DOCSLIB.ORG

Vitek®2 Id & Ast Cards

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Vitek®2 Id & Ast Cards ® VITEK 2 ID & AST CARDS Reliable • safe • rapid bioMérieux S.A. • 69280 Marcy l’Étoile • France • Tel.: + 33 (0)4 78 87 20 00 • Fax: +33 (0)4 78 87 20 90 www.biomerieux.com • www.biomerieux-diagnostics.com RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in the lab. The ADVANCED EXPERT SYSTEM™ validates ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal compared to other systems6,10,12.The cards provide increased standardization and automated, same-day results helping clinicians to optimise antibiotic therapy sooner2,3. Designed for VITEK 2 automated systems, VITEK 2 identi cation (ID) and susceptibility (AST) cards provide reliable and accurate results for clinically important bacteria and yeasts1,2,4,5 ® VITEK 2 ID & AST CARDS Rapid, Flexible, E cient Each self-contained, disposable test card provides rapid and INNOVATIVE AND FLEXIBLE DESIGN accurate species- level identi cation or • Each card contains microwells with biochemicals or antimicrobials susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability EUCAST and CLSI compliant AST formulations available reference CLSI** and • ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: US FDA*****, or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10. • No reagent addition UNIQUE, SAFE, CLOSED CONSUMABLE: • Optimal for user safety • No aerosols, splattering, or spills • Small, lightweight cards save on contaminated disposal costs and storage space BROAD AND EXPANDING ID/AST TEST MENU IDENTIFICATION CARD TYPES ANTIBIOTIC SUSCEPTIBILITY CARD TYPES* • GN (Gram negative bacilli) 187 organisms • Gram negative Bacilli 78 antimicrobials and ESBL† test • GP (Gram positive cocci & bacilli) 128 organisms • Staphylococci &/or Enterococci 67 antimicrobials, †† • ANC (anaerobes & Corynebacteria) 91 organisms 4 high level aminoglycoside screens and ICR test • NH (Neisseria & Haemophilus) 36 organisms • Streptococci 18 antimicrobials and ICR test and gentamicin synergy • YST (Yeast) 57 organisms • Streptococcus pneumoniae 23 antimicrobials • YST (Yeast) 6 antimicrobials * Minimum Inhibitory Concentration † Extended-spectrum-beta-lactamase ** Clinical & Laboratory Standards Institute †† Inducible clindamycin resistance *** International Organization for Standardization **** European Committee on Antimicrobial Susceptibility Testing† Extended-spectrum-beta-lactamase ***** Food and Drug Administration • Roseomonas gilardii • Pasteurella pneumotropica • Gemella bergeri • Salmonella entérica ssp arizonae • Pasteurella testudinis • Gemella haemolysans GRAM NEGATIVE • Salmonella entérica ssp diarizonae • Photobacterium damselae • Gemella morbillorum • Salmonella group (3) • Pseudomonas aeruginosa • Gemella sanguinis IDENTIFICATION • Salmonella ser. Gallinarum • Pseudomonas alcaligenes • Globicatella sanguinis VITEK® 2 GN CARD • Salmonella ser. paratyphi A • Pseudomonas fluorescens • Globicatella sulfidifaciens • Salmonella ser. typhi • Pseudomonas luteola • Granulicatella adiacens REF. 21341 • Serratia ficaria • Pseudomonas mendocina • Granulicatella elegans • Serratia fonticola • Pseudomonas oleovorans • Helcococcus kunziii • Serratia liquefaciens group (4) • Pseudomonas oryzihabitans • Kocuria kristinae • Serratia marcescens • Pseudomonas putida • Kocuria rhizophila • Serratia odorifera • Pseudomonas stutzeri • Kocuria rosea ENTEROBACTERIACEAE • Serratia plymuthica • Ralstonia insidiosa • Kocuria varians • Budvicia aquatica • Serratia rubidaea • Ralstonia mannitolilytica • Lactococcus garvieae • Buttiauxella agrestis • Shigella group (5) • Ralstonia pickettii • Lactococcus lactis ssp cremoris • Cedecea