View metadata, citation and similar papers at core.ac.uk brought to you by CORE
provided by Directory of Open Access Journals
International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
Innovative Approach to Improve Hybrid Cryptography by Using DNA Steganography
Mohammad Reza Najaf Torkaman1, Nazanin Sadat Kazazi1, Azizallah Rouddini2
1 Faculy of Computer Science and Information System, UNIVERSITI TEKNOLOGI MALAYSIA (UTM), Kuala Lumpur, Malaysia 2Faculty of Management and Human Resources Development, UNIVERSITI TEKNOLOGI MALAYSIA (UTM), Kuala Lumpur, Malaysia
{[email protected], [email protected], [email protected]}
Consequently, the attackers are not aware of ABSTRACT transmission of session key through unsecure channel. Finally, the strength point There exists a big demand for innovative of the DNA steganography is discussed. secure electronic communications while the expertise level of attackers increases rapidly and that causes even bigger demands and KEYWORDS needs for an extreme secure connection. An ideal security protocol should always be Cryptography; Cryptography Protocols; protecting the security of connections in DNA steganography; Innovation; many aspects, and leaves no trapdoor for the creativity; attackers. Nowadays, one of the popular cryptography protocols is hybrid
cryptosystem that uses private and public key cryptography to change secret message. 1 INTRODUCTION In available cryptography protocol attackers are always aware of transmission of One of the scientific topic sensitive data. Even non-interested attackers investigations in disciplines has been can get interested to break the ciphertext out creativity [1]. The human creative of curiosity and challenge, when suddenly thinking capabilities and the solving of catches some scrambled data over the problems make possible by evolvements network. First of all, we try to explain the of computer science and technology of roles of innovative approaches in information. On the other hand, the cryptography. After that we discuss about fundamental cells of an innovative the disadvantages of public key system are the talents of entrepreneurial cryptography to exchange secret key. Furthermore, DNA steganography is and creativity [2]. In addition, Creativity explained as an innovative paradigm to has defined an evident that crates the diminish the usage of public cryptography to useful and new ideas such as involving exchange session key. In this protocol, the discovery of scientific, the invention session key between a sender and receiver is of social, the innovation of technological hidden by novel DNA data hiding technique.
224 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
and the imagination of artistic in the 1.1 Innovation and Creativity many human activity [3]. Cryptography is the science and art of One of the scientific subject secret writing that it cannot form investigations in disciplines has been without creativity actions with creativity [1]. The human creative entrepreneurial talent [4][5][6]. It studies thinking capabilities and the solving of some mathematical techniques and problems make possible by evolvements provides mechanisms necessary to of computer science and technology of provide aspects related to information information. For instance, According to security like confidentiality, data Ratten internet capabilities make integrity, entity authentication, and data possible mobile banking and it has origin authentication [6]. caused that the most people can use from Symmetric algorithms are cryptosystems electronic all communication, which has that either a secret key will be shared for enable them to market products and both encryption and decryption [7][8]. services by the mobile phones [12]. The algorithms of symmetric Moreover, it has increased and cryptosystems are very strong against improvement these capabilities through possible attacks, but mainly weakness of gain entrance to the resources of large symmetric cryptosystems is brute- information and the interaction of forcing the secret key. This characteristic multimodal with algorithms [13] [11]. creates the biggest critical act in any On the other hand, the fundamental cells cryptosystem that uses symmetric of an innovative system are the talents of algorithms which is distribution of the entrepreneurial and creativity [2] [14] .In shared secret between the two parties addition, education and research in like DES algorithms [8] [9]. entrepreneurship are developing as a Asymmetric algorithms use different critical area of a study program for the values for encryption and decryption and students of computer science [15]. do not need to share secret between two Entrepreneurship matters are greatly parties. Each party only has to keep a believed that it can be significant to the secret of its own. The earliest foundation global modern business [16]. Nowadays, of asymmetric algorithms known as there is a great correlation among public key cryptosystems comes from knowledge, education, economic growth, key exchange problem of symmetric and information and communication algorithms. In 1976, Whitfield Diffie technology in the knowledge-based and Martin Hellman proposed a method economy [17]. Therefore, what is were the sender and receiver do not have entrepreneurship? to share a secret. That was the first work A wide of domain activeness and on hybrid cryptosystem [6][7][10]. processes has covered the meanings of The information of this study shows that entrepreneurship, involving foundation how DNA steganography can be used in of an organization and innovation [18]. the information security. In fact Based on Styles and Seymour, proposed approach is innovative concept claimed that Entrepreneurship has a in hybrid cryptography. direct attention to distinct or individual opportunistic actions [19]. These activities are forcefully connected with innovation that they produce the value
