Mutation of the Principal Cr Factor Causes Loss of Virulence in a Strain

Proc. Natl. Acad. Sci. USA Vol. 92, pp. 8036-8040, August 1995 Microbiology

Mutation of the principal cr factor causes loss of virulence in a strain of the Mycobacterium tuberculosis complex (r70/RNA polymerase/transcription factor/Mycobacterium bovis) DESMOND M. COLLINS*t, R. PAMELA KAwAKAMI*, GEOFFREY W. DE LISLE*, LISA PASCOPELLA4§, BARRY R. BLOOMt, AND WILLiAM R. JACOBS, JR.* *AgResearch, Wallaceville Animal Research Centre, P.O. Box 40063, Upper Hutt, New Zealand; and tHoward Hughes Medical Institute, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461 Contributed by Barry R Bloom, May 4, 1995

ABSTRACT Tuberculosis continues to be responsible for M. tuberculosis H37Rv for mice, two clones with overlapping the deaths ofmillions ofpeople, yet the virulence factors ofthe cosmid inserts had a selective growth advantage in mice causative pathogens remain unknown. Genetic complementa- indicating that these inserts contained one or more factors tion experiments with strains of the Mycobacterium tubercu- contributing to virulence. losis complex have identified a gene from a virulent strain that Here we have used the same in vivo complementation restores virulence to an attenuated strain. The gene, desig- technique to restore virulence to an attenuated strain of M. nated rpoV, has a high degree of homology with principal bovis as assessed by a guinea pig model. A DNA fragment of transcription or r factors from other bacteria, particularly 2.7 kb was eventually shown to confer the virulence phenotype, Mycobacterium smegmatis and Streptomyces griseus. The homol- and this contained a single large open reading frame (ORF) ogous rpoVgene ofthe attenuated strain has a point mutation that encoded a principal a- factor that has been designated causing an arginine -* histidine change in a domain known to rpoV.¶ rpoV was shown to differ from the homologous se- interact with promoters. To our knowledge, association ofloss quence in the avirulent strain by a single point mutation that ofbacterial virulence with a mutation in the principal r factor caused an arginine -> histidine change in a region known to has not been previously reported. The results indicate either interact with promoters. that tuberculosis organisms have an alternative principal or factor that promotes virulence genes or, more probably, that MATERIALS AND METHODS this particular mutant principal cr factor is unable to promote expression of one or more genes required for virulence. Study Bacterial Strains and Growth Conditions. M bovis ATCC- of genes and proteins differentially regulated by the mutant 35721 was obtained from the American Type Culture Collec- transcription factor should facilitate identification of further tion. The strain is synonymous with TMC403, which was virulence factors. originally isolated from cattle, deposited by A. G. Karlson in the Trudeau Culture Collection 45 years ago and described as Tuberculosis caused the death of2.5 million people in 1990 and having low virulence for guinea pigs (6). M bovis WAg200 and is predicted by the World Health Organization to kill 3.5 WAg201 were isolated in New Zealand from tuberculous million by the year 2000 (1). Yet the virulence factors of the animals. The strains were identified as M bovis by their colony causative organisms, Mycobacterium tuberculosis and to a lesser morphology, slow growth, acid-fast staining, susceptibility to extent Mycobacterium africanum and Mycobacterium bovis, thiophene-2-carboxylic acid hydrazide and isoniazid, and remain unknown. These species, referred to as the M. tuber- growth on pyruvate-supplemented but not