Identification of Molecular-Genetic Causes for Osteogenesis Imperfecta, Interdigital Hyperplasia and Ribosomopathies in Cattle
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database. -
Htra1 Is a Novel Transcriptional Target of RUNX2 That Promotes Osteogenic Differentiation
Cellular Physiology Cell Physiol Biochem 2019;53:832-850 DOI: 10.33594/00000017610.33594/000000176 © 2019 The Author(s).© 2019 Published The Author(s) by and Biochemistry Published online: online: 9 9November November 2019 2019 Cell Physiol BiochemPublished Press GmbH&Co. by Cell Physiol KG Biochem 832 Press GmbH&Co. KG, Duesseldorf IyyanarAccepted: et 7al.: November Runx2 Regulates 2019 Htra1 During Osteogenesiswww.cellphysiolbiochem.com This article is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 Interna- tional License (CC BY-NC-ND). Usage and distribution for commercial purposes as well as any distribution of modified material requires written permission. Original Paper Htra1 is a Novel Transcriptional Target of RUNX2 That Promotes Osteogenic Differentiation Paul P.R. Iyyanara,b Merlin P. Thangaraja B. Frank Eamesc Adil J. Nazaralia aLaboratory of Molecular Cell Biology, College of Pharmacy and Nutrition and Neuroscience Research Cluster, University of Saskatchewan, Saskatoon, SK, Canada, bDivision of Developmental Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, OH, USA, cDepartment of Anatomy and Cell Biology, University of Saskatchewan, Saskatoon, SK, Canada Key Words Runx2 • Htra1 • Osteoblast differentiation • Matrix mineralization Abstract Background/Aims: Runt-related transcription factor 2 (Runx2) is a master regulator of osteogenic differentiation, but most of the direct downstream targets of RUNX2 during osteogenesis are unknown. Likewise, High-temperature requirement factor A1 (HTRA1) is a serine protease expressed in bone, yet the role of Htra1 during osteoblast differentiation remains elusive. We investigated the role of Htra1 in osteogenic differentiation and the transcriptional regulation of Htra1 by RUNX2 in primary mouse mesenchymal progenitor cells. Methods: Overexpression of Htra1 was carried out in primary mouse mesenchymal progenitor cells to evaluate the extent of osteoblast differentiation. -
Loss of the Tectorial Membrane Protein CEACAM16 Enhances Spontaneous, Stimulus-Frequency, and Transiently Evoked Otoacoustic Emissions
The Journal of Neuroscience, July 30, 2014 • 34(31):10325–10338 • 10325 Cellular/Molecular Loss of the Tectorial Membrane Protein CEACAM16 Enhances Spontaneous, Stimulus-Frequency, and Transiently Evoked Otoacoustic Emissions Mary Ann Cheatham,1 Richard J. Goodyear,3 Kazuaki Homma,4 P. Kevin Legan,3 Julia Korchagina,3 Souvik Naskar,3 Jonathan H. Siegel,1 X Peter Dallos,1,2 Jing Zheng,4 and Guy P. Richardson3 1Roxelyn and Richard Pepper Department of Communication Sciences and Disorders, The Knowles Hearing Center, and 2Department of Neurobiology, Northwestern University, Evanston, Illinois 60208, 3Sussex Neuroscience, School of Life Sciences, University of Sussex, Falmer, Brighton, BN1 9QG, United Kingdom, and 4Department of Otolaryngology-Head and Neck Surgery, The Knowles Hearing Center, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611 ␣-Tectorin (TECTA), -tectorin (TECTB), and carcinoembryonic antigen-related cell adhesion molecule 16 (CEACAM) are secreted glycoproteins that are present in the tectorial membrane (TM), an extracellular structure overlying the hearing organ of the inner ear, the organ of Corti. Previous studies have shown that TECTA and TECTB are both required for formation of the striated-sheet matrix within which collagen fibrils of the TM are imbedded and that CEACAM16 interacts with TECTA. To learn more about the structural and functional significance of CEACAM16, we created a Ceacam16-null mutant mouse. In the absence of CEACAM16, TECTB levels are reduced, a clearly defined striated-sheet matrix does not develop, and Hensen’s stripe, a prominent feature in the basal two-thirds of the TM in WT mice, is absent. CEACAM16 is also shown to interact with TECTB, indicating that it may stabilize interactions between TECTA and TECTB. -
Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Quantigene Flowrna Probe Sets Currently Available
QuantiGene FlowRNA Probe Sets Currently Available Accession No. Species Symbol Gene Name Catalog No. NM_003452 Human ZNF189 zinc finger protein 189 VA1-10009 NM_000057 Human BLM Bloom syndrome VA1-10010 NM_005269 Human GLI glioma-associated oncogene homolog (zinc finger protein) VA1-10011 NM_002614 Human PDZK1 PDZ domain containing 1 VA1-10015 NM_003225 Human TFF1 Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) VA1-10016 NM_002276 Human KRT19 keratin 19 VA1-10022 NM_002659 Human PLAUR plasminogen activator, urokinase receptor VA1-10025 NM_017669 Human ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like VA1-10029 NM_017699 Human SIDT1 SID1 transmembrane family, member 1 VA1-10032 NM_000077 Human CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) VA1-10040 NM_003150 Human STAT3 signal transducer and activator of transcripton 3 (acute-phase response factor) VA1-10046 NM_004707 Human ATG12 ATG12 autophagy related 12 homolog (S. cerevisiae) VA1-10047 NM_000737 Human CGB chorionic gonadotropin, beta polypeptide VA1-10048 NM_001017420 Human ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) VA1-10050 NM_197978 Human HEMGN hemogen VA1-10051 NM_001738 Human CA1 Carbonic anhydrase I VA1-10052 NM_000184 Human HBG2 Hemoglobin, gamma G VA1-10053 NM_005330 Human HBE1 Hemoglobin, epsilon 1 VA1-10054 NR_003367 Human PVT1 Pvt1 oncogene homolog (mouse) VA1-10061 NM_000454 Human SOD1 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult)) -
Distinct Energy Metabolism of Auditory and Vestibular Sensory Epithelia
Distinct energy metabolism of auditory and vestibular PNAS PLUS sensory epithelia revealed by quantitative mass spectrometry using MS2 intensity Kateri J. Spinellia,b,1, John E. Klimekc,1, Phillip A. Wilmarthc, Jung-Bum Shina,b,2, Dongseok Choid, Larry L. Davidc,e, and Peter G. Gillespiea,b,3 aOregon Hearing Research Center, bVollum Institute, cProteomics Shared Resource, dDepartment of Public Health and Preventive Medicine, and eDepartment of Biochemistry and Molecular Biology, Oregon Health and Science University, Portland OR 97239 Edited by David P. Corey, Harvard Medical School, Boston, MA, and accepted by the Editorial Board December 14, 2011 (received for review September 26, 2011) Measuring the abundance of many proteins over a broad dynamic In our experiments, we desired an accurate quantitation method range requires accurate quantitation. We show empirically that, in for relative comparisons. Because varying peptide ionization, MS2 MS experiments, relative quantitation using summed dissociation- selection, and MS2 signal render the relationship between ion-cur- product ion-current intensities is accurate, albeit variable from rent intensity and peptide abundance uncertain, we sought to em- protein to protein, and outperforms spectral counting. By apply- pirically determine the suitability of MS2 intensity for protein ing intensities to quantify proteins in two complex but related quantitation under conditions of high protein complexity. Moreover, tissues, chick auditory and vestibular sensory epithelia, we find to verify our MS2 intensity quantitation methods, we sought a direct that glycolytic enzymes are enriched threefold in auditory epithe- comparison of the molecular composition of two related but distinct lia, whereas enzymes responsible for oxidative phosphorylation biological tissues. -
Rabbit Anti-Osterix/FITC Conjugated Antibody-SL1110R-FITC
SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-Osterix/FITC Conjugated antibody SL1110R-FITC Product Name: Anti-Osterix/FITC Chinese Name: FITC标记的成骨相关转录因子抗体 Osterix; MGC126598; Osx; Sp 7; Sp7; Sp7 transcription factor; Transcription factor Alias: Sp7; Zinc finger protein osterix; SP7_HUMAN. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Dog,Pig,Cow,Horse,Rabbit, Flow-Cyt=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 45kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human Osterix Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Storewww.sunlongbiotech.com at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino- terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This Product Detail: protein is a bone specific transcription factor and is required for osteoblast differentiation and bone formation.[provided by RefSeq, Jul 2010] Function: Transcriptional activator essential for osteoblast differentiation. -
Ingenuity Pathway Analysis of Human Facet Joint Tissues: Insight Into Facet Joint Osteoarthritis
EXPERIMENTAL AND THERAPEUTIC MEDICINE 19: 2997-3008, 2020 Ingenuity pathway analysis of human facet joint tissues: Insight into facet joint osteoarthritis CHU CHEN*, SHENGYU CUI*, WEIDONG LI, HURICHA JIN, JIANBO FAN, YUYU SUN and ZHIMING CUI Department of Spine Surgery, The Second Affiliated Hospital of Nantong University, Nantong, Jiangsu 226001, P.R. China Received August 17, 2019; Accepted January 30, 2020 DOI: 10.3892/etm.2020.8555 Abstract. Facet joint osteoarthritis (FJOA) is a common the top 5 IPA networks (with a score >30). The present study degenerative joint disorder with high prevalence in the elderly. provides insight into the pathological processes of FJOA from FJOA causes lower back pain and lower extremity pain, and a genetic perspective and may thus benefit the clinical treat- thus severely impacts the quality of life of affected patients. ment of FJOA. Emerging studies have focused on the histomorphological and histomorphometric changes in FJOA. However, the dynamic Introduction genetic changes in FJOA have remained to be clearly deter- mined. In the present study, previously obtained RNA deep Facet joint osteoarthritis (FJOA) is a common degenerative sequencing data were subjected to an ingenuity pathway joint disorder that causes the degeneration and breakdown analysis (IPA) and canonical signaling pathways of differ- of cartilage and restricts the movement of joints (1). It has entially expressed genes (DEGs) in FJOA were studied. The been reported that lumbar FJOA occurs at high prevalence top 25 enriched canonical signaling pathways were identified and the presence of FJOA is highly associated with age (2,3). and canonical signaling pathways with high absolute values A community-based cross-sectional study indicated that of z-scores, specifically leukocyte extravasation signaling, in populations aged <50 years, the prevalence of FJOA was Tec kinase signaling and osteoarthritis pathway, were inves- <45%, while it was ~75% in populations aged >50 years (4). -
Proteomic Analysis of the Organ of Corti Using Nanoscale Liquid Chromatography Coupled with Tandem Mass Spectrometry
Int. J. Mol. Sci. 2012, 13, 8171-8188; doi:10.3390/ijms13078171 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Proteomic Analysis of the Organ of Corti Using Nanoscale Liquid Chromatography Coupled with Tandem Mass Spectrometry Hong Peng 1,2, Miao Liu 1, Jason Pecka 3, Kirk W. Beisel 3,* and Shi-Jian Ding 1,4,* 1 Department of Pathology and Microbiology, University of Nebraska Medical Center, Omaha, NE 68198, USA; E-Mails: [email protected] (H.P.); [email protected] (M.L.) 2 Department of Environmental, Agricultural & Occupational Health, University of Nebraska Medical Center, Omaha, NE 68198, USA 3 Department of Biomedical Sciences, Creighton University, Omaha, NE 68178, USA; E-Mail: [email protected] 4 Mass Spectrometry and Proteomics Core Facility, University of Nebraska Medical Center, Omaha, NE 68198, USA * Authors to whom correspondence should be addressed; E-Mails: [email protected] (K.W.B.); [email protected] (S.-J.D.); Tel.: +1-402-280-4069 (K.W.B.); +1-402-559-4183 (S.-J.D.); Fax: +1-402-280-2690 (K.W.B.); +1-402-559-4651 (S.-J.D.). Received: 27 May 2012; in revised form: 5 June 2012 / Accepted: 25 June 2012 / Published: 2 July 2012 Abstract: The organ of Corti (OC) in the cochlea plays an essential role in auditory signal transduction in the inner ear. For its minute size and trace amount of proteins, the identification of the molecules in pathophysiologic processes in the bone-encapsulated OC requires both delicate separation and a highly sensitive analytical tool. -