225 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
and give birth risk. Although, the key management have been discussed in scholars have had a different definition [29]: from the word of the entrepreneurship, they accepted that entrepreneurship i. Data confidentiality – the first role of connects with the creative activity of cryptography is to protect data something new [20] [21]. In addition, confidentiality. Given that keys have a Creativity has defined an evident that major role in security of cryptosystem, crates the useful and new ideas such as they should fulfill this obligation. involving the discovery of scientific, the invention of social, the innovation of ii. Secure key distribution – the keys technological and the imagination of should be well protected in the process artistic in the many human activity of distribution to parties. They are the [3][22]. easiest way that Eve can get access to encrypted data. There are many points that Eve can get opportunity to attack 1.2 Key Management in cryptography the keys like key distribution, key updates, key revocation, etc. To create the best cryptosystem, it is feasible to use symmetric algorithms iii. Data authentication – the keys can be since they are extremely fast in process a tool to authenticate the and secure in algorithms comparing to communicating party. Public key asymmetric algorithms. However, the cryptography can provide this feature. distribution of the secret key over an insecure channel is one of the most iv. Efficiency of key management – challenging topics in cryptosystems nowadays most of the cryptosystems [4][7][8][9][10][23][24][25][26]. rely on centralized key certification Here on wards, this paper will express authorities for key management viable information on how to incorporate processes. Here all value and symmetric algorithms with other significance of the security of the keys methods to provide a new method that is granted to these authorities. holds a strong security in many aspects. Consequently, the efficiency and There are several steps in key security performance of these management of a cryptosystem. The certification authorities has a great deal main ones are: Key generation, Key in providing security to communicating distribution, and Key revocation [27]. parties. The distribution of the key is the critical step since it is the most interest of Eve to intercept and catch the key. If the 1.3 Public Key Methods Hybrid cryptosystem uses the strongest Cryptosystem algorithm with best generated key but distribution of the key has lack of The best existing method for a security, the overall security of that cryptosystem to provide best security cryptosystem would be zero. Diffie possible seems to be hybrid Hellman algorithm was the establisher of cryptosystems. They are called hybrid key distribution over insecure channels because they are a mixture of symmetric [28]. Some of the concerns of security in and asymmetric algorithms, using
226 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
security and speed of symmetric together much of a time period that authority is with asymmetric strength in secure key trusted [7]. distribution, authentication, etc. Public key methods have much strength but there are lots of drawbacks to these cryptosystems. The following is a short list of these drawbacks:
1. Public key methods are very low in speed [7]. The usage of symmetric algorithms has decreased this problem but this still is an issue in asymmetric Figure 1: Conventional Hybrid Cryptosystem role. 2. The asymmetric algorithms are very vulnerable to chosen-plaintext 1.4 Steganography attacks. This attack is effective because of the fact that encryption Steganography is the science and art of key is published [7][30][31]. information hiding. Cryptography and 3. Another consideration in asymmetric Steganography have same mission with algorithms is algorithmic attacks. different method, the former changes the Even though factoring n is known as content but latter covers the existence of nearly impossible calculation, but the information. In Greek‟s literature, researchers have shown the Steganography means “covered writing” possibility of this attack especially [35]. with the growth of technology and The famous traditional story of speed of computer‟s processors [32]. Steganography is known as Simmons‟ 4. Although the database that holds the Prisoner‟s Problem. Two of the prisoners value of the public keys are very are planning for an escape; they have to secured and only authorized user can discuss the plan without getting the modify it, there still exists a high risk attention of the guards. The only of Eve‟s chance in modifying the data practical way for them is by having a of the database[7]. normal insusceptible