Genetic Engineering of an Industrial Strain of Streptomyces Clavuligerus for Further Enhancement of Clavulanic Acid Production

Home , Strain (biology)

Turkish Journal of Biology Turk J Biol (2017) 41: 342-353 http://journals.tubitak.gov.tr/biology/ © TÜBİTAK Research Article doi:10.3906/biy-1608-17

Genetic engineering of an industrial strain of Streptomyces clavuligerus for further enhancement of clavulanic acid production

1,2, 1,3 1,4 1,5 1 Aslıhan KURT KIZILDOĞAN *, Güliz VANLI JACCARD , Alper MUTLU , İbrahim SERTDEMİR , Gülay ÖZCENGİZ 1 Department of Biological Sciences, Faculty of Arts and Science, Middle East Technical University, Ankara, Turkey 2 Department of Agricultural Biotechnology, Faculty of Agriculture, Ondokuz Mayıs University, Samsun, Turkey 3 Department of Physiology, University of Lausanne, Lausanne, Switzerland 4 Center for Quantitative Analysis of Molecular and Cellular Biosystems (BIOQUANT), University of Heidelberg, Heidelberg, Germany 5 Department of Molecular Biology-Genetics and Biotechnology, Graduate School of Science Engineering and Technology, İstanbul Technical University, İstanbul, Turkey

Received: 05.08.2016 Accepted/Published Online: 25.11.2016 Final Version: 20.04.2017

Abstract: An industrial clavulanic acid (CA) overproducer Streptomyces clavuligerus strain, namely DEPA, was engineered to further enhance its CA production. Single or multiple copies of ccaR, claR (pathway-specific activators), and cas2 (CA synthase) genes under the control of different promoters were introduced into this strain. CA titers of the resulting recombinants were analyzed by HPLC in a dynamic fashion and compared to the vector-only controls and a wild-type strain of S. clavuligerus while their growth was monitored throughout fermentation. The addition of an extra copy of ccaR, under control of its own promoter or constitutive ermE* promoter

(PermE*), led to 7.6- and 2.3-fold increased volumetric levels of CA in respective recombinants, namely the AK9 and ID3 strains. Its highly stable multicopy expression by the glpF promoter (PglpF) provided up to 25.9-fold enhanced volumetric CA titers in the respective recombinant, IDG3. claR expression controlled with its own promoter or ermE* and glpF-mediated amplification in an industrial strain brought about only about 1.2-fold increase in the volumetric CA titers. An extra copy of cas2 integration with PermE* into the S. clavuligerus DEPA genome led to 3.8-fold higher volumetric CA production by GV61. Conclusively, multicopy expression of ccaR under

PglpF can result in significantly improved industrial high-titer CA producers.

Key words: Clavulanic acid, industrial Streptomyces clavuligerus, strain improvement, promoters, ccaR overexpression

1. Introduction CA and clavam biosynthesis (Medema et al., 2010). In Clavulanic acid (CA) is one of the most important addition, cephamycin C and CA clusters are consecutively secondary metabolites naturally produced by Streptomyces positioned on the chromosome as a 60-kb β-lactam clavuligerus. It is a member of very powerful class of supercluster (Ward and Hodgson, 1993). Characterization β-lactamase inhibitors with very weak antibiotic activity of the CA gene cluster is still an ongoing process. However, (minimal inhibitory concentration around 25–125 µg/ essential genes such as cas2 (clavaminate synthase, CAS, a mL) (Baggaley et al., 1997). CA exerts its effect on rate-limiting enzyme) have already been identified (Song penicillin- and cephalosporin-resistant bacteria in such et al., 2009). CA regulation is accomplished by pleiotropic a way that it irreversibly binds to the serine hydroxyl and pathway-specific regulators at the molecular level. group in the catalytic sites of β-lactamases and leads The best known pathway-specific regulators of CA to the formation of a highly stable and inactive enzyme biosynthesis are CcaR and ClaR, which are transcriptional (Foulstone and Reading, 1982; Baggaley et al., 1997). Its activators encoded by ccaR (located in the cephamycin C industrial production is based on large-scale S. clavuligerus gene cluster), and pathway-specific activators encoded by fermentations, as its chemical synthesis in such volumes is claR, respectively (Liras et al., 2008). not practical (Bentley et al., 1977; Ferguson et al., 2016). Media optimization, genetic and metabolic Three distinct gene clusters, namely CA and 5S clavams engineering, and synthetic biology approaches have located in the S. clavuligerus genome and the paralog been commonly used for obtaining high-titer industrial gene cluster found in the megaplasmid, are involved in metabolites, especially β-lactams (Olano et al., 2008;

* Correspondence: [email protected] 342 KURT KIZILDOĞAN et al. / Turk J Biol

Nielsen et al., 2009; Baltz, 2011; Özcengiz and Demain, kanamycin 25 µg/mL, chloramphenicol 25 µg/mL; all 2013). The use of random mutagenesis and screening purchased from Sigma). DNA manipulations were carried strategies provided an industrial S. clavuligerus strain that out in E. coli DH5α and then E. coli ET12567/pUZ8002 produces 100-fold higher CA production than its wild- to avoid the restriction barrier of S. clavuligerus before type counterpart (Medema et al., 2011a). However, such conjugation. MS agar (Hobbs et al., 1989) was used to classical techniques are tedious and time-consuming, and grow exconjugants after conjugation. S. clavuligerus DEPA rational technologies are more preferred by researchers. was grown in vegetation medium [per liter: soy flour, 20

Moreover, the combination of classical strain isolation g; dextrin, 10 g; KH2PO4, 0.6 g; glycerol trioleate (GTO), techniques with modern strain engineering strategies 5 mL] as preculture and in fermentation medium [per results in multiple complex phenotypes (Patnaik, 2008). liter: soy flour, 20 g; dextrin, 10 g; KH2PO4, 0.6 g; GTO, In general, the amount of secondary metabolite produced 5 g; MOPS, 10.5 g; oligo elements solution (per liter: by standard strains is much lower than what is required CaCl2, 10 g; MgCl2.6H2O, 10 g; FeCl3, 3 g; ZnCl2, 0.5 g; for industrial-scale production; therefore development MnSO4.H2O; 0.5 g; NaCl, 10 g), 10 mL] for CA production. of a super-producer strain by manipulating high-titer Precultures that reached an OD600 value of around 6 were industrial ones is a very rational option (Nielsen et al., used to inoculate fermentation media in a 1/100 ratio. The 2009; Pickens et al., 2011). In the literature, there is only fermentation cultures were supplemented with GTO (0.8 one relevant report in which a double disruption of the lat mL/40 mL) at 96 h of incubation. Fermentations were and cvm genes (lat::apr-cvm::apr) involved in cephamycin carried out on rotary shakers in baffled flasks at 23.5 °C. C and clavam biosynthesis, respectively, resulted in a For CA bioassay, Klebsiella pneumoniae ATCC 29665 was 10% increment in CA yield in commercial S. clavuligerus grown in TSB (Oxoid) at 30 °C and 200 rpm to get an