davisae • Shigella sonnei • Rhizobium radiobacter • Lactococcus lactis ssp lactis • Cedecea lapagei • Yersinia aldovae • Roseomonas gilardii • Lactococcus raffinolactis • Citrobacter amalonaticus • Yersinia enterocolitica/frederiksenii • Shewanella algae • Leuconostoc citreum • Citrobacter braakii • Yersinia intermedia • Shewanella putrefaciens • Leuconostoc lactis • Citrobacter farmeri • Yersinia kristensenii • Sphingobacterium multivorum • Leuconostoc mesenteroides ssp. • Citrobacter freundii • Yersinia pestis • Sphingobacterium spiritivorum cremoris • Citrobacter koseri • Yersinia pseudotuberculosis • Sphingobacterium thalpophilum • Leuconostoc mesenteroides ssp. • Citrobacter sedlakii • Yersinia ruckeri • Sphingomonas paucimobilis dextranicum • Citrobacter youngae • Yokenella regensburgei • Stenotrophomonas maltophilia • Leuconostoc mesenteroides ssp. • Cronobacter sakazakii group (1) • Tatumella ptyseos mesenteroides • Edwardsiella hoshinae • Vibrio alginolyticus • Leuconostoc pseudomesenteroides NON-ENTEROBACTERIACEAE • Edwardsiella tarda • Vibrio cholerae • Listeria fleischmannii • Enterobacter aerogenes • Achromobacter denitrificans • Vibrio fluvialis • Listeria grayi • Enterobacter asburiae • Achromobacter xylosoxidans • Vibrio metschnikovii • Listeria innocua • Enterobacter cancerogenus • Acinetobacter baumannii complex (6) • Vibrio mimicus • Listeria ivanovii • Enterobacter cloacae complex (2) • Acinetobacter haemolyticus • Vibrio parahaemolyticus • Listeria monocytogenes • Escherichia coli • Acinetobacter junii • Vibrio vulnificus • Listeria rocourtiae • Escherichia coli O157 • Acinetobacter lwoffii • Listeria seeligeri • Escherichia fergusonii • Actinobacillus radioresistens HIGHLY PATHOGENIC • Listeria welshimeri • Escherichia hermannii • Actinobacillus ursingii ORGANISMS • Micrococcus luteus • Escherichia vulneris • Actinobacillus ureae • Brucella melitensis • Micrococcus lylae • Ewingella americana • Aeromonas hydrophila/ • Burkholderia mallei • Pediococcus acidilactici • Hafnia alvei Aeromonas caviae • Burkholderia pseudomallei • Pediococcus pentosaceus • Hafnia paralvei • Aeromonas salmonicida • Escherichia coli O157 • Rothia mucilaginosa • Klebsiella oxytoca • Aeromonas sobria • Francisella tularensis • Staphylococcus arlettae • Klebsiella pneumoniae • Aeromonas veronii • Yersinia pestis • Staphylococcus aureus ssp ozaenae • Alcaligenes faecalis ssp. faecalis • Staphylococcus auricularis • Klebsiella pneumoniae • Bordetella bronchiseptica • Staphylococcus capitis ssp pneumoniae • Bordetella hinzii • Staphylococcus caprae • Klebsiella pneumoniae • Bordetella trematum • Staphylococcus carnosus ssp. ssp rhinoscleromatis • Brevundimonas diminuta/vesicularis GRAM POSITIVE carnosus • Kluyvera ascorbata • Brucella melitensis IDENTIFICATION • Staphylococcus chromogenes • Kluyvera cryocrescens • Burkholderia cepacia group (7) • Staphylococcus cohnii ssp. cohnii ® • Kluyvera intermedia • Burkholderia gladioli VITEK 2 GP CARD • Staphylococcus cohnii ssp. urealyticus • Leclercia adecarboxylata • Burkholderia mallei REF. 21342 • Staphylococcus epidermidis • Lelliottia amnigena 1 • Burkholderia pseudomallei • Staphylococcus equorum (Enterobacter amnigenus 1) • Chromobacterium violaceum • Staphylococcus gallinarum • Lelliottia amnigena 2 • Chryseobacterium gleum • Staphylococcus haemolyticus (Enterobacter amnigenus 2) • Chryseobacterium indologenes • Abiotrophia defectiva • Staphylococcus hominis ssp. • Moellerella wisconsensis • Comamonas testosteroni • Aerococcus urinae hominis • Morganella morganii ssp. morganii • Cupriavidus pauculus • Aerococcus viridans • Staphylococcus hominis ssp. • Morganella morganii ssp. sibonii • Delftia acidovorans • Alloiococcus