communication 5. Man-in-the-Middle-Attack is the most that carries the message in a hidden way popular attak to public key [36]. cryptosystem[7]. Interlock Protocol In Steganography ancient history, [33] has been proposed to solve this Histiaeus in 5th century BC used a problem but there are still big steganography technique to send his arguments against the efficiency and message by tattooing shaved head of a effectiveness of this protocol [34]. slave and sending him as a carrier when Certification Authorities (CA) were a the hair grew back. Another historical solution to public key distribution. But story is a reinvention of a Chinese old there still exists critical issues for this method of secret writing by an Italian method as well, such as the terms mathematician using a paper mask that certificate, trust, how to choose the holds some holes and will be put on a authority on top of everyone, and how blank page, the holes should be filled up
227 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
with letters of the secret message, and 1.4.1 Fingerprinting and when the mask is removed, the blank Watermarking spaces between letter will be filled up with other letters to make a normal Fingerprinting and watermarking is an sentence so the message looks application of steganography that mostly differently, but when the mask is put is used for copyright protection and back, the letters of the secret message purposes. This allows the owner to will be distinct. The mask is shared search in the internet and detect illegal between two parties. [37] use of his product. Also, sometimes Every method that includes when there is a restriction in delivering Steganography uses an algorithm that the information of a specific image, it embeds the data into a carrier and can be embedded into the image so employs a detector function that carried everywhere together with the retrieves back the embedded image. Fingerprinting and watermarking information. The embedding function differ when used for protection of has to use a secret key that only intellectual properties. Watermarking authorized parties are aware of. The embeds the copyright so when function detects and recovers the distributed to all users, any point of time message using the secret key. The the copyright can be retrieved. With hardest part in embedding the data is to fingerprint, however, the owner embeds not to create any detectable changes in different serial numbers in the product carrier media while embedding. The and can trace thirds party suppliers of most important point here is although their products. One of the most detection of embedded data and secret important jobs that these techniques data does not necessarily results to provide is changes in the carrier does not recovering it, but the risk of the chance reflect the embedded data [40]. of attacker‟s success is very high, hence avoiding obvious modifications is a must. The other important point to 1.4.2 Least Significant Bit Insertion consider is that avoiding detectable changes does not guarantee invisibility Steganography algorithms can be of embedded data [38][39]. categorized into two categories of Some requirements of Steganography spatial/time domain and transform are capacity, imperceptibility, and domain techniques. LSB method is robustness. Where, each concentrates spatial/time domain type of respectfully on: the biggest amount of steganography where the information is data that can be embedded in the carrier, embedded in the spatial domain of the avoiding unauthorized detection of image or time domain of audio carrier. embedded data, and strength of This method plays with the binary embedded data against being removed or representation of the hidden data. The damaged by operations done on the progress is that the least significant bit of carrier like copy, cut, and paste [36]. a binary number of the carrier media which is the most right digit of the binary number will be alternated to the value of binary number of the message to be embedded. Any changes in the
228 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
carrier will directly affect the embedded DNA Steganography is one of the data like cropping, compression, color cutting edge techniques in this area. degradation, and so on [23]. This method Basic concepts of the DNA is best effective when applying on gray Steganography are based on the scale images. Rather than that, it is properties of natural DNA sequences in vulnerable to steganalysis [40]. the cell. In molecular biology, genetic information is stored in deoxyribonucleic acid which is known 1.4.3 Transform Domain Based as DNA in the cells. DNA is made by Steganography four nucleotides which are thymidine (T), cytidine (C), guanosine (G), and As it is discussed, LSB method is adenosine (A). These bases are linked by spatial/time domain type of backbone of DNA strands which are steganography where the information is sugar components and phosphate groups. embedded in the spatial domain of the This backbone identifies the direction of image or time domain of audio carrier. the DNA strands [41]. However, Transform domain methods use different parts of the media to embed the data. They operate on three different methods of: Discrete Cosine Transform (DCT), Discrete Fourier Transform (DFT), and Discrete Wavelet Transform (DWT) [40].
