumen, which catalyzes asparagine membrane linked glycosylation of newly synthesized proteins. OSW5 YMR148W Pdr18p Protein of unknown function that may play Membrane a role in spore wall assembly; predicted to contain an Nterminal transmembrane domain; osw5 null mutant spores exhibit increased spore wall permeability and sensitivity to betaglucanase digestion. PDC1 YLR044C Nft1p Major of three pyruvate decarboxylase Cytoplasm and nucleus isozymes, key enzyme in alcoholic fermentation, decarboxylates pyruvate to acetaldehyde; subject to glucose, ethanol, and autoregulation; involved in amino acid catabolism. PDR11 YIL013C Nft1p, ATPbinding cassette (ABC) transporter, Plasma membrane Pdr10p, multidrug transporter involved in multiple Pdr18p drug resistance; mediates sterol uptake when sterol biosynthesis is compromised; regulated by Pdr1p; required for anaerobic growth. PGK1 YCR012W Nft1p 3phosphoglycerate kinase, catalyzes Cytoplasm and mitochondria transfer of highenergy phosphoryl groups from the acyl phosphate of 1,3 bisphosphoglycerate to ADP to produce ATP; key enzyme in glycolysis and gluconeogenesis. PHO86 YJL117W Pdr10p Endoplasmic reticulum (ER) resident Endoplasmic reticulum protein required for ER exit of the high affinity phosphate transporter Pho84p,

specifically required for packaging of Pho84p into COPII vesicles. PRO3 YER023W Nft1p Delta 1pyrroline5carboxylate reductase, Cytoplasm catalyzes the last step in proline biosynthesis. PTR2 YKR093W Nft1p, Integral membrane peptide transporter, Plasma membrane Pdr10p mediates transport of di and tripeptides; conserved protein that contains 12 transmembrane domains; PTR2 expression is regulated by the Nend rule pathway via repression by Cup9p. RNR4 YGR180C Nft1p Ribonucleotidediphosphate reductase Cytoplasm, nucleus and (RNR), small subunit; the RNR complex ribonucleosidediphosphate catalyzes the ratelimiting step in dNTP reductase complex synthesis and is regulated by DNA replication and DNA damage checkpoint pathways via localization of the small subunits. SBA1 YKL117W Nft1p Cochaperone that binds to and regulates Cytoplasm and nucleus Hsp90 family chaperones; important for pp60vsrc activity in yeast; homologous to the mammalian p23 proteins and like p23 can regulate telomerase activity. SBH1 YER087CB Pdr10p Beta subunit of the Sec61p ER Sec61 translocon complex translocation complex (Sec61pSss1p Sbh1p); involved in protein translocation into the endoplasmic reticulum; interacts with the exocyst complex and also with Rtn1p; homologous to Sbh2p. SSB1 YDL229W Nft1p Cytoplasmic ATPase that is a ribosome Cytoplasm and polysome associated molecular chaperone, functions with Jprotein partner Zuo1p; may be involved in folding of newlymade polypeptide chains; member of the HSP70 family; interacts with phosphatase subunit Reg1p. SSM4 YIL030C Pdr18p Ubiquitinprotein ligase involved in ER Doa10p ubiquitin ligase associated protein degradation; located in complex, endoplasmic the ER/nuclear envelope; ssm4 mutation reticulum membrane, nuclear suppresses mRNA instability caused by an envelope and nuclear inner rna14 mutation. membrane TPI1 YDR050C Nft1p Triose phosphate isomerase, abundant Mitochondria and cytoplasm glycolytic enzyme; mRNA halflife is regulated by iron availability; transcription is controlled by activators Reb1p, Gcr1p, and Rap1p through binding sites in the 5' noncoding region; inhibition of Tpi1p activity by PEP (phosphoenolpyruvate) stimulates redox metabolism in respiring cells; E104D mutation in human TPI causes a rare autosomal disease. TRP5 YGL026C Nft1p Tryptophan synthase, catalyzes the last step Cytoplasm and nucleus of tryptophan biosynthesis; regulated by the general control system of amino acid biosynthesis. TRX2 YGR209C Nft1p Cytoplasmic thioredoxin isoenzyme of the Cytoplasm and vacuole thioredoxin system which protects cells

against oxidative and reductive stress, forms LMA1 complex with Pbi2p, acts as a cofactor for Tsa1p, required for ERGolgi transport and vacuole inheritance. VBA4 YDR119W Pdr10p Protein of unknown function with proposed Vacuolar membrane role as a basic amino acid permease based on phylogeny; GFPfusion protein localizes to vacuolar membrane; physical interaction with Atg27p suggests a possible role in autophagy; nonessential gene. VTC2 YFL004W Pdr10p Subunit of the vacuolar transporter Vacuolar membrane chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and nonautophagic vacuolar fusion. YDR056C YDR056C Pdr10p Putative protein of unknown function; Membrane and endoplasmic green fluorescent protein (GFP)fusion reticulum protein localizes to the endoplasmic reticulum; YDR056C is not an essential protein. YGL081W YGL081W Nft1p, Putative protein of unknown function; non Unknown Vmr1p essential gene; interacts genetically with CHS5, a gene involved in chitin biosynthesis. YNL010W YNL010W Nft1p Putative protein of unknown function with Cytoplasm and nucleus similarity to phosphoserine phosphatases; green fluorescent protein (GFP)fusion protein localizes to the cytoplasm and nucleus; homozygous diploid mutant shows an increase in glycogen accumulation. YNR062C YNR062C Pdr10p Putative membrane protein of unknown Membrane function ZRC1 YMR243C Pdr10p, Vacuolar membrane zinc transporter, Vacuolar Membrane Pdr18p transports zinc from the cytosol into the vacuole for storage; also has a role in resistance to zinc shock resulting from a sudden influx of zinc into the cytoplasm; human ortholog SLC30A10 functions as a Mn transporter and mutations in SLC30A10 cause neurotoxic accumulation of Mn in liver and brain. ZRT1 YGL255W Pdr10p Highaffinity zinc transporter of the plasma Plasma membrane membrane, responsible for the majority of zinc uptake; transcription is induced under lowzinc conditions by the Zap1p transcription factor.

The hits (“preys”) from all 4 baits were combined to generate a proteinprotein interactome using the Cytoscape software (Figure 12) (Smoot, Ono et al. 2011). The description provided by the SGD database (Cherry, Hong et al. 2012) was used to categorize all hits into

86 functional categories (represented by colour in Figure 12). There were 11 hits involved in metabolism, 9 hits involved in transport, 8 hits with unknown function, 4 hits involved in trafficking and secretion, 3 hits involved in protein folding, 2 hits involved in stress response, and 1 hit in each of the following categories: cell wall, cytoskeleton, nuclear function, protein degradation, protein modification and protein synthesis. Additionally, the localization information from the SGD database (Cherry, Hong et al. 2012) and Yeast Resource Center

(Riffle, Malmstrom et al. 2005) was used to categorize each prey into one of three categories: membrane associated protein, nonmembrane protein or unknown localization (represented by shape in Figure 12). 28 hits were membrane associated, 14 hits were nonmembrane, and 1 hit had unknown localization.

Figure 12 : Proteinprotein interactome of Nft1p, Pdr10p, Pdr18p and Vmr1p from MYTH. All hits are categorized according to function (colour) and localization (shape). There were 23 interactors for Nft1p, 22 for Pdr10p, 4 for Pdr18p and 1 for Vmr1p.

Many preys interacted with multiple baits. Pdr11p interacted with Nft1p, Pdr10p and

Pdr18p. Ygl081wp interacted with both Nft1p and Vmr1p. Zrc1p interacted with both Pdr10p and Pdr18p. Erg9p, Ptr2p and Cos1p interacted with both Nft1p and Pdr10p. The physical interaction discovered between Nft1p and Gas4p by MYTH was previously reported as a

88 negative genetic interaction in the BioGRID and SGD database (Costanzo, Baryshnikova et al.

2010). All remaining interactions discovered by MYTH are novel and were not previously reported in the BioGRID database (Stark, Breitkreutz et al. 2011) or SGD database (Cherry,

Hong et al. 2012). The overlay of previously known genetic and physical interactions on the

MYTH proteinprotein interactome is shown in Figure 13.

Figure 13 : Overlay of previously known genetic and physical interactions on the proteinprotein interactome of Nft1p, Pdr10p, Pdr18p and Vmr1p from MYTH. Legend: red background represents the four MYTH baits; blue border indicates that this gene has a human ortholog; rectangular box indicates that the human ortholog of this gene is a diseasecausing gene; solid line represents interactions that are found in MYTH; red solid line represents novel interactions that are found in MYTH and were not previously reported in the literature; blue solid line represents interactions that are found in MYTH and were also previously reported in the literature; dash line indicates previously known genetic or physical interactions that were not detected in MYTH; green dash line represents previously known genetic

89 interactions reported in the literature that were not detected in MYTH; and purple line represents previously known physical interactions reported in the literature that were not detected in MYTH. Pdr10p and Pdr12p physical interaction was detected in MYTH but Pdr12p was the bait and Pdr10p was the prey. For Nft1p, only previously reported genetic and physical interactions of Ykr103wp fragment are shown in this figure; previously reported interactions of Ykr104wp are not shown. This figure was adapted and modified from the original figure created by a collaborating Bioinformatics lab.

Funspec database (Robinson, Grigull et al. 2002) was used to find enriched GO molecular function, biological process, and cellular component annotations in the interactome.

The pvalue cutoff was set at 0.01. For GO molecular function annotations, the interactome was significantly enriched in catalytic activity (18.6% of hits) (Figure 14A). For GO biological process annotations, the interactome was significantly enriched in transport processes (30.2% of hits), metabolic processes (18.6% of hits), and lipid biosynthetic processes (9.3% of hits)

(Figure 14B). For GO cellular component annotations, the interactome was significantly enriched in membrane component (62.8% of hits) (Figure 14C).

Figure 14 : GO annotation enrichment analysis for Nft1p, Pdr10p, Pdr18p and Vmr1p proteinprotein interactors from MYTH using the Funspec database. The pvalue cutoff was set at 0.01. (A) Enrichment

91 of GO molecular processes. (B) Enrichment of GO biological processes. (C) Enrichment of GO cellular components.

InParanoid Database (Ostlund, Schmitt et al. 2010) was used to find human homologs of interactors from the MYTH interactome. Online Mendelian Inheritance in Man (OMIM) database was used to find if any human homologs are associated with a human disease

(McKusick 1998). Interestingly, 19 interactors have homologs found in humans, and 6 of them are associated with a human disease (Table 8). The presence of human homologs of ABC transporters and its interactors suggest that findings from the yeast can be translated into human physiology and disease.

Table 8: Human Homologs of Preys According to the InParanoid Database, and Associated Diseases from OMIM Database

Yeast Human Human Protein Name Associated Disease Gene Gene name Name AGP1 SLC7A14 Probable cationic amino acid transporter No Entry in the database (Solute carrier family 7 member 14) COF1 CFL1 Cofilin1 None reported CPR6 PPID Peptidylprolyl cistrans isomerase D None reported (Cyclophilin40) ERG9 FDFT1 Squalene synthase None reported ERG27 HSD17B7 3ketosteroid reductase None reported ERG28 C14orf1 Probable ergosterol biosynthetic protein None reported 28 GUP2 HHATL Proteincysteine Npalmitoyltransferase None reported HHATlike protein Proteincysteine Npalmitoyltransferase HHAT ORM2 ORMDL3 ORM1like protein 3 • Inflammatory bowel disease • Susceptibility to childhood asthma OST2 DAD1 Dolichyldiphosphooligosaccharide None reported protein glycosyltransferase subunit DAD1 PDR11 ABCA3 ATPbinding cassette subfamily A Surfactant metabolism member 3 dysfunction, pulmonary, 3 PGK1 PGK1 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 deficiency PRO3 PYCR1 Pyrroline5carboxylate reductase 1, • Cutis laxa, autosomal mitochondrial recessive, type IIB

• Cutis laxa, autosomal recessive, type IIIB PTR2 SLC15A2 Solute carrier family 15 member 2 None reported

SBA1 PTGES3 Prostaglandin E synthase 3 None reported SSM4 MARCH6 E3 ubiquitinprotein ligase MARCH6 None reported TPI1 TPI1 Triosephosphate isomerase Hemolytic anemia due to triosephosphate isomerase deficiency TRX2 TXN Thioredoxin None reported ZRC1 SLC30A1 Zinc transporter 1 (ZnT1)(Solute carrier None reported family 30 member 1) ZRT1 SLC39A3 Zinc transporter ZIP3 (ZIP3)(Solute Proposed tumor suppressor carrier family 39 member 3) gene

3.5: Studying Interactions of Zrt1p and Zrc1p with ABC Transporters

Interestingly, there were two zinc transporters (Zrc1p and Zrt1p) in the proteinprotein interactome of S. cerevisiae ABC transporters generated using MYTH. Moreover, the GO biological process enrichment analysis found that the ABC transporter interactome is enriched in zinc ion transport ( pvalue = 0.001). Zrc1p is a vacuolar membrane zinc transporter involved in transport of zinc from the cytoplasm into the vacuole. Zrt1p is a plasma membrane high affinity zinc transporter responsible for majority of zinc uptake into the cell. Zrc1p interacted with Pdr10p and Pdr18p, and Zrt1p interacted with Pdr5p, Pdr10p and Pdr15p in MYTH (Figure

15). The novel interactions of Zrc1p and Zrt1p with ABC transporters were chosen for follow up functional studies because zinc homeostasis is very important for biological processes. In addition, ABC transporters have not previously been implicated in playing a major role in zinc homeostasis.

Figure 15 : Overview of proteinprotein interaction between ABC transporters and Zinc transporters. Zrc1p interacted with Pdr10p and Pdr18p, and Zrt1p interacted with Pdr5p, Pdr10p and Pdr15p in MYTH.

The ZRC1 ORF contains 1329 nucleotide bases and encodes the 442 amino acid long

Zrc1p. There were three different fragments of Zrc1p that interacted with Pdr10p in MYTH: from amino acids 56 to 313, 170 to 436, and 195 to 442. The Zrc1p fragment that interacted with Pdr18p in MYTH was from amino acids 89 to 337 (Figure 16).

Figure 16 : Overview of Zrc1p fragments that interacted with Pdr10p and Pdr18p. It should be noted that actual fragments might be longer than illustrated because sequencing was done from only one end of the gene (5’ end). Zrc1p structure is adapted from (Reynolds, Kall et al. 2008).

The ZRT1 ORF contains 1131 nucleotide bases and encodes the 376 amino acid long

Zrt1p. Zrt1p fragment from 191 to 339 amino acids interacted with Pdr5p, from 191 to 376 amino acids interacted with Pdr10p, and from 191 to 322 amino acids interacted with Pdr15p in

MYTH (see Figure 8). The actual fragments of Zrc1p and Zrt1p might be longer than mentioned because sequencing was done from only one end of the gene (5’ end).

Figure 17 : Overview of Zrt1p fragments that interacted with Pdr5p, Pdr10p and Pdr18p. It should be noted that actual fragments might be longer than illustrated because sequencing was done from only one end of the gene (5’ end). Zrt1p structure is adapted from (Reynolds, Kall et al. 2008).

3.5.1: Deletion of PDR15 and PDR18 Causes Sensitivity to Zinc Shock

“Zinc shock” occurs when zinclimited cells are resupplied with zinc. Under zinclimited conditions, cells upregulate the high affinity zinc transporter Zrt1p at the plasma membrane to increase the capacity for zinc uptake. However, even modest amounts of extracellular zinc can result in accumulation of extremely high concentrations of zinc inside the cell due to the activity of Zrt1p. The vacuolar Zrc1p is responsible for removing excess zinc from the cytoplasm and for surviving zinc shock, with deletion of ZRC1 resulting in reduced tolerance to zinc shock compared to the wildtype (MacDiarmid, Milanick et al. 2003; Simm, Lahner et al. 2007).

To test whether ABC transporters are involved in zinc homeostasis and zinc shock tolerance, pdr5 ∆, pdr15 ∆, pdr10 ∆, pdr18 ∆ and wildtype (Y7092) strains were tested using a zinc shock assay. The zrc1 ∆ strain was used as a positive control for the zinc shock assay. All strains were initially grown in either zincreplete or zinclimited media and then transferred to zinclimited medium containing 2 mM zinc chloride. The growth was measured in Tecan

GENios platereader (Proctor, Urbanus et al. 2011). Zincreplete and zinclimited media are modified synthetic minimal glucose medium, which contains approximately 400 g per liter (or

2.5 M) of zinc sulfate (Guthrie and Fink 2002). Therefore, according to the MaxChelator program (available at http://www.stanford.edu/~cpatton/webmaxc/webmaxcS.htm ) free zinc ion concentration in zincreplete medium is approximately 2.5 M because it does not contain any chelating agent (Patton, Thompson et al. 2004). On the other hand, zinclimited medium contains 1 mM final EDTA concentration. Therefore, according to the MaxChelator program, presence of EDTA in zinclimited medium reduces the free zinc ion concentration to 1.3 X 10 12

M. Addition of 2 mM zinc chloride to zinclimited medium results in 1 mM free zinc ion concentration during the zinc shock experiment according to the MaxChelator program.

As expected, there was no difference between the pdr15 ∆, pdr18 ∆, and wildtype strains if all strains were initially grown in zincreplete medium and then exposed to 2 mM zinc (Figure

18A). In contrast, pdr15 ∆ and pdr18 ∆ strains initially grown in zinclimited medium and then exposed to 2 mM zinc chloride had a longer lag phase compared to the wildtype strain, which suggests that deletion of PDR15 and PDR18 results in reduced tolerance to zinc shock (Figure

18B). pdr5 ∆ strain did not experience zinc shock if initially grown in zinclimited medium and then exposed to 2 mM zinc chloride, and pdr10 ∆ strain displayed a general slow growth phenotype in all media used and was not further tested (see Figure 29 in Appendix 2). Overall,

96 the results suggest that deletion of PDR15 and PDR18 decreases cell tolerance for zinc shock, which indicates that both Pdr15p and Pdr18p may play an essential role in zinc homeostasis.

