MOLECULAR CHARACTERIZATION OF CARBAPENEMASE PRODUCING BACTERIAL STRAIN OF ENTEROBACTERIACEAE FAMILY
THESIS
SUBMITTED FOR THE AWARD OF THE DEGREE OF Doctor of Philosophy IN BIOTECHNOLOGY
BY NAYEEM AHMAD
UNDER THE SUPERVISION OF PROF. ASAD ULLAH KHAN
MaulanaINTERDISCIPLINARY Azad Library, BIAligarhOTECHNOLOGY Muslim UNITUniversity ALIGARH MUSLIM UNIVERSITY ALIGARH - 202002 (INDIA) 2019
Certificate
This is to certify that the thesis entitled “Molecular characterization of carbapenemase producing bacterial strain of enterobacteriaceae family” herewith submitted by Nayeem Ahmad, in fulfilment of the requirement for the degree of Doctor of Philosophy in Biotechnology of the Aligarh Muslim University, Aligarh, is an authentic record of the research work carried out by him under my supervision and guidance and that no part, thereof, has been presented before for any other degree. He has fulfilled all the prerequisites necessary for the submission of the Ph.D. thesis according to 2009 regulation of University Grants Commission, New Delhi.
Date: (Prof. Asad U Khan) Maulana Azad Library, Aligarh Muslim (Ph.D. University Supervisor)
Candidate DECLARATION
I, hereby declare that thesis entitled “Molecular characterization of carbapenemase producing bacterial strain of enterobacteriaceae family” embodies the work carried out by me.
Dated: (Nayeem Ahmad)
Maulana Azad Library, Aligarh Muslim University
COURSE WORK/COMPREHENSIVE EXAMINATION/PRE-SUBMISSION SEMINAR COMPLETION CERTIFICATE
This is to certify that Mr. Nayeem Ahmad, Interdisciplinary Biotechnology Unit, has satisfactorily completed the Coursework/Comprehensive examination/Pre-submission seminar requirement which is part of his Ph.D. programme.
MaulanaDate:…….. Azad Library, Aligarh Muslim (Signature ofUniversity Chairman)
Contents
LIST OF CONTENTS
Page No. Acknowledgement i-iii List of Abbreviation iv-v List of Figures vi-viii List of Tables ix Abstract x-xiii
1-33 Chapter 1: Review of Literature 1.1. Antimicrobial resistance (AMR) 1 1.2. General concepts 1 1.3. Carbapenems 3 1.3.1. Evolution of carbapenems 3 1.3.2. Classification 5 1.3.3. Mechanism of action 6 1.3.4. Activity of carbapenems 7 1.3.5. Pharmacology and clinical use 7 1.3.6. Differences among Individual Carbapenems 7 1.3.6.1. Imipenem 7 1.3.6.2. Meropenem 8 1.3.6.3. Ertapenem 8 1.3.6.4. Doripenem 8 1.3.7. Mechanism of carbapenem resistance 8 1.3.7.1. Carbapenemases 8 1.3.7.2. Efflux pumps 9 1.3.7.3. Loss of porins 10 1.3.7.4. Penicillin-binding proteins (PBP) 10 Maulana1.3.8. Azad Carbapenem Library, resistance in AligarhEnterobacteriaceae Muslim University10 1.3.9. Molecular class A carbapenemases 12 1.3.9.1. The KPC family 12 1.3.10. Class D serine-carbapenemases: the OXA β-lactamases 13 1.3.10.1. The OXA-48 family 1.3.10.1 13 Contents
1.3.11. Molecular class B carbapenemases: the Metallo-β-lactamases 14 1.3.11.1. The IMP family 14 1.3.11.2. The VIM family 15 1.3.11.3. New Delhi Metallo-β-lactamase (NDM) 15 1.3.11.3.1. Multi-drug resistance by NDM-1 producing 15 bacteria 1.3.11.3.2. Major healthcare risk of NDM producers 16 1.3.11.3.3. Global distribution of NDM variants 16 1.3.11.3.4. NDM and clinical infections 26 1.4. Microbiology of neonatal infections 26 1.4.1. Major pathogens in neonatal septicemia 28 1.4.1.1. Klebsiellas spp. 28 1.4.1.2. Infections by Klebsiella pneumoniae 28 1.4.1.3. Infections by Escherichia coli 29 1.4.1.4. Clinical categories of E. coli 29 1.4.1.5. Extra-intestinal infections due to E. coli 30 1.4.1.6. ExPEC and neonatal sepsis 31 1.4.1.7. Infections by Enterobacter species 31 1.5 Aims and objective of the study 33
34-45 Chapter 2: Material and Methods 2.1. Antibiotic disc 34 2.2. Antibiotic powders 35 2.3. Culture media 35 2.4. Some of the important reagent, chemical and kits 36 2.5. Collection of bacterial strains and hospital setting 37 2.6. Ethical approval 38 2.7. Identification of isolates 38 2.8. Antimicrobial susceptibility testing and MICs 38 Maulana Azad Library, Aligarh Muslim University 2.9. Detection of Metallo-β-Lactamase 39 2.10. Carba NP test for detection of carbapenemase 39 2.11. Amplification of resistance genes by Polymerase chain reaction 39 2.12. DNA sequencing 40 Contents
2.13. Conjugation experiment 40 2.14. Molecular characterization of plasmid 40 2.15. Genetic environment analysis 41 2.16. Integron analysis 41 2.17. Molecular genotyping of isolates 41 2.18. Generate dendrogram by using PyElph version 1.4 Software 42 2.19. Multi-locus sequence typing (MLST) 42
Chapter 3: Occurrence of bla variants among NDM 46-68 Enterobacteriaceae from a Neonatal Intensive Care Unit in a northern India Hospital 3.1. Introduction 46 3.2. Experimental outline 47 3.3. Results 48 3.3.1. Antimicrobial susceptibility, Metallo-β-lactamase (MBL) and 48 MICs 3.3.2. Isolate identification 53 3.3.3. Carbapenemase production 53 3.3.4. Detection of antibiotic resistance markers 53 3.3.5. Conjugation 60 3.3.6. Replicon typing 60 3.3.7. Integron analysis 60 3.3.8. Genetic relatedness of the carbapenem-resistant NDM 62 producing Enterobacteriaceae isolates
3.3.9. Genetic environment of the blaNDM gene 62 3.4. Discussion 64 3.5. Conclusions 67
Chapter 4: Isolation and characterization of NDM producing bacterial (E. aerogenes, C. lepagi, and M. wisconsensis) 69-80 in the NICU of Indian Hospital
4.1. Objective: To detect NDM variants among Enterobacter Maulana Azad Library, Aligarh Muslim University69 aerogenes from NICU of Indian Hospital. 4.1.1. Introduction 69 4.1.2. Experimental outline 70 4.1.3. Results 70 Contents
4.1.3.1. Isolate identification, antimicrobial susceptibility test and 70 MICs 4.1.3.2 Metallo-β-lactamase (MBL) detection 73 4.1.3.3. Carba NP test 74 4.1.3.4 Identification and Genetic context of bla bla NDM-4, NDM-5 74 and blaNDM-7 4.1.3.5 Genetic environment analysis 75 4.1.3.6 Molecular typing 75 4.1.3.7 Replicon typing 75 4.1.4. Discussion 79 4.1.5. Nucleotide sequence Accession numbers 79 4.1.6. Conclusion 80 4.2: Objective: To characterize NDM-1 among rare species of 81 Enterobacteriaceae family 4.2.1. Introduction 81 4.2.2. Case Presentation 81 4.2.3. Nucleotide sequence accession number 84 4.2.4. Conclusion 84 4.3. Objective: To characterize carbapenem-resistant genes in the north Indian pediatrics patients to know if blaNDM-1 and blaVIM-1 are 85 disseminating through any rare species. 4.3.1. Introduction 85 4.3.2. Case Presentation 86 4.3.3. Discussion 90 4.3.4. Nucleotide sequence accession number: 91 4.3.5. Conclusion 91
Chapter 5: Molecular characterization of novel sequence type of 92-109 carbapenem-resistant NDM-1 producing Klebsiella pneumoniae in NICU of Indian Hospital. 5.1. Introduction 92 5.2. Experimental outline 93 Maulana5.3. Results Azad Library, Aligarh Muslim University93 5.3.1. Clinical characteristics of the carbapenem-resistant K. 93 pneumoniae isolates 5.3.2. Antibacterial susceptibility, MICs and Metallo-β-Lactamase 94 (MBL) production 5.3.3. Carbapenemase Production 94 Contents
5.3.4. Detection of antibiotic resistance genes 94
5.3.5. Genetic environment of the blaNDM 94 5.3.6. Plasmid analysis 101 5.3.7. Molecular typing 101 5.4. Discussion 106 5.5. Conclusion 109
Chapter 6: Conclusion 110
BIBLIOGRAPHY 111-130
LIST OF PUBLICATIONS
CONFERENCES ATTENDED
Maulana Azad Library, Aligarh Muslim University
DEDICATED TO MY BELOVED PARENTS AND FAMILY
Maulana Azad Library, Aligarh Muslim University
Acknowledgement
Acknowledgment
Beginning with the name of Allah (SWT), the most Gracious and the most Merciful. Praise is to Allah (SWT), Lord of the Universe, who bestowed upon me the strength, capability, and perseverance to complete Ph.D. work. Peace and prayers to be on His last Prophet and Messenger Mohammad (SAW), the ideal role model for all Makhluqaat.