Figure 2: The Backbone of DNA strand [23] 1.4.4 Text Information Hiding Steganography Each single strand is linked by hydrogen bond to make the DNA double Texts are one of the most important strand. The standard situation of media used today in telecommunication nucleotides allows to make a hydrogen technology. The characteristics of being bind between C and G; or A and T. This exceedingly efficient in transmissions, complementarily standard rule is known occupying fewer resources, along with as Watson-Crick base-pairing. C and G its intelligible meaning put together to are bonded by triple hydrogen bond, make it the universal most used media although A and T are linked by double [40]. hydrogen bond. This complementarily concept is the fundamental issue in genetic activities that leads to double 1.4.5 DNA Steganography DNA strands are twisted together and make DNA double helix. The mixture of Nowadays, scientists work on different these basic nucleotides which are kind of Steganography algorithms to thymidine (T), cytidine (C), guanosine ameliorate the security of system. There (G), and adenosine (A) make the long are many Steganography algorithms to polymer strands which able to make hide the secret data in to the host carrier. massive amount of combinations of DNA double helix that stores the every
229 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
living features and properties of proposed protocol‟s aim is reducing the creatures such as human and mammal. usage of public key cryptography. There are several DNA data hiding The structure of proposed algorithm is approaches based on [42] [43] [44]. It combinational of concepts of means that scientists work on real cryptography and steganography. molecular DNA. Although, these works Available cryptography protocols use are very worthwhile and introduced new potential advantages of symmetric and area of data hiding approaches, they public cryptography. As we know, have some drawbacks. One of the most private key cryptography is strong in popular disadvantages of natural DNA- terms of their algorithms and public key based data hiding is the biological errors cryptography can be used to protect like mutation and difficulty of symmetric algorithm by distributing its implementation of DNA system. key. However, because of the nature of Luckily, Shiu worked on three different cryptographic algorithms the attacker is data hiding methods based on DNA- always aware of transmission of coding technology. He proved that his sensitive data. Even a non-interested algorithm is robust and do not need attackers can get interested to break the equipped laboratory. Actually, DNA ciphertext out of curiosity and challenge, reference sequence S is chosen and when abruptly catches some scrambled sample message N is mixed with it to data over the network, and who knows, produce final data hiding result (S‟). this might be some crucial information Moreover, he compared these three of a an organization! So the problem still algorithms based on capacity and is how to distribute the secret key of payload. DNA reference sequence can symmetric algorithms. be selected from different DNA The existence of transmission of database. One very important DNA message is hidden by using database is EBI that provides steganography which propose in this fundamental genetic information [45]. paper. Steganography needs a secret key, which is distributed among two parties for every establishment of new 2 THE PROPOSED PROTOCOL: communication, for embedding the data. CRYPTOGRAPHY- The steganography method in this paper STEGANOGRAPHY is DNA-based algorithm to hide secret TEGANOGRAPHY PROTOCOL messages. Every DNA steganography algorithm As discussed earlier, public key methods has its secret key to extract real message have much strength but there are lots of from the carrier. We can employ some drawbacks to these cryptosystems. We different techniques to transfer the are proposing a technique for best steganography key. In this paper, we do security possible using a combination of not want to focus on approach to cryptographic and steganography exchange DNA steganography, but we techniques. The method answers to can use hybrid cryptosystem based on requirements of a secure communication DNA steganography which is proposed while defeating most of the popular in NajafTorkaman‟s work [46]. Sender attacks known up until today. The
230 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
and receiver use following protocol to this section to hide the session key [45]. exchange the session key. In fact there are different DNA sequences on diverse DNA bank web For the first communication, sites like EBI database (European 1. Alice communicates with Bob to Bioinformatics Institute) [47]. The share a secret key (DNA proposed algorithm uses the EBI DNA steganography key). bank to extract 163 million DNA based 2. Bob receives the steganography key sequences. and uses it to embed the symmetric There are two main rules in this DNA key in a DNA stream steganography process. The first rule is 3. Alice receives the DNA stream, the DNA coding technology rule that is extracts the symmetric key and the kept secret among the sender and symmetric connection is established. receiver. DNA coding technology is the approach to convert binary data to DNA For all next communications, string. The second one is DNA 1. Alice embeds a new symmetric key in complementary rule is also kept secret in a DNA stream, sends it to Bob. sender and receiver side. There are six 2. Using the same DNA Steganography major complementary rules for each key, Bob extracts the symmetric key letter of DNA sequence. For all letter x, and generates a symmetric C(x), C(C(x)), C(C(C(x))) is not equal. connection.