Figure 18 : (A) pdr15 ∆ and pdr18 ∆ strains do not experience zinc shock if they are initially grown in zincreplete medium and then transferred to zinclimited medium and 2 mM zinc chloride. (B) However, pdr15 ∆ and pdr18 ∆ strains experience zinc shock (longer lag phase compared to the wildtype strain) if they are initially grown in zinclimited medium and then transferred to zinclimited medium and 2 mM zinc chloride. This suggests that pdr15 ∆ and pdr18 ∆ strains have reduced tolerance for zinc shock and altered zinc tolerance mechanisms, which indicate that Pdr15p and Pdr18p may play an important role in zinc homeostasis. The experiment was performed at least twice.

3.5.2: Deletion of PDR15 and PDR18 Causes Changes in ZRC1 and ZRT1 mRNA Levels

To further investigate the involvement of Pdr15p and Pdr18p in zinc homeostasis, the mRNA levels of ZRC1 and ZRT1 (which represent the two major zinc transporters in yeast) were investigated in the pdr15 ∆, pdr18 ∆ and wildtype (Y7092) strains using qRTPCR. ACT1 was used as a control gene to standardize the mRNA levels. Cells were grown to exponential phase (OD 600 ~ 0.6) in both zincreplete and zinclimited media. Interestingly, ZRC1 mRNA levels were increased in the pdr15 ∆ and pdr18 ∆ strains compared to the wildtype in zinc replete medium by 28.3% and 23.3%, respectively ( p ≤ 0.01) (Figure 19A). This suggests that deletion of PDR15 and PDR18 alters zinc homeostasis because the transcription of a major vacuolar zinc transporter is altered. There were no changes in the ZRC1 mRNA levels between

97 the wildtype and the pdr15 ∆ and pdr18 ∆ strains in zinclimited medium (Figure 19B). One possible reason for the failure to observe any changes is because in zinclimiting conditions,

Zap1p is active and maximally transcribes ZRC1 to prepare cells for potential over accumulation of zinc and zinc shock. Therefore, alteration of ZRC1 transcription due to deletion of PDR15 and PDR18 was not detected in zinclimiting conditions.

Figure 19 : (A) In zincreplete medium, the levels of ZRC1 mRNA in the pdr15 ∆ and pdr18 ∆ strains are 28.3% and 23.3% higher, respectively, than in WT ( p ≤ 0.01). Zrc1p is an important element of zinc homeostasis. It is responsible for transporting excess zinc from the cytoplasm to the vacuole. The data suggests that an important regulator of zinc homeostasis is altered in the pdr15 ∆ and pdr18 ∆ strains. (B) In zinclimited medium, pdr15 ∆ and pdr18 ∆ strains have similar ZRC1 mRNA levels as the wildtype strain. One possible reason for the failure to observe any changes is because in zinclimiting conditions, Zap1p is active and maximally transcribes ZRC1 to prepare cells for potential over accumulation of zinc. There were three biological replicates for each condition and strain. Relative mRNA level was calculated by dividing ZRC1 relative concentration with ACT1 relative concentration. ttest function in Microsoft Excel 2007 was used to find whether the relative mRNA level between strains is significantly different.

In addition, ZRT1 mRNA levels were increased by 100% in the pdr15 ∆ strain (p ≤ 0.01), and decreased by 55.6% in the pdr18 ∆ strain (p ≤ 0.001) compared to levels in wildtype strain when cells were grown in zincreplete medium (Figure 20A). This suggests that deletion of

PDR15 and PDR18 alters zinc homeostasis because the transcription of a high affinity zinc uptake transporter is altered in the deleted strains. There were no changes in the ZRT1 mRNA

98 levels between the wildtype, pdr15 ∆ and pdr18 ∆ strains in zinclimited medium (Figure 20B).

A possible reason for the failure to observe any changes is because in zinclimiting conditions,

Zap1p is active and maximally transcribes ZRT1 to increase the cell’s capacity for zinc uptake.

Therefore, changes in the ZRT1 transcription due to deletion of PDR15 and PDR18 were not detected in zinclimiting conditions.

Figure 20 : (A) In zincreplete medium, pdr15 ∆ strain has 100% higher and pdr18 ∆ strain has 55.6% lower ZRT1 mRNA levels than the wildtype strain. Zrt1p is an important element of zinc homeostasis because it is responsible for majority of zinc uptake. This suggests that zinc homeostasis is altered in the pdr15 ∆ and pdr18 ∆ strains. (B) In zinclimited medium, pdr15 ∆ and pdr18 ∆ strains have similar ZRT1 mRNA levels as the wildtype strain. A possible reason for the failure to observe any changes is because in zinclimiting conditions, Zap1p is active and maximally transcribes ZRT1 to increase the cell’s capacity for zinc uptake. There were three biological replicates for each condition and strain. Relative mRNA level was calculated by dividing ZRT1 relative concentration with ACT1 relative concentration. t test function in Microsoft Excel 2007 was used to find whether the relative mRNA level between strains is significantly different.

3.5.3: Deletion of PDR18 Causes Changes in Zrc1p and Zrt1p Protein Levels

To investigate protein levels of Zrc1p and Zrt1p in the wildtype (Y7092), pdr15 ∆ and pdr18 ∆ strains, C ub YFPVP16LexA MYTH tag was integrated downstream and continuous

99 with the ORFs of ZRC1 and ZRT1 in all three strains. In zincreplete medium, pdr15 ∆ strain has similar Zrc1p protein levels compared to wildtype, while in pdr18 ∆ strain Zrc1p levels are significantly reduced (p value ≤ 0.05) (Figure 21). The Zrc1p protein levels in zincreplete medium do not correlate with the ZRC1 mRNA levels because deletion of both PDR15 and

PDR18 resulted in an increase in the ZRC1 mRNA levels (Figure 19A). One possible explanation is that there is an increase in degradation of Zrc1p protein due to deletion of PDR15 and PDR18 .

Figure 21 : Zrc1p protein levels in zincreplete medium. (A) Western blot for Zrc1p and hexokinase (loading control) protein levels in wildtype (WT), pdr15 ∆ and pdr18 ∆ strains. (B) Relative integrated pixel density was calculated by dividing integrated pixel density from VP16 signal by integrated pixel density from hexokinase signal. In zincreplete medium, pdr15 ∆ has similar and pdr18 ∆ has lower levels (p value ≤ 0.05) of Zrc1p compared to the wildtype strain. There was no detectable VP16 signal in lane

8 possibly due to disruption of Cub YFPVP16LexA MYTH tag. Integrated pixel density from lane 8 was not included in the average relative integrated density for pdr18 ∆ strain. There were three biological replicates for each strain. ttest function in Microsoft Excel 2007 was used to find whether the relative integrated pixel density between strains is significantly different.

On the other hand, in zinclimited medium, both pdr15 ∆ and pdr18 ∆ strains have similar

Zrc1p proteins levels compared to the wildtype strain (Figure 22). It is interesting to note that there were also no changes in ZRC1 mRNA levels in pdr15 ∆ and pdr18 ∆ strains in zinclimited medium compared to the wildtype strain (Figure 19). There was one pdr18 ∆ colony in both

100

Figure 21 and Figure 22 that did not produce a detectable VP16 signal in the Western blot. It appears that Cub YFPVP16LexA MYTH tag integrated downstream of ZRC1 ORF in the pdr18 ∆ strain was possibly disrupted in these colonies resulting in no detectable signal.

Therefore, colonies that did not produce a detectable signal were omitted from the quantification of average relative integrated pixel density.

Figure 22 : Zrc1p protein levels in zinclimited medium. (A) Western blot for Zrc1p and hexokinase (loading control) protein levels in wildtype (WT), pdr15 ∆ and pdr18 ∆ strains. (B) Relative integrated pixel density was calculated by dividing integrated pixel density from VP16 signal by integrated pixel density from hexokinase signal. In zinclimited medium, pdr15 ∆ and pdr18 ∆ strains have similar levels of Zrc1p compared to the wildtype strain. There was no detectable VP16 signal in lane 8 possibly due to disruption of Cub YFPVP16LexA MYTH tag. Integrated pixel density from lane 8 was not included in the average relative integrated density for pdr18 ∆ strain. There were three biological replicates for each strain. ttest function in Microsoft Excel 2007 was used to find whether the relative integrated pixel density between strains is significantly different.

In zincreplete medium, pdr15 ∆ strain has similar and pdr18 ∆ strain has lower Zrt1p protein levels ( p value ≤ 0.001) compared to the wildtype strain (Figure 23). Interestingly, both mRNA and protein levels of Zrt1p decreased in the pdr18 ∆ strain compared to the wildtype strain in zincreplete medium. On the other hand, ZRT1 mRNA levels increased with no changes in protein levels in the pdr15 ∆ strain compared to the wildtype strain in zincreplete medium.

101

Figure 23 : Zrt1p protein levels in zincreplete medium. (A) Western blot for Zrt1p and hexokinase (loading control) protein levels in wildtype (WT), pdr15 ∆ and pdr18 ∆ strains. (B) Relative integrated pixel density was calculated by dividing integrated pixel density from VP16 signal by integrated pixel density from hexokinase signal. In zincreplete medium, pdr15 ∆ strain has similar and pdr18 ∆ strain has lower levels ( p value ≤ 0.001) of Zrt1p compared to the wildtype strain. There were three biological replicates for each strain. ttest function in Microsoft Excel 2007 was used to find whether the relative integrated pixel density between strains is significantly different.

Moreover, there might possibly be a similar trend for Zrt1p protein levels in zinclimited medium (Figure 24). In zinclimited medium, pdr15 ∆ strain has similar and pdr18 ∆ strain has possibly lower Zrt1p protein levels (not significant due to large variation) compared to the wild type strain. It is interesting to note that both mRNA and protein levels of Zrt1p in pdr15 ∆ strain were similar to the wildtype strain in the zinclimited medium. On the other hand, protein levels of Zrt1p appear to decrease with no changes in the ZRT1 mRNA levels in the pdr18 ∆ strain compared to the wildtype strain in zinclimited medium.

102

Figure 24 : Zrt1p protein levels in zinclimited medium. (A) Western blot for Zrt1p and hexokinase (loading control) protein levels in wildtype (WT), pdr15 ∆ and pdr18 ∆ strains. (B) Relative integrated pixel density was calculated by dividing integrated pixel density from VP16 signal by integrated pixel density from hexokinase signal. In zinclimited medium, pdr15 ∆ strain has similar and pdr18 ∆ strain has lower levels (not significant) of Zrt1p compared to the wildtype strain. There were three biological replicates for each strain. ttest function in Microsoft Excel 2007 was used to find whether the relative integrated pixel density between strains is significantly different.

3.5.4: Zrc1p and Zrt1p Properly Localize in pdr15 ∆ and pdr18 ∆ strains

Localization of Zrc1p and Zrt1p was investigated in pdr15 ∆, pdr18 ∆ and wildtype

(Y7092) strains to see whether alteration of zinc homeostasis upon deletion of PDR15 and

PDR18 results from mislocalization of zinc transporters. The C ub YFPVP16LexA MYTH tag was integrated downstream and continuous with the ORFs of ZRC1 and ZRT1 in order to allow for visualization of protein localization using fluorescence microscopy. As expected, Zrc1p fused to the YFP tag correctly localized to the vacuolar membrane (Figure 25).

103

Figure 25 : Zrc1p fused to C ub YFPVP16LexA correctly localizes to the vacuolar membrane. FM464 dye was used as a vacuolar membrane marker. This is a wildtype strain (Y7092) grown in zinclimited medium. The experiment was performed at least twice.

The localization of Zrc1p was qualitatively similar in the pdr15 ∆ and wildtype strains in both zincreplete and zinclimited media (Figure 26AD). The expression of Zrc1p (as determined by intensity of YFP signal) in both the pdr15 ∆ and wildtype strains appeared qualitatively stronger in zinclimited medium than in zincreplete medium. This is expected because cells upregulate Zrc1p in zinclimited conditions to prepare for potential over accumulation of zinc due to the cell’s high capacity for zinc uptake in zinclimiting conditions.

Interestingly, vacuolar membrane expression of Zrc1p was very weak in the pdr18 ∆ strain in zincreplete medium (Figure 26E; Zrc1p signal in the pdr18 ∆ strain was very weak so it was enhanced for visibility). There was no Zrc1p signal detected in the pdr18 ∆ strain in zinclimited medium possibly due to disruption of Cub YFPVP16LexA MYTH tag in the colony used during the experiment (Figure 26F). Overall, the results suggest that Zrc1p is not mislocalized in the pdr15 ∆ and pdr18 ∆ strains.

104

105

Figure 26 : (AD) Zrc1p fused to the C ub YFPLexAVP16 tag is correctly localized to the vacuolar membrane in the wildtype (Y7092) and pdr15 ∆ strains in both zincreplete medium and zinclimited medium. Zrc1p expression is qualitatively greater in zinclimited medium than in zincreplete medium for both wildtype and pdr15 ∆ strains. (E) Zrc1p is localized to the vacuolar membrane in the pdr18 ∆ strain in zincreplete medium but the expression is very weak. The YFP signal was very weak so it was enhanced for visibility. (F) Zrc1p signal was not detected in the pdr18 ∆ strain grown in zinclimited medium, possibly due to disruption of Cub YFPVP16LexA MYTH tag in the colony used during the experiment. The YFP image is enhanced because the signal is very weak. Overall, the results suggest that Zrc1p is not mislocalized in pdr15 ∆ and pdr18∆ strains. The experiment was performed at least twice.

Zrt1p fused to the YFP tag localized to three different places: the plasma membrane, in punctate structures near the plasma membrane, and intracellularly. The punctate structures near the plasma membrane, and intracellular expression of Zrt1p did not colocalize with the FM464 dye, which suggest that they do not correspond to the vacuoles (Figure 27).

Figure 27 : Zrt1p fused to the Cub YFPVP16LexA tag localized to three different places: the plasma membrane, in punctate structures near the plasma membrane, and intracellularly. The punctate structures near the plasma membrane, and intracellularly expressed Zrt1p did not colocalize with the FM464 dye (marker for the vacuolar membrane), which suggest that they do not correspond to the vacuoles. The experiment was performed at least twice.

Punctate structures near the plasma membrane may correspond to zincosomes.

Zincosomes do not correspond to the vacuole, Golgi or the prevacuolar compartment. No function is currently ascribed to zincosomes but they may be sites for zinc storage/zinc

106 detoxification or serve as a buffer system for cytosolic zinc to protect the cell from transient perturbations of zinc homeostasis (Eide 2006). The intracellular localization of Zrt1p may correspond to endocytic vesicles because excess Zrt1p from the plasma membrane is removed via endocytosis and broken down in the vacuole (Gitan and Eide 2000). The intracellular localization may also correspond to the ER and Golgi because new Zrt1p travels to the plasma membrane via the secretory pathway.

The localization of Zrt1p was qualitatively similar between the wildtype and pdr15 ∆ strains in both zincreplete and zinclimited media (Figure 28AD). Interestingly, the qualitative expression of Zrt1p is extremely low in pdr18 ∆ strain in zincreplete medium (Figure 28E; the image needed to be enhanced for visibility). There appears to be no punctate structures near the plasma membrane and localization is primarily plasma membrane and intracellular. However, in zinclimited medium, the expression of Zrt1p in pdr18 ∆ strain is qualitatively much higher than when the same strain is grown in zincreplete medium (Figure 28F). In zinclimited medium,

Zrt1p is localized to all three places (plasma membrane, punctate structures near the plasma membrane and intracellular vesicles) like the wildtype strain. Overall, the results suggest that

Zrt1p is not mislocalized in pdr15 ∆ and pdr18∆ strains.

107

108

Figure 28 : Zrt1p fused to the Cub YFPLexAVP16 tag localized to three different places: the plasma membrane, in punctate structures near the plasma membrane, and intracellularly. (AD) The localization of Zrt1p was similar between the wildtype and pdr15 ∆ strains in both zincreplete and zinclimited media. (E) The expression of Zrt1p is extremely weak in pdr18 ∆ strain when grown in zincreplete medium. There are no punctate structures near the plasma membrane and localization is primarily plasma membrane and intracellular. The YFP image is enhanced because the signal is very weak. (F) In zinc limited medium, the expression of Zrt1p in pdr18 ∆ strain is qualitatively much higher compared to the same strain grown in zincreplete medium. Zrt1p is localized to all three places (plasma membrane, punctate structures near the plasma membrane and intracellular vesicles) like the wildtype strain. Overall, the results suggest that Zrt1p is not mislocalized in pdr15 ∆ and pdr18∆ strains. The experiment was repeated at least twice.

The qRTPCR, Western blot and fluorescence microscopy results for Zrc1p and Zrt1p in the pdr15 ∆, pdr18 ∆ and wildtype strains are summarized in Table 9.

Table 9: Summary of qRTPCR, Western Blot and Fluorescence Microscopy Results for Zrc1p and Zrt1p in the pdr15 ∆, pdr18 ∆ and Wildtype (Y7092) Strains

Gene/Protein Experiment pdr15 ∆ pdr18 ∆ ZRC1 /Zrc1p qRTPCR (mRNA) • Increase in ZRC1 mRNA • Increase in ZRC1 mRNA levels in zincreplete levels in zincreplete medium medium • No changes in ZRC1 • No changes in ZRC1 mRNA levels in zinc mRNA levels in zinc limited medium limited medium Western blot (protein) • No changes in Zrc1p • Decrease in Zrc1p protein levels in both zinc protein levels in zinc replete and zinclimited replete medium medium • No changes in Zrc1p protein levels in zinc limited medium Localization • Zrc1p is properly localized • Zrc1p is properly to the vacuolar membrane localized to the vacuolar in both zincreplete and membrane in zinc zinclimited media replete medium • Zrc1p signal was not detected in zinclimited medium ZRT1 /Zrt1p qRTPCR (mRNA) • Increase in ZRT1 mRNA • Decrease in ZRT1 levels in zincreplete mRNA levels in zinc medium replete medium • No changes in ZRT1 • No changes in ZRT1 mRNA levels in zinc mRNA levels in zinc limited medium limited medium Western blot (protein) • No changes in Zrt1p • Decrease in Zrt1p protein levels in both zinc protein levels in zinc

109

replete and zinclimited replete medium media • No significant changes in Zrt1p protein levels in zinclimited medium Localization • Wildtype localization in • Wildtype localization in both zincreplete and zinc both zincreplete and limited media zinclimited media • Zrt1p expression was qualitatively weak in zincreplete medium

110

Chapter 4: Discussion

111

4.1: Analysis of ABC Transporter ProteinProtein Interactome

MYTH screening found 23 interactors for Nft1p, 22 interactors for Pdr10p, 4 interactors for Pdr18p and 1 interactor for Vmr1p. Out of the 43 total unique interactors, 28 hits were categorized as membrane associated, 14 hits as nonmembrane, and 1 hit had unknown localization. This is reflected in GO Annotation cellular component enrichment analysis, which found that ABC transporter interactors are enriched in membrane component (62.8% of the hits)

(see Figure 14). It is not surprising to see that majority of interactors are membrane associated because the 4 ABC transporters themselves are localized to the plasma and vacuolar membranes.