otitis novobiosepticus • Pantoea agglomerans • Elizabethkingia meningoseptica • Dermacoccus nishinomiyaensis / • Staphylococcus hyicus • Pantoea spp. • Francisella tularensis Kytococcus sedentarius • Staphylococcus intermedius • Plesiomonas shigelloides • Grimontia hollisae • Enterococcus avium • Staphylococcus kloosii • Pluralibacter gergoviae • Mannheimia haemolytica • Enterococcus casseliflavus • Staphylococcus lentus (Enterobacter gergoviae) • Methylobacterium spp. • Enterococcus cecorum • Staphylococcus lugdunensis • Proteus hauseri • Moraxella group (8) • Enterococcus columbae • Staphylococcus pseudintermedius • Proteus mirabilis • Myroides spp. • Enterococcus durans • Staphylococcus saprophyticus • Proteus penneri • Neisseria animaloris/zoodegmatis •Enterococcus faecalis • Staphylococcus schleiferi • Proteus vulgaris • Ochrobactrum anthropi • Enterococcus faecium • Staphylococcus sciuri • Providencia alcalifaciens • Oligella ureolytica • Enterococcus gallinarum • Staphylococcus simulans • Providencia rettgeri • Pandoraea spp • Enterococcus hirae • Staphylococcus vitulinus • Providencia rustigianii • Paracoccus yeei • Enterococcus raffinosus • Staphylococcus warneri • Providencia stuartii • Pasteurella aerogenes • Enterococcus saccharolyticus • Staphylcoccus xylosus • Rahnella aquatilis • Pasteurella canis • Erysipelothrix rhusiopahiae • Streptococcus agalactiae • Raoultella ornithinolytica • Pasteurella dagmatis • Facklamia hominis • Raoultella planticola • Pasteurella multocida • Gardnerella vaginalis • Streptococcus alactolyticus • Bacteroides fragilis
Load more

Recommended publications
  • Pluralibacter Gergoviae Als Spender- Oder Empfängerorganismus Gemäß § 5 Absatz 1 Gentsv
    Az. 45241.0205 Juni 2020 Empfehlung der ZKBS zur Risikobewertung von Pluralibacter gergoviae als Spender- oder Empfängerorganismus gemäß § 5 Absatz 1 GenTSV Allgemeines Pluralibacter gergoviae (früher: Enterobacter gergoviae [1]) ist ein Gram-negatives, fakultativ anaerobes, peritrich begeißeltes, stäbchenförmiges Bakterium aus der Familie der Enterobacteriaceae, das zuerst 1980 beschrieben wurde [2]. Es ist weltweit verbreitet und wurde aus klinischen Proben (Blut, Urin, Sputum, Stuhl, Hautabstriche, Ohrendrainage, nicht näher beschriebene Wunden, Abszesse, Lunge, Niere) sowie aus dem Darm eines Roten Baumwollkapselwurms, Wasserproben und Kosmetikprodukten isoliert [2–7]. Das Überleben in Kosmetikprodukten wird dadurch ermöglicht, dass P. gergoviae eine hohe Toleranz gegen Konservierungsmittel wie Benzoesäure und Parabenen aufweist [8]. Aufgrund dieser Toleranz ist P. gergoviae in der Vergangenheit mehrfach als mikrobielle Verunreinigung in Kosmetikprodukten aufgetreten, die daraufhin zurückgerufen werden mussten [9]. Im klinischen Kontext tritt P. gergoviae vergleichsweise selten als Krankheitserreger auf. Das Bakterium löst vor allem bei Immunkompromittierten Infektionen aus, die tödlich verlaufen können. Es verursachte Harnwegsinfektionen oder Infektionen der Operationswunde bei Empfängern von Nierentransplantaten [10], mehrere Sepsisfälle auf einer Neugeborenenstation, von denen die Mehrzahl Frühgeborene betrafen [3], und führte zu einem Septischen Schock bei einem Leukämie-Patienten [11]. Bei Immunkompetenten wurden eine Sepsis
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • CATALOGO GENERALE - Listino Prezzi 2020 2021 Chromart CATALOGOTERRENI GENERALE Listinocromogeni Prezzi 2021 - 2022 Per La Microbiologia Industriale