AT TC CG GA The following figure demonstrates a AT TG GC CA graphical representation of the proposed AC CT TG GA protocol: AC CG GT TA
AG GT TC CA
AG GC CT TA
Figure 4: Six major complementary rules for each DNA sequence
Moreover, our DNA coding technology rules to convert binary data to DNA string in this paper is based on table following rules. 00 is converted to AA, 01 converted to T, 10 converted to C, 11 converted to GG, 0 converted to A, and 1 converted to G. Figure 3: Proposed method – hybrid The DNA-based data hiding algorithm cryptosystem integrated with DNA Steganography is divided to two main part sender and receiver process. Sender follows several steps to conceal binary data in the DNA 2.1 Proposed DNA Steganography sequence. First, sender extracts reference sequence from EBI database which is Shiu experiment is used as basic accessible publicly or uses DNA coding information of proposed algorithm in
231 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
technology to convert any binary data original secret message. As we and make reference DNA sequence. For mentioned C(s(i)) is complementary instance, the reference sequence is S= based on complementary rule . The „CGTATCGAATCGATGCAGAT‟. In output of this pseudo code is M which is this example secret message is the original secret message. M=‟10001101‟. As we can see the length of reference sequence is 20 and function S'=extract(S, S') the length of secret message is 8. After i=1; j=1; that we can use different random x= size(S',2); generator functions to generate 8 integer for i=1:x random numbers. The random generator if (s(i)==s(i')) function produces numbers from 1 to 20 M(j)= 0; j=j+1; (length of reference sequence). Finally, else (s'(i)== C(s(i))) the pseudo code algorithm is M(j)= 1; implemented in MATLAB software to j=j+1; produce the final output. For this end example output of the algorithm is s'= end „CGATGATCGGATCGAATGCA‟. Sender can send this DNA string in In connection establishment, sender and public channel to receiver. receiver transfer steganography key which is complementary rules. This transformation process can be done with S=s1+s2+s3+…+sm = CGTATCGAATCGATGCAGAT different kind of current cryptography or DNA cryptography algorithms. After M=m1+m2+m3+…+mp= ‟10001101‟ that session key of communication is A= {A1+A2+A3+…+Ap} = {1, 3, 4, 6, 9, 11, 13, 16} transferred by proposed DNA steganography. function S'=hide(S,M,A) x= size(S,2); // get the length of reference sequence 2.2 Strength of Proposed DNA y= size(A,2); // get the length Steganography of set of random number for i=1:x for j=1:y In proposed DNA steganography, as we if (i== A(j) && M(j)==1 ) mentioned there are six main S'(i)= C(s(i)) // use complementary rules for each letter in complementary rule else if (i== A(j) && M(j)==0 ) DNA sequence. The strength point of the S'(i)= s(i); steganography method is DNA reference else sequences which are chosen from EBI S'(i)= C( C(s(i))) // use database. There are approximately 163 complementary rule million DNA sequences. It is unfeasible end end for the attackers to find any information end about existence of a secret message which is concealed in the DNA Receiver knows about complementary sequence. In case the attacker knows that rule and the DNA reference sequence S. a secret message is embedded in the He uses this pseudo code to discover DNA sequence, it is unfeasible to guess
232 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