glycerol-supple- culosis complex, are so closely related genetically that they are mented media. Strains were grown statically at 37°C in Middle- better considered as variants of the same species (2, 3). They brook 7H9 liquid medium (Middlebrook 7H11 for solid me- cause a similar disease in humans and guinea pigs and are likely dium) enriched with albumin/glucose complex (Difco), 0.05% to share similar virulence mechanisms. Although the virulence Tween 80, and 1% sodium pyruvate. For electroporation M of these tuberculosis organisms has been investigated for many bovis ATCC35721 was grown in roller bottles at 1 rpm in liquid years, their slow growth and, until recently, the lack of medium supplemented with 1% glycerol. A library of M applicable molecular genetic techniques have prevented tuberculosis Erdman (V. Balasubramanian, Albert Einstein progress toward convincingly identifying any virulence factors. College of Medicine, Bronx, NY) was also used. E. coli strains The development of mycobacterial shuttle vectors and tech- used were X2764 (7) to prepare the cosmid library, XL1-Blue niques to transfer them from Escherichia coli into pathogenic (Stratagene) and HB101 for general cloning, and DH10B (Life and nonpathogenic mycobacteria enabled molecular genetic Technologies, Grand Island, NY) for cloning Pac I inserts studies of mycobacteria to be performed (4). Recently, an recovered from chromosomal DNA. E. coli strains were grown integrating cosmid shuttle vector, pYUB178, was developed with agitation in L broth and X2764 was grown at 30°C. For (5). When this vector is electroporated into strains of the M. selection of clones containing pYUB178, kanamycin was tuberculosis complex it inserts in the genome at a single phage added to culture medium at a concentration of 10 ,ug/ml for integration site in a stable manner without the requirement for M bovis and 50 ,ug/ml for E. coli. continuous antibiotic selection. These properties enabled the Construction and Electroporation of M. bovis WAg2OO entire M. tuberculosis H37Rv genome to be represented in a Library. Genomic DNA was prepared from M bovis WAg200 few hundred clones and for each cosmid to be stably incor- using a scaled-up version of the method described by van porated as a single copy in the avirulent host strain, M. tuberculosis H37Ra (5). While none of the M. tuberculosis Abbreviation: ORF, open reading frame. H37Ra(pYUB178::H37Rv) recombinants was as virulent as tTo whom reprint requests should be addressed. §Present address: Rocky Mountain Laboratories, 903 South 4th Street, Hamilton, MT 59840. The publication costs of this article were defrayed in part by page charge 1The sequences reported in this paper have been deposited in the payment. This article must therefore be hereby marked "advertisement" in GenBank data base [accession nos. U21130 (WAg200), U21131 accordance with 18 U.S.C. §1734 solely to indicate this fact. (WAg201), U21132 (ATCC35721), and U21134 (Erdman)]. 8036 Microbiology: Collins et aL Proc. Natl. Acad. Sci. USA 92 (1995) 8037

Soolingen et al. (8) and partially digested with Sau3AI. Frag- A Recombinant M. bovis clones inoculated ments of 30-50 kb were prepared using sucrose gradient centrifugation (9), ligated to Bcl I-digested pYUB178, pack- aged into A heads (GigaPack II Gold, Stratagene), and trans- 1781 1178 duced into E. coli X2764 (5). Kanamycin-resistant clones were pooled and cosmid DNA was prepared by alkaline lysis (10). Washed M. bovis ATCC35721 cells were prepared and an aliquot (0.4 ml) was electroporated with 4 jig of pooled cosmid DNA using previously described methods (11). Guinea Pig Infection. The virulence of M bovis strains was tested in female Duncan-Hartley