    Microbiologia Microbiologia Microbiologia Microbiologia Microbiologia Microbiologia CATALOGO GENERALE - Listino Prezzi 2020 2021 CATALOGO ChromArt CATALOGOTERRENI GENERALE ListinoCROMOGENI Prezzi 2021 - 2022 Per la Microbiologia Industriale Microbiologia Clinica e Industriale Ph: A. Geraci Microbiologia Clinica e Industriale Terreni cromogeni Rev. 02/2021 per l’isolamento e l’identificazione dei principali patogeni ed indicatori fecali negli alimenti, mangimi ed acque. Biolife Biolife ItalianaBiolife srl - VItalianaiale Monza srl - 272Viale 20128 Monza Milano272 20128 - Tel. 02Milano 25209.1 - Tel. 02- www 25209.1.biolifeitaliana.i - www.biolifeitaliana.it t Biolife Italiana srl - Viale Monza 272 20128 Milano - Tel. 02 25209.1 - www.biolifeitaliana.it t .biolifeitaliana.i www - 25209.1 02 l. Te - Milano 20128 272 Monza iale V - l sr Italiana Biolife CONDIZIONI GENERALI DI VENDITA PREZZI I prezzi segnati nei nostri listini si intendono Iva esclusa e sono comprensivi di imballo normale e spedizione con vettori con noi convenzionati. Gli imballi speciali e/o refrigerati saranno addebitati al costo. Le spedizioni con vettori scelti dal cliente saranno a carico di quest’ultimo. L’IVA (Imposta sul Valore Aggiunto) è sempre a carico del Committente nella misura di legge. ORDINI Gli ordini devono essere formulati per iscritto e verranno evasi rispettando le unità di confezioni indicate nel listino. Per evitare errori raccomandiamo di indicare sempre negli ordini il numero di codice e la denominazione di ciascun articolo nonché la quantità richiesta. È nostro diritto accettare, annullare e procrastinare in tutto o in parte ordini a seguito di sopravvenute impossibilità da parte nostra, dei nostri fornitori e dei vettori. Tali cause ci sollevano da ogni obbligo precedentemente assunto con l’accettazione dell’ordine.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]
  • 2021 ECCMID | 00656 in Vitro Activities of Ceftazidime-Avibactam and Comparator Agents Against Enterobacterales
    IHMA In Vitro Activities of Ceftazidime-avibactam and Comparator Agents against Enterobacterales and 2122 Palmer Drive 00656 Schaumburg, IL 60173 USA Pseudomonas aeruginosa from Israel Collected Through the ATLAS Global Surveillance Program 2013-2019 www.ihma.com M. Hackel1, M. Wise1, G. Stone2, D. Sahm1 1IHMA, Inc., Schaumburg IL, USA, 2Pfizer Inc., Groton, CT USA Introduction Results Results Summary Avibactam (AVI) is a non-β- Table 1 Distribution of 2,956 Enterobacterales from Israel by species Table 2. In vitro activity of ceftazidime-avibactam and comparators agents Figure 2. Ceftazidime and ceftazidime-avibactam MIC distribution against 29 . Ceftazidime-avibactam exhibited a potent lactam, β-lactamase inhibitor against Enterobacterales and P. aeruginosa from Israel, 2013-2019 non-MBL carbapenem-nonsusceptible (CRE) Enterobacterales from Israel, antimicrobial activity higher than all Organism N % of Total mg/L that can restore the activity of Organism Group (N) %S 2013-2019 comparator agents against all Citrobacter amalonaticus 2 0.1% MIC90 MIC50 Range ceftazidime (CAZ) against Enterobacterales (2956) 20 Enterobacterales from Israel (MIC90, 0.5 Citrobacter braakii 5 0.2% Ceftazidime-avibactam 99.8 0.5 0.12 ≤0.015 - > 128 Ceftazidime Ceftazidime-avibactam organisms that possess Class 18 mg/L; 99.8% susceptible). Citrobacter freundii 96 3.2% Ceftazidime 70.1 64 0.25 ≤0.015 - > 128 A, C, and some Class D β- Cefepime 71.8 > 16 ≤0.12 ≤0.12 - > 16 16 . Susceptibility to ceftazidime-avibactam lactmase enzymes. This study Citrobacter gillenii 1 <0.1% Meropenem 98.8 0.12 ≤0.06 ≤0.06 - > 8 increased to 100% for the Enterobacterales Amikacin 95.4 8 2 ≤0.25 - > 32 14 examined the in vitro activity Citrobacter koseri 123 4.2% when MBL-positive isolates were removed Colistin (n=2544)* 82.2 > 8 0.5 ≤0.06 - > 8 12 of CAZ-AVI and comparators Citrobacter murliniae 1 <0.1% Piperacillin-tazobactam 80.4 32 2 ≤0.12 - > 64 from analysis.