the correct sequence among 163 million cryptography. According to the DNA sequences. Therefore the information of this work, asymmetric probability of finding the original secret cryptography brings many disadvantages message from 163 million DNA when used in key distribution protocols. sequences is: Therefore, in this paper we proposed to decrease the usage of asymmetric cryptography and introduced a novel Proposed DNA steganography algorithm cryptographic-steganography protocol. is based on the third algorithm of shiu Furthermore, we explained the [45] and he compared different DNA importance of creativity approaches in steganography based on capacity and information security especially in payload. This algorithm has some cryptography. The main advantage of properties. The first property is using proposed cryptography protocol was DNA reference sequence from EBI using innovative DNA steganography database. Therefore, it is impossible to techniques to conceal secret session key find correct message among 163 million which is transferred among sender and DNA sequences. The second property is receiver throughout unsecured channel. its capacity which is equal to selected In proposed protocol attackers are not DNA string (|S|) that means the payload aware of exchanging session key which of this algorithm is zero. Table 1 shows is hidden by DNA data hiding method. the comparison between proposed The strength point of the DNA algorithm and two other DNA data steganography algorithm is using DNA hiding method which are presented in reference sequences which are selected Shiu‟s papper [45]. from EBI database. We have approximately used 163 million DNA Table 1: A comparison of the different sequences from EBI database. It is DNA data hiding methods impossible for attackers to find whether or not there are secret message hidden in DNA data Capacity Payload DNA sequences. Even if attackers know hiding method a secret message is embedded in DNA sequences, it is impossible to guess the Insertion correct sequence among 163 million DNA sequences. Complementary
pair Algorithm of 4 REFERENCES
this paper 1. VAN LANGEN, P. H. G., WIJNGAARDS, N. J. E. & BRAZIER, F. M. T. Designing creative artificial systems. Artificial 3 CONCLUSION Intelligence for Engineering Design, Analysis and Manufacturing(2004), 18, 217- Hybrid cryptosystem is one of the post 225. 2. SUN, H. The 3-3-3 framework and 7P popular algorithms in cryptography to model for teaching creativity, innovation encrypt data. Hybrid cryptosystem is and entrepreneurship. Journal of Chinese combination of public and private key Entrepreneurship,(2011) 3, 159-166.
233 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
3. THAGARD, P. & STEWART, T. C. The 17. ZAMFIR, A. & PLUMB, I. Year. Using a Aha! experience: Creativity through Computer-based Model for Developing emergent binding in neural networks. Business Students‟ Skills: Case Study on the Cognitive science.(2011) Regional Application of the Model. In, World Scientific and Engineering Academy 4. Willett, M., Cryptography old and new, and Society (WSEAS),(2011) 49-54. ScienceDirect, Computers & Security, 18. GARTNER, W. Who is an entrepreneur? Is (1982) 177- 186. the wrong question. American Journal of 5. Lin, H. S., Cryptography and Public Policy, Small Business (1988), 12, 11-32 Journal of Government Information, (1998) 19. STYLES, C. & SEYMOUR, R. G. 135–148. Opportunities for marketing researchers in 6. Alia, M.A., Yahya, A., Public–Key international entrepreneurship. International Steganography Based on Matching Method, Marketing Review,(2006) 23, 126-145. European Journal of Scientific 20. AUTIO, E. Creative tension: the Research,(2010) 223-231. significance of Ben Oviatts and Patricia 7. Schneier, B., Applied Cryptography,New McDougalls articletoward a theory of York : John Wiley & Sons, 1996. international new ventures'. Journal of 8. Kumar, S., & Wollinger, T. ,Fundamentals International Business Studies,(2005) 36, 9- of Symmetric Cryptography, Embedded 19. Security in Cars, (2006) 125-143. 