Many hits interacted with multiple baits. Pdr11p interacted with Nft1p, Pdr10p and

Pdr18p. Ygl081wp interacted with both Nft1p and Vmr1p. Zrc1p interacted with both Pdr10p and Pdr18p. Erg9p, Ptr2p and Cos1p interacted with both Nft1p and Pdr10p. This is expected because many ABC transporters have overlapping functions and are involved in similar biological processes. For example, both Ycf1p and Bpt1p are involved in transport of cadmium and glutathione conjugates (Paumi, Chuk et al. 2009).

The 43 total interactors were categorized into distinct functional categories. There were

11 interactors involved in metabolism, 9 interactors involved in transport, 8 interactors with unknown function, 4 interactors involved in trafficking and secretion, 3 interactors involved in protein folding, 2 interactors involved in stress response, and 1 interactor in each of the following categories: cell wall assembly, cytoskeleton maintenance, nuclear function, protein degradation, protein modification and protein synthesis. Interestingly, the protein interactors are involved in a range of biological processes, and their observed interaction with the 4 ABC transporters may be a reflection of the broad substrate specificities of the ABC transporters in general. The ABC transporter interactome suggests a possible role of ABC transporters in

112 metabolism, sphingolipid and ergosterol biosynthesis, transport, osmoregulation, and cell wall assembly, and this is discussed in detail in the following sections.

4.1.1: Metabolism

11 hits in the ABC transporter interactome were involved in metabolism. This is reflected in the GO biological process enrichment analysis, which found that ABC transporter interactors are enriched in metabolic processes (18.6% of hits), lipid biosynthetic processes

(9.3% of hits), gluconeogenesis (7.0% of hits), glycolysis (7.0% of hits), ergosterol biosynthetic processes (7.0%), steroid biosynthetic processes (7.0% of hits), and deoxyribonucleotide biosynthetic processes (4.7% of hits) (see Figure 14). 2 hits (Pro3p and Trp5p) are involved in amino acid metabolism, 4 hits (Pdc1p, Tpi1p, Fba1p and Pgk1p) are involved in carbohydrate metabolism, 4 hits (Erg9p, Erg27p, Erg28p, Orm2p) are involved in lipid metabolism and 1 hit

(Rnr4p) is involved in nucleotide metabolism. Out of 11 metabolic hits, 7 interacted with Nft1p only (Pro3p, Trp5p, Pdc1p, Tpi1p, Fba1p, Pgk1p, Rnr4p), 3 interacted with Pdr10p only

(Erg27p, Erg28p, Orm2p), and Erg9p interacted with both Nft1p and Pdr10p.

ABC transporters have previously been shown to be involved in many metabolic processes. For example, the S. cerevisiae Pxa1p and Pxa2p are required for transport of long chain fatty acids into peroxisomes (Hettema, van Roermund et al. 1996). The human homolog of Pxa1p and Pxa2p is ABCD1, which is also responsible for transporting very long chain fatty acids and it is linked to adrenoleukodystrophy (Stefkova, Poledne et al. 2004). Moreover, bacterial ABC transporters play an essential role in uptake of nutrients, including amino acids and sugars (Davidson, Dassa et al. 2008). Human ABCG5 and ABCG8 play a role in lipid metabolism and mutations in either gene can cause sitosterolemia resulting in atherosclerosis and cardiac infarct. Human ABCA1, MDR3 and other ABCGs are also involved in lipid

113 metabolism and transport (Glavinas, Krajcsi et al. 2004). Furthermore, human ABCB4,

ABCB11 and ABCC2 are involved in bileacid transport. ABCB4 and ABCB11 are linked to progressive familial intrahepatic cholestasis, and ABCC2 is linked to DubinJohnson syndrome

(Stefkova, Poledne et al. 2004). Likewise, Ybt1p in S. cerevisiae is involved in bile acid transport (Ortiz, St Pierre et al. 1997). Human ABCB6, ABCB7, ABCB8 and ABCB10 localize to mitochondria and are involved in iron metabolism (Stefkova, Poledne et al. 2004). Similarly,

Atm1p is involved in iron homeostasis in mitochondria of S. cerevisiae (Lill and Kispal 2001).

Given the numerous examples reported in the literature for involvement of ABC transporters in metabolic processes and transport of metabolic products, it is not surprising that

11 out of 43 (25.6%) ABC transporter interactors in S. cerevisiae are involved in metabolic processes. The proteinprotein interactome generated in this project reveals that ABC transporters may play an essential role in many metabolic processes inside the cell. While the exact meaning of these interactions in unclear at the moment, followup experiments should allow us to determine the specific biological relevance of these metabolic associations.

Perhaps, ABC transporters are possibly involved in transport of metabolic substrates, intermediates, and end products. Interestingly, the yeast vacuole is a major site for macromolecular degradation and metabolite storage (Klionsky, Herman et al. 1990). Given the numerous interactions of Nft1p with metabolic proteins, Nft1p might be involved in transportation of metabolites across the vacuolar membrane for waste removal, detoxification, degradation, compartmentalization and/or storage purposes in the yeast vacuole. It is interesting to note that the vacuolar ATPase plays an important role in metabolite transport by generating an electrochemical potential difference of protons across the vacuolar membrane. The proton gradient then provides the major driving force for the transport of most metabolites via proton

114 antiporters and secondary active transport (Li and Kane 2009). Given the importance of the vacuole inside the cell, ABC transporters like Nft1p might provide a redundant mechanism of transport of various metabolites across the vacuolar membrane. This is supported by observation that many vacuolar acidificationdependent processes are only moderately affected upon deletion of yeast vacuolar ATPase subunits (Li and Kane 2009). Moreover, ABC transporters may also provide means of transport for large metabolites that cannot be transported via secondary active transport. For example, the ABC transporter Ycf1p was previously found to play an important role in transporting bilirubinlike pigments, derived from the degradation of hemecontaining proteins, across the vacuolar membrane (Petrovic, Pascolo et al. 2000). The role of ABC transporters, such as Nft1p in transporting metabolites across vacuolar membrane can be studied using transport assays that measure the transport of a specific labelled metabolite across the vacuole in the presence or absence of the ABC transporter. Given the large number of possible metabolites that may be transported by the ABC transporter, the list of possible candidates can be narrowed by doing a global metabolite profiling on vacuolar extracts (or cell extracts) from wildtype and ABC transporter deleted strain using gas chromatography and mass spectrometry (Schneider, Kromer et al. 2009).

4.1.2: Sphingolipid Biosynthesis

Sphingolipids are a class of lipids that are fatty acid derivatives of sphingoid bases. They are found mainly in the membranes and play an important role in many cellular processes, such as signal transmission and cell signalling. In yeast, sphingoid bases are dihydrosphingosine and phytosphingosine. Yeast dihydrosphingosine is a 16, 18 or 20 carbon amino alcohol with a saturated hydrocarbon chain. Phytosphingosine can contain 18 or 20 carbons, and it is a 4 hydroxy derivative of dihydrosphingosine. The fatty acid in yeast sphingolipids is usually saturated with 26 carbons, and can contain zero, one or two hydroxyl groups (Dickson 2008).

115

Previously, it was reported that Pdr10p requires mature sphingolipids to function, and Pdr10p displays a genetically interaction with Ipt1p and Sur1p, two proteins that are involved in sphingolipid biosynthesis (Rockwell, Wolfger et al. 2009). Consistent with this involvement, our MYTH screening identified an interaction between Pdr10p and Orm2p, a protein thought to control membrane biogenesis by coordinating lipid homeostasis with protein quality control in the ER. Interestingly, the ORM2 human homolog (ORMDL3) is an asthma susceptibility gene.

Orm2p has physical and genetic interactions with many proteins involved in sphingolipid synthesis, including serine palmitoyltransferase (Lcb1p and Lcb2p), which are responsible for the first committed step in sphingolipid synthesis. In addition, deletion of both ORM1 and

ORM2 causes accumulation of the sphingolipid precursor phytosphingosine, which suggests that absence of these proteins causes dysregulation of sphingolipid synthesis. Deletion of both

ORM1 and ORM2 also results in inositol auxotrophy and impaired transcriptional regulation of genes encoding phospholipid biosynthesis enzymes. Other phenotypes include unfolded protein response, sensitivity to stress, and slow ERtoGolgi transport. Intriguingly, these pleiotropic phenotypes are suppressed if sphingolipid homeostasis is disrupted by the addition of myriocin to ORM1 and ORM2 deleted strains, which suggests that alterations in sphingolipid homeostasis cause the appearance of these varied phenotypes (Han, Lone et al. 2010). The role of Orm2p in sphingolipid homeostasis, and the requirement of sphingolipids for Pdr10p function suggest a complex regulatory role for Orm2p. Perhaps, Orm2p is required for maturation and proper folding of Pdr10p as it is synthesized in the ER by providing a proper lipid environment. This hypothesis is supported by previous studies which found that knock down of ORM2 homologs in humans caused impaired maturation of nicastrin, a component of the gamma secretase complex (Araki, TakahashiSasaki et al. 2008). If Orm2p is required for proper maturation of

Pdr10p then deletion of ORM2 should result in phenotypes observed in pdr10 ∆ strain, as Pdr10p

116 function should be impaired in the absence of Orm2p. A followup experiment to test this hypothesis would be to challenge orm2 ∆ and orm1∆orm2 ∆ strains with compounds that produce a sensitivity or resistance in pdr10 ∆ strain, including calcofluor white, congo red, potassium sorbate, dodecyl phosphocholine, and dodecyl maltoside, to assess the function of Pdr10p in the absence of Orm2p (Rockwell, Wolfger et al. 2009).

4.1.3: Ergosterol Biosynthesis and Transport

Sterols, such as cholesterol and ergosterol, are steroid alcohols. A steroid is an organic compound that contains four cycloalkane rings joined together. Sterols play an important role in cell physiology, including affecting cell membrane’s fluidity and playing a role in signalling.

Ergosterol is the main sterol found in fungi, and it is a component of cell membranes where it modulates membrane fluidity (Jacquier and Schneiter 2012). It is interesting to note that there were three proteins in the ABC transporter interactome that are part of the sterol biosynthesis pathway. In MYTH, Pdr10p interacted with Erg27p and Erg28p, and both Nft1p and Pdr10p interacted with Erg9p. Erg9p, Erg27p and Erg28p are all important components of the sterol biosynthesis pathway (Fegueur, Richard et al. 1991; Gachotte, Sen et al. 1999; Mo, Valachovic et al. 2004). The ER is the major site for synthesis of membrane lipids, including sphingolipids, phospholipids, and sterols (Han, Lone et al. 2010). Previously, Pdr18p was reported to play an essential role in plasma membrane sterol composition and incorporation because deletion of

PDR18 causes accumulation of precursors, and reduction of endproducts, of the ergosterol biosynthetic pathway in the plasma membrane (Cabrito, Teixeira et al. 2011). Whether Nft1p and Pdr10p play a similar role in the plasma membrane sterol composition and incorporation should be further tested by investigating the effects of PDR10 and NFT1 deletion on the levels of ergosterol biosynthetic pathway metabolites. It is thought that newly synthesized ergosterol is transported from the ER to the plasma membrane via two separate mechanisms. The first

117 mechanism is dependent on vesicular transport, while the second mechanism is dependent on

ATP but independent of vesicular transport (Sullivan, OhvoRekila et al. 2006). The non vesicular transport is thought to occur at narrow cytoplasmic gaps called membrane contact sites

(or MCSs) where two organelles come into close proximity (Levine 2004). So far no transporter is implicated in the nonvesicular ergosterol movement, but Pdr18p is thought to contribute to this physiological function (Cabrito, Teixeira et al. 2011). The potential role of Nft1p, Pdr10p and Pdr18p in nonvesicular ATP dependent sterol transport can be studied using radiolabelled

[3H]ergosterol (Sullivan, OhvoRekila et al. 2006). If deletion of these ABC transporters causes impairment in sterol transport, it will provide evidence that ABC transporters are important for nonvesicular ATP dependent transport of sterols from the ER to the plasma membrane. It is interesting to note that two ABC transporters (Aus1p and Pdr11p) have previously been found to mediate nonvesicular movement of plasma membrane sterol to the ER (Li and Prinz 2004).

Perhaps, ABC transporters are important for bidirectional transport of sterols between the ER and plasma membrane, and this needs to be studied further.

4.1.4: ABC Transporter Interactors Involved in Transport Function

Nine hits in the ABC transporter interactome have transport function. These include:

Agp1p, Flc1p, Fps1p, Gup2p, Pdr11p, Ptr2p, Vba4p, Zrc1p, and Zrt1p. The major function of

ABC transporters is to move substrates across membranes. Thus, it is not surprising to see that several interactors of ABC transporters are also involved in the transport of substrates. There are many possible reasons for proteinprotein interactions between the ABC transporters and other transporters. The ABC transporter may regulate the localization and function of another transporter, like Pdr10p regulates the plasma membrane localization of Pdr12p (Rockwell,

Wolfger et al. 2009). The two transporters may also be energy coupled, such that the ATP hydrolysis or movement of substrate through the ABC transporter provides energy for transport

118 of substrates through another transporter or open and closes a channel. For example, the sulfonylurea receptors ABCC8/SUR1 and ABCC9/SUR2 couple ATP hydrolysis to potassium channels regulation (Bryan, Munoz et al. 2007). Pdr11p, Fps1p and Gup2p are discussed in detail in the following sections to discuss the possibility of ABC transporters forming complexes with each other, and a possible role of ABC transporters in osmoregulation.

4.1.4.1: ABC Transporter Complexes

Pdr11p as a prey interacted with four ABC transporters in MYTH: Nft1p, Pdr10p,

Pdr12p and Pdr18p. Pdr11p and Aus1p are involved in sterol uptake under anaerobic growth when sterol biosynthesis is compromised (Wilcox, Balderes et al. 2002). Previously, other ABC transporters have also been implicated in sterol metabolism and plasma membrane maintenance.

For example, Pdr18p is suggested to play a role in plasma membrane sterol incorporation

(Cabrito, Teixeira et al. 2011), and Pdr5p, Yor1p and Pdr10p are implicated in plasma membrane asymmetric distribution (Rockwell, Wolfger et al. 2009). The interaction of Pdr11p with multiple ABC transporters suggests two things. First, multiple ABC transporters appear to be involved in sterol transport, and plasma membrane maintenance. Second, ABC transporters may interact with each other possibly to regulate function and localization of each other, or form a functional homo or heterodimers to transport their overlapping substrates. As mentioned above, Pdr10p is previously reported to regulate Pdr12p localization and expression, which provides an excellent example of an ABC transporter regulating another ABC transporter function (Rockwell, Wolfger et al. 2009). In addition, deletion of YOR1 , SNQ2 or PDR5 affects the mRNA and protein levels of the remaining paralogues, which suggests the existence of a complex regulatory mechanism to maintain homeostatic levels of individual ABC transporter

(Kolaczkowska, Kolaczkowski et al. 2008). If the proteinprotein interaction between ABC transporters in MYTH has regulatory function then the deletion of one transporter should affect

119 the levels, function and/or localization of the other transporters. On the other hand, ABC transporters might be interacting with each other to form functional complexes. We know that

ABC half transporters, such as Pxa1p and Pxa2p, are known to dimerize to form a functional transporter. But it is very interesting to note that human CFTR, a full length functional ABC transporter, also homodimerizes to form a single chloride channel (Zerhusen, Zhao et al. 1999).

Therefore, one possibility for proteinprotein interaction between ABC transporters in MYTH is that full length ABC transporters interact with other ABC transporters and might even dimerize and form large complexes to carry out their function. Coimmunoprecipitation (discussed later in this chapter) and biomolecular association analysis can provide further evidence about whether ABC transporters dimerize with each other and forms complexes in vivo .

4.1.4.2: Possible Role of ABC Transporters In Osmoregulation

The interaction of Fps1p with Nft1p in MYTH is very interesting because it suggests a novel role in osmoregulation for ABC transporters in yeast. Fps1p is a member of major intrinsic protein (MIP) family and it is responsible for glycerol efflux and acetic acid uptake at the plasma membrane (Tamas, Luyten et al. 1999; Wysocki, Chery et al. 2001). In yeast, osmoregulation is regulated by production and accumulation of glycerol, and this is regulated by the high osmolarity glycerol (HOG) signaling system, which converges on Hog1p, a mitogen activated protein kinase (MAPK). During hyperosmotic shock, yeast cells shrink due to water efflux, which results in closing of Fps1p to prevent glycerol leakage. In response, Hog1p stimulates ion export, cell cycle arrest, reduction of translational capacity, and glycolysis to enhance production of glycerol. Once the glycerol levels reach onethird of the maximum,

Hog1p is inactivated by dephosphorylation. In contrast, during hypoosmotic shock cell volume increases, and the Fps1p channel opens to allow glycerol release (Hohmann, Krantz et al. 2007).