    [Show full text]
  • Identification of Pasteurella Species and Morphologically Similar Organisms
    UK Standards for Microbiology Investigations Identification of Pasteurella species and Morphologically Similar Organisms Issued by the Standards Unit, Microbiology Services, PHE Bacteriology – Identification | ID 13 | Issue no: 3 | Issue date: 04.02.15 | Page: 1 of 28 © Crown copyright 2015 Identification of Pasteurella species and Morphologically Similar Organisms Acknowledgments UK Standards for Microbiology Investigations (SMIs) are developed under the auspices of Public Health England (PHE) working in partnership with the National Health Service (NHS), Public Health Wales and with the professional organisations whose logos are displayed below and listed on the website https://www.gov.uk/uk- standards-for-microbiology-investigations-smi-quality-and-consistency-in-clinical- laboratories. SMIs are developed, reviewed and revised by various working groups which are overseen by a steering committee (see https://www.gov.uk/government/groups/standards-for-microbiology-investigations- steering-committee). The contributions of many individuals in clinical, specialist and reference laboratories who have provided information and comments during the development of this document are acknowledged. We are grateful to the Medical Editors for editing the medical content. For further information please contact us at: Standards Unit Microbiology Services Public Health England 61 Colindale Avenue London NW9 5EQ E-mail: [email protected] Website: https://www.gov.uk/uk-standards-for-microbiology-investigations-smi-quality- and-consistency-in-clinical-laboratories UK Standards for Microbiology Investigations are produced in association with: Logos correct at time of publishing. Bacteriology – Identification | ID 13 | Issue no: 3 | Issue date: 04.02.15 | Page: 2 of 28 UK Standards for Microbiology Investigations | Issued by the Standards Unit, Public Health England Identification of Pasteurella species and Morphologically Similar Organisms Contents ACKNOWLEDGMENTS .........................................................................................................
    [Show full text]
  • Antibiotic Use Guidelines for Companion Animal Practice (2Nd Edition) Iii
    ii Antibiotic Use Guidelines for Companion Animal Practice (2nd edition) iii Antibiotic Use Guidelines for Companion Animal Practice, 2nd edition Publisher: Companion Animal Group, Danish Veterinary Association, Peter Bangs Vej 30, 2000 Frederiksberg Authors of the guidelines: Lisbeth Rem Jessen (University of Copenhagen) Peter Damborg (University of Copenhagen) Anette Spohr (Evidensia Faxe Animal Hospital) Sandra Goericke-Pesch (University of Veterinary Medicine, Hannover) Rebecca Langhorn (University of Copenhagen) Geoffrey Houser (University of Copenhagen) Jakob Willesen (University of Copenhagen) Mette Schjærff (University of Copenhagen) Thomas Eriksen (University of Copenhagen) Tina Møller Sørensen (University of Copenhagen) Vibeke Frøkjær Jensen (DTU-VET) Flemming Obling (Greve) Luca Guardabassi (University of Copenhagen) Reproduction of extracts from these guidelines is only permitted in accordance with the agreement between the Ministry of Education and Copy-Dan. Danish copyright law restricts all other use without written permission of the publisher. Exception is granted for short excerpts for review purposes. iv Foreword The first edition of the Antibiotic Use Guidelines for Companion Animal Practice was published in autumn of 2012. The aim of the guidelines was to prevent increased antibiotic resistance. A questionnaire circulated to Danish veterinarians in 2015 (Jessen et al., DVT 10, 2016) indicated that the guidelines were well received, and particularly that active users had followed the recommendations. Despite a positive reception and the results of this survey, the actual quantity of antibiotics used is probably a better indicator of the effect of the first guidelines. Chapter two of these updated guidelines therefore details the pattern of developments in antibiotic use, as reported in DANMAP 2016 (www.danmap.org).