Among the mortal beings, the courage and motivation to pursue and complete this research work came from my supervisor and esteemed teacher, Prof. Asad Ullah Khan, Coordinator, Interdisciplinary Biotechnology Unit, AMU, Aligarh. From his rich fund of knowledge and immaculate conceptual clarity, he regularly rendered brief, precise and to the point comments and suggestions. His positive attitude, wholehearted cooperation, and constructive criticism kept me moving forward towards my goal. His very presence in mind sustained my motivation. I consider myself fortunate to be his student. I shall always remain in debt of gratitude to my supervisor with respect and humbleness.
I take this opportunity to express my sincere thanks to Prof. Rizwan Hasan Khan, Prof. M. Owais, Dr. Waseem Ahmad Siddiqui, Dr. Hina Yunus and Dr. Shaper Nazeer Khan of Interdisciplinary Biotechnology Unit for their valuable cooperation and encouragement. I very special thank goes to Prof. Syed Munazir Ali, Department of pediatrics JNMCH for providing clinical sample from neonates admitted in NICU.
I appreciate the support and cooperation of my seniors Dr. Sadaf Hasan, Dr. Shakir Khan, Dr. Danishuddin, Dr. Shariq Qayyum, Dr. Lama Misbah, Dr. Divakar Sharma and Dr. Sneha Lata.
I also extend my sincere thanks to my colleague Dr. Azna Zuberi, Mr. Abid Ali, Mr. Mohd Waqar Azam and Dr. Lubna Maryam for being such a wonderful friend. Their advice, guidance, and endless support kept me focused and helped me during difficult phases of my journey. They were always there whenever I am in need of a help and Maulanacooperated Azad with me in Library, every possible way. Aligarh Muslim University Words can never be enough in acknowledging my juniors Shamsi, Ayesha, Farheen, Sahar, Hayder, Nabeela and Salman for everything they have done for me. It was their love,
i Acknowledgement
support, untiring cooperation and constant motivation that pushed me towards the completion of my work.
I am also thankful to the members of non-teaching staff Mr. Lal Mohd, Mr. Syed Faisal Maqbool, Mr. Aqtedar Husain, Dr. Parveen Salahuddin, Mr. Amir Ali, Mr. Ramesh Chandra, Mr. Chandra Pal, Mr. Isham Khan, Mr. Mohd Nasir, Mr. Ashraf, Mr. Waseem, Mr. Rajesh and Mr. Naresh for their timely cooperation. Without their help, I could not procure the required chemicals and complete my experimental works.
Department of Biotechnology (DBT), New Delhi is gratefully acknowledged for providing financial assistance during my research work.
I would especially like to mention my friends Noshad Ali, Sachin Kumar, Mohd Alam, Haseeb Alam, Mohd Suaib, Mohd Aslam, Mohd Galib and Mushkey. They have unconditionally supported me during my good and bad times.
I owe my deepest gratitude to my Ammi, now she is no more in this world. Ammi without you I bearded lots of pain at every steps to complete this journey but your aspirations and blessing gives me such strength and positive attitude at every moment. O Allah forgive my Ammi Late. Sabri Khatoon and elevate her station among those who are guided. Send her along the path of those who came before, and forgive us and him, O Lord of the world, Enlarge of my Ammi grave and shed light upon her grave, I Dua to Allah (SWT) for my ammi to shift the highest place in Jannah.
I would also like to present a bouquet of thanks to my Abba Mr. Muslum Husain, for their love and never-ending care and support. They left no stone unturned in fulfilling my each and every wish and needs. No words I write here will ever do justice to their invaluable prayers for me; their paramount support, constant encouragement, idealism and profound love has been the most important source of comfort and guidance to me; which has been seminal in keeping me anchored to the shore at high tide and of inherent value to me at every step. I have short of words to thank my sisters, Shabnam Khatoon and Salma MaulanaKhatoon, they have Azad been with Library, me in bearing the Aligarh burnt of the frustrations, Muslim and sharing University in the joy of the successes. The moral support from my brother Mr. Mohd Faisal and cousin brothers, Mr. Azeem Ahmed, Mr. Ashkar Husain, Mr. Sabir Ali, Mr. Feroz, Mr. Farman, Mr. Shaqib Ahmed and Ahad also acknowledged. I would also like to thank my brother in law, Mr. Irshad Ali, and Mr. Mujassim for constant support and encouragement.
ii Acknowledgement
Words can never be enough in acknowledging my Mamu Zaheen Ahmed and Mumani Zubera Ahmed for everything they have done for me. It was their love, support, untiring cooperation and constant motivation that pushed me towards the completion of my work. I would also like to thank my sister-in-law; Soulat Zaheen, Niece Zeenat, Nusrat, Jeelani, Kaif and Raza, Nephew; Hasan, Ilhaan and Alshifa for love and encouragement.
My loving daughter Mayisha Nayeem. She rejuvenated my mood every time I saw her smiling. Just a look at her relieved me of all day’s worries and tensions. I deeply regret for the neglect she has to face on my part owing to my busy working hours but she has always been the source of my happiness, enthusiasm and positive energy. I thank to my new born doll Ayisha Nayeem for making my life so full of love and delight.
Last but not the least I would like to thank the most important lady in my life, my better half Nida Nayeem for always being supportive and letting me pursue my dream. I shall always remain indebted to her for all the pain she took and problems she faced for me. She always stood by in my support and never let me fall. She comforted me when I was sad and lifted my spirits when I felt low and depressed. She believed my capabilities, always helped me overcome problems and held me when I stumbled. I could not have asked my Lord for a better life partner. I thank her for being my strength, love and the one I can look upon for anything.
Finally, I thank all others whose names are not mentioned here but nevertheless been an important part of my journey.
(Nayeem Ahmad)
Maulana Azad Library, Aligarh Muslim University
iii List of Abbreviations
LIST OF ABBREVIATIONS
AMR - Antimicrobial resistance BLAST - Basic Local Alignment Search Tool bp - Base pair CDC - Centers for disease control and prevention CDDEP - Centre for Disease Dynamics, Economics and Policy CHDLs - Carbapenem-hydrolyzing class D β-lactamases CLSI - Clinical and laboratory standards institute CMY - Cephalomycinase CRE - Carbapenem-resistant Enterobacteriaceae CRKP - Carbapenem-resistant Klebsiella pneumoniae CTX-M - Cefotaximases DHP - Dehydropeptidase DDST - Double disk synergy test DNA - Deoxyribonucleic acid EDTA - Ethylene diamine tetra acetic acid SBL - Extended spectrum β-lactamases EUCAST - European Committee on Antimicrobial Susceptibility Testing Enterobacterial repetitive intergenic consensus- Polymerase ERIC-PCR - chain reaction JNMCH - Jawahar Lal Nehru Medical College and Hospital kb - Kilobase pair MBLs - Metallo-β-lactamases (MBLs MDR - Multi-Drug Resistant MIC - Minimum inhibitory concentration MLST - Multilocus sequence typing MaulanaNCBI Azad- Library,National Center Aligarh for Biotechnology Muslim Information University NICU - Neonatal Intensive care unit NICHD - National Institute of Child Health and Development NNPD - National Neonatal Perinatal Database NNIS - National Nosocomial Infection Surveillance
iv List of Abbreviations
NDM - New Delhi Metallo-β-lactamase OMP - Outer membrane proteins PBP - Penicillin Binding Proteins PBRT - PCR-based replicon typing UPGMA - Unweighted pair group method using arithmetic averages UTI - Urinary tract infection VIM - Verona integron-encoded Metallo-β-lactamase VLBW - Very low birth weight WHO - World Health Organization µg/ml - Microgram per milliliter
Maulana Azad Library, Aligarh Muslim University
v List of Figures
LIST OF Figures
Figure No Title Page No Figure 1.1 Chemical structure of drugs 5
Figure 1.2 Mechanism of antibiotic-resistant 6
Figure 1.3 Geographical distribution of carbapenem-resistant genes 12
Figure 2.1 A schematic representation for PCR-based genetic 41 environment analysis of blaNDM Figure 3.1 Showing the numbers of co-associate resistant marker of 53 blaNDM among Enterobacteriaceae family isolates
Figure 3.2(a) Detection of blaNDM in AK-66-AK-78 by PCR 54 Amplification
Figure 3.2(b) Detection of blaNDM in AK-79-AK-88 by PCR 54 Amplification
Figure 3.2 (c) Detection of blaNDM in AK-89-AK-102 by PCR 55 Amplification
Figure 3.2(d) Detection of blaNDM in AK-103-AK-109 by PCR 55 Amplification