It is interesting that Fps1p has previously shown to genetically interact with a number of ABC

120 proteins and transporters including New1p, Pxa1p and Ycf1p, and the PDR transcription factor

Pdr1p (Costanzo, Baryshnikova et al. 2010; MaciaszczykDziubinska, Migdal et al. 2010). In addition, Hog1p also genetically interacts with a number of ABC proteins and transporters

(Mdl2p, New1p, Yor1p), interactors of ABC transporters from MYTH (Get2p and Ptr2p), and the zinc homeostasis transcription factor Zap1p (Costanzo, Baryshnikova et al. 2010; Sharifpoor, van Dyk et al. 2012). Overall, the results reveal that ABC transporters such as Nft1p are possibly involved in osmoregulation in yeast.

Previously, ABC transporters have been shown to play an important role in osmoregulation in bacteria. For example OpuA, an ABC transporter in Lactococcus lactis is both an osmosensor and osmoregulator. Interestingly, this ABC transporter is thought to sense changes in the physical status of the lipid bilayer via lipidprotein interactions (van der Heide and Poolman 2000). Furthermore, Gup2p is a membrane protein with a possible role in uptake of glycerol using proton symport mechanism (Holst, Lunde et al. 2000), and it interacted with

Pdr10p in MYTH. This further supports the possible role of ABC transporters in glycerol transport and osmoregulation. There are two possible explanations for proteinprotein interaction between Nft1p and Fps1p, and Pdr10p and Gup2p. First, ABC transporters might actually transport glycerol and these interactions signify that glycerol transporters and channels are functionally tethered. Second, ABC transporters might have a more complex function in osmoregulation where they sense the osmotic gradient via changes in physical properties of the phospholipid membrane (van der Heide and Poolman 2000), and regulate glycerol channels like

Fps1p and Gup2p. Whether deletion of these ABC transporters affects glycerol accumulation or transport, and sensitivity to hyperosmotic or hypoosmotic stress can be tested to provide evidence for a role of ABC transporters in osmoregulation and glycerol transport. Another possible way to study the role of ABC transporters in osmoregulation is to purify the ABC

121 transporters and attempt to reconstitute the ABC transporter (with or without other glycerol channels) in a proteoliposome with an ATPregenerating system (van der Heide and Poolman

2000). This system could then be used to investigate whether ABC transporters can transport glycerol. Alternatively, small amphipathic molecules can be added to the proteoliposome system to alter the curvature stress in the membrane, a membrane bilayer property that is also affected by osmotic stress (van der Heide and Poolman 2000). This experiment can provide evidence whether ABC transporters have the ability to sense osmotic gradient change in yeast, and alter the transport of glycerol in response.

4.1.5: Cell/Spore Wall Assembly and Maintenance

The ABC transporter interactome from MYTH reveals a possible involvement in cell/spore wall assembly and maintenance. The most interesting interaction is between Gas4p and Nft1p. Gas4p (for GlycophospholipidAnchored Surface protein) localizes to the cell wall and is a 1,3betaglucanosyltransferase involved in spore wall assembly. Gas4p is part of the glycoside hydrolase family 72 (GH72 family) of fungal enzymes, which are involved in cell wall maintenance, and includes Gas1p, Gas2p, Gas3p, Gas4p and Gas5p. Gas4p is expressed mainly during sporulation, but can also function in vegetative growth. Deletion of GAS4 results in a defective spore wall due to improper attachment of the glucan to the chitosan layer (Ragni,

Coluccio et al. 2007). The spore wall in yeast is composed of 4 layers. The two inner layers are shared with the normal cell wall and are composed of mannans and βglucans. The outer two layers are unique to the spore cell wall and are composed of chitosan (a glucosamine polymer) and dityrosine (Suda, Rodriguez et al. 2009). It is interesting to note that Nft1p also has a genetic interaction with both Gas1p and Gas4p (Costanzo, Baryshnikova et al. 2010; Hoppins,

Collins et al. 2011).

122

Another spore wall related interaction detected in our MYTH screen is between Osw5p and Pdr18p. Osw5p (for Outer Spore Wall) is thought to play a role in spore wall assembly because spores from an osw5 ∆ strain exhibit increased sensitivity to betaglucanase digestion compared to the wildtype spores, and the deletion also causes increased spore wall permeability

(Suda, Rodriguez et al. 2009). Interestingly, Osw5p is functionally connected to Gas4p

(interactor of Nft1p in MYTH), which is a 1,3betaglucanosyltransferase involved in spore wall assembly. In addition, Osw5p is also functionally connected to Chs3p (a genetic interactor of

Pdr10p), which is a Chitin Synthase III required for synthesis of the majority of cell wall chitin.

Lastly, Ygl081wp is the only interactor of Vmr1p in MYTH, and it seems to be also involved in chitin biosynthesis. YGL081W deletion results in a decrease in chitin levels, and

Ygl081wp genetically interacts with Chitin Synthase I (Chs1p) and Chs5p, which is a protein involved in export of Chs3p (Tong, Lesage et al. 2004; Lesage, Shapiro et al. 2005; Trautwein,

Schindler et al. 2006).

Overall, it seems that multiple ABC transporters, including Nft1p, Pdr10p, Pdr18p and

Vmr1p, may be involved in yeast cell wall and spore wall assembly and maintenance. It will be interesting to investigate whether deletion of these ABC transporters results in alterations to the cell and spore wall. A simple experiment like one previously used by researchers to screen for mutants with altered spore wall permeability can be used to test the role of ABC transporters in spore and cell wall function (Suda, Rodriguez et al. 2009). The experiment first requires the generation of diploid strains homozygously deleted for individual ABC transporters. The next step would be to obtain spores from the ABC transporter deleted strains and then test for defects and alterations in the permeability of the outer spore wall using a βglucanase digestion assay.

Normal spores are resistant to βglucanase digestion because the βglucan layer is shielded by

123 the outer wall layers. If the spores from ABC transporter deleted strains are more sensitive to β glucanase digestion, it would provide further evidence that ABC transporters are important for spore outer wall synthesis and assembly. The effect of ABC transporter deletion on the spore outer layer can also be measured using a dityrosine fluorescence assay to detect any abnormalities in the dityrosine layer (Suda, Rodriguez et al. 2009). Alternatively, changes in the cell wall can be studied in haploid ABC transporter deleted strains by measuring the cells sensitivity or resistance to chitin binding agent, such as Calcofluor white, to detect abnormal levels of cell wall chitin (Rockwell, Wolfger et al. 2009). Furthermore, individual components of the cell wall including β1,3Glucan, β1,6Glucan, chitin, chitosan and mannoproteins can be quantitatively measured in wildtype and ABC transporter deletes to find evidence for changes in cell wall components.

One possible explanation for why ABC transporters physically interact with proteins involved in cell wall assembly comes from studies on Pdr10p. Deletion of PDR10 results in an abnormal amount of cell wall chitin and sensitivity to the chitinbinding agent Calcofluor White due to reduced endocytosis of the chitin synthase Chs3p (Rockwell, Wolfger et al. 2009). This suggests that proteinprotein interaction with ABC transporters may be regulating levels or localization of proteins involved in cell wall function. This can be tested by deleting individual

ABC transporters and observing any changes in levels or localization of cell wall proteins using fluorescence microscopy. ABC transporters might also be interacting with these cell wall proteins to directly deliver substrates from the cytoplasm to enzymes for cell and spore wall synthesis. This can be tested using transport assays which investigate whether these ABC transporters have the ability to transport substrates involved in cell synthesis, such as glucose and Nacetylglucosamine.

124

4.2: Analysis of Zinc Shock Phenotype for pdr15 ∆ and pdr18 ∆ strains

There were two zinc transporters (Zrc1p and Zrt1p) in the ABC transporter interactome.

Zrc1p is localized to the vacuolar membrane and it is responsible for transporting zinc from the cytoplasm into the vacuole. Zrt1p is localized to the plasma membrane and it is responsible for majority of zinc uptake in zinc limiting conditions (Eide 2006). Previously, ABC transporters were not implicated to play an important role in zinc metabolism and homeostasis. We found through MYTH that ABC transporters are possibly involved in zinc metabolism and homeostasis because they interact with zinc transporters. In MYTH screening, Pdr5p, Pdr10p and Pdr15p interacted with Zrt1p; and Pdr10p and Pdr18p interacted with Zrc1p (Pdr5p and

Pdr15p screening were done by others in the lab as part of our efforts to map the entire ABC transporter interactome in yeast).

Zinc shock occurs when cell are grown under zinclimited conditions and then resupplied with low amounts of zinc. During zinclimited conditions, cells upregulate the plasma membrane transporter Zrt1p to increase the cells capacity for zinc uptake. Thus, when zinc is resupplied, cells accumulate large amounts of zinc before transcriptional and post translational mechanisms can shut off Zrt1p and additional zinc uptake. Excess zinc causes toxicity and cell stress, because zinc competes with other metal ions for the active sites of enzymes and proteins (MacDiarmid, Milanick et al. 2003).The yeast vacuole is a major site for zinc sequestration and detoxification. Mutants, such as zrc1 ∆ strains, that are unable to transport excess zinc into the vacuole during zinc shock are sensitive to extremely low zinc concentrations (Eide 2006). Moreover, ZRC1 is upregulated by Zap1p transcription factor in zinclimiting conditions as a proactive mechanism to avoid over accumulation of zinc. The proactive strategy is a much faster response than poststress induction of zinc tolerance genes and removal of Zrt1p from the plasma membrane (Miyabe, Izawa et al. 2000; MacDiarmid,

125

Milanick et al. 2003). In the presence of zinc, transcription of ZRT1 is repressed and Zrt1p is removed from the plasma membrane via zincinduced endocytosis and subsequently degraded in the vacuole (Gitan, Luo et al. 1998).

I decided to test the role of ABC transporters in zinc metabolism and homeostasis by investigating the effect of ABC transporters deletion on zinc shock sensitivity. The results demonstrated deletion of both PDR15 and PDR18 caused a slow growth phenotype compared to the wildtype (Y7092) strain in the zinc shock assay. This suggests that Pdr15p and Pdr18p are involved in zinc homeostasis and tolerance against zinc shock. I hypothesize that deletion of

PDR15 and PDR18 may cause sensitivity to zinc shock due to an inadequate or defective zinc removal system, or an increased capacity for zinc uptake. Thus, deletion of PDR15 and PDR18 may cause over accumulation of zinc, decrease in zinc removal or both. The mRNA levels, protein levels and localization of Zrc1p and Zrt1p were studied in pdr15 ∆ and pdr18 ∆ strains to investigate whether the zinc removal or uptake system is different from that in the wildtype strain. Although there are other zinc transporters in yeast, I chose to focus on Zrc1p and Zrt1p for two reasons. First, Zrc1p and Zrt1p were the only two zinc transporters that interacted with

ABC transporters in our MYTH screen. Second, Zrc1p and Zrt1p are the two main and most important transporters in zinc transport. Zrc1p is the major vacuolar membrane zinc transporter and responsible for the majority of zinc removal from the cytoplasm; and Zrt1p is the major plasma membrane zinc transporter and responsible for the majority of zinc uptake.

4.2.1: Alterations in Zinc Homeostasis in pdr15 ∆ strain

Deletion of PDR15 causes sensitivity to zinc shock, perhaps due to defective zinc removal system, or an increased capacity for zinc uptake. Interestingly, deletion of PDR15 caused a small increase in ZRC1 mRNA levels in zincreplete medium but there was no change

126 in ZRC1 mRNA levels in zinclimited medium compared to the wildtype. Moreover, there were no changes in Zrc1p protein levels and localization between the pdr15 ∆ and wildtype strain in both zincreplete and zinclimited media according to Western blot and live microscopy. ZRT1 mRNA levels were also increased due to deletion of PDR15 in zincreplete medium, with no changes in mRNA levels in zinclimited medium compared to the wildtype strain. Like Zrc1p, protein levels and localization of Zrt1p were also similar between the pdr15 ∆ and wildtype strain.

It is not surprising to see that there were no changes in mRNA levels for both ZRC1 and

ZRT1 between pdr15 ∆ and wildtype strain in zinclimited medium. One possible reason is that

Zap1p is maximally active under low zinc conditions, and thus, will maximize the transcription of ZRC1 and ZRT1 (Eide 2006). Therefore, if the transcription changes caused by PDR15 deletion are small, they will not be observed in zinclimited medium because the transcription of both ZRC1 and ZRT1 will be saturated. To observe the small differences in transcription, it is better to look at mRNA levels and transcription in zincreplete medium where Zap1p is not maximally active, and thus, any small changes in ZRC1 and ZRT1 transcription caused by deletion of PDR15 can be observed. Another possible explanation is the presence of a transcriptional repressor, which blocks the transcription of ZRC1 and ZRT1 under zincreplete conditions, but not under zinclimited conditions. Deletion of PDR15 may result in removal of this transcriptional repression, and cause ZRC1 and ZRT1 mRNA levels to increase. However, since this transcriptional repression is normally eliminated in zinclimited conditions, there would be no effect of PDR15 deletion on ZRC1 and ZRT1 transcription in low zinc conditions.

In zincreplete medium, deletion of PDR15 only caused a modest 28.3% increase in mRNA levels of ZRC1 , whereas there was a much larger 100% increase in mRNA levels of

127

ZRT1 compared to the wildtype strain. It is interesting to note that Pdr15p only interacted with

Zrt1p in MYTH, and did not interact with Zrc1p. This may explain why there is a larger change in ZRT1 mRNA levels than ZRC1 mRNA levels. In contrast, deletion of PDR15 did not cause a corresponding change in protein levels of Zrc1p and Zrt1p according to Western blot. Neither were there any changes observed in Zrc1p and Zrt1p localization between pdr15 ∆ and wildtype strain in live microscopy. An argument can be made that no changes for Zrc1p protein levels were detected by Western blot because there was only a modest increase in ZRC1 transcription, and perhaps Western blot is not sensitive enough to detect small protein level differences between the pdr15 ∆ and wildtype. However, the increase in ZRT1 mRNA levels in pdr15 ∆ was substantial. This suggests that there is a faster rate of synthesis for Zrt1p but also an increased rate of turnover for Zrt1p in pdr15 ∆ strain resulting in similar levels of Zrt1p to the wildtype strain.

Perhaps, the proteinprotein interaction between Pdr15p and Zrt1p is required to stabilize

Zrt1p at the plasma membrane. Without Pdr15p at the plasma membrane in the pdr15 ∆ strain,

Zrt1p is less stable resulting in an increase in turnover and degradation of the protein. This in return will cause the transcription of ZRT1 to increase and replenish Zrt1p at the plasma membrane. We did not see any changes in Western blots because it was looking at gross levels of Zrt1p. One possibly way to test for changes in the stability of Zrt1p is to use a “pulsechase” experiment using a radioactive amino acid. During the “pulse” part of the experiment, cells will be exposed to a labelled amino acid, which will incorporate into Zrt1p. During the “chase” part of the experiment, cells will be allowed to grow normally and incorporate natural amino acids.

Afterwards, levels of radiolabelled Zrt1p between the wildtype and pdr15 ∆ strains will tell us whether stability of Zrt1p is affected by deletion of PDR15 (Yamaguchi, Inoue et al. 2009).

128

The model that Pdr15p is stabilizing Zrt1p at the plasma membrane can also explain the zinc shock sensitivity caused by PDR15 deletion. In zinclimited medium, deletion of PDR15 leads to a less stable Zrt1p at the plasma membrane. This in return causes cell to upregulate other zinc transporters at the plasma membrane, such as Zrt2p and Fet4p, to maintain high zinc capacity uptake. In addition, cells may also upregulate Zrt3p at the vacuolar membrane to transport zinc from vacuole into the cytoplasm. Therefore, now you have a condition where

Zrt1p is still synthesized but you also have upregulation of other zinc transporters leading to a large increase in zinc uptake capacity. Upon addition of zinc, pdr15 ∆ strain over accumulates zinc compared to the wildtype strain leading to zinc shock sensitivity. Other zinc importers may also upregulate if there is a drop in Zrt1p import activity caused by PDR15 deletion.

It should be noted that it is extremely hard to make a correct working model because there are two important points of data missing. First, we only looked at two zinc transporters to understand the zinc shock sensitivity in pdr15 ∆ and pdr18 ∆ strains. There are other zinc transporters that are also important in zinc homeostasis, and without knowing how they are altered by deletion of PDR15 and PDR18 , it is hard to refine the model. Second, we only investigated Zrc1p and Zrt1p in zincreplete and zinclimited media. We did not investigate

Zrc1p and Zrt1p levels and their localization during an actual zinc shock, where zinc is added to zinclimited cells. Thus, the current data only tell us about the two zinc transporters in the normal homeostasis situation (zincreplete medium), and low zinc conditions (zinclimited medium). It does not tell us anything about how the transcription, protein levels and localization of Zrc1p and Zrt1p are affected by PDR15 and PDR18 deletion during an actual zinc shock.

Thus, it would not be surprising to find that deletion of PDR15 causes alterations in zinc homeostasis that are only observable during an actual zinc shock. For example, it is possible that

129

Zrt1p endocytosis is compromised due to deletion of PDR15 upon addition of zinc to zinc limited cells. Zrt1p endocytosis and degradation is one of the major processes to prevent zinc over accumulation. If Zrt1p endocytosis is compromised in a pdr15 ∆ strain, it means that deletion of PDR15 causes inability of cells to trigger the recovery program to move back to zincreplete conditions, and this could explain the zinc shock sensitivity. Interestingly, amino acids 205218 in Zrt1p are required for zincinduced ubiquitination and endocytosis (Gitan,

Shababi et al. 2003). These amino acids are part of the Zrt1p fragment which interacted with

Pdr15p (see Figure 17), which suggests that Pdr15p may play a role in Zrt1p endocytosis and stability at the plasma membrane. Previously, Pdr10p was implicated in endocytosis of the cell wall protein Chs3p (Rockwell, Wolfger et al. 2009). Thus, Pdr15p may play a similar role in endocytosis and regulation of Zrt1p. Overall, perhaps decrease degradation of Zrt1p during zinc shock due to PDR15 deletion results in the inability of the cells to recover from zinc shock.