(Paradkar et al., 2001). OD600 value of 0.9–1.0. Integrative and/or multicopy expressions of cas2, 2.2. Construction of plasmids and strains claR, and ccaR under the control of different promoters Chromosomal DNA of S. clavuligerus DEPA was isolated in wild-type S. clavuligerus have resulted in enhanced CA by using the salting-out procedure described by Pospiech production (Pérez-Llarena et al., 1997; Pérez-Redondo et and Neumann (1995) and used as template DNA for PCR al., 1998; Hung et al., 2007; Baltz, 2011; Guo et al., 2013). cloning of the ccaR, claR, and cas2 genes. Primers designed Indeed, the use of previously reported gene manipulations for PCR amplifications were synthesized by Alpha DNA on industrial strains obtained from random mutation (Montreal, Canada) and are listed in Table 2. PCR reactions strategies might yield more productive strains (Paradkar, were prepared as follows: template DNA (50 ng), 1 µL; 10C 2013). Thus, in the present study, we aimed at enhancing PCR buffer, 2.5 µL; 10 mM dNTP, 1 µL; DMSO, 1 µL; each CA yields of the industrial S. clavuligerus strain DEPA forward and reverse primer (10 µM), 1.25 µL; Taq DNA to obtain a versatile CA super-producer with the use of polymerase (Thermo Fisher Scientific, 5 U/µL), 0.5 µL; different vector systems and promoters by (i) insertion MgCl2 (25 mM), 2 µL; dH2O, 14.5 µL. The PCR conditions of ccaR expressed from its own promoter or ermE* were started with an initial denaturation step (10 min constitutive promoter (PermE*) by the use of the pSET152 at 94 °C), followed by 35 cycles of amplification (45 s at integration vector (Wilkinson et al., 2002) and from a 95 °C for denaturation, 45 s at Tm-5 °C for annealing, 1 strong glycerol inducible glpF promoter (PglpF) in the pSPG min/1 kb at 72 °C for extension), and ended with a final multicopy plasmid (Kurt et al., 2013), (ii) integrative/ extension step of 72 °C for 10 min. Enzymes (all 10 U/µL multicopy expression of claR under the control of its in concentration except for Taq DNA polymerase) used in own promoter and PermE* and PglpF, respectively, and (iii) cloning experiments were from Thermo Fisher Scientific cas2 gene expression with the ermE* promoter. To our (Petaluma, CA, USA). knowledge, this study reports for the first time an absolute 2.2.1. The sources/properties of plasmids and related quantification of high-titer CA production via HPLC promoters in recombinant industrial bacteria constructed using a pSPG (Supplementary Figure 1a) is a pIJ699-derived rational approach. replicable vector with a copy number ranging from 40

to 300 per cell (Kieser and Melton, 1988). PglpF in the 2. Materials and methods pSPG vector is a glycerol-inducible promoter found 2.1. Bacterial strains, plasmids, and culture conditions in a glycerol utilization pathway in S. clavuligerus that The microorganisms and plasmid vectors used in the coordinates GlyR-dependent regulation (Baños et al., study are listed in Table 1. Escherichia coli strains were 2009). In addition, pSET152 (Supplementary Figure grown in either Luria broth (LB) (Merck) or on agar plates 1b) is an integrative vector that is unable to replicate in at 37 °C, supplemented with the appropriate amount Streptomyces, but with the presence of the fC31 (phiC31) of antibiotics when necessary (ampicillin 100 µg/mL, attP-int locus in its sequence, it is inserted into the phiC31

343 KURT KIZILDOĞAN et al. / Turk J Biol

Table 1. Bacterial strains and plasmids used in this study.

Strain/plasmid Description Source or reference Strains Industrial S. clavuligerus DEPA Clavulanic acid overproducer DEPA Pharmaceuticals İzmit, Turkey S. clavuligerus pSET152/VC pSET152 without gene insert integrated into S. clavuligerus DEPA This study pSET152ErmE* without gene insert integrated into S. clavuligerus S. clavuligerus pSET152ErmE*/VC This study DEPA S. clavuligerus pSPG/VC pSPG without gene insert propagated in S. clavuligerus DEPA This study Recombinant industrial S. clavuligerus with ccaR inserted in S. clavuligerus AK9 This study pSETccaR integration vector Recombinant industrial S. clavuligerus with ccaR inserted in pEccaR S. clavuligerus ID3 This study integration vector Recombinant industrial S. clavuligerus with ccaR inserted in S. clavuligerus IDG3 This study pGlpFccaR multicopy expression vector Recombinant industrial S. clavuligerus with claR inserted in pEclaR S. clavuligerus MA28 This study integration vector Recombinant industrial S. clavuligerus with claR inserted in S. clavuligerus MAG2 This study pGlpFclaR multicopy expression vector S. clavuligerus GV61 Recombinant industrial S. clavuligerus with cas2 inserted in pEcas2 This study integration vector Professor P Liras, INBIOTEC, Leon, Klebsiella pneumoniae ATCC 29665 Clavulanic acid indicator strain Spain F` ϕdlacZM15 (lacZYA argF), U169, supE44λ-, thi-1, gyrA, recA1, E. coli DH5α E. coli Genetic Stock Center relA1, endA1, hsdR17 K Chater, John Innes Centre, E. coli ET12567/pUZ8002 F- dam 13::Tn9 dcm-6 hsdM hsdR, lacYI Norwich, UK Plasmids pGEM-T Easy AmpR, lacZ’ Promega pBluescript II KS (+) Phagemid, AmpR, lacZ’ Stratagene Ampicillin- and apramycin-resistant (AmpR, AprR), Streptomyces-E. pSPG coli multicopy vector containing the promoter of the glpF gene, and P Liras, INBIOTEC, León, Spain aac(3)IV-oriT pSET152 lacZ, reppuc, attФC31, oriT Bierman et al. (1992) Combinature Biopharm AG, pSET152ErmE* lacZ, reppuc, attФC31, oriT, ermE* Wilkinson et al. (2002) pGccaR pGEM-T Easy with S. clavuligerus ccaR gene at its EcoRI site This study pGpccaR pGEM-T Easy with S. clavuligerus pccaR gene at its EcoRI site This study pEccaR pSET152ErmE* with S. clavuligerus ccaR gene at its EcoRI site This study pSETccaR pccaR containing pSET152 at its EcoRI site This study pGlpFccaR pSPG with S. clavuligerus ccaR gene at its NdeI-SpeI recognition sites This study pGEM-T Easy with S. clavuligerus claR gene including EcoRI-BamHI pGclaREB This study sites pGEM-T Easy with S. clavuligerus claR gene including NdeI-SpeI pGclaRNS This study recognition sites pSET152ErmE* with S. clavuligerus claR gene at its EcoRI-BamHI pEclaR This study recognition site pGlpFclaR pSPG with S. clavuligerus claR gene at its NdeI-SpeI recognition site This study pGcas2 pGEM-T Easy with S. clavuligerus cas2 gene at its EcoRI site This study pBKScas2 pBluescriptII KS (+) with S. clavuligerus cas2 gene at its EcoRI site This study pEcas2 pSET152ErmE* with S. clavuligerus cas2 gene at its XbaI site This study