guinea pigs using a variation of a method described previously (6). Each strain was tested in three guinea pigs that were housed in a level 3 containment ,_4. facility. Guinea pigs were inoculated subcutaneously in the flank with 106 colony-forming units (cfu), except that 107 cfu were used in the case of the pool of M bovis ATCC- 35721(pYUB178::WAg200) clones. Animals were sacrificed after 12 weeks for the initial experiment with library and control animals and after 8 weeks for subsequent experiments. .:...... Animals were examined for the presence of gross lesions of -_ _ -1.2 tuberculosis. Formalin-fixed tissues from the spleen, liver, kidney, and lung were embedded in paraffin, sectioned at 3-5 ,um, stained either with hematoxylin/eosin or by the Ziehl- Neelsen method, and examined for histological evidence of tuberculosis. Representative samples from the injection site, preferred lymph nodes, and spleen were cultured for M bovis. B Recombinant M. bovis clones from lesions Characterization ofM. bovis Recombinants. Recombinants containing integrated cosmids were characterized by junction xI 175 fragment analysis (5). DNA was extracted (8) from M bovis ATCC35721(pYUB178::WAg200) clones, digested with Pst I, and subjected to agarose gel electrophoresis. DNA was trans- ferred to nylon membranes by Southern blotting and the membranes were hybridized with probes of pYUB178 labeled by nick-translation with 32p (10) to reveal the size of fragments - 5.7 at the junction sites where the integrated vector arms join the cosmid insert and host chromosomal DNA. - fto --- 9 .0 0 - 3.8 Cosmid Subcloning. Vector pUHA8 was constructed by .... incorporating aPac I site on either side of the Bcl I cloning site of pYUB178. A cosmid that conferred virulence on M bovis ATCC35721 was partially digested with Sau3AI and fragments of 2-4 kb were prepared by sucrose gradient fractionation (9) and ligated into the Bcl I cloning site of pUHA8. DNA Sequencing and Analysis. Ordered deletions of the 2.7-kb fragment in a pBluescript derivative that contained a - 1.2 Pac I cloning site were generated using the Erase-a-base system (Promega). Complete sequencing in both directions was performed using a cycle sequencing kit (Life Technolo- gies) with 33P-labeled ATP. Homologous fragments from other M tuberculosis complex strains were sequenced in both FIG. 1. Autoradiographs of Southern blots of DNA from recom- directions using oligonucleotide primers designed from the binant M. bovis ATCC35721(pYUB178::WAg200) clones. DNA was sequence of the 2.7-kb fragment. Sequencing of the relevant digested with Pst I and hybridized with a probe of the vector pYUB178 genes from wild-type M bovis and M tuberculosis Erdman to reveal the size of fragments at the junction sites between the strain was performed by the same methods. Sequences were integrated cosmids and the genomic DNA. (A) Randomly selected analyzed using the Genetics Computer Group package (12) clones from the pool inoculated into guinea pigs. (B) Representative and compared to sequences obtained from GenBank. clones recovered from spleen lesions. ulated into guinea pigs as controls. At autopsy, the three RESULTS guinea pigs that had received the pool of recombinants had Selection of Virulent Recombinant Strain from Library. multiple macroscopic spleen lesions (Fig. 24) and other evi- Approximately 4000 kanamycin-resistant clones were obtained dence of progressive disease including numerous microscopic when the library of pYUB178::WAg200 was electroporated as well as some macroscopic lesions in other organs. Control into M bovis ATCC35721. M bovis ATCC35721 inoculated by guinea pigs had no macroscopic (Fig. 2B) and only a few