Due to the limited amount of data available, pdr15 ∆ strain sensitivity to zinc shock can be explained with three possible models. According to the first model, deletion of PDR15 results in over accumulation of zinc inside the cell due to higher zinc uptake capacity of pdr15 ∆ strain than the wildtype strain in similar condition. Perhaps, Pdr15p stabilizes Zrt1p at the plasma membrane, and removal of Pdr15p causes cell to upregulate Zrt1p and other zinc transporters more than normal to maintain high zinc capacity. This model is supported by transcription and

Western blot data that shows that PDR15 deletion causes an increase in ZRT1 transcription with no changes in Zrt1p protein levels. This model can be further tested using zinc uptake assays to compare zinc transport between pdr15 ∆ and wildtype strain. If this model is true then pdr15 ∆ strain should have a higher zinc uptake capacity than the wildtype. In addition, increases in protein levels or transcription of other zinc uptake transporters due to PDR15 deletion can provide evidence for this model.

130

A second possible model is that deletion of PDR15 results in inadequate endocytosis and degradation of Zrt1p during zinc shock. Thus, cells do not decrease their zinc uptake during zinc shock and the zinc metal over accumulates in the cytoplasm causing cytotoxicity. Differences in zinc uptake during zinc shock between pdr15 ∆ and wildtype strain can provide evidence for this model. In addition, changes in Zrt1p endocytosis due to PDR15 deletion can be investigated with fluorescence microscopy and by examining protein levels in the vacuole. This model is supported by evidence that the Zrt1p amino acids required for its endocytosis overlap with the

Zrt1p amino acids that interact with Pdr15p. In addition, ABC transporters have been previously implicated in endocytosis of plasma membrane and cell wall proteins.

Lastly, the third model is that deletion of PDR15 results in inadequate removal of zinc from the cytoplasm. Although, we did not see any changes in Zrc1p protein levels, there are other zinc transporters responsible for removing zinc from cytoplasm including Cot1p at the vacuolar membrane, and Zrg17pMsc2p complex in ER. However, Pdr15p did not interact with any other ABC transporter in MYTH. Although this may be due to the remaining zinc transporters not been represented in our prey libraries, or the tag could have disrupted the interaction making it undetectable in our assay. Regardless, other zinc transporters need to be studied in pdr15 ∆ strain to rule out this model.

Regardless of which model is true, the data highly suggests that Pdr15p is involved in zinc homeostasis. Pdr15p interacts with Zrt1p, a major zinc uptake transporter at the plasma membrane. Moreover, deletion of PDR15 causes alteration in zinc homeostasis. This includes an increase in zinc shock sensitivity, and an increase in transcription of both ZRC1 and ZRT1 .

131

4.2.2: Alterations in Zinc Homeostasis in pdr18 ∆ strain

Deletion of PDR18 causes sensitivity to zinc shock. Interestingly, deletion of PDR18 also caused a small 23.3% increase in ZRC1 mRNA levels in zincreplete medium, which is similar to pdr15 ∆ strain. In contrast, ZRT1 mRNA levels were decreased by 55.6% in pdr18 ∆ strain grown in zincreplete medium. This suggests that the mechanism for zinc shock sensitivity between pdr15 ∆ and pdr18 ∆ strains is probably different. There were no changes in both ZRC1 and ZRT1 mRNA levels in zinclimited medium, perhaps due to Zap1p activity saturating transcription of ZRC1 and ZRT1 . In addition, pdr18 ∆ strain had lower Zrc1p and

Zrt1p protein levels in zincreplete medium compared to the wildtype strain according to

Western blot.

It is clear that both Zrt1p mRNA and protein levels are reduced upon deletion of PDR18 .

This suggests two possible models. According to the first model, PDR18 deletion causes cells to downregulate Zrt1p and the zinc uptake system in response to inadequate function of Zrc1p and zinc removal system. This model is supported by Western blot experiments, which showed a reduction in protein levels of Zrc1p in pdr18 ∆ strain. Furthermore, the live microscopy pictures also confirmed that Zrc1p expression is qualitatively very low in pdr18 ∆ strain. Perhaps, the proteinprotein interaction of Zrc1p with Pdr18p is essential for stability and activity of Zrc1p.

If this is true then deletion of PDR18 will cause instability or reduce activity of Zrc1p and loss of major zinc removal system inside the cell. In return, cells may also downregulate the zinc uptake system to compensate for potential over accumulation of zinc. However, the reduced zinc uptake does not help in the zinc shock situation because even a slightest increase in zinc levels in cytoplasm can cause zinc toxicity because cells are missing a major zinc removal system in the pdr18 ∆ strain. Although we see that ZRC1 transcription is increased in the pdr18 ∆ strain, it might not help to increase protein levels in the absence of Pdr18p. Overall, the data

132 suggests that without Pdr18p inside the cells, Zrc1p levels are reduced, which causes sensitivity to zinc shock. A pulsechase experiment with radiolabelled amino acid could provide evidence that removal of Pdr18p causes Zrc1p degradation to increase.

It is also possible that Pdr18p may play a direct role in zinc homeostasis by transporting zinc out of the cell. We know that other ABC transporters, such as Ycf1, are responsible for transport of cadmium and other metals. Therefore, knocking out Pdr18p might reduce the cells ability to remove excess zinc from the cytoplasm. Interestingly, previously it was found that deletion of PDR18 causes sensitivity to 10 mM zinc, and this observation supports that Pdr18p might be a zinc transporter (Cabrito, Teixeira et al. 2011). Zinc uptake assays can provide further evidence of whether Pdr18p is directly involved in zinc transport.

A second possible model to explain the zinc shock sensitivity in pdr18 ∆ strain and the other experimental data is that cells are downregulating Zrt1p and the zinc uptake system because deletion of PDR18 leads to an increase in zinc uptake, which is independent of Zrt1p.

The second model is supported by a previous paper which suggested that Pdr18p is important in sterol incorporation and maintenance in the plasma membrane. The authors found that deletion of PDR18 changes plasma membrane sterol composition and plasma membrane potential, which they suggested may explain how Pdr18p is involved in MDR. They proposed that changes in plasma membrane ergosterol composition can alter plasma membrane physical characteristics and permeability to drugs and metals (Cabrito, Teixeira et al. 2011). Thus, the pdr18 ∆ strain may be sensitive to zinc shock because changes in plasma membrane permeability or composition allow higher than normal zinc accumulation in the cytoplasm. This problem is further exacerbated due to less than normal function of Zrc1p in pdr18 ∆ strain.

133

It is highly possible that elements from both models are true. The zinc homeostasis system and its regulation are complex, and without adequate data it is hard to deduce how exactly Pdr18p is involved in the process. However, it is clear that Pdr18p interacts with Zrc1p, a major zinc transporter at the vacuolar membrane. And deletion of PDR18 leads to major alterations in zinc homeostasis and reductions in levels of two major transporters, Zrc1p and

Zrt1p. To get a clearer picture of changes in zinc homeostasis, changes in other zinc transporters and Zap1p transcription factor should be investigated in the pdr18 ∆ strain.

4.3: Future Directions

The ABC transporter interactome demonstrated that ABC transporters are involved in a range of biological processes. Earlier in the discussion, I suggested a possible role of ABC transporters in metabolism, sphingolipid and ergosterol biosynthesis, osmoregulation, and cell wall assembly. I also listed a number of possible experiments to explore the significance of proteinprotein interactions, and role of ABC transporters in these biological processes. Besides the previous listed experiments for future directions, we are also interested in confirming the proteinprotein interactions with alternate methods, and mapping the site essential for protein protein interaction. Moreover, although my data suggests the Pdr15p and Pdr18p are involved in zinc homeostasis, we still need to perform additional experiments to understand how zinc homeostasis is altered by deletion of these two ABC transporters.

4.3.1: Confirmation of ProteinProtein Interactions and Mapping of Interaction Sites

The proteinprotein interactions of ABC transporters should be confirmed with other biochemical and genetic methods to rule out any nonbiologically relevant interactions and provide further evidence. We are currently collaborating with other labs to confirm protein protein interactions via both coimmunoprecipitation and bimolecular fluorescence

134 complementation (BiFC). BiFC is a protein complementation assay where both the bait and prey are fused to fluorescent protein fragments. Upon interaction of the bait and prey, the fluorescent protein is reconstituted resulting in the production of a fluorescent signal (Kerppola 2009).

Moreover, MYTH can be used to investigate the important amino acid residues required for proteinprotein interaction between the bait and prey. The mapping of important residues will provide more detail into the function of the proteinprotein interaction. For example, if the Zrt1p amino acid residues required for proteinprotein interaction with Pdr15p overlap with Zrt1p amino acid residues required for its endocytosis, it may tell us that Pdr15p plays an important role in regulating Zrt1p endocytosis and degradation.

4.3.2: ABC Transporters and Zinc Homeostasis

The proteinprotein interaction between ABC transporters and zinc transporters, increased sensitivity to zinc shock in pdr15 ∆ and pdr18∆ strains, and changes in transcription and protein levels of Zrc1p and Zrt1p in pdr15 ∆ and pdr18 ∆ strains suggest that ABC transporters, particularly Pdr15p and Pdr18p are involved in zinc homeostasis. However, the current data is inadequate to complete the model of how exactly ABC transporters contribute to this process. Perhaps ABC transporters such as Pdr18p are directly involved in transport of zinc.

Zinc transport assays with wildtype and pdr18 ∆ strains can provide evidence about whether

ABC transporters can transport zinc. It might be necessary to express Pdr18p in a foreign organism for zinc transport assays to rule out the contribution of other yeast zinc transporters.

Moreover, deletion of ABC transporters may alter the cytoplasmic and cell zinc concentration in normal conditions. Thus, we may need to use atomic absorption spectroscopy to quantitate whether the cell’s zinc concentration is drastically altered upon deletion of PDR15 and PDR18 .

Perhaps zinc concentrations are altered due to changes in plasma membrane composition and permeability caused by ABC transporter deletion.

135

Furthermore, no study of zinc homeostasis is complete without investigating the activity of the Zap1p transcription factor. We need to study how Zap1p protein levels and activity are affected by deletion of PDR15 and PDR18 . Zinc homeostasis is very complex due to numerous zinc transporters across plasma and cellular membranes, and zinc binding proteins such as alcohol dehydrogenase. Therefore, how deletion of ABC transporters affect transcription, protein levels, and localization of these other zinc transporters and zinc binding proteins should be further investigated.

4.4: Summary and Conclusion

The purpose of this work was to investigate the proteinprotein interactions of S. cerevisiae ABC transporters using MYTH. This study focused on 4 ABC transporters: Nft1p,

Pdr10p, Pdr18p and Vmr1p. The remaining ABC transporters were screened previously by members of Dr. Stagljar’s lab. There were 23 interactors for Nft1p, 22 interactors for Pdr10p, 4 interactors for Pdr18p and 1 interactor for Vmr1p. Out of the 43 total interactors, 28 hits were categorized as membrane associated, 14 hits as nonmembrane, and 1 hit had unknown localization. The majority of hits are membrane associated, which is not surprising as the ABC transporters also localize to plasma and organellar membranes. The 43 interactors belong to a wide variety of functional categories. There were 11 interactors involved in metabolism, 9 interactors involved in transport, 8 interactors with unknown function, 4 interactors involved in trafficking and secretion, 3 interactors involved in protein folding, 2 interactors involved in stress response, and 1 interactor in each of the following categories: cell wall assembly, cytoskeleton maintenance, nuclear function, protein degradation, protein modification and protein synthesis. Analysis of interactors found that the four ABC transporters are involved in multiple biological processes, including general amino acid, carbohydrate, nucleotide and lipid metabolism; ergosterol and lipid biosynthesis; cell wall assembly and maintenance; amino acid,

136 nutrient, peptide and ion transport; osmoregulation; endocytic regulation of other proteins; zinc, phosphate and iron metabolism and homeostasis; and stress response. It is not surprising that

ABC transporters are involved in a diverse range of biological pathways because ABC transporters are known to have broad substrate specificities.

The role of ABC transporters in zinc homeostasis was further investigated because multiple ABC transporters interacted with two zinc transporters, Zrc1p and Zrt1p. We found that Pdr15p and Pdr18p play an important role in zinc homeostasis because deletion of these

ABC transporters results in sensitivity to zinc shock. This suggests that in absence of Pdr15p and Pdr18p, cells over accumulate zinc in the cytoplasm, inadequately remove zinc from the cytoplasm or both. In addition, deletion of PDR15 changes ZRC1 and ZRT1 transcription, whereas deletion of PDR18 effects both transcription and protein levels of Zrc1p and Zrt1p, thus, providing further evidence that removal of Pdr15p and Pdr18p drastically alters the important components of zinc homeostasis. The proteinprotein interactome generated from this study has provided new insights into the role of ABC transporters inside the cell. In conclusion, we hope that the new insights into the role of ABC transporters obtained from my study will be applicable not only to yeast, but in our understanding of other organisms as well. Hopefully such insights will help lead to new avenues of research into the development of therapeutics for human diseases associated with ABC transporters, and better strategies to combat MDR in human cancers and pathogenic microorganisms.

137

Appendix 1

138

A1.1: Strains, Plasmids, Prey Libraries and Antibodies

The yeast strains used during the experiments are listed in Table 10.

Table 10: List of Yeast Strains Used in the Experiments

Strain Genotype Source/Reference THY.AP4 MATa leu2 , ura3 , trp1 :: ( lexAop ) lacZ (lexAop ) HIS3 (Snider, Kittanakom et al. (lexAop ) – ADE2 2010) NMY51 MATa his3delta200 trp1901 leu23,112 ade2 (Condamine, Le Texier et al. LYS2::(lexAop)4HIS3 ura3::(lexAop)8lacZ (lexAop)8 2010) ADE2 GAL4) L40 MATa HIS3 200 trp1901 leu23, 112 ade2 LYS2 :: (Snider, Kittanakom et al. (lexAop )4 HIS3 URA3 :: ( lexAop )8 lacZ GAL4 2010) Y7092 MATα can1 :: STE2prhis5 lyp1 ura30 leu20 his31 (DeLuna, Vetsigian et al. met150 2008)

pdr5∆ Y7092 pdr5∆::natMX C. Boone (University of Toronto) pdr10∆ Y7092 pdr10∆::natMX C. Boone (University of Toronto) pdr15∆ Y7092 pdr15∆::natMX C. Boone (University of Toronto) pdr18∆ Y7092 pdr18∆::natMX C. Boone (University of Toronto) zrc1∆ BY4741 zrc1∆::kanMX C. Boone (University of Toronto) Y7092 Y7092 ZRC1CubYFPLexAVP16 This Study ZRC1 MYTH Tag Y7092 Y7092 ZRT1CubYFPLexAVP16 This Study ZRT1 MYTH Tag pdr15∆ pdr15∆ ZRC1CubYFPLexAVP16 This Study ZRC1 MYTH Tag pdr15∆ pdr15∆ ZRT1CubYFPLexAVP16 This Study ZRT1 MYTH Tag pdr18∆ pdr18∆ ZRC1CubYFPLexAVP16 This Study ZRC1 MYTH Tag pdr18∆ pdr18∆ ZRT1CubYFPLexAVP16 This Study ZRT1

139

MYTH Tag

AMBV MYTH plasmid was acquired from Dualsystems Biotech. AMBVYFP MYTH plasmid for live microscopy was previously created by Dr. Jamie Snider from Dr. Stagljar’s lab

(University of Toronto) by inserting YFP venus tag between C ub and LexAVP16 MYTH tag. cDNA NubGx prey library was acquired from Dualsystems Biotech. Genomic NubGx prey library was previously prepared in Dr. Stagljar’s lab (Paumi, Menendez et al. 2007). Rabbit anti

VP16 IgG primary polyclonal antibody was acquired from SigmaAldrich. AntiRabbit IgG secondary antibody conjugated to horseradish peroxidase, and produced in donkey was acquired from GE Healthcare. Antihexokinase conjugated to horseradish peroxidase was acquired from

Dr. Andrews’s lab (University of Toronto).

A1.2: Media Recipes

A1.2.1: 10X Amino Acid and Nucleotide Dropout Solution (1 L)

Amino acids or nucleotides (see Table 11) were dissolved in doubledistilled water and the final volume was adjusted to 1 L. Appropriate amino acids were omitted to make a selective

10X dropout solution. For example, for minus leucine dropout solution, leucine was not added.

The solution was autoclaved and stored at 4 °C.

Table 11: Amino Acids and Nucleotides in 10X Dropout Solution

Reagent Molecular Weight (g/mol) Mass (in mg) for 1 L Adenine Sulfate Dihydrate 404.36 400 LArginine Hydrochloride 210.7 200 LHistidine Monohydrochloride 209.63 200 LIsoleucine Free Base 131.18 300 LLeucine Free Base 131.18 1000 LLysine Hydrochloride 182.65 300 LMethionine 149.21 1500 LPhenylalanine 165.19 500 LThreonine 119.1 2000

140

LTryptophan 204.23 400 LTyrosine Free Acid 181.19 300 LUracil Ultra Pure 112.09 200 LValine 117.15 1500

A1.2.2: LB Medium (Liquid or Solid, with or without Antibiotic) (1 L)

There were two different recipes for LB medium. For the first recipe, 20 g of LB Broth

Lennox (10 g of tryptone, 5 g of yeast extract, and 5 g of sodium chloride) from Bioshop was dissolved in doubledistilled water, and the final volume was adjusted to 1 L. For the second recipe, 10 g of tryptone, 5 g of yeast extract, and 10 g of sodium chloride (MW = 58.44 g/mol) were dissolved in doubledistilled water, and the final volume was adjusted to 1 L. For both recipes, 20 g of agar was also added for solid medium only. The medium was autoclaved. If antibiotic was needed (e.g., LB + ampicillin medium), the medium was allowed to cool down until the container was comfortable to touch by hand. 1 mL of 1000X stock of appropriate antibiotic was added to the medium. Liquid medium was stored at room temperature. Solid medium was poured into sterile plates and stored at 4 °C. Medium containing antibiotics was also stored at 4 °C.