344 KURT KIZILDOĞAN et al. / Turk J Biol

Table 2. Primers used in this study.

Name 5¢_Primer sequence_3¢ Description FP(i): catatgaacacctggaatgatgtg ccaR PCR amplification of ccaR RP(ii): tccccgccgttgtgagaaga FP: tctagaaggagacatcgtgtcatgg cas2 PCR amplification of cas2 RP: aagcttatgagccgggctcagc FP: ttcccacagccttcccacccacccgtcccgactcgc pccaR PCR amplification of ccaR with its own promoter RP: tccccgccgttgtgagaaga FP: gaattcgccgatgcgatctgtcttta claR1 PCR amplification of claR for pSET152ErmE* cloning RP: ggatccgccccgggaccgtatgtc FP: catatggccgatgcgatctgtcttta claR2 PCR amplification of claR for pSPG cloning RP: actagtgccccgggaccgtatgtc To confirm insertion of pccaR in pSET152 and pSETF FP: tagtcctgtcgggtttcgccac pSET152 FP ccaR, cas2 or claR in pSET152ErmE* pSPGR RP: tgcctttgctcggttgatcc pSPG FP To confirm insertion of ccaR/claR in pSPG

(i): Forward primer, (ii): reverse primer. attachment site (attP) in the Streptomyces chromosome amplify the 1426-bp claR by PCR. Both PCR fragments as a single copy in theory (Medema et al., 2011b). PermE* were cloned to pGEM-T Easy to obtain pGclaREB (claR is the upmutated strong constitutive promoter of the in pGEM-T Easy with its EcoRI-BamHI recognition sites) erythromycin resistance gene used for both homologous and pGclaRNS (claR in pGEM-T Easy with its NdeI-SpeI and heterologous gene expression in Streptomyces recognition sites). Then EcoRI-BamHI-digested claR (Wilkinson et al., 2002). It is located in the pSET152ErmE* was released from pGclaREB and was ligated to EcoRI- vector (Supplementary Figure 1c). BamHI-linearized pSET152ErmE* to generate pEclaR 2.2.2. Construction of pSETccaR, pEccaR, and pGlpFccaR (Supplementary Figure 1g), a recombinant plasmid used to ccaR was subcloned to the pGEM-T Easy vector (Promega, integrate an extra copy of claR into the chromosome. For Madison, WI, USA) either as a fragment of 875 bp claR multicopy expression, pGclaRNS was digested with (promoterless gene, ccaR) to yield pGccaR or as a 1108- NdeI-SpeI restriction enzymes to release the gene and this bp DNA fragment carrying ccaR with its own promoter fragment was ligated to pSPG at the NdeI-SpeI recognition (pccaR) to yield pGpccaR. Next, ccaR was cloned to (i) sites to give pGlpFclaR (Supplementary Figure 1h). a pSET152 integration vector together with its native 2.2.4. Construction of pEcas2 promoter or ahead of the ermE* constitutive promoter for To yield pGcas2, cas2 was subcloned to the pGEM-T Easy insertion of its extra copy into the chromosome and (ii) vector as a 1016-bp DNA fragment. In order to clone this a pSPG expression vector carrying PglpF, a strong glycerol- gene to the XbaI site of pSET152ErmE*, it was necessary inducible promoter, for its multicopy expression in the to add an XbaI site to its 3’ end. Thecas2 gene was then cell. Then ccaR with its own promoter was released from released from pGcas2 by EcoRI digestion and subcloned pGpccaR by EcoRI digestion and cloned to pSET152 at the to EcoRI-linearized pBlueskriptKS+ to create pBKScas2. EcoRI site generating pSETccaR (Supplementary Figure Finally, XbaI-digested cas2 released from pBKScas2 1d). Meanwhile, EcoRI-digested promoterless ccaR from was inserted to pSET152ErmE* to generate pEcas2 pGccaR was inserted into EcoRI-linearized pSET152ErmE* (Supplementary Figure 1i). and referred to as pEccaR (Supplementary Figure 1e). In Constructions were verified by restriction digestion, addition, NdeI-SpeI-digested ccaR released from pGccaR PCR, or sequencing. The plasmids (pSPG, pSET152, and was ligated to an NdeI-SpeI-digested pSPG vector to give pSET152ErmE*) and the recombinant ones (pSETccaR, pGlpFccaR (Supplementary Figure 1f). pEccaR, pGlpFccaR, pEclaR, pGlpFclaR, and pEcas2) 2.2.3. Construction of pEclaR and pGlpFclaR were propagated in E. coli DH5a cells. Thereafter, they Two different sets of primers with EcoRI-BamHI and were introduced by transformation into the methylation- NdeI-SpeI recognition sites, respectively, were used to deficient E. coli ET12567/pUZ8002 strains in order to obtain nonmethylated DNA.