Figure 3.2(e) Detection of blaNDM in AK-110-AK-116 by PCR 56 Amplification
Figure 3.3(a) Detection of blaCMY in 12 Enterobacteriaceae isolates by 57 PCR Amplification
Figure 3.3(b) Detection of blaCMY in 08 Enterobacteriaceae isolates by 57 PCR Amplification
Figure 3.4(a) Detection of blaOXA-9 in 11 Enterobacteriaceae isolates by 58 PCR Amplification
Figure 3.4(b) Detection of blaOXA-9 in 11 Enterobacteriaceae isolates by 58 PCR Amplification
Figure 3.5(a) Detection of blaSHV in 10 Enterobacteriaceae isolates by 59 PCR Amplification
MaulanaFigure 3.5(b)Azad Detection Library, of blaSHV Aligarh in 02 Enterobacteriaceae Muslim isolates University by 59 PCR Amplification Figure 3.6 Percent prevalence of plasmids replicon types of 44 NDM 61 producing Enterobacteriaceae isolates Figure 3.7 ERIC PCR analysis of 44 NDM producing isolates 62
vi List of Figures
Figure 3.8. A schematic representation of genetic elements 63 surrounding blaNDM Figure 3.9 The clustered bar graph presents the number of NDM 64 variants among Enterobacteriaceae family bacterial species Figure 3.10 Percentage of OXA-1, OXA-9, CMY-1, CMY-4, CMY- 65 145, SHV-1, SHV-2 with NDM-1, NDM-4, NDM-5 and NDM-7 respectively Figure 4.1.1 Strains AK-93, AK-95 and AK-96 showing Metallo-β- 73 lactamase (MBL) production Figure 4.1.2 Strains AK-93, AK-95 and AK-96 showing 74 carbapenemase production
Figure 4.1.3 PCR Amplification of blaNDM and its transconjugats 75
Figure 4.1.4 PCR Amplification of blaOXA-9 and its transconjugats 76
Figure 4.1.5 PCR Amplification of blaOXA-1 and its transconjugats 76
Figure 4.1.6 PCR Amplification of blaSHV and its transconjugats 77
Figure 4.1.7 PCR Amplification of blaVIM and its transconjugate 77
Figure 4.1.8 ERIC-PCR Amplification in AK-93, AK-95 and AK-96 78 strains
Figure 4.2.1 PCR Amplification of blaNDM-1 in Cedecea lapagei (AK- 82 68) strain and its transconjugant
Figure 4.2.2 PCR Amplification of blaSHV-1 in Cedecea lapagei (AK- 83 68) strain and its transconjugant
Figure 4.3.1 PCR Amplification of blaNDM-1 in Moellerella 88 wisconsensis (AK-92) strain and its transconjugant
Figure 4.3.2 PCR Amplification of blaVIM-1 in Moellerella wisconsensis 89 (AK-92) strain and its transconjugant
Figure 5.1 (a) Detection of blaNDM in 10 Klebsiella pneumoniae isolates 97 by PCR Amplification
Figure 5.1 (b) Detection of blaNDM in 07 Klebsiella pneumoniae isolates 97 by PCR Amplification
Figure 5.2(a) Detection of blaCTXM-15 in 07 Klebsiella pneumoniae 98 Maulana Azadisolates by Library, PCR Amplification Aligarh Muslim University
Figure 5.2(b) Detection of blaCTXM-15 in 06 Klebsiella pneumoniae 98 isolates by PCR Amplification
Figure 5.3 Detection of blaOXA-48 in 07 Klebsiella pneumoniae 99 isolates by PCR Amplification
vii List of Figures
Figure 5.4 Detection of blaCMY in 07 Klebsiella pneumoniae isolates 99 by PCR Amplification
Figure 5.5 Detection of blaSHV in 05 Klebsiella pneumoniae isolates 100 by PCR Amplification Figure 5.6 Percentage of resistant markers among carbapenem- 100 resistant Klebsiella pneumoniae (CRKP) isolates Figure 5.7 Distribution of plsmid replicon types of 17 carbapenem- 101 resistant Klebsiella pneumoniae (CRKP) isolates. Figure 5.8 PCR Amplification of MLST gapA gene 102
Figure 5.9 PCR Amplification of MLST infB gene 102
Figure 5.10 PCR Amplification of MLST mdh gene 103
Figure 5.11 PCR Amplification of MLST pgi gene 103
Figure 5.12 PCR Amplification of MLST phoE gene 104
Figure 5.13 PCR Amplification of MLST rpo gene 104
Figure 5.14 PCR Amplification of MLST tonB gene 105
Figure 5.14 PHYLOViZ-generated minimum-spanning tree is based on the 107 allele number matrix of the gene loci included in the K. pneumoniae MLST scheme
Maulana Azad Library, Aligarh Muslim University
viii List of Tables
LIST OF TABLES
Table No. Title Page No
Table 1.1 Worldwide distribution of NDM producing bacteria, as per articles available on PubMed database in the time 18 period of Dec 2013 to Feb 2017 Table 2.1 List of primers used in this study 43
Table 3.1 Minimum Inhibitory Concentrations (MICs) values for 48 NDM-producing enterobacteriaceae isolated from NICU setting Table 3.2 Phenotypic and Genotypic Characterization of (NDM) 50 producing Enterobacteriaceae isolates from NICU setting Table 4.1.1 Phenotypes and genotypes characterization of NDM-4, 71 NDM-5 and NDM-7 producing Enterobacter aerogenes and its transconjugants isolated NICU Patients Table 4.1.2 Characterization of NDM-4, NDM-5 and NDM-7 72 producing Enterobacter aerogenes isolates NICU Patients Table 4.2.1 MICs and genetic profile of NDM-1 producing Cedecea 82 lepagei Table 4.3.1 Phenotype and genotype characterization of NDM-1 and 87 VIM-1 producing Moellerella wisconsensis isolated from NICU and its transconjugants Table 5.1 Demographic and phenotypic charectrization of 95 carbapenem-resistant Klebsiella pneumoniae (CRKP) isolates Table 5.2 Genetic characterization of carbapenem-resistant 96 Klebsiella pneumoniae (CRKP) isolates
Table 5.3 MLST profile of 17 carbapenem–resistant K. pneumoniae 106 CRKP isolates
Maulana Azad Library, Aligarh Muslim University
ix
Abstract
Maulana Azad Library, Aligarh Muslim University
Abstract
Carbapenems, penicillins, cephalosporins and monobactams are the most common known β-lactams antibiotics used worldwide so far. Their common mechanism of action includes the binding and inactivation of PBPs i.e. penicillin-binding proteins through common β-lactam ring that ultimately inhibits the formation of bacterial cell wall. As reported earlier carbapenems, among all β-lactams, are the most effective antibiotic against both Gram-negative and Gram-positive bacteria, hence they are known to possess a broad spectrum of antibacterial activity. It is due to the reason lies behind the presence of its unique molecular structure ie the combination of carbapenem along with the β-lactam ring that confers exceptional stability in comparision to other available β-lactamases including ampicillin, extended spectrum β-lactamases (ESBLs) and carbenicillin (AmpC).
Carbapenems were considered to be the most reliable last-resort antibiotic for treatment of bacterial infections but looking towards it seems that carbapenem resistance is becoming an ongoing public-health concern in all global dimensions. Moreover because of its rapid spread through transferable carbapenemase-encoding genes, carbapenem resistance is becoming the cause of serious outbreaks of antibiotic resistance with dramatically limiting treatment options.
In this thesis, important key points related to carbapenem resistance were reviewed along with the introduction of the family of Enterobacteriaceae. Its future perspectives, spread, and genetic makeup were also discovered. The whole research work was performed on clinical isolates from infants admitted to the NICU of Jawaharlal Medical College and Hospital Aligarh, India.
The objective of first study was to understand NDM producing enterobacteriaceae and their genetic basis of resistance, spreading in neonatal intensive care unit. Carbapenem resistant NDM producing enterobacteriaceae isolates were recovered from rectal swab and blood sample of infants admitted in NICU. These were determined by using Carba-NP test. All isolates were identified using BD PhoenixTM- 100 Maulana and MICsAzad were Library, determined by Aligarhbroth microdilution Muslim method. The University blaNDM and associated resistant markers were checked by PCR followed by sequencing.
Moreover, ERIC-PCR and genetic environment of blaNDM gene was also performed for the analysis of clonal relationship and genetic surrounding of the strains. Here, we
characterized 44 isolates with blaNDM variants in Escherichia coli (45.5%), Klebsiella
x Abstract
pneumoniae (40.9%), Citrobacter freundii (4.5%), Citrobacter braakii (2.3%), Klebsiella oxytoca (2.3%), Enterobacter cloacae (2.3%), Enterobacter aerogenes (2.2%) from NICU, showing resistance against all antibiotics except colistin and
polymixin B. ISAba125 and bleomycin gene were also found surrounding all blaNDM variants, besides class I integron on plasmid. (ERIC)-PCR data revealed non-clonal relatedness among most of the isolates. The transfer of resistant markers was also confirmed by conjugation experiment. Further the PCR-based replicon typing was
carried out using DNA of transconjugants. These isolates carried NDM-1 (20.45%), NDM-4 (36.36%), NDM-5 (38.64%), NDM-7 (4.55%), along with OXA, CMY and
SHV variants on conjugative plasmid of IncFIA, IncFIC, IncF, IncK, IncFIB, IncB/O, IncHI1, IncP, IncY, IncFIIA, IncI1 and IncN types.