itself into the same kanamycin-containing medium produced microscopic spleen lesions. This decreased virulence of M. no colonies. Twelve randomly selected clones of M bovis bovis ATCC35721 was not due to auxotrophy as the strain was ATCC35721(pYUB178::WAg200) were characterized byjunc- found to have normal in vitro growth in minimal medium. tion fragment analysis (Fig. 1A). All clones contained an Colonies from spleen tissue were counted and it was found that integrated cosmid and no two clones had the same pattern. animals with macroscopic spleen lesions had -400 times more The 4000M. bovis ATCC35721(pYUB178::WAg200) clones organisms than those without such lesions. The ability to cause were pooled and inoculated into guinea pigs. M. bovis macroscopic spleen lesions in guinea pigs was used in subse- ATCC35721 and M. bovis ATCC35721(pYUB178) were inoc- quent experiments to determine whether or not recombinants 8038 Microbiology: Collins et al. Proc. Natl. Acad. Sci. USA 92 (1995)

N N ATCC A ATCC35721 M Ml 35721

attL onE aph WAg200 DNA cos attR I, {aphNorE

probe 4 kb

B I N M M N 2 M M N 3 M M 4 N

N 5 4- 4 kb M FIG. 3. Strategy used to identify a 2.7-kb fragment from M. bovis WAg200 that conferred a virulence phenotype on M. bovis ATCC- 35721 (N, Not I; M, Mlu I; attL and attR, phage attachment site; oriE, E. coli origin of replication; aph, kanamycin-resistance gene). (A) Diagram of the cosmid integration region of a virulent M. bovis FIG. 2. Spleens from guinea pigs inoculated with M. bovis ATCC35721(pYUB178::WAg200) recombinant with the predominant ATCC35721. (A) M. bovis ATCC35721 containing the integrating vector, junction fragment pattern and the plasmid recovered from excision of pYUB178 (pUHA8 gave similar results). (B) A library of M. bovis the Not I fragment. (B) Alignment of the plasmid recovered from ATCC35721(pYUB178::WAg200) clones. All M. bovis ATCC35721 re- excision of the Not I fragment (plasmid 1), cosmids that hybridized to combinants that contained an integrating vector with an insert that a 2.3-kb Mlu I fragment from plasmid 1 and that conferred a virulence included rpoV from M. bovis WAg200 gave similar results. phenotype when integrated into M. bovis ATCC35721 (cosmids 2-4), and the 2.7-kb fragment that conferred a virulence phenotype when had increased virulence compared to M. bovis ATCC35721. integrated into M. bovis ATCC35721 (no. 5). On in vitro culture, M. bovis ATCC35721 and its recombinant progeny had similar growth rates. cosmids was identical but their inserts all overlapped to some Junction fragment analysis was performed on 100 clones extent. Three cosmids, designated 2-4, were selected. Their recovered from spleens with macroscopic lesions. Represen- alignment with each other and with the 6 kb of partial cosmid tative patterns from 14 clones are shown in Fig. 1B. The same insert DNA is shown in Fig. 3B. pattern was shared by 80% of the clones, indicating there was Identification of a 2.7-kb Cosmid Fragment Conferring Viru- a predominant M. bovis ATCC35721(pYUB178::WAg200) lence. Cosmids 2-4 were electroporated into M. bovis clone whose integrated cosmid had conferred a virulence ATCC35721 and the recombinants so formed were inoculated phenotype on M. bovis ATCC35721. One of these clones with into guinea pigs. All three recombinants were virulent, indicating the predominant pattern was inoculated back into guinea pigs that the virulence factor they had acquired must be present in the to confirm its virulence. overlapping portions of cosmids 2-4. Cosmid 2 was subcloned Partial Retrieval of pYUB178::WAg200 Cosmid from Pre- into pUHA8, the subclones were transformed into M bovis dominant Clone. The pYUB178::WAg200 