A1.2.3: Synthetic Dropout (SD) Medium (Liquid or Solid, with or without Antibiotic) (1 L)

100 mL of appropriate 10X dropout solution, 6.7 g of yeast nitrogen base, and 20.0 g of

Dglucose (MW = 180.16 g/mol) were dissolved in doubledistilled water and the final volume was adjusted to 1 L. For solid medium, 20 g of agar was also added. The medium was autoclaved. If antibiotic was needed (e.g., SD + geneticin medium), the medium was allowed to cool until the container was comfortable to touch by hand. 1 mL of 1000X stock of appropriate antibiotic was added to the medium. Liquid medium was stored at room temperature. Solid medium while hot was poured in sterile plates and stored at 4 °C when it solidified. Medium containing antibiotics was also stored at 4 °C.

141

A1.2.4: Synthetic Dropout (SD) + XGal Medium (Solid) (1 L)

100 mL of appropriate 10X dropout solution, 6.7 g of yeast nitrogen base, 20.0 g of D glucose (MW = 180.16 g/mol), 20 g of agar were dissolved in 800 mL of doubledistilled water.

The medium was autoclaved. The medium was allowed to cool until the flask was comfortable to touch by hand. 100 mL of phosphate solution for Xgal and 0.4 mL of 100 mg/mL Xgal solution was added to the medium. The medium was mixed, poured into sterile plates and stored at 4 °C.

A1.2.5: Terrific Broth (TB) Liquid Medium (with or without Antibiotic) (1 L)

47.6 g of TB mix from Bioshop was mixed in doubledistilled water. 4 mL of glycerol was added to the medium, and the final volume was adjusted to 1 L. The solution was autoclaved. If antibiotic was needed (e.g., TB + ampicillin medium), the medium was allowed to cool until the container was comfortable to touch by hand. 1 mL of 1000X stock of appropriate antibiotic was added to the medium. The medium was stored at room temperature (without antibiotic) or 4 °C (with antibiotic).

A1.2.6: YPAD Medium (Liquid or Solid, with or without Antibiotic) (1 L)

10 g of yeast extract, 20 g of peptone, 20 g of Dglucose (MW = 180.16 g/mol), and 40 mg of adenine sulfate dihydrate (MW = 404.36 g/mol) were dissolved in doubledistilled water, and the final volume was adjusted to 1 L. 20 g of agar was also added for solid medium only.

The medium was autoclaved. If antibiotic was needed (e.g., YPAD + geneticin (G418) medium), the medium was allowed to cool until the container was comfortable to touch by hand. 1 mL of

1000X stock of appropriate antibiotic was added to the medium. Liquid medium was stored at room temperature. Solid medium was poured into sterile plates and stored at 4 °C. Medium containing antibiotics was also stored at 4 °C.

142

A1.2.7: 2X YPAD (Liquid) (1 L)

20 g of yeast extract, 40 g of peptone, 40 g of Dglucose (MW = 180.16 g/mol), and 40 mg of adenine sulfate dihydrate (MW = 404.36 g/mol) were dissolved in doubledistilled water, and the final volume was adjusted to 1 L. The medium was autoclaved, and stored at room temperature.

A1.2.8: ZincLimited Medium (500 mL)

Zinclimited medium or lowzinc medium is the standard SD complete medium with added EDTA for chelating ions, and sodium citrate added for low pH. 3.37 g of yeast nitrogen base, 10 g of Dglucose (MW = 180.16 g/mol), 10 mL of 1 M sodium citrate pH 4.2, 50 mL of

10X complete amino acid/nucleotide dropout solution, and 1 mL of 0.5 M EDTA pH 8.0 were mixed in doubledistilled water, and the final volume was adjusted to 500 mL. The approximate pH of the medium was 4.63, which was measured with a pH meter. The solution was autoclaved, and stored at room temperature.

A1.2.9: ZincReplete Medium (500 mL)

Zincreplete medium is the standard SD complete medium with sodium citrate added for low pH as a control for zinclimited medium, which also has low pH. 3.37 g of yeast nitrogen base, 10 g of Dglucose (MW = 180.16 g/mol), 10 mL of 1 M sodium citrate pH 4.2, and 50 mL of 10X complete amino acid/nucleotide dropout solution were mixed in doubledistilled water, and the final volume was adjusted to 500 mL. The approximate pH of the medium was 4.60, which was measured with a pH meter. The solution was autoclaved, and stored at room temperature.

143

A1.3: Antibiotics

A1.3.1: 100 mg/mL Ampicillin 1000X Stock (10 mL)

1.0 g of ampicillin sodium salt (MW = 371.39 g/mol) was dissolved in 10 mL of double distilled water, filter sterilized, and stored at 20 °C until further use.

A1.3.2: 200 mg/mL Geneticin (G418) 1000X Stock (10 mL)

2.0 g of G418 sulfate (MW = 692.71 g/mol) was dissolved in 10 mL of doubledistilled water. The antibiotic solution was sterilized by filtration, and stored at 20 °C until further use.

A1.3.3: 50 mg/mL Kanamycin 1000X Stock (10 mL)

0.5 g of kanamycin monosulfate (MW = 582.58 g/mol) was dissolved in 10 mL of doubledistilled water, filter sterilized, and stored at 20 °C until further use.

A1.3.4: 100 mg/mL Nourseothricin 1000X Stock (10 mL)

1.0 g of nourseothricin was dissolved in 10 mL of doubledistilled water. The antibiotic solution was sterilized by filtration, and stored at 20 °C until further use.

A1.4: Chemical Solution Recipes

A1.4.1: 10% Ammonium Persulfate (1 mL)

100 mg of ammonium persulfate (MW = 228.18 g/mol) was dissolved in 1 mL of doubledistilled water. Solution was stored at 4 °C till further use.

A1.4.2: Cell Wall Disruption Solution for 96well Yeast Miniprep

For a single 96well plate yeast miniprep, 20 mL of Solution A, 4.5 mL of zymolyase solution, and 220 L of βmercaptoethanol were mixed together.

144

1 L of Solution A was made by dissolving 182.17 g of Dsorbitol (MW = 182.17 g/mol),

29.4 g of sodium citrate trisodium salt dihydrate (MW = 294.1 g/mol), 120 mL of 0.5 M EDTA pH 8.0 in 600 mL of doubledistilled water. The pH was adjusted to 7.5, and the final volume was brought up to 1 L with doubledistilled water. The solution was autoclaved.

Zymolyase Solution (100 units/mL) was made by dissolving 50.0 mg of zymolyase powder (20T) in 10 mL of 1 M Sorbitol.

A1.4.3: 1 M Dithiothreitol (DTT) (10 mL)

1.54 g of DTT (MW = 154.25 g/mol) was dissolved in doubledistilled water, and the final volume was adjusted to 10 mL. The solution was sterilized by filtration, and stored at 20

°C until further use.

A1.4.4: 0.5 M Ethylenediaminetetraacetic Acid (EDTA), pH 8.0

186.10 g of disodium EDTA ·2H 2O (MW = 372.24 g/mol) was dissolved in 800 mL of doubledistilled water. The pH was adjusted to 8.0 using sodium hydroxide pellets

(approximately 10 g). The final volume of the solution was brought up to 1 L with double distilled water. The solution was autoclaved, and stored at room temperature.

A1.4.5: 6X Gel Loading Dye for Agarose Gels

The 6X gel loading dye for agarose gel included 0.25% of bromophenol blue (MW =

669.96 g/mol), 0.25% xylene cyanol FF (MW = 538.61 g/mol), and 30% glycerol in double distilled water.

A1.4.6: 80% Glycerol (100 mL)

80 mL of 100% glycerol was diluted in 20 mL of doubledistilled water. The solution was autoclaved, and stored at room temperature.

145

A1.4.7: Inoue Buffer for Competent E. coli Preparation

10.88 g of manganese chloride tetrahydrate (MW = 197.9 g/mol), 2.20 g of calcium chloride dihydrate (MW = 147.02 g/mol), 18.65 g of potassium chloride (MW = 74.56 g/mol), and 20 mL of 0.5 M PIPES pH 6.7 were dissolved in doubledistilled water, and the final volume of adjusted to 1 L. The solution was sterilized by filtration and stored at 20 °C until further use.

100 mL of 0.5 M PIPES pH 6.7 (piperazineN,N′bis(2ethanesulfonic acid)) was made by dissolving 15.1 g of PIPES (MW = 302.37 g/mol) in 80 ml of doubledistilled water. The pH of the solution was adjusted to 6.7 with concentrated sodium hydroxide, and then final volume was adjusted to 100 mL with doubledistilled water. The solution was sterilized by filtration, and stored at room temperature while protected from light.

A1.4.8: 1 M and 2 M Lithium Acetate for Yeast Transformation (1 L)

102.0 g (or 204.0 g for 2 M) of lithium acetate dihydrate (MW = 102 g/mol) was dissolved in doubledistilled water, and the final volume was brought up to 1 L. The solution was autoclaved, and stored at room temperature.

A1.4.9: 5% Milk Blocking Solution for Western Blot (100 mL)

5% skim milk block solution was made by dissolving 5 g of skim milk powder from

BioShop in 100 mL of 1X TBST solution. Blocking solution was always made fresh before use.

A1.4.10: Phosphate Solution for Xgal Medium (1 L)

70 g of sodium phosphate dibasic (MW = 141.96 g/mol), and 30 g of sodium phosphate monobasic (MW = 119.98 g/mol) were dissolved in doubledistilled water. The final volume was adjusted to 1 L. The solution was autoclaved, and stored at room temperature.

146

A1.4.11: 50% Polyethylene Glycol (PEG) 3350 for Yeast Transformation (50 mL)

25 g of PEG 3350 (MW = 335.1 g/mol) was dissolved in doubledistilled water, and the final volume was adjusted to 50 mL. The solution was sterilized by filtration. The solution was made fresh before each yeast transformation experiment.

A1.4.12: 0.1% Ponceau S for Western Blot (100 mL)

0.1% Ponceau S solution was made by dissolving 0.1 g of Ponceau S powder in 100 mL of 5% glacial acetic acid. Solution was stored at room temperature. 5% glacial acetic acid was made by diluting 5 mL of concentrated 100% glacial acetic acid in 95 mL of doubledistilled water.

A1.4.13: 2 mg/mL Salmon Sperm DNA (ssDNA) Solution for Yeast Transformation

200 mg of salmon sperm DNA was dissolved in 100 mL of sterile doubledistilled water in a sterile 250 mL bottle. The solution was aliquot into sterile 1.5 mL microfuge tubes. The tubes were boiled twice at 100 °C for 5 minutes and placed immediately on ice. Tubes were stored at 20 °C until further use. Before adding to yeast transformation master mix, tubes were boiled again for 5 minutes at 100 °C.

A1.4.14: 2X Sample Buffer for Proteins (50 mL)

The following components were mixed together: 3 mL of 1 M Tris pH 6.8, 15 mL of

10% SDS, 10 mL of 50% glycerol, 2.5 mL of 1% bromophenol blue, and 19.5 mL of double distilled water. Doubledistilled water was added in place if a certain component was omitted.

For example, no bromophenol blue was added in 2X sample buffer without bromophenol blue, and instead an additional 2.5 mL of doubledistilled water was added to the solution. 50% glycerol was made by diluting 100% glycerol 1:2 ratio using doubledistilled water. 1%

147 bromophenol blue was made by dissolving 1 g of bromophenol blue powder (MW = 669.96 g/mol) in 100 mL of doubledistilled water.

A1.4.15: 0.9% Sodium Chloride (100 mL)

0.9 g of sodium chloride (MW = 58.44 g/mol) was dissolved in doubledistilled water, and the final volume was adjusted to 100 mL. The solution was autoclaved, and stored at room temperature.

A1.4.16: 1 M Sodium Citrate, pH 4.2 (200 mL)

58.82 g of sodium citrate trisodium salt dihydrate (MW = 294.10 g/mol) was dissolved in 150 mL of doubledistilled water. The solution of pH was adjusted to 4.2 using concentrated hydrochloric acid. The final volume was adjusted to 200 mL with doubledistilled water. The solution was sterilized by filtration and stored at room temperature.

A1.4.17: 10% Sodium Dodecyl Sulfate (SDS)

10 g of SDS (MW = 288.38 g/mol) was dissolved in doubledistilled water and the final volume was adjusted to 100 mL. Solution was stored at room temperature.

A1.4.18: 1X and 10X SDS Gel Running Buffer (2 L)

For 10X SDS gel running buffer, 60.6 g of Tris base (MW = 121.14 g/mol), 288 g of glycine (75.07 g/mol), and 20 g of SDS (288.38 g/mol) were dissolved in doubledistilled water and the final volume was adjusted to 2 L. The solution was stored at room temperature.

For 1X SDS gel running buffer, 200 mL of 10X SDS gel running buffer was diluted in

1800 mL of doubledistilled water. The solution was stored at room temperature.

148

A1.4.19: 2 M Sodium Hydroxide (100 mL)

2 M sodium hydroxide was made by diluting 20 mL of 10 M concentrated sodium hydroxide (commercially available) in 80 mL of doubledistilled water.

A1.4.20: 1 M Sorbitol (1 L)

182.17 g of Dsorbitol (MW = 182.17 g/mol) was dissolved in doubledistilled water, and the final volume was adjusted to 1 L. The solution was autoclaved, and stored at room temperature.

A1.4.21: 1X and 50X TAE Buffer for DNAAgarose Electrophoresis (1 L)

50X TAE Buffer was made by dissolving 242.0 g of Tris base (MW = 121.14 g/mol),

57.1 mL of glacial acetic acid (60.05 g/mol), and 100 mL of 0.5 M EDTA pH 8.0 in double distilled water and the final volume was adjusted to 1 L. The solution was stored at room temperature.

1X TAE buffer was made by diluting 50X TAE buffer 1:50 in doubledistilled water.

For 1 L, 20 mL of 50X TAE was mixed in 980 mL doubledistilled water. The solution was stored at room temperature.

A1.4.22: 10X TBS, pH 7.5 for Western Blot (1 L)

60.55 g of Tris base (MW = 121.14 g/mol), 87.66 g of sodium chloride (MW = 58.44 g/mol) were dissolved in 800 mL of doubledistilled water. The pH was adjusted to 7.5 using concentrated hydrochloric acid. The final volume was adjusted to 1 L. Solution was stored at room temperature.

149

A1.4.23: 1X TBST Solution for Western Blot (1 L)

100 mL of 10X TBS pH 7.5, 900 mL of doubledistilled water, and 1 mL of Tween20 were mixed together. The solution was stored at room temperature.

A1.4.24: 1X and 10X Transfer Buffer for Western Blot (2 L)

For 10X transfer buffer, 60.5 g of Tris base (MW = 121.14 g/mol), and 288.27 g of glycine (MW = 75.07 g/mol) were dissolved in doubledistilled water. The final volume was adjusted to 2 L, and the solution was stored at room temperature.

For 1X transfer buffer, 200 mL of 10X transfer buffer, 400 mL of methanol, and 1400 mL of doubledistilled water were mixed. The solution was stored at room temperature.

A1.4.25: 50% Trichloroacetic Acid (100 mL)

50 g of trichloroacetic acid (MW = 163.39 g/mol) was dissolved in 100 mL of double distilled water. The solution was stored at room temperature.

A1.4.26: 1.0 M Tris, pH 6.8, 7.5 or 8.0 (1 L)

121.14 g of Tris base (MW = 121.14 g/mol) was dissolved in 800 mL of doubledistilled water. The pH was adjusted to 6.8, 7.5 or 8.0 using concentrated hydrochloric acid, and the final volume was adjusted to 1 L. Solution was stored at room temperature

A1.4.27: 1.5 M Tris, pH 8.8 (1 L)

181.71 g of Tris base (MW = 121.14 g/mol) was dissolved in 800 mL of doubledistilled water. The pH was adjusted to 8.8 using concentrated hydrochloric acid, and the final volume was adjusted to 1 L. Solution was stored at room temperature.

150

A1.4.28: 10X TrisEDTA (TE) Solution for MYTH Large Scale Transformation (1 L)

100 mL of 1 M Tris pH 7.5, 20 mL of 0.5 M EDTA pH 8.0 were mixed with double distilled water, and the final volume was adjusted to 1 L. The solution was autoclaved, and stored at room temperature.

A1.4.29: 100 mg/mL Xgal Solution (1 mL)

100.0 mg of XGal (MW = 408.64 g/mol) was dissolved in 1 mL of dimethylformamide.

The solution was made fresh before use, and protected from light.

A1.4.30: 40 mM Zinc Chloride Stock Solution for Zinc Shock Assay (10 mL)

Initially, 0.5 M zinc chloride solution was made by dissolving 3.41 g of zinc chloride

(MW = 136.3 g/mol) in doubledistilled water, and the final volume was adjusted to 50 mL. The solution was sterilized by filtration. Next, 0.1 M zinc chloride solution was made by diluting 2 mL of 0.5 M zinc chloride in 8 mL of sterile doubledistilled water. Finally, 40 mM zinc chloride solution was made by diluting 4 mL of 0.1 M zinc chloride solution in 6 mL of sterile doubledistilled water.