345 KURT KIZILDOĞAN et al. / Turk J Biol

2.2.5. Intergeneric conjugation between Streptomyces 2.4. Fermentation, growth determination, and CA and E. coli bioassay The conjugation procedure between recombinant E. coli Fermentation experiments were performed by growing ET12567/pUZ8002 cells and the S. clavuligerus DEPA three biological replicates of S. clavuligerus DEPA and its strain was carried out as described by Flett et al. (1997). recombinants, including their respective controls, in the Fresh LB was inoculated with 16-h-old E. coli ET12567/ fermentation medium. All experiments were repeated pUZ8002 culture with the desired plasmid as a seed culture two times. Aliquots of 1 mL were taken from each flask and incubated in a rotary shaker at 37 °C and 200 rpm until for DNA quantification and CA bioassay. An additional 0.5 mL of culture sample was taken from the cultures for OD600 reached 0.4–0.6. The cells were washed twice with equal volumes of LB at 3500 rpm for 10 min to remove the HPLC analysis. Growth measurement of cultures via DNA antibiotics. The final pellet was resuspended in 0.1 volume quantification was performed according to Burton (1968). of LB. S. clavuligerus mycelia, 24 h old and grown on TSA, The amounts of DNA samples were calculated according to were harvested using 5 mL of 20% sterilized glycerol. a standard curve drawn using the data obtained by herring The glycerol-dissolved S. clavuligerus mycelia and E. coli sperm and expressed as µg of DNA per mL of culture. The suspension were mixed at equal volumes and overlaid agar plate diffusion method was used for CA bioassay, with K. pneumoniae ATCC 29665 as the indicator organism on MS agar. After 20 h of incubation at 30 °C, sterile (Romero et al., 1984). Potassium clavulanate was kindly dH O containing 0.5 mg/mL nalidixic acid and 1 mg/mL 2 provided by DEPA Pharmaceuticals, Turkey, and used selective agent was spread on plates in aliquots of 10 mL as the standard in the bioassay and HPLC experiments. and incubation continued for 4 further days. The presence All exconjugant strains were tested in terms of their of plasmids in S. clavuligerus exconjugants was confirmed CA production by bioassay. Afterwards, the selected by PCR in which a reverse primer of the cloned gene and recombinant strains were further analyzed by HPLC to a primer designed from the internal part of the apramycin compare their CA production capacities. sequence were used to amplify the desired regions (Table 2.5. HPLC quantification of CA 2). The control strains (S. clavuligerus pSPG/VC, pSET152/ Culture supernatants were 5-fold diluted with 48.7 mM VC, and pSET152ErmE*/VC having vectors without any sodium acetate buffer, pH 6.0, and mixtures were filtered gene inserted) were generated to determine the probable through a Millipore membrane (pore diameter: 0.4 µm). effect in CA increments in recombinants. Approximately HPLC was performed by using a Varian Prostar Separations 200 exconjugants were obtained after conjugal transfers Module and Pursuit C (A3000150x046, Serial No. and verification by PCR. These recombinant strains were 18 318437) reverse column with a flow rate of 1.0 mL/min. designated as follows: S. clavuligerus AK numbered 1 to 40 The samples were eluted with a mobile phase composed of (S. clavuligerus DEPA strains carrying an additional copy 0.1 M sodium dihydrogen phosphate buffer, pH 4.0, and of ccaR by pSETccaR integration into the chromosome); HPLC grade methanol in a 95:5 ratio. The column eluent S. clavuligerus ID numbered 1 to 25 (S. clavuligerus DEPA was monitored at 210 nm with the Varian PDA Detector strains carrying an additional copy of ccaR by pEccaR Model 330. As the CA peak of the standard sample was integration into the chromosome); S. clavuligerus IDG obtained at minutes 3–5 of the run, 7 min was chosen as numbered 1 to 10 (S. clavuligerus DEPA having extra the total run time for each injection. All injections were ccaR overexpressed from pGlpFccaR); S. clavuligerus MA performed at 21 °C and repeated two times. The related numbered 1 to 30 (S. clavuligerus DEPA strains carrying chromatograms are given in Supplementary Figure 2. an additional copy of claR as a result of pEclaR integration 2.6. Plasmid stability test into the chromosome); S. clavuligerus MAG numbered The stability of the pGlpFccaR plasmid (ccaR-carrying 1 to 8 (S. clavuligerus DEPA strains having extra claR pSPG) in S. clavuligerus IDG3 was determined by overexpressed from pGlpFclaR); and S. clavuligerus GV performing a colony plating assay as described by Fong et numbered 1 to 80 (S. clavuligerus DEPA strains carrying al. (2007), with slight modifications: (i) cultivation time an additional copy of cas2 as a result of pEcas2 integration before each passage was set to 24 h and the diluted S. into the chromosome). clavuligerus IDG3 cells were subcultured 15 times, and (ii) 2.3. Nucleotide sequencing at each subculturing, the diluted cells were grown in TSA. DNA sequencing was carried out at RefGen Biotechnology, 2.7. Statistical analysis Inc. (Ankara, Turkey) by the chain termination method. The HPLC data were statistically evaluated by carrying out Deduced nucleotide sequences were compared with a one-tailed t-test to compare CA yields of the parental and the use of the BLAST search in the National Center for manipulated industrial S. clavuligerus strains in Minitab Biotechnology Information database (http://www.ncbi. Statistical Software (Minitab Inc., State College, PA, USA). nlm.nih.gov/BLAST). Error bars represent 95% confidence intervals.