cosmids were stably ATCC35721, and 300 M bovis ATCC35721(pUHA8::cosmid 2) integrated into the chromosome of M. bovis ATCC35721 and colonies were pooled and inoculated into guinea pigs. Clones could not be easily recovered. The strategy used to obtain part were subsequently cultured from macroscopic spleen lesions and of the pYUB178::WAg200 cosmid from the predominant their DNA was extracted and digested with Pac I. Since there are clone is illustrated in Fig. 3A. Genomic DNA was digested with noPac I sites in the genome ofM. tuberculosis complexstrains, the the restriction enzyme Not I and self-ligated. The only replicon only fragment produced by such digestion is the DNA inserted expected to be formed in this reaction is a plasmid of the type into the integrated pUHA8. The smallest fragments obtained shown in Fig. 3A. The ligation mixture was electroporated into were 2.7 kb in size and one of these was ligated into a sequencing E. coli DH1OB, and several kanamycin-resistant clones con- vector and was also ligated back into pUHA8. To confirm the taining identical plasmids were isolated. A plasmid recovered fulfilment of Koch's molecular postulates (13), this pUHA8 from one of these clones contained the expected aph gene construct was electroporated into M bovis ATCC35721 to form encoding kanamycin resistance and the E. coli origin of a recombinant that was subsequently shown to be virulent in replication from the left arm of the integrated pYUB178 guinea pigs. The alignment of the 2.7-kb fragment with cosmids vector. It also contained -6 kb of cosmid insert DNA, the 2-4 is shown-in Fig. 3B. length of insert between the left arm of the pYUB178 vector, Analysis of the 2.7-kb Fragment and Comparison to Ho- and the first Not I site of the insert. mologous Sequences. The 2.7-kb fragment of DNA from M. Selection of Cosmids Containing Putative Virulence Factor. bovis WAg200 contained a single large ORF of 1590 bp, which A 2.3-kb DNA fragment, defined by Mlu I sites, was prepared begins with GTG at positions 835-837 (Fig. 4). There are two from the 6-kb cosmid insert that had been recovered. This frag- overlapping potential ribosome binding sites and because these ment was used as a colony hybridization probe of the E. coli are so close or overlap this codon, the likely start codon is the (pYUB178::WAg200) library. Approximately 1 colony in ev- third codon of the ORF, which is also GTG as indicated. The ery 130 library colonies gave a positive hybridization signal. positions at which the homologous sequences from the three Cosmids were isolated from 48 hybridizing clones and com- virulent M. tuberculosis complex strains differed from that of pared to each other on the basis of restriction enzyme patterns M. bovis WAg200 are also shown in Fig. 4. All sequences were and selective Southern blot hybridizations. None of these >99.8% identical. Compared to the sequence from M. bovis Microbiology: Collins et aL Proc. Natl. Acad. Sci. USA 92 (1995) 8039

GATCAAGCTGCTGACCCCGCAACCGGCCACTCCGTTGGCGGTCGCCAAAACCATCGCCGAGGTCGTCAACGGTTTCGGCT 80 strains and an M. tuberculosis strain were GGCGGGGTCCGCTGGGGGTGACCTATCCCGGCGTCGTCACTCACGGCGTCGTCCGGACCGCGGCTMCGTGGACAGTCC 160 shown to be virtually TGGATAGGGACCMCGCACGCGACACTATCGGCGCCGAGCTGGGCGGTCAGCAGGTCACCATCCTCAACGACGCTGATGC 240 CGCCGGGCTGGCCGAGACACGCTACGGGGCCGGCAAGAACAACCCTGGCTTAGTGGTACTGCTCACATTCGGMACCGGGA 320 identical, emphasizing the close relationship of these species. TCGGGTCCGCGGTCATCCACAACGGGACGTTGATACCCAACACCGAGTTCGGACATCTTGAGGTCGGCGGCAAGGAAGCG 400 GAGGAAGGGCCGCCTCCTCGGTAAAGGAAAAGAACGACTGGACCTATCCAGTGGGCCMGCAGGTGAcACGCGTGCT 480 The high degree of homology between these rpoV sequences