Microrna Mir-378 Promotes BMP2-Induced Osteogenic
Hupkes et al. BMC Molecular Biology 2014, 15:1 http://www.biomedcentral.com/1471-2199/15/1 RESEARCH ARTICLE Open Access MicroRNA miR-378 promotes BMP2-induced osteogenic differentiation of mesenchymal progenitor cells Marlinda Hupkes1*, Ana M Sotoca1, José M Hendriks1, Everardus J van Zoelen1 and Koen J Dechering1,2,3 Abstract Background: MicroRNAs (miRNAs) are a family of small, non-coding single-stranded RNA molecules involved in post-transcriptional regulation of gene expression. As such, they are believed to play a role in regulating the step-wise changes in gene expression patterns that occur during cell fate specification of multipotent stem cells. Here, we have studied whether terminal differentiation of C2C12 myoblasts is indeed controlled by lineage-specific changes in miRNA expression. Results: Using a previously generated RNA polymerase II (Pol-II) ChIP-on-chip dataset, we show differential Pol-II occupancy at the promoter regions of six miRNAs during C2C12 myogenic versus BMP2-induced osteogenic differentiation. Overexpression of one of these miRNAs, miR-378, enhances Alp activity, calcium deposition and mRNA expression of osteogenic marker genes in the presence of BMP2. Conclusions: Our results demonstrate a previously unknown role for miR-378 in promoting BMP2-induced osteogenic differentiation. Background nucleotides) involved in post-transcriptional gene silencing The generation of distinct populations of terminally dif- and as such play important roles in diverse biological pro- ferentiated, mature specialized cell types from multipo- cesses such as developmental timing [3], insulin secretion tent stem cells, via progenitor cells, is characterized by a [4], apoptosis [5], oncogenesis [6] and organ development progressive restriction of differentiation potential that [7,8]. -
Supplemental Table 3 Site ID Intron Poly(A) Site Type NM/KG Inum
Supplemental Table 3 Site ID Intron Poly(A) site Type NM/KG Inum Region Gene ID Gene Symbol Gene Annotation Hs.120277.1.10 chr3:170997234:170996860 170996950 b NM_153353 7 CDS 151827 LRRC34 leucine rich repeat containing 34 Hs.134470.1.27 chr17:53059664:53084458 53065543 b NM_138962 10 CDS 124540 MSI2 musashi homolog 2 (Drosophila) Hs.162889.1.18 chr14:80367239:80329208 80366262 b NM_152446 12 CDS 145508 C14orf145 chromosome 14 open reading frame 145 Hs.187898.1.27 chr22:28403623:28415294 28404458 b NM_181832 16 3UTR 4771 NF2 neurofibromin 2 (bilateral acoustic neuroma) Hs.228320.1.6 chr10:115527009:115530350 115527470 b BC036365 5 CDS 79949 C10orf81 chromosome 10 open reading frame 81 Hs.266308.1.2 chr11:117279579:117278191 117278967 b NM_032046 12 CDS 84000 TMPRSS13 transmembrane protease, serine 13 Hs.266308.1.4 chr11:117284536:117281662 117283722 b NM_032046 9 CDS 84000 TMPRSS13 transmembrane protease, serine 13 Hs.2689.1.4 chr10:53492398:53563605 53492622 b NM_006258 7 CDS 5592 PRKG1 protein kinase, cGMP-dependent, type I Hs.280781.1.6 chr18:64715646:64829150 64715837 b NM_024781 4 CDS 79839 C18orf14 chromosome 18 open reading frame 14 Hs.305985.2.25 chr12:8983686:8984438 8983942 b BX640639 17 3UTR NA NA NA Hs.312098.1.36 chr1:151843991:151844258 151844232 b NM_003815 15 CDS 8751 ADAM15 a disintegrin and metalloproteinase domain 15 (metargidin) Hs.314338.1.11 chr21:39490293:39481214 39487623 b NM_018963 41 CDS 54014 BRWD1 bromodomain and WD repeat domain containing 1 Hs.33368.1.3 chr15:92685158:92689361 92688314 b NM_018349 6 CDS 55784 MCTP2 multiple C2-domains with two transmembrane regions 2 Hs.346736.1.21 chr2:99270738:99281614 99272414 b AK126402 10 3UTR 51263 MRPL30 mitochondrial ribosomal protein L30 Hs.445061.1.19 chr16:69322898:69290216 69322712 b NM_018052 14 CDS 55697 VAC14 Vac14 homolog (S.