346 KURT KIZILDOĞAN et al. / Turk J Biol

3. Results the fermentation (Figure 1g). This strain had the highest As a preliminary study, the ccaR, claR, and cas2 genes were increases of volumetric CA production [4575 mg/L (9.5- amplified by PCR using S. clavuligerus DEPA genomic DNA fold) and 6690 mg/L (25.9-fold)] compared to the vector as a template and were sequenced to determine whether control (482.5 mg/L and 259 mg/L) at T144 and T168, they had any mutations. The nucleotide sequences of genes respectively. It also produced as much as 13,137.2 mg/g were exactly the same as those found in the wild type (data CA at T144, corresponding to a 10.5-fold increased CA level not shown). Based on these results, we conducted our relative to its vector control (1244.1 mg/g) (Figures 1h and experiments to further improve CA production in the 1i). Due to its high CA production capacity, the stability industrial strain, which has more than 100-fold higher CA of pGlpFccaR in the recombinant S. clavuligerus IDG3 production capacity than the wild type (data not shown). was determined through a plasmid-curing experiment. 3.1. Growth and CA production by S. clavuligerus AK9, The recombinant plasmid was stable after 7 subcultures in ID3, and IDG3 strains carrying ccaR overexpressed from nonselective media at a 93% ratio (Supplementary Figure different promoters 3). There have been several reports indicating the strong 3.2. Growth and CA production by S. clavuligerus MA28 regulatory effect of the ccaR gene both in cephamycin C and MAG2 strains carrying claR expressed from ermE* and CA production in the wild-type S. clavuligerus (Pérez and glpF promoters, respectively Llarena et al., 1997; Kurt et al., 2013). Based on these data, claR is pathway-specific regulatory gene in the CA we primarily focused on ccaR to determine its effect on biosynthesis cluster. Its overexpression increases CA CA production in DEPA. Therefore, we constructed three biosynthesis, but this increase does not reach the levels different recombinant strains carrying an additional copy obtained by ccaR overexpression in the wild-type S. of ccaR under the control of distinct promoters: the ccaR clavuligerus (Pérez-Redondo et al., 1998). To investigate promoter (PccaR) (1), strong constitutive ermE* promoter its effect on the CA yield of our industrial strain, we used

(PermE*) (2), and strong inducible glpF (PglpF) promoter (3). ermE* and its own promoter (PclaR) to add its additional The S. clavuligerus AK9 strain with an additional copy copy into the chromosome, as well as the glpF promoter of ccaR expressed from its native promoter grew better than for its multicopy expression in the cell. S. clavuligerus DEPA during fermentation and exhibited a The recombinant strain S. clavuligerus MA28, which growth pattern quite similar to that of its vector control has an extra copy of the claR gene under the control of

(Figure 1a). Therefore, S. clavuligerus AK9 provided 7.6- PermE*, exhibited a slightly higher growth pattern (Figure 2a) fold higher volumetric (958.5 mg/L) CA production at and did cause an increase in both volumetric and specific

T144 compared to S. clavuligerus pSET152/VC (125 mg/L). CA production in comparison to the control (produced

At the same time, this strain had a maximum specific CA 1.2-fold more CA at T144 than the vector control). Hence, titer of 448.3 mg/g that corresponds to a 6.7-fold higher its specific CA titer was 1.28-fold higher at 120T (Figures production (specific CA titer of the vector control was 66.8 2b and 2c). Integrative expression of claR (with its native mg/g) (Figures 1b and 1c). promoter) was also quantified; however, no statistically The growth of S. clavuligerus ID3 was better than that significant increase in CA production was observed (data of the parental strain and pSET152ErmE*/VC, especially not shown). at T96 (Figure 1d). The expression of an extra copy of ccaR Simultaneously, multicopy expression of claR with the under the control of PermE* resulted in improved CA titers control of PglpF was analyzed by HPLC. This recombination by S. clavuligerus ID3. In regard to volumetric CA titers, slightly increased the growth until T72 compared to the 1.8- to 2.3-fold increases were recorded with ID3 (582.5 control (Figure 2d) and also resulted in an increased and 584.83 mg/L) compared to the vector control at T120 volumetric CA yield in S. clavuligerus MAG2, providing

(324 mg/L) and T144 (249 mg/L), respectively (Figure a 1.14-fold elevated CA level at T144 (Figures 2e and 2f).

1e). Accordingly, S. clavuligerus ID3 produced 1114.8 Thus, both integrative expression of claR (with PermE*) and mg/g specific CA at 144T , which corresponds to a CA its multicopy expression (with PglpF in pSPG) gave rise to titer 1.65-fold higher than the control (DEPA strain and increased CA yields. S. clavuligerus pSET152ErmE*/VC produced 675 mg/g 3.3. Growth and CA production by industrial S. and 552 mg/g specific CA, respectively, at this time stage) clavuligerus strains carrying cas2 expressed from the (Figure 1f). ermE* promoter Among the strains compared, the best CA overproducer cas2 encodes a biosynthetic enzyme involved in the early was S. clavuligerus IDG3, in which ccaR (cloned in pSPG, steps of the CA biosynthesis pathway. Its overexpression a free replicating multicopy plasmid) was expressed from and its insertion together with ccaR in the wild-type PglpF. Interestingly, the growth of S. clavuligerus IDG3 S. clavuligerus resulted in an elevated CA level (Hung was slightly lower than that of the controls throughout et al., 2007). Therefore, we introduced an extra copy

347 KURT KIZILDOĞAN et al. / Turk J Biol

Figure 1. The effect ofccaR integrative and multicopy expression under the control of different promoters on growth (DNA concentration) (a, d, g), volumetric (b, e, h), and specific (c, f, i) CA production in S. clavuligerus AK9 (■), ID3 (♦), and IDG3 (▲) with respect to the strain DEPA (○) and vector-only controls [pSET152/VC (□): pSET152 integrated S. clavuligerus DEPA vector control, pSET152ErmE*/ VC (◊): pSET152ErmE*-integrated S. clavuligerus DEPA vector control, pSPG/VC (∆): pSPG-containing S. clavuligerus DEPA vector control].

348 KURT KIZILDOĞAN et al. / Turk J Biol

Figure 2. The effect of claR integration and its multicopy expression under the control of PermE* and PglpF, respectively, on growth (a, d), volumetric (b, e), and specific (c, f) CA production in S. clavuligerus MA28 (■) and MAG2 (▲) with respect to the strain DEPA (○) and vector-only controls. pSET152ErmE*/VC (□): pSET152ErmE*-integrated S. clavuligerus DEPA vector control, pSPG/VC (∆): pSPG- containing S. clavuligerus DEPA vector control.