21. HESSELS, J. International 9. Burke, J., McDonald, J., & Austin, T., Entrepreneurship: Value Creation Across Architectural support for fast symmetric-key National Borders. Scales Research Reports, cryptography. Architectural support for (2008). programming languages and operating 22. Khan, A. M , Innovative and Noninnovative systems. (2000) Association of Computing Small Firms: Types and Characteristics. Machinery.Stone, J.V.: Independent Management Science,(1989) Vol. 35, no. 5. Component Analysis: A Tutorial Pp. 597–606. Introduction. MIT Press, Cambridge, MA 23. Knudsen, L.R. ,Block ciphers-analysis, (2004). design, applications, Doctor Philosohy, 10. Mohapatra, P. K.,Public-Key Cryptography, Aarhus University, 1994. 2000, Crossroads. 24. Stinson, D., Cryptography: Theory and 11. Christensen, C. "The Rules of Innovation". Practice (discrete mathematics and its Technology Review ,(2002),105 (5): 32–38. applications). s.l. : CRC Press, 1995. 12. RATTEN, V. Mobile Banking Innovations 25. de Canniere, C., Biryukov, A. , Preneel, B., and Entrepreneurial Adoption Decisions. An introduction to Block Cipher International Journal of E-Entrepreneurship Cryptanalysis, (2006)346 – 356. and Innovation (IJEEI)(2011), 2, 27-38. 26. Vignesh, R.S., Sudharssun, S. ,Kumar, 13. MAHER, M. L., BONNARDEL, N. & KIM, K.J.J. , Limitations of quantum & the Y. S. Creativity: Simulation, stimulation, versatility of classical cryptography: a and studies. Artificial Intelligence for comparative study, Environmental and Engineering Design, Analysis and Computer Science, (2009) 333 - 337. Manufacturing,(2010), 24, 149-151. 27. Chaeikar, S., Razak, S., Honarbakhsh, S., 14. Thomke, S. H. . "Experimentation Matters: Zeidanloo, H., Zamani, M., & Jaryani, F. Unlocking the Potential of New Interpretative Key Management (IKM), A Technologies for Innovation". Harvard Novel Framework, Computer Research and Business School Press, 2003. Development, (2010)265 – 269. 15. LAWLER, J. A Financial Technology 28. Diffie, W. , Hellman, M. E., New Directions Entrepreneurship Program for Computer in Cryptography, s.l. : IEEE, Transactions Science Students. Information Systems on Information Theory,(1976) 644 - 654. Education Journal,(2011) 9, 53. 29. Boukerche, A., Ren, Y., & Samarah, S. A 16. LI, X. Entrepreneurial Competencies as an Secure Key Management Scheme for Entrepreneurial Distinctive: An Examination Wireless and Mobile Ad Hoc Networks of the Competency Approach in Defining Using Frequency-Based Approach: Proof Entrepreneurs,(2009). and Correctness. GlobalTelecommunications Conference (2008) (pp. 1 - 5). IEEE.
234 International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 224-235 The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
30. Tzeng, W.G., Common modulus and 44. Shimanovsky, B., Feng, J. , Potkonjak, M., chosen-message attacks on public-key Hiding data in DNA, in: Revised Papers schemes with linear recurrence relations, from the 5th International Workshop on Information Processing Letters, (1999) 153- Information Hiding, Lecture Notes in 156. Computer Science 2578 (2002) 373–386. 31. Izmerly,O., Mor, T., Chosen ciphertext 45. Shiu, H., Ng, K., Fnag, J. F., Lee, R., attacks on lattice-based public key Huang, C., Data hiding methods based upon encryption and modern (non-quantum) DNA sequences, Information Sciences, 180 cryptography in a quantum environment, (2010) 2196–2208. Theoretical Computer Science,(2006) 308- 46. Najaftorkaman, M., Shanmuham, B., 323. Abbasy, M., & Ordi, A., Hybrid 32. Aboud, S.J., An efficient method for attack Cryptosystem with DNA Technology. RSA scheme. , s.l. : IEEE, Applications of International Conference on Information Digital Information and Web Security and Artificial Intelligence Technologies.(2009) 587 - 591. Vol.1(2010)460-464 . 33. Rivest, R.L. , Shamir, A. ,How to Expose an 47. European Bioinformatics Institute Eavesdropper., Communications of the Corporation,
235