In our second study total 402 Enterobacteriaceae isolates were recovered from blood and rectal swabs of 1000 infants admitted to the NICU. Carbapenamase producers were determined by Carba NP phenotype biochemical assay. Out of 402 isolates, it was the
first time, 3 of the isolates were identified as E. aerogenes carrying blaNDM-4, blaNDM-5,
and blaNDM-7 genes. These genes were identified by PCR and sequence analysis. The isolates were further characterized to know the plasmid type and genetic environment features, including integron and IS elements. These three E. aerogenes isolates (AK-93, AK-95 and AK-96) were resistant to all β-lactams including carbapenems. The β-
lactamase genes blaOXA-1, blaOXA-9, blaSHV-1, blaVIM-2 were also found to be co-associated
with blaNDM-4 in AK-93, blaOXA-1, blaOXA-9, blaCMY-149 were found to be co-associated
with blaNDM-5 in AK-95 and blaOXA-1; blaOXA-9 and blaCMY-145 were also found to be co-
associated with blaNDM-7 in AK-96, identified by PCR analysis. Plasmid based replicon typing (PBRT) revealed plasmids of different incompatibility in Enterobacter aerogenes in each of the isolates (AK-93 AK-95 and AK-96), respectively. ERIC-PCR was performed for the analysis of genetic relatedness of the strains. In this study we
found blaNDM-4, blaNDM-5 and blaNDM-7 producing three E. aerogenes strains which were not clonally related. Genetic environment analysis revealed the presence of bleomycin
Maulanaresistance gene (AzadbleMBL) to downstreamLibrary, of bla AligarhNDM and complete Muslim ISAba125 sequenceUniversity
were found upstream of blaNDM in all the three variants of these isolates. This is the
first report of blaNDM-4, blaNDM-5 and blaNDM-7 in E. arogenes species, isolated from the NICU of tertiary care hospital in India.
xi Abstract
Third study was performed on 26 days old female baby, admitted in pediatrics ICU of 1300 bedded tertiary care hospital in Aligarh, India, where we have reported the presence of a clinically significant NDM-1 producing C. lepagei. She was diagnosed preterm, late onset sepsis, apnea and hypocalcemia and was treated with Cefotaxim and epsolin with no recovery as observed after first week. Amikacin was also added in treatment along with cefotaxim for another one week. Baby started recovering after 14 days. Blood sample was characterized, NDM-1 producing Cedecea lapagei was detected, as a first report to the best of our knowledge.
In fourth study we report clinical significance of NDM-1 and VIM-1 producing Moellerella wisconsensis which has not yet been described in the literature; this is the
first report of M. wisconsensis strain harbouring blaNDM-1 and blaVIM-1, recovered from the rectal swab of low birth weight female child admitted in NICU of the north Indian tertiary care hospital. A plasmid of IncW incompatibility with size of 154 kb was observed in AK-92 strain.
The last study of my Ph.D. work includes the characterization of carbapenem-resistant K. pneumoniae (CRKP) isolates from infants admitted to the Neonatal Intensive Care Unit (NICU) to find the clonal outbreak of NDM producers. In this study 17 carbapenem-resistant, K. pneumoniae isolates were analyzed. Antimicrobial susceptibility of the isolates was determined by the disc diffusion and micro-dilution method. Carba NP test and double disk synergy test (DDST) were performed for the detection of carbapenemase and Metallo-β-lactamase producing K. pneumoniae. Antibiotic resistant markers were detected by PCR and sequencing methods. Clonal relatedness of the isolates was checked by multi-locus sequence typing (MLST). Conjugation experiments were performed to determine the transferability of the plasmids. All 17 carbapenem-resistant K. pneumoniae isolates were found to carry
blaNDM (13 blaNDM-1, 1 blaNDM-4 and 3 blaNDM-5), 7 isolates carried blaOXA-48, 13
isolates have blaCTX-M-15, 7 isolates carried blaCMY-1 and 5 isolates were found to carry
blaSHV-1 on conjugative plasmids of different types (IncFIA, IncFIB, IncFIIAs, MaulanaIncFIC, IncAzadA/C, Inc Library,F, IncK, IncX, Inc AligarhW and IncY). MuslimOf six different UniversitySTs identified, ST3344 was detected as a novel sequence type in two K. pneumoniae isolates. Genetic environment analysis revealed ISAba125 and bleomycin genes flanking to all
blaNDM variants. To the best of our knowledge, this is the first report of novel ST3344 in two NDM-1 producing K. pneumoniae isolates from neonates admitted in NICU of
xii Abstract
one of the North Indian Hospitals. Moreover, these strains were also found to carry
blaCTX-M-15, blaCMY-1 and blaSHV-1.
Present study has given a new lead to understand the genetic features of this new type strain involved in resistance, which is an alarming signal for health workers and policy makers. Hence, it is utmost important to think about infection control measures.
Maulana Azad Library, Aligarh Muslim University
xiii
Chapter 1 Review of Literature
Maulana Azad Library, Aligarh Muslim University
Review of Literature
1.1. Antimicrobial resistance (AMR)
1.2. General concepts
Antimicrobial resistance is defined as resistance shown by microorganisms against any antimicrobial drug which is used to treat the infection carried by the particular microorganism. In practice, resistance is determined by assessing a patient isolate against an antimicrobial in vitro assay method. For microorganisms, especially bacteria, the usual in vitro testing is done by automated liquid media microdilution, disc diffusion, and the E-test method. In quantitative determining systems like broth microdilution, the measure of drug activity is the minimum inhibitory concentration (MIC). Over-checking of large numbers of isolates, breakpoints that explain the thresholds of susceptibility for each microbe-drug combination is developed by groups such as the US Clinical and Laboratory Standards Institutes (CLSI) and Breakpoints are included in US Food and Drug Administration (FDA) permitted product marking for new antimicrobial agents. A strain found to be susceptible in vitro has a MIC value equal to or below a defined susceptibility breakpoint, which is believed to be the reason for therapeutic success. For the strains that are reported as intermediate, the therapeutic effect is unreliable; reported strains as resistant; use of an agent is linked with the high probability of treatment failure.
There are three main ways by which resistance may occur: through natural resistance in certain forms of bacteria (Intrinsic resistance), through a genetic mutation, or through one species obtaining resistance from another (Acquired resistance). Intrinsic resistance is probably due to lack of suitable target, the inability of the drug to find target or presence of enzymes that can inactivate the drug. Acquired resistance may be due to owing of spontaneous or random mutations, to develop resistance over the cycle of time against the selective pressure of antimicrobial agents, or to improper Maulanaconsumption Azad of antibiotics, Library, although Aligarhthe latter two pathways Muslim are the mostUniversity important. Some important acquired resistance attributes may be directly picked in vitro and in vivo via single or multiple point mutations in antimicrobial target genes [Wright, 2005; Munita et al., 2016; Codjoe et al., 2018].
1 Review of Literature
The rising trend in drug resistance can be ascribed into three main areas: use of antibiotics in the animal population, use of antibiotics in the human population, and spread of resistant strains around human or non-human sources. A small number of doses of Antibiotic in livestock feed for growth promotion is an accepted practice in many developed countries and is known to cause an increased range of resistance. Antibiotic-resistant strains are mainly due to the poor waste water treatment by pharmaceutical companies, causing a huge quantity of antibiotics release in the environment [Lood et al., 2017].
Multi-drug resistance (MDR) is described as resistance against all the three groups of antibiotics known as ampicillin, gentamicin and cefotaxime/ceftazidime [Viswanathan et al., 2012], and the microbes owing MDR are often referred to as superbugs. Antimicrobial resistance is the progressive challenging problem that causes large numbers of deaths every year. High morbidity and mortality is the challenging factor that is associated with antimicrobial resistance in bacterial pathogens [Frieri et al., 2017], as it is more difficult to treat and acquire substitute drugs or higher level of doses, against these associated infections, both of which may be more costly or more toxic [Anderson et al., 2008; Li B et al., 2018]. A World Health Organization (WHO) report stated on April 2014 stated, "This serious threat is no longer a forecast for the future, recently it is being in each region of the world and has the power to affect anyone, of any age, anywhere in any country. Antibiotic resistance when bacteria change so antibiotics no longer work in people who required them to cure infections is now a severe threat to public health. There have been progressing public calls for global collective action to mark the threat, as well as a proposal for an international contract on antimicrobial resistance. Antibiotic resistance is not perfectly mapped around the world, but the countries that are affected, most are poor countries with already weaker healthcare systems [Laxminarayan et al., 2016]. Probably poor quality medicines are important to note that these can be critically damaging to public health Maulanain different aspects Azad beyond Library, promoting anti Aligarh-microbial resistance Muslim [Elizabeth University et al., 2015]. As resistance to antibiotics occurs more common so there is a greater need for alternative therapy. Call for new antibiotic remedies have been issued, but there are continually reduced in the number of authorized drugs.