CATCGCCATCGAGAACGCGATCTGGCCTGACCTGTTCATCGCCGGCGGCGGCATCAGCCGCMGGCCGACMMTGGGTGC 560 CGCTACTGGAAAACCGCACACCAGTAGTGCCCGCGGCCCTGCAGAACACCGCCGGAATTGTCGGTGCGGCCATGGCCTCT 640 GTCGCAGATACGACGCACTGAAACTTGCCCGCTCGGGCTGTACTCGTGCGCAGTAAAGTTACAATGGTCAGCGGCGGCCG 720 of theM. tuberculosis complex and the principal c-factors ofM. CAGACCCAACCGGAGTAGTMGAcGTACGACGATGGTCGTATGGTGAGCAGCGAGCCAAAGCAAGCACGGCGACCGTGAcGC8CGG80 smegmatis and Streptomyces spp. may reflect their evolutionary - M A A T K A S T A T D E P relationship and the fact that both of these genera have DNA G CATCC35721 and Erdman) TKARAGCTATCCGACCAAGTCGCCCGCGGCTTCCGCGTCCGGGGAKGATCCGGCCAAGCGAACAGCGGCGAGTCC 960 with a high guanine plus cytosine percentage. A There was only one position at which the rpoV of M. bovis GCTAGTGGCTCCCCACCCGCGAAGCGGGCTACCAAGCCCGCGGCCCGGTCCGTCAAGCCCGCCTCGGCACCCCAGGACAC 1040 ATCC35721 had a different sequence from all three of the TACGACCAGCACCATCCCGAAAAGGAAGACCCGCGCCGCGGCCAAATCCGCCGCCGCGAAGGCACCGTCGGCCCGCGGCC 1120 T T S T I P K R K T R A A A K S A A A K A P S A R G virulent M. tuberculosis complex strains. The histidine -> ACGCGACCAAGCCACGGGCGCCCAAGGATGCCCAGCACGMAGCCGCACGGATCCCGAGGACGCCCTGGACTCCGTCGAG 1200 arginine substitution that resulted from this change occurred H A T K P R A P K D A Q H E A A T D P E D A L D S V E GAGCTCGACGCTGAACCAGACCTCGACGTCGAGCCCGGCGAGGACCTCGACCTTGACGCCGCCGACCTCAACCTCGATGA 1280 in a region that is highly conserved among principal of factors E L D A E P D L D V E P G E D L D L D A A D L N L D D and their homologues. This region has the characteristics of a CCTCGAGGACGACGTGGCGCCGGACGCCGACGACGACCTCGACTCGGGCGACGACGAAGACCACGMGACCTCGMGCTG 1360 L E D D V A P D A D D D L D S G D D E D H E D L E A helix-turn-helix motif and is believed to be involved in -35 AGGCGGCCGTCGCGCCCGGCCAGACCGCCGATGACGACGAGGAGATCGCTGAACCCACCGAAAGGACCMGGCCTCCGGT 1440 E A A V A P G Q T A D D D E E I A E P T E K D K A S G sequence recognition (15). Mutation of an arginine to a GATTTCGTCTGGGATGAAGACGAGTCGGAGGCCCTGCGTCAAGCACGCAAGGACGCCGMCTCACCGCATCCGCCGACTC 1520 histidine in this region has previously been shown to cause an D F V WJ D E D E S E A L R Q A R K D A E L T A S A D S GGTTCGCGCCTACCTCAAACAGATCGGCAAGGTAGCGCTGCTCAACGCCGAGGAAGAGGTCGAGCTAGCCAAGCGGATCG 1600 alteration in promoter recognition in E. coli (16). V RA YL KOQI GKV AL L NA EE E VE LA KR I Bacterial RNA polymerases are composed of a core enzyme AGGCTGGCCTGTACGCCACGCAGCTGATGACCGAGCTTAGCGAGCGCGGCGAAAAGCTGCCTGCCGCCCAGCGCCGCGAC 1680 E A G L Y A T Q L M T E L S E R G E K L P A A Q R R D with the subunit composition a2t3' and one of a variety of a- ATGATGTGGATCTGCCGCGACGGCGATCGCGCGAAAAACCATCTGCTGGAAGCCAACCTGCGCCTGGTGGTTTCGCTAGC 1760 M M W I C R D G D R A K N H L L E A N L R L V V S L A factors. Transcription responses to changes in growth condi- CAAGCGCTACACCGGCCGGGGCATGGCGTTTCTCGACCTGATCCAGGAAGGCMCCTGGGGCTGATCCGCGCGGTGGAGA 1840 tions are modulated by multiple RNA K R Y T G R G N A F L D L Q N polymerases having I E G L G L I R A V E a AGTTCGACTACACCAAGGGGTACAAGTTCTCCACCTACGCTACGTGGTGGATTCGCCAGGCCATCACCCGCGCCATGGCC 1920 different factors that promote transcription of different K F D Y T K G Y K F S T Y A T W W I R Q A I T R A N A classes of promoters. The principal cr factor plays a central role GACCAGGCCCGCACCATCCGCATCCCGGTGCACATGGTCGAGGTGATCAACAAGCTGGGCCGCATTCAACGCGAGCTGCT 2000 in bacteria by promoting essential "housekeeping" genes. GCAGGACCTGGGCCGCGAGCCCACGCCCGAGGAGCTGGCCAAAGAGATGGACATCACCCCGGAGAAGGTGCTGGAAATCC 2080 Q D L G R E P T P E E L A K E M D I T P E K V L E I Genes for alternative c- factors are present in all bacteria and AGCAATACGCCCGCGAGCCGATCTCGTTGGACCAGACCATCGGCGACGAGGGCGACAGCCAGCTTGGCGATTTCATCGM 2160 have been shown to promote specific virulence