349 KURT KIZILDOĞAN et al. / Turk J Biol of cas2 expressed from ermE* into the chromosome of level in the wild-type S. clavuligerus (Pérez-Llarena et al., S. clavuligerus DEPA to see its effect on the strain’s CA 1997; Pérez-Redondo et al., 1998). Increased dosage of production. The constructed strain S. clavuligerus GV61 the pleiotropic regulator AdpA enhanced CA production grew much more poorly in the fermentation medium by almost 2-fold (López-García et al., 2010). In another than the parental strain and its vector control (Figure approach, inactivation of the lat gene in the cephamycin 3a). However, S. clavuligerus GV61 displayed a 3.8-fold C biosynthesis pathway in a commercial S. clavuligerus increased volumetric (646 mg/L) and 14.4-fold increased strain resulted in a 2.5-fold increase in CA production specific CA titer compared to the vector control (168 mg/L (Paradkar et al., 2001). On the other hand, deletion of the and 72.7 mg/g) during fermentation (Figures 3b and 3c). glyceraldehyde 3-phosphate dehydrogenase (gap1) gene in S. clavuligerus channeled G-3-P flux, a limiting factor 4. Discussion in CA biosynthesis, to the CA pathway rather than to CA is an industrially important secondary metabolite due the glycolytic one and resulted in a 2-fold enhancement to its inhibitory action on b-lactamases. There have been in CA production (Li and Townsend, 2006). Moreover, many examples of strain improvement strategies applied overexpression and chromosomal integration of both ccaR to S. clavuligerus aiming at high levels of CA production. and claR in a gap1-deleted mutant further improved CA These are grouped into three main categories: (i) to increase yields by 2.6-fold and 5.9-fold, respectively (Jnawali et precursor flow into the pathway, (ii) to increase the gene al., 2010a). In a study by Guo et al. (2013), recombinant dosage of key biosynthetic and regulatory genes, and (iii) to S. clavuligerus with extra ccaR under the control of the eliminate competing reactions by oriented modifications, glycerol promoter in pSET152 provided 3.19-fold more as stated by Paradkar (2013). Multicopy or integrative CA production than recombinants with ccaR integration expression of biosynthetic/regulatory genes has generally with its native promoter in pSET152. been the preferred strategy. For instance, multicopy and CcaR regulates CA production in both direct and integrative expression of the ceas2, bls2, cas2, and pah2 indirect ways. Directly, it regulates the expression of the genes in the CA pathway together in the wild-type S. early genes of the CA biosynthesis pathway, ceaS2-bls-pah- clavuligerus increased CA yields by about 5.1- and 8.7-fold, cas2; indirectly, it controls the late genes’ expression in the respectively (Jnawali et al., 2010b). cas2 overexpression, or CA cluster by regulating claR expression. In the absence of insertion of its extra copy into the wild-type S. clavuligerus ccaR, claR expression significantly decreased as no CcaR chromosome, resulted in an up to 5-fold increase in CA binding to PclaR occurred. In the study by Álvarez-Álvarez titers. Furthermore, dual expression of the ccaR and cas2 et al. (2014), microarray analysis revealed that the genes genes via chromosomal integration induced a 23.8-fold responsible for arginine biosynthesis and genes for glycerol increase in CA yield (Hung et al., 2007). Amplification of utilization, which are precursors for CA biosynthesis ccaR or claR regulatory genes yielded 3-times higher CA (arginine and a C3 compound derived from glycerol),

Figure 3. The effect ofcas2 integration under the control of PermE* on growth (a), volumetric (b), and specific (c) CA production in S. clavuligerus GV61 (■) with respect to the strain DEPA (DEPA) (○) and vector-only control (pSET152ErmE*/VC) (□).

350 KURT KIZILDOĞAN et al. / Turk J Biol were downregulated in the ccaR-mutant compared to the CA, a much higher CA titer than ever reported before. wild-type S. clavuligerus. In addition, CcaR binding to Thus, although IDG3 harbors a recombinant multicopy the promoter of ceaS2 positively affected cas2 expression plasmid, it can be used as an effective strain for the (Santamarta et al., 2011; Paradkar, 2013). Medema et al. industrial fermentation of CA, because at the end of seven (2011a) conducted a genome-wide gene expression analysis subcultures the recombinant expression plasmid was still of a randomly mutated industrial strain of S. clavuligerus 93% stable in nonselective media. compared to the wild type and showed that the expression Advances in systems biological tools, such as next of cas2, claR, and ccaR increased by 5.47-fold, 2.23-fold, generation sequencing and “-omics” technologies, have and 5.6-fold, respectively, in the industrial one. led to more efficient ways to engineer microorganisms for In the present study, we preferred to overexpress secondary metabolite titer improvement (Bro and Nielsen, a key biosynthetic gene (cas2) and two regulatory 2004; Bekker et al., 2014). Furthermore, the integration of genes (ccaR and claR) separately under the control of genetic/metabolic engineering with systems biological tools different promoters in S. clavuligerus DEPA to construct provides invaluable contributions to increase secondary recombinant high-titer CA-producers. We did not use the metabolite production (Hwang et al., 2014). Thus, genome- multiple gene expression strategy to avoid possible side wide expression profiling or comparative proteomics effects on metabolic titer improvement (Rodriguez et al., analysis can be adopted for a better understanding of 2003; Nielsen et al., 2009; Chen et al., 2010). In addition, we CA overproduction in our industrial strain to provide did not evaluate the possible expression differences at the alternative ways of designing novel high-producer strains. mRNA level in our manipulated strains compared to the We have recently performed a comparative proteome control, as we just focused on increases in CA production analysis between the wild-type S. clavuligerus and the levels. According to our results, overexpression of cas2 industrial DEPA strain (Ünsaldı et al., 2016). According to via chromosomal integration increased CA production the data obtained, the upregulation of some biosynthetic 3.8-fold in volumetric and 14.4-fold in specific titer. enzymes in the CA pathway, some overexpressed stress- Amplification of claR in our industrial strain improved CA and resistance-related proteins, several underrepresented production at a maximum rate of 1.3-fold. Furthermore, secondary metabolite genes, downregulation of amino ccaR overexpression was found to be the most effective acid metabolism (especially methionine biosynthesis), manipulation applied for the titer improvement in and lower expression levels in some enzymes of the the DEPA strain, as its chromosomal integration and glycolytic system and S-adenosylmethionine synthetase multicopy expression under PermE* and PglpF resulted in mainly account for the overall CA production in our 7.6- and 25.9-fold increases in volumetric production in industrial strain. The findings obtained from the current strains AK9 and IDG3, respectively. To our knowledge, genetic engineering and proteomics study will be used to the highest CA production in S. clavuligerus was reported design new strategies to further increase CA production in in the study of Jiang et al. (2004), being as much as 3000 industrial DEPA strains. mg/L CA titer through the optimization of fermentation media (Demain and Dana, 2007). On the other hand, by Acknowledgments increasing the gene dosage of key CA biosynthetic and/or We would like to thank the Molecular Biology and regulatory genes, a maximum of 23-fold CA production Biotechnology R&D Laboratory of Middle East Technical by S. clavuligerus was also reported (Hung et al., 2007). University for their kind assistance in the HPLC study. We