2 Review of Literature
1.3. Carbapenems
The carbapenems were launched in the 1980s into a healthcare setting and they soon became the mainstay of therapy for treating serious and life-threatening infections caused by ESBL producing Enterobacteriaceae, Multidrug-Resistant (MDR) Pseudomonas and Acinetobacter species [Kateete et al., 2016]. But the subsequent emergence and spread of resistance to carbapenems resulted in restricted therapeutic options. This resistance is mediated by;
1. Production of β-lactamases (carbapenemases) which hydrolysis the carbapenems antibiotic
2. Antibiotic entry is blocked by the changing in outer-membrane porins
3. Active pumping of antibiotic`c out of the cell by using complex “efflux pumps”.
The condition is more complicated with the matter that the “permeability” efflux mechanisms also affect another class of antibiotics (e.g., tigecycline, quinolones, and aminoglycosides). The genes of encoding enzymes can be either chromosome or plasmid-borne. The latter pose a threat in the situation of stopping bacterial resistance, due to plasmid-borne β-lactamase genes are easily transferable among bacteria, permitting an effective and rapid spread of resistance. Recognition of the presence of the carbapenemase in a Gram-negative organism is of paramount importance since severe infection-control measures are required to avert hospital epidemics and to prevent the dissemination to such genes to other Gram-negative species [Arias, 2009; Codjoe et al., 2018].
1.3.1. Evolution of carbapenems
The late 1960s marked the emergence of bacterial β-lactamases and restricted the use of penicillin that eventually leads to the search for β-lactamase inhibitors. In 1976, the natural products (olivanic acids) generated by the Gram-positive Maulanabacterium Azad Streptomyces Library, clavuligerus Aligarh were used asMuslim first β-lactamase University inhibitors Moreover, the discovery of thienamycin that essentially generated by Streptomyces cattleya in 1976. Thienamycin showed strong broad-spectrum antibacterial and β-lactamase inhibitory activity (Figure 1.1). With time, determination for such compound grew rapidly, since thienamycin demonstrated
3 Review of Literature
inhibitory microbiological activity against Gram-negative bacteria, such as Pseudomonas aeruginosa, anaerobes likes Bacterodes fragilis and Gram-positive bacteria. These type of compounds were chemically unstable, so they were not used clinically. [Kattan et al., 2008; Papp-Wallace et al., 2011]
Later, an imipenem, a more stable known derivative of thienamycin, was discovered and authorized for use in 1984 [Hellinger, 1999]. It turn out to be the first carbapenem, approved for the treatment of complex bacterial infections. Imipenem inherits the tendency of high affinity for PBPs and consistency against β-lactamases like its parent, thienamycin. Along the way towards the discovery of most-stable carbapenems having a broad spectrum, many currently available compounds were developed such as meropenem, doripenem and ertapenem (Figure 1.1) significant advance in this “synthetic journey” was the addition of methyl group at 1-β position. Meropenem was the first known carbapenem having 1-β- methyl group and 2-thiopyrrolidinyl moiety that provide this antibiotic constant to DHP-I [Wallace et al., 2011]. In the subsequent decades, carbapenems with these conformational change were generated, which includes lenapenem, ertapenem, biapenem, and doripenem [Bonfiglio et al., 2002; Wallace et al., 2011].
Maulana Azad Library, Aligarh Muslim University
4 Review of Literature
Figure 1.1: Chemical structure of drugs [Source; Papp-Wallace et al., 2011] (A); Chemical structures of olivanic acid, clavulanic acid, and thienamycin. (B); clinically available carbapenems, as well as cilastatin and betamipron
Maulana1.3.2. Classification Azad Library, Aligarh Muslim University The classification system of carbapenems divides them into two groups. Group 1 carbapenems, are ertapenem, defined as broad-spectrum agents that have limited or no activity against non-fermentative Gram-negative bacilli and are most suited for use in the treatment of infections caused by Enterobacteriaceae, whereas group
5 Review of Literature
2 carbapenems, meropenem, imipenem, and doripenem, are broad-spectrum antibiotic which is highly active over Gram-negative bacteria and are especially beneficial in the treatment of nosocomial infections. The third group of carbapenems has also been recommended which include agents with activity against methicillin-resistant Staphylococcus aureus (MRSA) [Kattan et al., 2008, Shah et al., 2003].
1.3.3. Mechanism of action
As carbapenems not easily diffuse along the bacterial cell wall so most of them enters in Gram-negative bacteria through outer membrane proteins (OMPs), also known as porins (Figure 1.2). After entering the bacterial cell these carbapenems inhibit the synthesis of the peptidoglycan layer of the bacterial cell wall. Formation of cell wall peptidoglycan catalyzing Penicillin Binding Proteins (PBP) is permanently acetylated by the carbapenems after they traverse the periplasmic space. Carbapenems behave as mechanism-based inhibitors to the peptidase domain of PBPs and can inhibit peptide cross-linking peptidase reactions. The main factor of the efficacy of carbapenems is its capacity to bind to multiple PBPs. Subsequently, the peptidoglycan weakens, and the cell bursts because of osmotic pressure [Wallace et al., 2011; Hashizume et al., 1984].
Maulana Azad Library, Aligarh Muslim University
Figure 1.2: Mechanism of antibiotic-resistant [Source; Nordmann et al., 2012a]
6 Review of Literature
1.3.4. Activity of carbapenems
Carbapenems are known for their broad-spectrum antimicrobial activity and considered to be an active bactericidal agent because of its tendency of high binding affinity towards PBPs of Gram-negative bacteria. The antibiotic for the treatment of infections due to ESBL producing Enterobacteriaceae are carbapenems [Rodrigues, 2011]. Further carbapenems (except ertapenem) are classified into the category of antibiotics that are active against clinically important Gram-negative non-fermenters. The examples of such bacteria includes Acinetobacter spp, P. aeruginosa and Burkholderia cepacia [Unal et al., 2005; Poulakou et al., 2018]. Streptococci, methicillin-sensitive Staphylococci, Neisseria and Haemophilus are also the examples of other bacteria that are susceptible towards carbapenems. Gram-positive and Gram- negative anaerobes are also found susceptible against carbapenems, which makes this antibiotic superior in comparison to other broad-spectrum antibiotics but according to certain reports it has been shown that certain bacteria were also found to be resistant against this antibiotic, the examples of which are methicillin-resistant Staphylococci, ampicillin-resistant Enterococcus faecium, Stenotrophomonas maltophilia and some isolates of Clostridium difficile [Kattan et al., 2008; Cassir et al., 2014].
1.3.5. Pharmacology and clinical use
Almost all available carbapenems have minimum oral bioavailability and subsequently do not cross gastrointestinal membranes quickly and will be applied intravenously; ertapenem and imipenem are often delivered intramuscularly. As with another β-lactams, all these carbapenems are eliminated mainly by renal excretion. Allergic reactions to β-lactam compounds are the most common adverse events in treatment with carbapenems [Chambers et al., 2005; Bush et al., 2016].
1.3.6. Differences among Individual Carbapenems
1.3.6.1. Imipenem
Imipenem is still used substantially, although it has some disadvantages as compared Maulanawith the Azadmost recent Library, carbapenems. ItAligarh is not approved Muslim by the US FoodUniversity and Drug Administration (FDA) for meningitis and must be avoided in the treatment of central nervous system infections because of its tendency to cause seizures in patients with elevated risk factors, e.g. renal failure or brain disease. It is naturally very active against P. aeruginosa and Acinetobacter spp.
7 Review of Literature
1.3.6.2. Meropenem
Meropenem has a spectrum of activity same to that of imipenem (such as P. aeruginosa and Acinetobacter spp.) and is slightly more active towards Gram- negative bacteria. This agent is a substrate for the multidrug efflux system MexAB– OprM, present in P. aeruginosa. Overexpression of this efflux system increase the MIC of meropenem and other substrate antibiotics, but not for imipenem. The combination of a β-lactamase and down-regulation of outer membrane proteins, like OprD, and an efflux system, such as Mex AB–OprM, is required for outright resistance against meropenem to occur (Figure 1.1).
1.3.6.3 Ertapenem
Ertapenem possesses a longer apparent elimination half-life which permits for a convenient, once-daily administration schedule figure 1.1. Ertapenem is the most important option for the empirical therapy of infections where a mixed flora of anaerobes and aerobes is the cause including complicated intra-abdominal infections. It lacks antimicrobial activity against non- fermentative Gram-negative bacilli such as P. aeruginosa and Acinetobacter spp. [Keating et al., 2005; Codjoe et al., 2018].
1.3.6.4. Doripenem
Doripenem is a parenteral 1-beta-methyl carbapenem (Figure1.1) which suggested for nosocomial pneumonia (including ventilator-associated pneumonia), complicated intra-abdominal and urinary tract infections [Gales et al., 2011].