genes in some Q Q Y A R E P I S L D Q T I G D E G D S Q L G D F I E GACAGCGAGGCGGTGGTGGCCGTCGACGCGGTGTCCTTCACTTTGCTGCAGGATCAACTGCAGTCGGTGCTGGACACGCT 2240 pathogens (17, 18). Streptomyces spp. contain several homo- D S E A V V A V D A V S F T L L Q D 0 L Q S V L D T L logues of principal cr factors (19) that are not essential for CTCCGAGCGTGAGGCGGGCGTGGTGCGGCTACGCTTCGGCCTTACCGACGGCCAGCCGCGCACCCTTGACGAGATCGGCC 2320 S E R E A G V V R L R F G L T D G Q P R T L D E I G normal growth but that appear to have a function under certain AGGTCTACGGCGTGACCCGGGAACGCATCCGCCAGATCGAATCCAAGACTATGTCGAAGTTGCGCCATCCGAGCCGCTCAAC(ATCC35721) 2400 growth conditions. One possible explanation for the current Q V Y G V T R E R I R Q I E S K T N S K L R H P S R S H results is that rpoV is not the principal a- factor itself but is a CAGGTCCTGCGCGACTACCTGGACTGAGAGCGCCCGCCGAGGCGACCAACGTAGCGGGCCCCCATGTCAGCTAGCCGCAC 2480 homologue of the a Q V L R D Y L D * principal a- factor and that it plays major CATGGTCTCGTCCGGATCGGAGTTCGAATCAGCCGTCGGCTACTCGCGCGCGGTACGCATCGGGCCACTCGTGGTGGTGG 2560 role in promoting the expression of virulence determinants. CCUAM2O ATCC35721 Erdmamn) However, this explanation is unlikely as Southern blot analysis CCGGAACGACCGGCAGCGGCGATGATATCGTCGCTCAGA GCGAGACGCTCTGCGCCGCATCGAGATTGCGCTCGGACAGTand 2640 GCCGGCGCAACTCTGGCCGACGTGGTCCGTACCCGCATCTATGTGACCGATATTTCCCGCTGGCGCGAGGTCGGCGAAGT 2720 nrATr^trAnnrTrrTTrnr.r.rnr.Tr ,c of genomic DNA from M. tuberculosis complex strains using the 2.7-kb fragment as a probe revealed only one strongly FIG. 4. DNA and predicted amino acid sequence of the 2.7-kb hybridizing fragment (result not shown). An alternative and fragment encoding the rpoVgene from M. bovis WAg200, showing the more likely explanation is that the rpoV gene is the principal point differences compared to the sequences of other M. bovis and M. c- factor but that the mutation in the coding region alters its tuberculosis rpoV genes (strain numbers in brackets). Potential ribo- some binding sites are underlined. specificity for promoting a subset of genes, one or more of which are involved in virulence. While the association of loss WAg200, the DNA sequence from the attenuated M. bovis of a virulence phenotype with such a mutation in a principal ATCC35721 had no sequence differences upstream of the c- factor has not been reported, nonlethal mutations affecting ORF but had two point differences in the coding sequence. subsets of genes in E. coli and Bacillus subtilis have been One of these differences was also present in the virulent strain, described (20, 21). M. tuberculosis Erdman, but the other difference, which caused Whatever the explanation, this discovery should enable the an arginine -- histidine change at position 522, was not found investigation and eventual identification of further tuberculo- in any of the virulent strains analyzed. Thus we deduce that this sis virulence genes. This could be achieved by investigating is the likely mutation that causes M. bovis ATCC35721 to differential gene promotion in the attenuated and comple- become attenuated. mented strains either by study of differentially expressed genes Comparison of the large ORF to sequences in GenBank (12) or by reverse genetics after identifying protein expression revealed that the ORF has high homology to principal factors differences. It is our view that identification of such virulence and highest homology to the principal factors of Streptomyces genes is essential for the elucidation of the mechanisms of griseus (68%) and Mycobacterium smegmatis (86%; ref. 14). tuberculosis pathogenesis, for identifying potential targets for The homologies were particularly high at the C-terminal