    [Show full text]
  • Vitek®2 Id & Ast Cards
    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
    [Show full text]
  • In Vitro Activities of Aztreonam-Avibactam and Ceftazidime-Avibactam Against Less Commonly Encountered Gram-Negative Bacteria Co
    IHMA, Inc. In Vitro Activities of Aztreonam-avibactam and Ceftazidime-avibactam Against Less Commonly Encountered Gram-Negative 2122 Palmer Drive P1155 Schaumburg, IL 60173 USA Bacteria Collected During the ATLAS Global Surveillance Program 2012-2017 www.ihma.com M. Hackel1, G Stone2, B. deJonge3, D. Sahm1 1IHMA, Inc., Schaumburg IL, USA 2Pfizer Inc., Cambridge, MA USA 3Pfizer Inc., Cambridge MA, USA Introduction Results Results While antimicrobial susceptibility Table 1. Less commonly isolated gram-negative species Table 2. In vitro activity of ceftazidime-avibactam, aztreonam-avibactam and comparators against less commonly encountered gram-negative bacteria collected in 2012-2017 . ATM-AVI and CAZ-AVI showed MIC90 values from the ATLAS Global Surveillance Program 2012-2017 AZT-AVI CAZ-AVI CST* MEM TGC TZP LVX profiles have been well described in Organism N ranging from ≤0.015 to 0.5 mg/L and 0.06 to 1 %S MIC Range %S MIC Range %S MIC Range %S MIC Range %S MIC Range %S MIC Range %S MIC Range more common members of the 90 90 90 90 90 90 90 mg/L, respectively, against members of the Organism N Percent of total Acinetobacter nosocomialis 183 na 64 2 - >128 na 32 1 - >128 96.8 2 0.25 - >8 79.8 > 8 0.015 - >8 na 1 0.06 - 4 na > 128 ≤0.25 - >128 76.5 >4 0.06 - >8 Enterobacterales, notably Escherichia Enterobacterales (Table 2). 98.3% were coli and Klebsiella pneumoniae, and in Acinetobacter nosocomialis 183 5.1 Acinetobacter pittii 402 na 64 2 - >128 na 16 0.5 - >128 99.2 2 0.12 - 4 92.3 1 ≤0.06 - >8 na 1 0.03 - >8 na 64 ≤0.25 - >128 88.6 2 0.06 - >8 Citrobacter spp.
    [Show full text]
  • Phenotypic and Molecular Characterization of the Capsular Serotypes of Pasteurella Multocida Isolates from Pneumonic Cases of Cattle in Ethiopia
    Phenotypic and Molecular Characterization of the Capsular Serotypes of Pasteurella multocida Isolates from Pneumonic Cases of Cattle in Ethiopia Mirtneh Akalu Yilma ( [email protected] ) Koneru Lakshmaiah Education Foundation https://orcid.org/0000-0001-5936-6873 Murthy Bhadra Vemulapati Koneru Lakshmaiah Education Foundation Takele Abayneh Tefera Veterinaerinstituttet Martha Yami VeterinaryInstitute Teferi Degefa Negi VeterinaryInstitue Alebachew Belay VeterinaryInstitute Getaw Derese VeterinaryInstitute Esayas Gelaye Leykun Veterinaerinstituttet Research article Keywords: Biovar, Capsular type, Cattle, Ethiopia, Pasteurella multocida Posted Date: January 19th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-61749/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/13 Abstract Background: Pasteurella multocida is a heterogeneous species and opportunistic pathogen associated with pneumonia in cattle. Losses due to pneumonia and associated expenses are estimated to be higher in Ethiopia with limited information about the distribution of capsular serotypes. Hence, this study was designed to determine the phenotypic and capsular serotypes of P. multocida from pneumonic cases of cattle. Methods: A cross sectional study with purposive sampling method was employed in 400 cattle from April 2018 to January 2019. Nasopharyngeal swabs and lung tissue samples were collected from clinically suspected pneumonic cases of calves (n = 170) and adult cattle (n = 230). Samples were analyzed using bacteriological and molecular assay. Results: Bacteriological analysis revealed isolation of 61 (15.25%) P. multocida subspecies multocida. Incidence was higher in calves 35 (57.38%) compared to adult cattle 26 (42.62%) at P < 0.5. PCR assay targeting KMT1 gene (~460 bp) conrmed P.
    [Show full text]
  • Which Organisms Are Used for Anti-Biofouling Studies
    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
    [Show full text]