1.3.7. Mechanism of carbapenem resistance
1.3.7.1. Carbapenemases
Carbapenemases are specified β-lactamases with the capability to hydrolyze carbapenems. These types of periplasmic enzymes hydrolyze carbapenems preventing the drug to reach PBP target. Currently, β-lactamases are classified into four specific Maulanaclasses based on Azad structural similaritiesLibrary, (classes Aligarh A, B, C and D).Muslim Class B β-lactamases University use zinc to inactivate β-lactams and almost all are carbapenemases. Class A, C, and D β-lactamases use the serine as a nucleophile to hydrolyze the β-lactam bond. Production of β-lactamases seems to be the most extensive cause of carbapenem resistance since the documentation of their distribution in different bacterial species is
8 Review of Literature
extensive. According to the reported data the large number of class A carbapenemases (e.g., GES and KPC enzymes), class B MBLs (e.g., IMP, VIM and NDM types), and class D carbapenemases (OXA carbapenemases) have emerged and these enzymes are generally encoded by plasmids or mobile DNA elements that are present extra- chromosomally within bacterial cell and have high capacity for dissemination [Walsh, 2010]. MBLs are divided into three subclasses (B1, B2, and B3) on the basis of sequence similarity and structural characteristics, with the mobile MBLs largely confined to subgroup B1. Acquired MBLs, IMP, VIM, SPM, NDM, GIM, SIM, DIM, TMB-1, FIM-1 and KHM-1 belongs to the B1 subclass. AIM-1 belongs to subclass B3 [Leiros, 2012; Bush, 2010].
Moreover, overproduction of class C β-lactamases (Amp C β-lactamases), can lead to carbapenem resistance, particularly when cooperated with different resistance mechanisms (e.g., porin loss) [Rodriguez-Martinez et al., 2009; Meletis, 2016].
1.3.7.2. Efflux pumps
Active efflux of chemicals and toxins out of the bacterial cell is a mechanism that protects them from the adverse outcomes of their environment. Antibiotics used in the healthcare settings are among those toxic compounds and extrusion of antibiotics from bacterial cells significantly reduces their clinical utility. Antibiotics are expelled from the bacterial cells by the membrane transporter proteins, the efflux pumps. Most of the genes coding these multidrug-resistant pumps are normal components of the bacterial chromosomes. In few of the genes have high constitutive expression and confer intrinsic resistance to the antibiotics although in others the genes are expressed after the acquisition of regulatory mutations [Lomovskaya et al., 2001; Fyfe et al., 2016]. Efflux pumps are categorized in different superfamilies that includes small multidrug resistance superfamily, resistance-nodulation-division superfamily, major facilitator superfamily, multidrug and toxic compound extrusion superfamily and the ATP-binding cassette (ABC) superfamily. Carbapenem resistance due to Maulanaoverexpression Azad of effluxLibrary, porins is described Aligarh mostly forMuslim Enterobacter University aerogenes, P. aeruginosa and A. baumannii [Wallace et al., 2011]. Due to its hydrophobic nature, meropenem is a substrate for the Mex AB–Opr M system containing a pump (Mex B), a linker lipoprotein (Mex A) and an exit portal (Opr M) [Quale et al., 2003]. Overexpression of the Mex AB-Opr M efflux system affects efficacy or meropenem
9 Review of Literature
but not that of imipenem. In addition, the Mex CD- opr J and Mex XY-Opr M efflux systems are associated in reduced susceptibility to meropenem [Rodriguez-Martinez et al., 2009].
1.3.7.3. Loss of porins
In porin loss, the loss of a membrane protein channel decreases the level of entry of antibiotics into the periplasm, therefore increasing the MIC. Substitutions in, or reduced expression of, porins resulting in decreased entry of carbapenems into the periplasm exists in K. pneumoniae, P. aeruginosa, Enterobacter aerogenes, E. coli, Proteus mirabilis, Serratia marcescens, Enterobacter cloacae, Citrobacter freundii, A. baumannii, Shigella dysenteriae, Proteus rettgeri and Salmonella enterica [Wallace et al., 2011]. Loss of Opr D confers resistance to imipenem and low-grade resistance to meropenem [Pai et al., 2001]. If combined with β-lactamase production, porin loss confers resistance to one or more antibiotics at the same time. An example of this mechanism is the loss of a particular porin known as Opr D in P. aeruginosa with multiple productions of Amp C confers resistance to imipenem [Livermore, 2002; Codjoe et al., 2018].
1.3.7.4. Penicillin-binding proteins (PBP)
Penicillin-binding proteins (PBPs) are a bunch of proteins that are uniquely characterized by their affinity for the penicillin. Mutations in the PBP protein and reductions in PBP transcription also result in carbapenem-resistant phenotypes in A. baumannii P. aeruginosa and Proteus mirabilis. Moreover, amino acid substitutions in PBPs or acquisition of the novel PBP can cause carbapenem resistance in E. coli, Proteus mirabilis, and P. aeruginosa [Wallace et al., 2011].
1.3.8. Carbapenem resistance in Enterobacteriaceae
Enterobacteriaceae belongs to the class of bacteria that are rod-shaped. They are Gram-negative bacilli and are found as the normal inhabitants of the intestinal flora. MaulanaEnterobacteriaceae Azad are among Library, the most commonly Aligarh known human Muslim pathogens Universitythat are associated with wide variety of infections ranging from cystitis to pyelonephritis, meningitis, pneumonia, peritonitis, septicemia, and device-associated infections. They are the most prevalent cause of both the community and nosocomial infections with Escherichia coli being by far the most relevant pathogen for humans.
10 Review of Literature
Enterobacteriaceae spread easily between humans by hand carriage along with contaminated food and water and have a tendency to acquire genetic material by horizontal gene transfer, mediated mainly by plasmids and transposons. This combination is why developing multidrug resistance in Enterobacteriaceae is of the most important for clinical treatment [Nordmann et al., 2012a, 2012b]. Among the Enterobacteriaceae, Klebsiella pneumoniae is a significant cause of nosocomial infections and a notorious collector of multidrug-resistant plasmids. That it continues and spreads quickly in the health care settings resulting in outbreaks, due to its efficiency to colonize and enhanced potential to acquire resistance to antibiotics. During the ESBL period, K. pneumoniae was the catalogue species for plasmids coding ESBLs and several genes encoding resistance to fluoroquinolones and aminoglycosides [Tzouvelekis et al., 2012]. The other common Enterobacteriaceae causing infections in humans including Enterobacter species, Citrobacter species, Proteus species, Serratia marcescens, and Providencia species. They cause a wide range of infections including septicemia, urinary tract, skin and soft tissue, and respiratory tract infections [Chen et al., 2012; Yang et al., 2012]. Since 2000, the spread of Enterobacteriaceae strains producing ESBLs able to hydrolyzing nearly all β-lactams except carbapenems has been reported globally. The consequence of this phenomenon has been an enhanced intake of carbapenems [Nordmann et al., 2011a].
In Enterobacteriaceae, carbapenem resistance occurs from two main mechanisms
Acquisition of carbapenemase genes which encode for enzymes capable of degrading carbapenems.
Decrease in the consumption of the antibiotics by a qualitative and quantitative insufficiency of porin expression in association with overexpression of β-lactamases that acquire a very weak affinity for carbapenems.
Carbapenemases belong to molecular classes A, B, and D Class A and D enzymes Maulanautilize serine Azad at their Library, active sites and Aligarhwere deactivated Muslim by the β-lactamase University inhibitors clavulanic acid and tazobactam. Class B, Metallo carbapenemases have at least one zinc atom at the position of the active site that works to facilitate hydrolysis of a bicyclic β-lactam ring [Queenan and Bush, 2007].
11 Review of Literature
Figure 1.3: Geographical distribution of carbapenem-resistant genes [Source; Al- Zahrani IA, 2018].
1.3.9. Molecular class A carbapenemases
Class A carbapenemases saw sporadically as single isolates or in small outbreaks in the clinical setting. These β-lactamases have been extensively detected in Enterobacteriaceae [Bonomo, 2017]. Bacteria associated with the expression of these enzymes shows less susceptibility towards imipenem. For this reason these β-lactamases by passes the routine susceptibility testing and may go non-recognized. For their hydrolytic mechanism they compulsorily requires serine at position 70 in active-site in the Ambler numbering system for class A β-lactamases [Ambler et al., 1991].
Penicillins, carbapenems, cephalosporins and aztreonam, belongs to the class of antibiotics that have the ability to hydrolyze broad range of β-lactams, further they all are inhibited by tazobactam and clavulanate [Queenan and Bush, 2007].
Maulana1.3.9.1. TheAzad KPC family Library, Aligarh Muslim University
KPC carbapenemases enzyme hydrolyzes β-lactams of all classes, with the highly efficient hydrolysis observed for cephalothin, cephaloridine, ampicillin, benzylpenicillin, and piperacillin. Imipenem and meropenem, along with cefotaxime
12 Review of Literature
and aztreonam, were hydrolyzed 10-fold-less systematically than the penicillins and early cephalosporins. Weak but quantifiable hydrolysis was observed for cefoxitin and ceftazidime, giving the KPC family a broad hydrolysis spectrum that includes most β-lactam antibiotics [Queenan and Bush, 2007].