ends, new drugs, and for identifying genes that could be mutated to and, in the case of the M. tuberculosis complex and M. allow development of new tuberculosis vaccines. In addition, smegmatis, 245 of the 246 C-terminal predicted amino acids the present results raise the possibility that the generation of were identical. On the basis of homology to principal a factors similar mutations in principal cr factor genes of other bacterial and the ability of the M. bovis WAg200 gene to confer a pathogens may provide a novel approach for elucidating virulence phenotype, we have named the gene rpoV. virulence factors. DISCUSSION We thank P. Atkinson for facilitating this work, V. Balasubramanian for supplying the M. tuberculosis library, and S. Erasmuson and D. In this study we used an in vivo complementation technique Stephens for expert technical help. This research was supported by to identify a DNA fragment from a virulent M. bovis strain. New Zealand Foundation for Research Science and Technology Grant This fragment conferred increased virulence on M. bovis C10306 (D.M.C., R.P.K, and G.W.d.) and National Institutes of ATCC35721 and encoded a putative principal a factor that was Health Grants AI26170, AI07118, and A123545 (L.P., B.R.B., and designated rpoV. Homologous sequences from other M. bovis W.R.J.). 8040 Microbiology: Collins et al. Proc. Natl. Acad. Sci. USA 92 (1995)

1. Dolin, P. J., Raviglione, M. C. & Kochi, A. (1994) Bull. WHO 72, 11. Jacobs, W. R., Kalpana, G. V., Cirillo, J. D., Pascopella, L., 213-220. Snapper, L. B., Udani, R. A., Jones, W., Barletta, R. G. & Bloom, 2. Imaeda, T. (1985) Int. J. Syst. Bacteriol. 35, 147-150. B. R. (1991) Methods Enzymol. 204, 537-555. 3. Frothingham, R., Hills, H. G. & Wilson, K H. (1994) J. Clin. 12. Devereux, J., Haeberli, P. & Smithies, 0. (1984) Nucleic Acids Microbiol. 32, 1639-1643. Res. 12, 387-395. 4. Snapper, S. B., Lugosi, L., Jekkel, A., Melton, R. E., Kieser, T., 13. Falkow, S. (1988) Rev. Infect. Dis. 10, S274-S276. Bloom, B. R. & Jacobs, W. R. (1988) Proc. Natl. Acad. Sci. USA 14. Predich, M., Doukhan, L., Nair, G. & Smith, I. (1995) Mol. 85, 6987-6991. Microbiol. 15, 355-366. 5. Pascopella, L., Collins, F. M., Martin, J. M., Lee, M. H., Hatfull, 15. Lonetto, M., Gribskov, M. & Gross, C. A. (1992)J. Bacteriol. 174, G. F., Stover, C. K., Bloom, B. R. & Jacobs, W. R., Jr. (1994) Infect. Immun. 62, 1313-1319. 3843-3849. 6. Anon. (1972) Trudeau Mycobacterial Culture Collection (Trudeau 16. Gardella, T., Moyle, H. & Susskind, M. (1989) J. Mol. Biol. 206, Inst., Saranac Lake, NY). 579-590. 7. Jacobs, W. R., Barrett, J. F., Clark-Curtiss, J. E. & Curtiss, R., III 17. Fang, C. F., Libby, S. J., Buchmeier, N. A., Loewen, P. C., Swi- (1986) Infect. Immun. 52, 101-109. tala, J., Harwood, J. & Guiney, D. G. (1992) Proc. Natl. Acad. Sci. 8. van Soolingen, D., Hermans, P. W. M., de Haas, P. E. W., Soil, USA 89, 11978-11982. D. R. & van Embden, J. D. A. (1991) J. Clin. Microbiol. 29, 18. Deretic, V., Schurr, M. J., Boucher, J. C. & Martin, D. W. (1994) 2578-2586. J. Bacteriol. 176, 2773-2780. 9. Weis, H. (1991) in Current Protocols in Molecular Biology, eds. 19. Buttner, M. J., Chater, K. F. & Bibb, M. J. (1990) J. Bacteriol. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, 172, 3367-3378. J. G., Smith, J. A. & Struhl, K. (Greene, New York), Suppl. 13. 20. Siegele, D. A., Hu, J. C., Walter, W. A. & Gross, C. A. (1989) J. 10. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Mol. Biol. 206, 591-603. Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, 21. Zuber, P., Healy, J., Carter, H. L., III, Cutting, S., Moran, C. P., Plainview, NY), 2nd Ed. Jr., & Losick, R. (1989) J. Mol. Biol. 206, 605-614.