151

Appendix 2

152

Table 12: List of Ykr103wp Interactors from the BioGRID Database

Systematic Name Gene Name Experimental System YIL033C BCY1 Negative Genetic YHR114W BZZ1 Twohybrid YMR307W GAS1 Negative Genetic YNL274C GOR1 Affinity CaptureMS YMR032W HOF1 Positive Genetic YJL034W KAR2 Positive Genetic YOR147W MDM32 Positive Genetic YJL019W MPS3 Synthetic Rescue YJL203W PRP21 Negative Genetic YDR217C RAD9 Phenotypic Enhancement YLR292C SEC72 PCA YPR024W YME1 Positive Genetic

Table 13: List of Ykr104wp Interactors from the BioGRID Database

Systematic Name Gene Name Experimental System YMR157C AIM36 Negative Genetic YOL053W AIM39 Negative Genetic YMR116C ASC1 Negative Genetic YLR393W ATP10 Negative Genetic YOR134W BAG7 Negative Genetic YOL008W COQ10 Negative Genetic YNL052W COX5A Negative Genetic YGR092W DBF2 Negative Genetic YDR359C EAF1 Negative Genetic YBR026C ETR1 Negative Genetic YLR214W FRE1 PCA YOL132W GAS4 Negative Genetic YJL101C GSH1 Negative Genetic YOR358W HAP5 Negative Genetic YJR075W HOC1 Negative Genetic YOL081W IRA2 Negative Genetic YJR022W LSM8 Twohybrid YMR115W MGR3 Negative Genetic YOR231W MKK1 Negative Genetic YJR131W MNS1 Negative Genetic YKL009W MRT4 Negative Genetic YGL236C MTO1 Negative Genetic YNL119W NCS2 Negative Genetic YJL208C NUC1 Negative Genetic YDR316W OMS1 Negative Genetic

153

YER153C PET122 Negative Genetic YNL003C PET8 Negative Genetic YJR059W PTK2 Negative Genetic YOL143C RIB4 Twohybrid YHL027W RIM101 Negative Genetic YPL079W RPL21B Negative Genetic YCR009C RVS161 Negative Genetic YGL066W SGF73 Negative Genetic YDR393W SHE9 Negative Genetic YGL115W SNF4 Negative Genetic YKL218C SRY1 Negative Genetic YCL032W STE50 Negative Genetic YNL070W TOM7 Negative Genetic YDR120C TRM1 Negative Genetic YDR080W VPS41 Negative Genetic YIL101C XBP1 Negative Genetic YDR369C XRS2 Negative Genetic YNL064C YDJ1 Negative Genetic YGL235W YGL235W Negative Genetic YJR054W YJR054W Negative Genetic

Table 14: List of Vmr1p Interactors from the BioGRID Database

Systematic Name Gene Name Experimental System YLR393W ATP10 Negative Genetic YHR114W BZZ1 Twohybrid YBR160W CDC28 Biochemical Activity YLR115W CFT2 Affinity CaptureMS YIL035C CKA1 Affinity CaptureMS YHR188C GPI16 Negative Genetic YBR010W HHT1 Affinity CaptureMS YNL031C HHT2 Affinity CaptureMS YMR032W HOF1 Positive Genetic YDR225W HTA1 Positive Genetic YDR224C HTB1 Positive Genetic YOR327C SNC2 PCA YLL039C UBI4 Affinity CaptureMS YDL156W YDL156W Affinity CaptureMS

Table 15: List of Pdr10p Interactors from the BioGRID Database

Systematic Name Gene Name Experimental System

154

YBR236C ABD1 Negative Genetic YDR511W ACN9 Positive Genetic YBR108W AIM3 Negative Genetic YBR023C CHS3 Synthetic Rescue YER166W DNF1 Phenotypic Enhancement YDR093W DNF2 Phenotypic Enhancement YBL032W HEK2 Affinity CaptureRNA YDR072C IPT1 Synthetic Rescue YKL161C KDX1 Negative Genetic YGL122C NAB2 Affinity CaptureRNA YPL058C PDR12 Synthetic Rescue YDR406W PDR15 Synthetic Rescue YOR153W PDR5 Synthetic Rescue YIL069C RPS24B Affinity CaptureMS YPL057C SUR1 Synthetic Rescue YNL128W TEP1 Negative Genetic YLL039C UBI4 Affinity CaptureMS

Table 16: List of Pdr15p Interactors from the BioGRID Database

Systematic Name Gene Name Experimental System YFL027C GYP8 Negative Genetic YBL032W HEK2 Affinity CaptureRNA YGL122C NAB2 Affinity CaptureRNA YOR328W PDR10 Synthetic Rescue YOR153W PDR5 Phenotypic Enhancement YOR076C SKI7 Negative Genetic YLR055C SPT8 Affinity CaptureMS YJL176C SWI3 Positive Genetic YLL039C UBI4 Affinity CaptureMS YAR027W UIP3 PCA YJL141C YAK1 Negative Genetic

Table 17: List of Pdr18p Interactors from the BioGRID Database

Systematic Name Gene Name Experimental System YGL021W ALK1 PCA YDR054C CDC34 Synthetic Growth Defect YBL032W HEK2 Affinity CaptureRNA YMR032W HOF1 Negative Genetic YBR159W IFA38 PCA YGL122C NAB2 Affinity CaptureRNA

155

Figure 29 : pdr5 ∆ and pdr10 ∆ strains do not experience zinc shock. (A) Growth in zincreplete medium. (B) Growth in zinclimited medium. zrc1 ∆ strain is a positive control for zinc shock sensitivity.

156

References

Alberts, B. (1998). "The cell as a collection of protein machines: preparing the next generation of molecular biologists." Cell 92 (3): 291-294. Alvaro, D., M. Lisby, et al. (2007). "Genome-wide analysis of Rad52 foci reveals diverse mechanisms impacting recombination." PLoS Genet 3(12): e228. Araki, W., N. Takahashi-Sasaki, et al. (2008). "A family of membrane proteins associated with presenilin expression and gamma-secretase function." FASEB J 22 (3): 819-827. Arita, A., X. Zhou, et al. (2009). "A genome-wide deletion mutant screen identifies pathways affected by nickel sulfate in Saccharomyces cerevisiae." BMC Genomics 10 : 524. Babu, M., N. J. Krogan, et al. (2009). "Systematic characterization of the protein interaction network and protein complexes in Saccharomyces cerevisiae using tandem affinity purification and mass spectrometry." Methods Mol Biol 548 : 187-207. Balzi, E., M. Wang, et al. (1994). "PDR5, a novel yeast multidrug resistance conferring transporter controlled by the transcription regulator PDR1." J Biol Chem 269 (3): 2206-2214. Bird, A., M. V. Evans-Galea, et al. (2000). "Mapping the DNA binding domain of the Zap1 zinc-responsive transcriptional activator." J Biol Chem 275 (21): 16160-16166. Bleackley, M. R. and R. T. Macgillivray (2011). "Transition metal homeostasis: from yeast to human disease." Biometals 24 (5): 785-809. Borst, P. and R. O. Elferink (2002). "Mammalian ABC transporters in health and disease." Annu Rev Biochem 71 : 537-592. Botstein, D. and G. R. Fink (2011). "Yeast: an experimental organism for 21st Century biology." Genetics 189 (3): 695-704. Bouige, P., D. Laurent, et al. (2002). "Phylogenetic and functional classification of ATP-binding cassette (ABC) systems." Curr Protein Pept Sci 3(5): 541-559. Breslow, D. K., D. M. Cameron, et al. (2008). "A comprehensive strategy enabling high-resolution functional analysis of the yeast genome." Nat Methods 5(8): 711-718. Bryan, J., A. Munoz, et al. (2007). "ABCC8 and ABCC9: ABC transporters that regulate K+ channels." Pflugers Arch 453 (5): 703-718. Cabrito, T. R., M. C. Teixeira, et al. (2011). "The yeast ABC transporter Pdr18 (ORF YNR070w) controls plasma membrane sterol composition, playing a role in multidrug resistance." Biochem J 440 (2): 195-202. Cangelosi, G. A., R. G. Ankenbauer, et al. (1990). "Sugars induce the Agrobacterium virulence genes through a periplasmic binding protein and a transmembrane signal protein." Proc Natl Acad Sci U S A 87 (17): 6708-6712. Chakraburtty, K. (2001). "Translational regulation by ABC systems." Res Microbiol 152 (3-4): 391-399. Cherry, J. M., E. L. Hong, et al. (2012). "Saccharomyces Genome Database: the genomics resource of budding yeast." Nucleic Acids Res 40 (Database issue): D700-705. Chloupkova, M., L. S. LeBard, et al. (2003). "MDL1 is a high copy suppressor of ATM1: evidence for a role in resistance to oxidative stress." J Mol Biol 331 (1): 155-165. Clegg, R. M. (1995). "Fluorescence resonance energy transfer." Curr Opin Biotechnol 6(1): 103-110. Condamine, T., L. Le Texier, et al. (2010). "Tmem176B and Tmem176A are associated with the immature state of dendritic cells." J Leukoc Biol 88 (3): 507-515. Costanzo, M., A. Baryshnikova, et al. (2010). "The genetic landscape of a cell." Science 327 (5964): 425- 431. Dassa, E. and P. Bouige (2001). "The ABC of ABCS: a phylogenetic and functional classification of ABC systems in living organisms." Res Microbiol 152 (3-4): 211-229. Davidson, A. L., E. Dassa, et al. (2008). "Structure, function, and evolution of bacterial ATP-binding cassette systems." Microbiol Mol Biol Rev 72 (2): 317-364, table of contents.

157

De Freitas, J. M., J. H. Kim, et al. (2004). "Exploratory and confirmatory gene expression profiling of mac1Delta." J Biol Chem 279 (6): 4450-4458. Dean, M., Y. Hamon, et al. (2001). "The human ATP-binding cassette (ABC) transporter superfamily." J Lipid Res 42 (7): 1007-1017. Dean, M., A. Rzhetsky, et al. (2001). "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res 11 (7): 1156-1166. Decottignies, A., A. M. Grant, et al. (1998). "ATPase and multidrug transport activities of the overexpressed yeast ABC protein Yor1p." J Biol Chem 273 (20): 12612-12622. DeLuna, A., K. Vetsigian, et al. (2008). "Exposing the fitness contribution of duplicated genes." Nat Genet 40 (5): 676-681. Dickson, R. C. (2008). "Thematic review series: sphingolipids. New insights into sphingolipid metabolism and function in budding yeast." J Lipid Res 49 (5): 909-921. Dong, J., R. Lai, et al. (2005). "The novel ATP-binding cassette protein ARB1 is a shuttling factor that stimulates 40S and 60S ribosome biogenesis." Mol Cell Biol 25 (22): 9859-9873. Dong, J., R. Lai, et al. (2004). "The essential ATP-binding cassette protein RLI1 functions in translation by promoting preinitiation complex assembly." J Biol Chem 279 (40): 42157-42168. Eide, D. J. (2003). "Multiple regulatory mechanisms maintain zinc homeostasis in Saccharomyces cerevisiae." J Nutr 133 (5 Suppl 1): 1532S-1535S. Eide, D. J. (2006). "Zinc transporters and the cellular trafficking of zinc." Biochim Biophys Acta 1763 (7): 711-722. Eide, D. J. (2009). "Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae." J Biol Chem 284 (28): 18565-18569. Eide, D. J. (2011). "The oxidative stress of zinc deficiency." Metallomics 3(11): 1124-1129. Ernst, R., R. Klemm, et al. (2005). "Yeast ATP-binding cassette transporters: cellular cleaning pumps." Methods Enzymol 400 : 460-484. Fay, J. C. and J. A. Benavides (2005). "Hypervariable noncoding sequences in Saccharomyces cerevisiae." Genetics 170 (4): 1575-1587. Fegueur, M., L. Richard, et al. (1991). "Isolation and primary structure of the ERG9 gene of Saccharomyces cerevisiae encoding squalene synthetase." Curr Genet 20 (5): 365-372. Fields, S. and O. Song (1989). "A novel genetic system to detect protein-protein interactions." Nature 340 (6230): 245-246. Fields, S. and R. Sternglanz (1994). "The two-hybrid system: an assay for protein-protein interactions." Trends Genet 10 (8): 286-292. Frey, A. G. and D. J. Eide (2011). "Roles of two activation domains in Zap1 in the response to zinc deficiency in Saccharomyces cerevisiae." J Biol Chem 286 (8): 6844-6854. Gachotte, D., S. E. Sen, et al. (1999). "Characterization of the Saccharomyces cerevisiae ERG27 gene encoding the 3-keto reductase involved in C-4 sterol demethylation." Proc Natl Acad Sci U S A 96 (22): 12655-12660. Giaever, G., A. M. Chu, et al. (2002). "Functional profiling of the Saccharomyces cerevisiae genome." Nature 418 (6896): 387-391. Gietz, R. D. and R. A. Woods (2006). "Yeast transformation by the LiAc/SS Carrier DNA/PEG method." Methods Mol Biol 313 : 107-120. Gitan, R. S. and D. J. Eide (2000). "Zinc-regulated ubiquitin conjugation signals endocytosis of the yeast ZRT1 zinc transporter." Biochem J 346 Pt 2 : 329-336. Gitan, R. S., H. Luo, et al. (1998). "Zinc-induced inactivation of the yeast ZRT1 zinc transporter occurs through endocytosis and vacuolar degradation." J Biol Chem 273 (44): 28617-28624. Gitan, R. S., M. Shababi, et al. (2003). "A cytosolic domain of the yeast Zrt1 zinc transporter is required for its post-translational inactivation in response to zinc and cadmium." J Biol Chem 278 (41): 39558-39564.

158

Glavinas, H., P. Krajcsi, et al. (2004). "The role of ABC transporters in drug resistance, metabolism and toxicity." Curr Drug Deliv 1(1): 27-42. Goosen, N. and G. F. Moolenaar (2001). "Role of ATP hydrolysis by UvrA and UvrB during nucleotide excision repair." Res Microbiol 152 (3-4): 401-409. Guthrie, C. and G. R. Fink (2002). Guide to Yeast Genetics and Molecular and Cell Biology - Part B , Academic Press. Han, S., M. A. Lone, et al. (2010). "Orm1 and Orm2 are conserved endoplasmic reticulum membrane proteins regulating lipid homeostasis and protein quality control." Proc Natl Acad Sci U S A 107 (13): 5851-5856. Henderson, D. P. and S. M. Payne (1994). "Vibrio cholerae iron transport systems: roles of heme and siderophore iron transport in virulence and identification of a gene associated with multiple iron transport systems." Infect Immun 62 (11): 5120-5125. Herbig, A., A. J. Bird, et al. (2005). "Zap1 activation domain 1 and its role in controlling gene expression in response to cellular zinc status." Mol Microbiol 57 (3): 834-846. Hettema, E. H., C. W. van Roermund, et al. (1996). "The ABC transporter proteins Pat1 and Pat2 are required for import of long-chain fatty acids into peroxisomes of Saccharomyces cerevisiae." EMBO J 15 (15): 3813-3822. Hohmann, S., M. Krantz, et al. (2007). "Yeast osmoregulation." Methods Enzymol 428 : 29-45. Holst, B., C. Lunde, et al. (2000). "GUP1 and its close homologue GUP2, encoding multimembrane- spanning proteins involved in active glycerol uptake in Saccharomyces cerevisiae." Mol Microbiol 37 (1): 108-124. Hoppins, S., S. R. Collins, et al. (2011). "A mitochondrial-focused genetic interaction map reveals a scaffold-like complex required for inner membrane organization in mitochondria." J Cell Biol 195 (2): 323-340. Huang, J., H. Zhu, et al. (2004). "Finding new components of the target of rapamycin (TOR) signaling network through chemical genetics and proteome chips." Proc Natl Acad Sci U S A 101 (47): 16594-16599. Inoue, H., H. Nojima, et al. (1990). "High efficiency transformation of Escherichia coli with plasmids." Gene 96 (1): 23-28. Ito, H. and W. M. Gray (2006). "A gain-of-function mutation in the Arabidopsis pleiotropic drug resistance transporter PDR9 confers resistance to auxinic herbicides." Plant Physiol 142 (1): 63- 74. Jacquier, N. and R. Schneiter (2012). "Mechanisms of sterol uptake and transport in yeast." J Steroid Biochem Mol Biol 129 (1-2): 70-78. Jensen, L. T., M. Ajua-Alemanji, et al. (2003). "The Saccharomyces cerevisiae high affinity phosphate transporter encoded by PHO84 also functions in manganese homeostasis." J Biol Chem 278 (43): 42036-42040. Johnsson, N. and A. Varshavsky (1994). "Split ubiquitin as a sensor of protein interactions in vivo." Proc Natl Acad Sci U S A 91 (22): 10340-10344. Jones, P. M., M. L. O'Mara, et al. (2009). "ABC transporters: a riddle wrapped in a mystery inside an enigma." Trends Biochem Sci 34 (10): 520-531. Joung, J. K., E. I. Ramm, et al. (2000). "A bacterial two-hybrid selection system for studying protein-DNA and protein-protein interactions." Proc Natl Acad Sci U S A 97 (13): 7382-7387. Kaboord, B. and M. Perr (2008). "Isolation of proteins and protein complexes by immunoprecipitation." Methods Mol Biol 424 : 349-364. Kamath, A. and K. Chakraburtty (1989). "Role of yeast elongation factor 3 in the elongation cycle." J Biol Chem 264 (26): 15423-15428. Kanki, T., K. Wang, et al. (2009). "A genomic screen for yeast mutants defective in selective mitochondria autophagy." Mol Biol Cell 20 (22): 4730-4738.