The KPC family has the greatest activity for spread due to its position on plasmids. It is most commonly found in K. pneumoniae, an organism is infamous for its ability to aggregate and transfer resistance determinants [Walsh, 2010]. However, there is striking
proof that the blaKPC gene is always related to a given genetic element, TN4401. It is aTn3-like transposons that have been found at different loci on plasmids differing in size and incompatibility group and in isolates from different geographical regions, of different sequence types in Enterobacteriaceae and P. aeruginosa [Lin et al., 2010; Walsh, 2010]. All these contributed to its worldwide dissemination in Enterobacter spp., Salmonella spp., P. aeruginosa, A. baumannii and E. coli within a few years [Nordmann et al., 2012c]. Till now, 39 KPC variants have been founded (http://www.lahey.org/Studies). Of
note, one specific K. pneumoniae clone (ST258) coding the gene blaKPC-2 has been extensively identified worldwide figure 1.3. [Lin et al., 2010].
1.3.10. Class D serine-carbapenemases: the OXA β-lactamases
Class D β-lactamases, also named OXAs for „oxacillinases‟, have 498 enzymes, with a few variants possessing some carbapenemase activity. Carbapenem-hydrolyzing class D β-lactamases (CHDLs) do not potentially hydrolyze expanded-spectrum cephalosporins. Overall, the carbapenemase activity of CHDLs is low and is not inhibited by either clavulanic acid or by EDTA, but is inhibited by NaCl [Lynch et al., 2013]. The vast majority of OXA carbapenemases have been discovered in the opportunistic Gram- negative pathogen A. baumannii, although there are reports on Enterobacteriaceae, and in particular K. pneumonia [Queenan and Bush, 2007]. Interestingly, the spread of carbapenemase-positive Acinetobacter spp. appears to be due to the spread of particular bacterial clones, which is opposite to class D carbapenemases in Enterobacteriaceae, Maulanawhich proliferate Azad from Library, strain to strain via Aligarh plasmids [Nordmann Muslim et al., 2012 Universitya]. 1.3.10.1. The OXA-48 family
In contrast to the fast increase in worldwide reports of OXA-expressing Acinetobacter strains, OXA-48 was founded in a clinical K. pneumoniae isolate [Poirel et al., 2004]. Plasmid encoding to OXA variant that has less than 50% similarity to the other OXA
13 Review of Literature
members. Sporadic descriptions or hospital outbreaks involving OXA-48-producing K. pneumoniae, E. coli, or E. cloacae have been reported in Turkey, France, Germany, Spain, Netherlands, Africa and Asia (Figure 1.3) [Lynch et al., 2013]. The recent expenditure of OXA-48 producers is a source of great concern. A single self- conjugative IncL/M type plasmid of approximately 62 kb is the main source of
blaOXA-48 spread in enterobacterial species.
1.3.11. Molecular class B carbapenemases: the Metallo-β-lactamases
Probably the emergence and significant development Metallo-β-lactamases (MBLs) in the last few years in Enterobacteriaceae. MBLs belong to class B of the structural classification of β-lactamases with main three major structural subclasses [Walsh, 2010]. In enzymes of subclasses B1 and B3, the active site has two zinc ions; in members of subclass B2, it has only one, thus excavating the narrower substrate specificity of this subclass.
MBLs are expressed either by genes that are part of the chromosomal structure in some bacterial species (resident Metallo-β-lactamases) or by heterologous genes obtained by horizontal gene transfer (acquired Metallo-β-lactamases). Since the 1990s, a dramatic increase in acquired or transferable MBL genes have been described in Pseudomonas spp., Enterobacteriaceae, A. baumannii, and other Gram-negative non-fermenters [Queenan and Bush, 2007]. Almost all of the obtained types belong to subclass B1 and show a broad spectrum of hydrolytic activity including all penicillins, cephalosporins, and carbapenems, with the exception of monobactam aztreonam [Nordmann et al., 2012a].
At least nine different types of acquired Metallo-β-lactamases have been described. The most important types for epidemiological dissemination and clinical relevance are the IMP-type, VIM-type, SPM-type, and NDM-type enzymes. As far as we are able to ascertain, IMP, VIM, GIM-1, and SPM-1, they started their role in P. aeruginosa and only a few have arisen within Enterobacteriaceae to a significant extent [Walsh, 2010; Queenan and Bush, 2007]. Maulana Azad Library, Aligarh Muslim University 1.3.11.1. The IMP family
IMP type β-lactamases the first obtained from MBLs producer. Since then, 80 IMP variants have been identified and these type carbapenemase producers spread worldwide [Nordmann et al., 2012c].
14 Review of Literature
1.3.11.2. The VIM family
Another family of MBLs has the VIM (for Verona integron-encoded Metallo-β-lactamase or Verona imipenemase) enzymes. The VIM group of enzymes have 46 variants, mainly identified from P. aeruginosa and to with a low extent from enterobacterial isolates. VIM-2 has the doubtful distinction of being the most-reported MBL worldwide, with a native spread in at least Southern Europe (Greece, Spain, Italy) and Southeast Asia (South Korea, Taiwan) [Nordmann et al., 2012c]. From a global reference, the two regions that are predominantly worrying are the Mediterranean basin (particularly Turkey and Greece) and the Indian subcontinent, the prior owing to the occurrence and spread of VIM in Enterobacteriaceae, and the later for NDM-1 [Walsh, 2010]. NDM-1 producing Enterobacteriaceae now needs the focus of worldwide attention.
1.3.11.3. New Delhi Metallo-β-lactamase (NDM)
The new MBL, NDM-1 to outbreak in India and Pakistan has become most worrying development since the penicillin has discovered by Flemming in 1929. NDM was named so after its place of origin New Delhi, India. First of all, it had been described in K. pneumoniae and E. coli isolated in Sweden in 2008 from an Indian patient shifted from a New Delhi Hospital [Yong et al., 2009].
This enzyme is coded by blaNDM-1 which encodes 269 amino acids having protein, with a molecular size of approx 27.5 kDa [Fallah et al., 2011]. To date, 24 variants of NDM have been identified [Wu et al., 2019], (NDM-11 was not assigned to any unique variant). The site mutations create the existence of new variants: the position of the mutation on the gene seems to predict rates of hydrolysis. Many of the variants, such as NDM-2 and NDM-3, share a common hydrolytic activity with NDM-1, as the mutations are not positioned in the active site of the enzyme. Some variants, such as NDM-4, do have genetic variations in the active site and have been found to have increased hydrolytic activity toward carbapenems [Zmarlicka et al., 2015].
1.3.11.3.1. Multi-drug resistance by NDM-1 producing bacteria
All commensal strains of E. coli bacteria are not associated with infectious diseases. MaulanaHowever, Azad in past few Library, decades the emergence Aligarh and fast spread Muslim of a new mutant University strain of E. coli that produce NDM-1 has thrown light on conversation of commensals microorganisms into pathogenic mutants expressing antibiotic resistance genes. These mutants differ from other by having single or either double amino acid substitutions at different positions, the examples of such variants are NDM-1 (Principle variant), NDM-2,
15 Review of Literature
NDM-3, NDM-4 and NDM-5 (minor variants) [Kaase et al., 2011; Hornsey et al., 2011; Yang et al., 2012]. New Delhi Metallo-β-lactamase (NDM) among bacterial strain from the Indian subcontinent is a newly evolved carbapenemase, which hydrolyzes all β-lactam antibiotics (except aztreonam), such as the broad spectrum antibiotic “carbapenems”, therefore leading to a challenge for health care worker [Miriagou et al., 2010]. The marker NDM-1 is mostly present on plasmid rather on chrosmosomal DNA hence they are mobile in nature and get easily transferred from one bacterial cell to another by horizontal gene transfer thereby increasing the spread of drug-resistant strains of pathogenic microorganisms [Rolain et al., 2010].
1.3.11.3.2. Major healthcare risk of NDM producers
NDM-1 strains are proved to be lethal as:
(i) As mostly these antibiotic markers are present on extra chromosomal DNA i.e. on plasmids that are found mobile, hence through the process of natural conjugation these plasmids bearing antibiotic markers get transferred from one bacterial cell to another suggesting their easy spread and flexibility in bacterial populations.
(ii) Secondly there is no standardized phenotypic assay for screening Metallo-β- lactamase (MBL) production in routine. (iii) According to studies it has been shown that there is high frequency of unknown asymptomatic carriers of theses markers (iv) Further due to the lack of availability effective antibiotics for the treatment of such multi-drug resistant NDM-1 associated infections [Rolain et al., 2010].
NDM-1 bearing E. coli invades the host through urinary tract, lungs, blood, and wounds, leading to the infections like septicemia, urinary tract infections, diarrhea, soft tissue infections, peritonitis and other device-related and pulmonary infections [Kaase et al., 2011]. These bacteria are characterized with type-IV secretion system as their virulence factor. Though this system they introduce bacterial proteins and enzymes into the host cell, thereby controlling the host cell metabolism [Hu et al., 2012]. Contamination during the food preparation, infections through body fluids or Maulanacommunity or healthcare Azad setting Library, are some noticeable Aligarh mode of Muslim transmission of UniversityNDM-1 producing strain [Bogaerts et al., 2010].