Accordingly, by introducing ccaR under the control PglpF gratefully acknowledge the Scientific and Technological into S. clavuligerus DEPA, our resulting recombinant Research Council of Turkey (TÜBİTAK, Grant No: S. clavuligerus IDG3 was able to produce 6690 mg/L TEYDEB-3080871) for supporting this study.

References

Álvarez-Álvarez R, Rodríguez-García A, Santamarta I, Pérez- Baltz RH (2011). Strain improvement in actinomycetes in the Redondo R, Prieto-Domínguez A, Martínez-Burgo Y, Liras P postgenomic era. J Ind Microbiol Biotechnol 38: 657-666. (2014). Transcriptomic analysis of Streptomyces clavuligerus Baños S, Pérez-Redondo R, Koekman B, Liras P (2009). Glycerol ΔccaR::tsr effects of the cephamycin C-clavulanic acid cluster utilization gene cluster in Streptomyces clavuligerus. Appl regulator CcaR on global regulation. Microb Biotechnol 7: 221- Environ Microbiol. 75: 2991-2995. 231. Bekker V, Dodd A, Brady D, Rumbold K (2014). Tools for metabolic Baggaley KH, Brown AG, Schofield CJ (1997). Chemistry and engineering in Streptomyces. Bioengineered 5: 293-299. biosynthesis of clavulanic acid and other clavams. Nat Prod Rep 4: 309-333.

351 KURT KIZILDOĞAN et al. / Turk J Biol

Bentley PH, Berry PD, Brooks G, Gilpin ML, Hunt E, Zomaya II Jnawali NH, Lee, HC, Shong JK (2010a). Enhancement of clavulanic (1977). Total synthesis of (±)-clavulanic acid. J Chem Soc acid production by expressing regulatory genes in gap gene Chem Commun 748-749. deletion mutant of Streptomyces clavuligerus NRRL3585. J Microbiol 20: 146-152. Bierman M, Logan R, O’Brien K, Seno ET, Rao RN, Schoner BE (1992). Plasmid cloning vectors for the conjugal transfer of Jnawali NH, Yoo JC, Jae KS (2010b). Improvement of clavulanic DNA from Escherichia coli to Streptomyces spp. Gene 116: 43- acid production in Streptomyces clavuligerus by genetic 49. manipulation of structural biosynthesis genes. Biotechnol Lett 33: 1221-1226. Bro C, Nielsen J (2004). Impact of ‘ome’ analyses on inverse metabolic engineering. Metab Eng 6: 204-211. Kieser R, Melton TE (1988). Plasmid pIJ699, a multi-copy positive- selection vector for Streptomyces. Gene 65: 83-91. Burton K (1968). Determination of DNA concentration with diphenylamine. Methods Enzymol 12: 163-166. Kurt A, Álvarez-Álvarez R, Liras P, Özcengiz G (2013). Role of the cmcH-ccaR intergenic region and ccaR overexpression in Chen Y, Yin M, Horsman GP, Huang S, Shen B (2010). cephamycin C biosynthesis in Streptomyces clavuligerus. Appl Manipulation of pathway regulation in Streptomyces Microbiol Biotechnol 97: 5869-5880. globisporus for overproduction of the enediyne antitumor antibiotic C-1027. J Antibiot 63: 482-485. Li R, Townsend CA (2006). Rational strain improvement for enhanced clavulanic acid production by genetic engineering of Demain AL, Dana CA (2007). The business of biotechnology. the glycolytic pathway in Streptomyces clavuligerus. Metab Eng Industrial Biotechnology 3: 269-283. 8: 240-252. Ferguson NL, Peña-Castillo L, Moore MA, Bignell DRD, Tahlan Liras P, Gomez-Escribano JP, Santamarta I (2008). Regulatory K (2016). Proteomics analysis of global regulatory cascades mechanisms controlling antibiotic production in Streptomyces involved in clavulanic acid production and morphological clavuligerus. J Ind Microbiol Biotechnol 35: 667-676. development in Streptomyces clavuligerus. J Ind Microbiol Biotechnol 43: 537-555. López-García MT, Santamarta I, Liras P (2010). Morphological differentiation and clavulanic acid formation are affected in a Flett F, Mersinias V, Smith CP (1997). High efficiency intergeneric Streptomyces clavuligerus adpA deleted mutant. Microbiology conjugal transfer of plasmid DNA from Escherichia coli to 156: 2354-2365. methyl DNA-restricting streptomycetes. FEMS Microbiol Lett 155: 223-229. Medema MH, Alam MT, Heijne WHM, van den Berg MA, Muller U, Trefzer A, Bovenberg RAL, Breitling R, Takano E (2011a). Fong R, Hu Z, Hutchinson CR, Huang J, Cohen S, Kao C (2007). Genome-wide gene expression changes in an industrial Characterization of a large, stable, high-copy-number clavulanic acid overproduction strain of Streptomyces Streptomyces plasmid that requires stability and transfer clavuligerus. Microb Biotechnol 4: 300-305. functions for heterologous polyketide overproduction. Appl Environ Microbiol 73: 1296-1307. Medema MH, Breitling R, Takano E (2011b). Synthetic biology in Streptomyces bacteria. In: Methods in Enzymology, Synthetic Foulstone M, Reading C (1982). Assay of amoxicillin and clavulanic Biology, Part A. Cambridge, MA, USA: Academic Press, pp. acid, the components of Augmentin, in biological fluids with 485-502. high-performance liquid chromatography. Antimicrob Agents Chemother 22: 753-762. Medema MH, Trefzer A, Kovalchuk A, Van den Berg M, Muller U, Heijne W, Wu L, Alam MT, Ronning CM, Nierman WC et Guo DK, Zhao YB, Yang KQ (2013). Coordination of glycerol al. (2010). The sequence of a 1.8-Mb bacterial linear plasmid utilization and clavulanic acid biosynthesis to improve reveals a rich evolutionary reservoir of secondary metabolic clavulanic acid production in Streptomyces clavuligerus. S c i pathways. Genome Biol Evol 2: 212-224. China Life Sci 56: 591-600. Nielsen J, Eliasson A, Borodina I (2009). Metabolic engineering of Hobbs G, Frazer M, Gardner DCJ, Cullum JA, Oliver SG (1989). Streptomyces. In: Smolke CD, editor. The Metabolic Pathway Dispersed growth of Streptomyces in liquid culture. Appl Engineering Handbook: Fundamentals. Boca Raton, FL: CRC Microbiol Biotechnol 31: 272-277. Press. Hung TV, Malla S, Park BC, Liou K, Lee HC, Sohng JK (2007). Olano C, Lombo F, Mendez C, Salas JA (2008). Improving production Enhancement of clavulanic acid by replicative and integrative of bioactive secondary metabolites in actinomycetes by expression of ccaR and cas2 in Streptomyces clavuligerus metabolic engineering. Metab Eng 10: 281-292. NRRL3585. J Microbiol Biotechnol 17: 1538-1545. Özcengiz G, Demain AL (2013). Recent advances in the biosynthesis Hwang KS, Kim HU, Charusanti P, Palsson BØ, Lee SY (2014). of penicillins, cephalosporins and clavams and its regulation. Systems biology and biotechnology of Streptomyces species for Biotechnol Adv 31: 287-311. the production of secondary metabolites. Biotechnol Adv 32: 255-268. Paradkar AS, Mosher RH, Anders C, Griffin A, Griffin J, Hughes C, Greaves P (2001). Applications of gene replacement technology Jiang SJ, Yang YY, Wang HQ (2004). Optimization of clavulanic acid to Streptomyces clavuligerus strain development for clavulanic fermentation. Chi J Antibiot 6: 335-733. acid production. Appl Environ Microbiol 67: 2292-2297.