159

Katzmann, D. J., P. E. Burnett, et al. (1994). "Transcriptional control of the yeast PDR5 gene by the PDR3 gene product." Mol Cell Biol 14 (7): 4653-4661. Katzmann, D. J., T. C. Hallstrom, et al. (1995). "Expression of an ATP-binding cassette transporter- encoding gene (YOR1) is required for oligomycin resistance in Saccharomyces cerevisiae." Mol Cell Biol 15 (12): 6875-6883. Kemner, J. M., X. Liang, et al. (1997). "The Agrobacterium tumefaciens virulence gene chvE is part of a putative ABC-type sugar transport operon." J Bacteriol 179 (7): 2452-2458. Kerppola, T. K. (2009). "Visualization of molecular interactions using bimolecular fluorescence complementation analysis: characteristics of protein fragment complementation." Chem Soc Rev 38 (10): 2876-2886. Kimura, Y. and K. Tanaka (2010). "Regulatory mechanisms involved in the control of ubiquitin homeostasis." J Biochem 147 (6): 793-798. Kispal, G., P. Csere, et al. (1997). "The ABC transporter Atm1p is required for mitochondrial iron homeostasis." FEBS Lett 418 (3): 346-350. Kispal, G., P. Csere, et al. (1999). "The mitochondrial proteins Atm1p and Nfs1p are essential for biogenesis of cytosolic Fe/S proteins." EMBO J 18 (14): 3981-3989. Kispal, G., K. Sipos, et al. (2005). "Biogenesis of cytosolic ribosomes requires the essential iron-sulphur protein Rli1p and mitochondria." EMBO J 24 (3): 589-598. Klein, M., Y. M. Mamnun, et al. (2002). "The ATP-binding cassette (ABC) transporter Bpt1p mediates vacuolar sequestration of glutathione conjugates in yeast." FEBS Lett 520 (1-3): 63-67. Klionsky, D. J., P. K. Herman, et al. (1990). "The fungal vacuole: composition, function, and biogenesis." Microbiol Rev 54 (3): 266-292. Koenderink, J. B., R. A. Kavishe, et al. (2010). "The ABCs of multidrug resistance in malaria." Trends Parasitol 26 (9): 440-446. Kohut, P., D. Wustner, et al. (2011). "The role of ABC proteins Aus1p and Pdr11p in the uptake of external sterols in yeast: dehydroergosterol fluorescence study." Biochem Biophys Res Commun 404 (1): 233-238. Kolaczkowska, A., M. Kolaczkowski, et al. (2008). "Compensatory activation of the multidrug transporters Pdr5p, Snq2p, and Yor1p by Pdr1p in Saccharomyces cerevisiae." FEBS Lett 582 (6): 977-983. Kovalchuk, A. and A. J. Driessen (2010). "Phylogenetic analysis of fungal ABC transporters." BMC Genomics 11 : 177. Kren, A., Y. M. Mamnun, et al. (2003). "War1p, a novel transcription factor controlling weak acid stress response in yeast." Mol Cell Biol 23 (5): 1775-1785. Kretschmer, M., M. Leroch, et al. (2009). "Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea." PLoS Pathog 5(12): e1000696. Kubota, H., K. Ota, et al. (2001). "Budding yeast GCN1 binds the GI domain to activate the eIF2alpha kinase GCN2." J Biol Chem 276 (20): 17591-17596. Kuchler, K., R. E. Sterne, et al. (1989). "Saccharomyces cerevisiae STE6 gene product: a novel pathway for protein export in eukaryotic cells." EMBO J 8(13): 3973-3984. Lankat-Buttgereit, B. and R. Tampe (2002). "The transporter associated with antigen processing: function and implications in human diseases." Physiol Rev 82 (1): 187-204. Lesage, G., J. Shapiro, et al. (2005). "An interactional network of genes involved in chitin synthesis in Saccharomyces cerevisiae." BMC Genet 6: 8. Levine, T. (2004). "Short-range intracellular trafficking of small molecules across endoplasmic reticulum junctions." Trends Cell Biol 14 (9): 483-490. Li, S. C. and P. M. Kane (2009). "The yeast lysosome-like vacuole: endpoint and crossroads." Biochim Biophys Acta 1793 (4): 650-663.

160

Li, X. Z. and H. Nikaido (2004). "Efflux-mediated drug resistance in bacteria." Drugs 64 (2): 159-204. Li, Y. and W. A. Prinz (2004). "ATP-binding cassette (ABC) transporters mediate nonvesicular, raft- modulated sterol movement from the plasma membrane to the endoplasmic reticulum." J Biol Chem 279 (43): 45226-45234. Li, Z., I. Lee, et al. (2009). "Rational extension of the ribosome biogenesis pathway using network- guided genetics." PLoS Biol 7(10): e1000213. Li, Z. S., M. Szczypka, et al. (1996). "The yeast cadmium factor protein (YCF1) is a vacuolar glutathione S- conjugate pump." J Biol Chem 271 (11): 6509-6517. Lill, R. and G. Kispal (2001). "Mitochondrial ABC transporters." Res Microbiol 152 (3-4): 331-340. Lockshon, D., L. E. Surface, et al. (2007). "The sensitivity of yeast mutants to oleic acid implicates the peroxisome and other processes in membrane function." Genetics 175 (1): 77-91. MacDiarmid, C. W., L. A. Gaither, et al. (2000). "Zinc transporters that regulate vacuolar zinc storage in Saccharomyces cerevisiae." EMBO J 19 (12): 2845-2855. MacDiarmid, C. W., M. A. Milanick, et al. (2003). "Induction of the ZRC1 metal tolerance gene in zinclimited yeast confers resistance to zinc shock." J Biol Chem 278 (17): 15065-15072. Maciaszczyk-Dziubinska, E., I. Migdal, et al. (2010). "The yeast aquaglyceroporin Fps1p is a bidirectional arsenite channel." FEBS Lett 584 (4): 726-732. Mahe, Y., A. Parle-McDermott, et al. (1996). "The ATP-binding cassette multidrug transporter Snq2 of Saccharomyces cerevisiae: a novel target for the transcription factors Pdr1 and Pdr3." Mol Microbiol 20 (1): 109-117. Mason, D. L., M. P. Mallampalli, et al. (2003). "A region within a lumenal loop of Saccharomyces cerevisiae Ycf1p directs proteolytic processing and substrate specificity." Eukaryot Cell 2(3): 588-598. Maurice, T. C., C. E. Mazzucco, et al. (1998). "A highly conserved intraspecies homolog of the Saccharomyces cerevisiae elongation factor-3 encoded by the HEF3 gene." Yeast 14 (12): 1105- 1113. McKusick, V. A. (1998). Mendelian inheritance in man : a catalog of human genes and genetic disorders . Baltimore, Johns Hopkins University Press. Miyabe, S., S. Izawa, et al. (2000). "Expression of ZRC1 coding for suppressor of zinc toxicity is induced by zinc-starvation stress in Zap1-dependent fashion in Saccharomyces cerevisiae." Biochem Biophys Res Commun 276 (3): 879-884. Miyahara, K., M. Mizunuma, et al. (1996). "The involvement of the Saccharomyces cerevisiae multidrug resistance transporters Pdr5p and Snq2p in cation resistance." FEBS Lett 399 (3): 317-320. Mo, C., M. Valachovic, et al. (2004). "The ERG28-encoded protein, Erg28p, interacts with both the sterol C-4 demethylation enzyme complex as well as the late biosynthetic protein, the C-24 sterol methyltransferase (Erg6p)." Biochim Biophys Acta 1686 (1-2): 30-36. Ortiz, D. F., M. V. St Pierre, et al. (1997). "A yeast ATP-binding cassette-type protein mediating ATP- dependent bile acid transport." J Biol Chem 272 (24): 15358-15365. Ostlund, G., T. Schmitt, et al. (2010). "InParanoid 7: new algorithms and tools for eukaryotic orthology analysis." Nucleic Acids Res 38 (Database issue): D196-203. Ouellette, M., D. Legare, et al. (2001). "Multidrug resistance and ABC transporters in parasitic protozoa." J Mol Microbiol Biotechnol 3(2): 201-206. Ozbabacan, S. E., H. B. Engin, et al. (2011). "Transient protein-protein interactions." Protein Eng Des Sel 24 (9): 635-648. Patton, C., S. Thompson, et al. (2004). "Some precautions in using chelators to buffer metals in biological solutions." Cell Calcium 35 (5): 427-431. Paumi, C. M., M. Chuk, et al. (2009). "ABC transporters in Saccharomyces cerevisiae and their interactors: new technology advances the biology of the ABCC (MRP) subfamily." Microbiol Mol Biol Rev 73 (4): 577-593.

161

Paumi, C. M., J. Menendez, et al. (2007). "Mapping protein-protein interactions for the yeast ABC transporter Ycf1p by integrated split-ubiquitin membrane yeast two-hybrid analysis." Mol Cell 26 (1): 15-25. Petrovic, S., L. Pascolo, et al. (2000). "The products of YCF1 and YLL015w (BPT1) cooperate for the ATP- dependent vacuolar transport of unconjugated bilirubin in Saccharomyces cerevisiae." Yeast 16 (6): 561-571. Phizicky, E. M. and S. Fields (1995). "Protein-protein interactions: methods for detection and analysis." Microbiol Rev 59 (1): 94-123. Piper, P., Y. Mahe, et al. (1998). "The pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast." EMBO J 17 (15): 4257-4265. Proctor, M., M. L. Urbanus, et al. (2011). "The automated cell: compound and environment screening system (ACCESS) for chemogenomic screening." Methods Mol Biol 759 : 239-269. Qin, S. L., K. Moldave, et al. (1987). "Isolation of the yeast gene encoding elongation factor 3 for protein synthesis." J Biol Chem 262 (16): 7802-7807. Ragni, E., A. Coluccio, et al. (2007). "GAS2 and GAS4, a pair of developmentally regulated genes required for spore wall assembly in Saccharomyces cerevisiae." Eukaryot Cell 6(2): 302-316. Reynolds, S. M., L. Kall, et al. (2008). "Transmembrane topology and signal peptide prediction using dynamic bayesian networks." PLoS Comput Biol 4(11): e1000213. Riffle, M., L. Malmstrom, et al. (2005). "The Yeast Resource Center Public Data Repository." Nucleic Acids Res 33 (Database issue): D378-382. Roberts, G. G. and A. P. Hudson (2006). "Transcriptome profiling of Saccharomyces cerevisiae during a transition from fermentative to glycerol-based respiratory growth reveals extensive metabolic and structural remodeling." Mol Genet Genomics 276 (2): 170-186. Robinson, M. D., J. Grigull, et al. (2002). "FunSpec: a web-based cluster interpreter for yeast." BMC Bioinformatics 3: 35. Rockwell, N. C., H. Wolfger, et al. (2009). "ABC transporter Pdr10 regulates the membrane microenvironment of Pdr12 in Saccharomyces cerevisiae." J Membr Biol 229 (1): 27-52. Rogers, B., A. Decottignies, et al. (2001). "The pleitropic drug ABC transporters from Saccharomyces cerevisiae." J Mol Microbiol Biotechnol 3(2): 207-214. Rowe, S. M., S. Miller, et al. (2005). "Cystic fibrosis." N Engl J Med 352 (19): 1992-2001. Rust, S., M. Rosier, et al. (1999). "Tangier disease is caused by mutations in the gene encoding ATP- binding cassette transporter 1." Nat Genet 22 (4): 352-355. Sardiu, M. E. and M. P. Washburn (2011). "Building protein-protein interaction networks with proteomics and informatics tools." J Biol Chem 286 (27): 23645-23651. Schmitt, L. and R. Tampe (2002). "Structure and mechanism of ABC transporters." Curr Opin Struct Biol 12 (6): 754-760. Schneider, K., J. O. Kromer, et al. (2009). "Metabolite profiling studies in Saccharomyces cerevisiae: an assisting tool to prioritize host targets for antiviral drug screening." Microb Cell Fact 8: 12. Schuller, C., Y. M. Mamnun, et al. (2007). "Membrane-active compounds activate the transcription factors Pdr1 and Pdr3 connecting pleiotropic drug resistance and membrane lipid homeostasis in saccharomyces cerevisiae." Mol Biol Cell 18 (12): 4932-4944. Seret, M. L., J. F. Diffels, et al. (2009). "Combined phylogeny and neighborhood analysis of the evolution of the ABC transporters conferring multiple drug resistance in hemiascomycete yeasts." BMC Genomics 10 : 459. Shani, N., A. Sapag, et al. (1996). "An S. cerevisiae peroxisomal transporter, orthologous to the human adrenoleukodystrophy protein, appears to be a heterodimer of two half ABC transporters: Pxa1p and Pxa2p." Ann N Y Acad Sci 804 : 770-772. Sharifpoor, S., D. van Dyk, et al. (2012). "Functional wiring of the yeast kinome revealed by global analysis of genetic network motifs." Genome Res 22 (4): 791-801.

162

Sharma, M. and R. Prasad (2011). "The quorum-sensing molecule farnesol is a modulator of drug efflux mediated by ABC multidrug transporters and synergizes with drugs in Candida albicans." Antimicrob Agents Chemother 55 (10): 4834-4843. Shekhawat, S. S. and I. Ghosh (2011). "Split-protein systems: beyond binary protein-protein interactions." Curr Opin Chem Biol 15 (6): 789-797. Simm, C., B. Lahner, et al. (2007). "Saccharomyces cerevisiae vacuole in zinc storage and intracellular zinc distribution." Eukaryot Cell 6(7): 1166-1177. Smoot, M. E., K. Ono, et al. (2011). "Cytoscape 2.8: new features for data integration and network visualization." Bioinformatics 27 (3): 431-432. Snider, J. and W. A. Houry (2008). "AAA+ proteins: diversity in function, similarity in structure." Biochem Soc Trans 36 (Pt 1): 72-77. Snider, J., S. Kittanakom, et al. (2010). "Detecting interactions with membrane proteins using a membrane two-hybrid assay in yeast." Nat Protoc 5(7): 1281-1293. Stark, C., B. J. Breitkreutz, et al. (2011). "The BioGRID Interaction Database: 2011 update." Nucleic Acids Res 39 (Database issue): D698-704. Stefkova, J., R. Poledne, et al. (2004). "ATP-binding cassette (ABC) transporters in human metabolism and diseases." Physiol Res 53 (3): 235-243. Suda, Y., R. K. Rodriguez, et al. (2009). "A screen for spore wall permeability mutants identifies a secreted protease required for proper spore wall assembly." PLoS One 4(9): e7184. Sullivan, D. P., H. Ohvo-Rekila, et al. (2006). "Sterol trafficking between the endoplasmic reticulum and plasma membrane in yeast." Biochem Soc Trans 34 (Pt 3): 356-358. Tamas, M. J., K. Luyten, et al. (1999). "Fps1p controls the accumulation and release of the compatible solute glycerol in yeast osmoregulation." Mol Microbiol 31 (4): 1087-1104. Tong, A. H., G. Lesage, et al. (2004). "Global mapping of the yeast genetic interaction network." Science 303 (5659): 808-813. Trautwein, M., C. Schindler, et al. (2006). "Arf1p, Chs5p and the ChAPs are required for export of specialized cargo from the Golgi." EMBO J 25 (5): 943-954. Ubersax, J. A., E. L. Woodbury, et al. (2003). "Targets of the cyclin-dependent kinase Cdk1." Nature 425 (6960): 859-864. van Bakel, H., E. Strengman, et al. (2005). "Gene expression profiling and phenotype analyses of S. cerevisiae in response to changing copper reveals six genes with new roles in copper and iron metabolism." Physiol Genomics 22 (3): 356-367. van der Heide, T. and B. Poolman (2000). "Osmoregulated ABC-transport system of Lactococcus lactis senses water stress via changes in the physical state of the membrane." Proc Natl Acad Sci U S A 97 (13): 7102-7106. Ventura, S. (2011). "Bimolecular fluorescence complementation: illuminating cellular protein interactions." Curr Mol Med 11 (7): 582-598. Verwaal, R., Y. Jiang, et al. (2010). "Heterologous carotenoid production in Saccharomyces cerevisiae induces the pleiotropic drug resistance stress response." Yeast 27 (12): 983-998. Wang, Z., L. S. Feng, et al. (2006). "Solution structure of a Zap1 zinc-responsive domain provides insights into metalloregulatory transcriptional repression in Saccharomyces cerevisiae." J Mol Biol 357 (4): 1167-1183. Waters, B. M. and D. J. Eide (2002). "Combinatorial control of yeast FET4 gene expression by iron, zinc, and oxygen." J Biol Chem 277 (37): 33749-33757. Wawrzycka, D., I. Sobczak, et al. (2010). "Vmr 1p is a novel vacuolar multidrug resistance ABC transporter in Saccharomyces cerevisiae." FEMS Yeast Res 10 (7): 828-838. Wilcox, L. J., D. A. Balderes, et al. (2002). "Transcriptional profiling identifies two members of the ATP- binding cassette transporter superfamily required for sterol uptake in yeast." J Biol Chem 277 (36): 32466-32472.

163

Wolfger, H., Y. Mahe, et al. (1997). "The yeast ATP binding cassette (ABC) protein genes PDR10 and PDR15 are novel targets for the Pdr1 and Pdr3 transcriptional regulators." FEBS Lett 418 (3): 269-274. Wolfger, H., Y. M. Mamnun, et al. (2004). "The yeast Pdr15p ATP-binding cassette (ABC) protein is a general stress response factor implicated in cellular detoxification." J Biol Chem 279 (12): 11593- 11599. Wu, Y. H., A. G. Frey, et al. (2011). "Transcriptional regulation of the Zrg17 zinc transporter of the yeast secretory pathway." Biochem J 435 (1): 259-266. Wysocki, R., C. C. Chery, et al. (2001). "The glycerol channel Fps1p mediates the uptake of arsenite and antimonite in Saccharomyces cerevisiae." Mol Microbiol 40 (6): 1391-1401. Yamaguchi, K., S. Inoue, et al. (2009). "Pulse-chase experiment for the analysis of protein stability in cultured mammalian cells by covalent fluorescent labeling of fusion proteins." Methods Mol Biol 577 : 121-131. Yamasaki, S., K. Sakata-Sogawa, et al. (2007). "Zinc is a novel intracellular second messenger." J Cell Biol 177 (4): 637-645. Yoshikawa, K., T. Tanaka, et al. (2009). "Comprehensive phenotypic analysis for identification of genes affecting growth under ethanol stress in Saccharomyces cerevisiae." FEMS Yeast Res 9(1): 32-44. Young, L., K. Leonhard, et al. (2001). "Role of the ABC transporter Mdl1 in peptide export from mitochondria." Science 291 (5511): 2135-2138. Zerhusen, B., J. Zhao, et al. (1999). "A single conductance pore for chloride ions formed by two cystic fibrosis transmembrane conductance regulator molecules." J Biol Chem 274 (12): 7627-7630. Zhao, H. and D. Eide (1996). "The yeast ZRT1 gene encodes the zinc transporter protein of a highaffinity uptake system induced by zinc limitation." Proc Natl Acad Sci U S A 93 (6): 2454-2458. Zhao, H. and D. Eide (1996). "The ZRT2 gene encodes the low affinity zinc transporter in Saccharomyces cerevisiae." J Biol Chem 271 (38): 23203-23210. Zhou, Z., K. A. White, et al. (1998). "Function of Escherichia coli MsbA, an essential ABC family transporter, in lipid A and phospholipid biosynthesis." J Biol Chem 273 (20): 12466-12475.