352 KURT KIZILDOĞAN et al. / Turk J Biol

Paradkar A (2013). Clavulanic acid production by Streptomyces Romero J, Liras P, Martin JF (1984). Dissociation of cephamycin and clavuligerus. J Antibiotics 66: 411-420. CA biosynthesis in Streptomyces clavuligerus. Appl Microbiol Biotechnol 20: 318-325. Patnaik R (2008). Engineering complex phenotypes in industrial strains. Biotechnol Prog 24: 38-47. Santamarta I, López-García MT, Kurt A, Nárdiz N, Álvarez-Álvarez R, Pérez-Redondo R. Martín JF, Liras P (2011). Characterization Pérez-Llarena FJ, Liras P, Rodríguez-García A, Martín JF (1997). A of DNA-binding sequences for CcaR in the cephamycin– regulatory gene (ccaR) required for cephamycin and clavulanic acid supercluster of Streptomyces clavuligerus. Mol clavulanic acid production in Streptomyces clavuligerus: Microbiol 81: 968-981. amplification results in overproduction of both β-lactam compounds. J Bacteriol 179: 2053-2059. Song JY, Kim ES, Kim DW, Jensen SE, Lee KJ (2009). A gene located downstream of the clavulanic acid gene cluster in Streptomyces Pérez-Redondo R, Rodríguez-García A, Martín JF, Liras P (1998). The clavuligerus ATCC 27064 encodes a putative response regulator claR gene of Streptomyces clavuligerus, encoding a LysR-type that affects clavulanic acid production. J Ind Microbiol regulatory protein controlling clavulanic acid biosynthesis, is Biotechnol 36: 301-311. linked to the clavulanate-9-aldehyde reductase (car)gene. Gene 211: 311-321. Ünsaldı E, Kurt-Kızıldoğan A, Voigt B, Becher D, Özcengiz G (2016). Proteome-wide alterations in an industrial clavulanic Pickens LB, Tang Y, Choo YH (2011). Metabolic engineering for the acid producing strain of Streptomyces clavuligerus. Synth Syst production of natural products. Annu Rev Chem Biomol Eng Biotechnol (in press). 2: 211-236. Ward JM, Hodgson JE (1993). The biosynthetic genes for clavulanic Pospiech A, Neumann B (1995). A versatile quick-prep of genomic acid and cephamycin production occurs as a supercluster in DNA from gram-positive bacteria. Trends Genet 11: 217-218. three Streptomyces. FEMS Microbiol Lett 110: 239-242. Rodriguez E, Hu Z, Ou S, Volchegursky Y, Hutchinson CR, McDaniel Wilkinson CJ, Hughes-Thomas ZA, Martin CJ, Bohm I, Mironenko R (2003). Rapid engineering of polyketide overproduction by T, Deacon M, Wheatcroft M, Wirtz G, Staunton J, Leadlay PF gene transfer to industrially optimized strains. J Ind Microbiol (2002). Increasing the efficiency of heterologous promoters in Biotechnol 30: 480-488. Actinomycetes. J Mol Microbiol Biotechnol 4: 417-426.

353 KURT KIZILDOĞAN et al. / Turk J Biol

Supplementary Figure 1. Maps of original vectors and recombinant plasmids used in manipulation of S. clavuligerus DEPA: (a) pSPG, (b) pSET152, (c) pSET152ErmE*, (d) pSETccaR, (e) pEccaR, (f) pGlpFccaR, (g) pEclaR, (h) pGlpFclaR, (i) pEcas2.

1 KURT KIZILDOĞAN et al. / Turk J Biol

Supplementary Figure 2. HPLC chromatograms of CA belonging to potassium clavulanate standard and recombinant AK9, ID3, IDG3,

MA28, MAG2, and GV61 strains as well as to their vector controls at T144/T168 (*: Chromatogram of four-times diluted IDG3 sample at

T144, **: chromatogram of five-times diluted sample of IDG3 at 168T ).

2 KURT KIZILDOĞAN et al. / Turk J Biol

Supplementary Figure 3. Percent stability of pGlpFccaR plasmid in S. clavuligerus IDG3 after 15 subcultures in TSA.