1.3.11.3.3. Global distribution of NDM variants According to the data the Asian sub-continent known to be the main reservoir of NDM producers with 58.15% of NDM-1 variants, that are distributed mostly in India
16 Review of Literature
and China worldwide. The prevalence of NDM-1 and its variants are shown in (Table 1.1). Europe around 16.8% of the total producers, with the highest spread of NDM-1 variant in Poland, Bulgaria, Turkey, Romania, France, Italy, Germany, Greece, Serbia, Croatia, London, Ukraine, Ireland and Azerbaijan. NDM-4 is also reported to be distributed in European subcontinent in Italy, whereas NDM-5 and NDM-7 are commonly prevalent in France and Denmark (Table 1.1). American continent shows around 10.8% abundance of the total NDM-1 producers as reported worldwide, of which subcontinent Brazil serves as the main reservoir while Mexico city, Colorado, California, Paraguay, Georgia, Florida, Illinois, Pennsylvania, Ecuador Jamaica, Uruguay and Argentina are considered as minor pool (Table 1.1). Africa carries about 10.8% pool of the total NDM-1 producers scattered worldwide. African subcontinent, Algeria revealed more distribution, while Greater Johannesburg region, Tunisia, KwaZulu-Natal, Libya, Egypt, and Madagascar have shown a low prevalence of such NDM-1 producers. NDM-5 is also reported to be distributed in Algeria (Table 1.1.).
Australia continent serves as the 1.6% reservoir of the total NDM-1 producers distributed in Perth, Brisbane, and New Zealand. Maximum distribution of these NDM variants is identified in E. coli and K. pneumoniae species (Table 1.1).
Maulana Azad Library, Aligarh Muslim University
17 Review of Literature
Table 1.1: Worldwide distribution of NDM producing bacteria, as per articles available on PubMed database in the time period of Dec 2013 to Feb 2017.
No. of S. Date of Source/ Continent/Country Variant/Spp NDM No. Detection References Processing 1. Asia/Dhaka, Bangladesh NDM/NA 241 2015 Jun PMID: 25989320 NDM-1/ Escherichia coli (6), Klebsiella pneumoniae (4), Pantoea 2. Asia/Bangladesh 13 2014 Apr PMID: 24489109 spp. (1), Acinetobacter baumannii (1), Enterobacter cloacae (1) 3. Asia/Shenyang, China NDM-5/Escherichia coli 1 2015 Oct PMID: 26482388 4. Asia/Changchun, China NDM-1/Acinetobacter lwoffii 1 2015 Dec PMID: 26470987 5. Asia/Southern China NDM-1/A. baumannii 2 2015 Dec PMID: 26470986 6. Asia/Henan Province, China NDM-1/E. cloacae 8 2015 Oct PMID: 26452278 7. Asia/Chengdu, China NDM-1/E. coli 1 2015 Jul PMID: 26194736 NDM-1/Citrobacter freundii, Escherichia coli, Acinetobacter 8. Asia/Guangzhou, China 3 2015 Aug PMID: 26055374 baumannii 9. Asia/Beijing, China NDM-14/Acinetobacter lwoffii 1 2015 Apr PMID: 25645836 NDM-1/K. pneumoniae (3), K. oxytoca (1), E. Cloacae (1), E. 10. Asia/South China 9 2015 Apr PMID: 25469995 hormaechei (1), E. aerogenes (1), and Acinetobacter spp. (2) NDM-1/K. pneumoniae (4), Enterobacter cloacae (1), Enterobacter 11. Asia/China 9 2014 Dec PMID: 25469701 aerogenes (1) and Citrobacter freundii (1) 12. Asia/China NDM-1/Acinetobacter Junii and Acinetobacter calcoaceticus 2 2015 Feb PMID: 25349061 13. Asia/China NDM-1/Acinetobacter calcoaceticus 1 2014 Sep PMID: 25181293 14. Asia/China NDM-1/Enterobacter cloacae 1 2016 Jan PMID: 26787700 NDM-1/E. coli (6), K. pneumoniae (4), K. oxytoca (1), E. cloacae 15. Asia/Henan Province, China 16 2014 Aug PMID: 24777095 (3), C. freundii (2) 16. Asia/China NDM-1/Raoultella planticola, Escherichia coli 2 2014 Mar PMID: 24594606 NDM-1/E. coli (1), K. pneumoniae (1), Providencia rettgeri (1), 17. Asia/Beijing, China 5 2014 Feb PMID: 24456600 Enterobacter cloacae (1), and Raoultella ornithinolytica (1). 18. Asia/Wenzhou, China NDM-1/ E. coli 2 2013 Dec PMID: 24313961 19. Asia/Hangzhou, China NDM-1/ A. nosocomialis (3), A. pittii (4) 7 2014 May PMID: 24306098 20. Asia/Zhejiang Province, China NDM-1/ Salmonella strain 1 2013 Dec PMID: 24274898 21. Asia/Hong Kong, China NDM-1/ E. coli (2), K. pneumoniae (1) 3 2016 Jan PMID: 26740321 Maulana Azad Library, Aligarh18 Muslim University Review of Literature
22. Asia/ China NDM-5/E. coli 3 2016 Jan PMID: 26482388 23. Asia/ China NDM-5/E. coli 1 2016 Feb PMID: 26542305 24. Asia/China NDM-7/E.coli 5 2016 Apr PMID: 27216384 25. Asia/Guangzhou, China NDM-9/E. coli 1 2016 Jan PMID: 26842777 26. Asia/Shanghai, China NDM-5/Proteus mirabilis 1 2016 Mar PMID: 27065982 27. Asia/Yunnan, China NDM-1/Klebsiella pneumonia 8 2016 Feb PMID: 26896089 28. Asia/China NDM-5/Klebsiella pneumonia 1 2016 Mar PMID: 26988061 29. Asia/China NDM-9/E. coli 1 2016 Mar PMID: 26842777 30. Asia/China NDM-1.C.werkmanii 1 2016 Sep PMID: 27667823 31. Asia/China NDM-5/E.coli 2 2016 Jul PMID: 27406405 32. Asia/China NDM-7/E.coli 5 2016 Jul PMID: 2721638 33. Asia/Ningxia Province/China NDM-1/Enterobacter cloacae 8 2017 Jan PMID: 28197140 34. Asia/China NDM-1/Klebsiella pneumonia 7 2017 Jan PMID: 28109845 35. Asia/China NDM-3/S. typhimurium, NDM-5/E.coli 1162 2017 Feb PMID: 28104504 36. Asia/China NDM-1/ Citrobacter werkmanii 1 2016 Nov PMID: 27667823 37. Asia/China NDM-4/E.coli 1 2016 Nov PMID: 27876781 38. Asia/China NDM-1(36); NDM-5/S. typhimurium (8); NDM-3/ E.coli (1) 45 2017 Feb PMID: 28104504 39. Asia/Manila, Phiippines NDM-7/Klebsiella pneumonia 2 2016 Mar PMID: 27032000 40. Asia/Czech Republic NDM-1/K. Pneumonia 2 2015 Feb PMID: 25421477 41. Asia/Egypt NDM-1/Pseudomonas aeruginosa 1 2014 Dec PMID: 25449240 42. Asia/Egypt NDM-5/Escherichia coli 1 2016 Jul PMID: 27173077 43. Asia/Egypt NDM-5/Escherichia coli 1 2016 Apr PMID: 27048740 44. Asia/Varanasi, India NDM-1/P. aeruginosa 3 2015 Jan PMID: 25635921 NDM-1/Escherichia coli (2), Klebsiella pneumoniae (2), 45. Asia/Kashmir valley, India Citrobacter freundii (3), Acinetobacter spp (1), and Pseudomonas 9 2014 Nov PMID: 25579151 aeruginosa (1) 46. Asia/South India NDM-1/Pseudomonas aeruginosa 4 2014 Oct PMID: 25488450 NDM-1/E coli (6), Klebsiella pneumonia (6), Enterobacter cloacae 47. Asia/West Bengal, India 15 2014 Nov PMID: 25406074 (3) 48. Asia/Chandigarh, India NDM-1/Klebsiella pneumonia 1 2014 Sep PMID: 25298566 49. Asia/Delhi NDM-1/Escherichia coli, Acinetobacter, Klebsiella pneumonia 4 2016 Jan PMID: 26776143
Maulana Azad Library, Aligarh19 Muslim University Review of Literature
50. Asia/Punjab, India NDM/Acinetobacter calcoaceticus-A. baumannii complex 32 2014 Oct-Dec PMID: 25297039 NDM-1/Acinetobacter baumannii (4), Escherichia coli (5), Klebsiella pneumoniae (8), Providencia rettgerii (8), Enterobacter 51. Asia/Bangalore, India 34 2014 Apr PMID: 24927351 cloacae (4), Proteus vulgaris (2), Burkholderia cepacia (1), Roultella ornitholytica (1), Pseudomonas putida (1) 52. Asia/Kuwait NDM-1/Klebsiella pneumonia 21 2016 Mar PMID: 27031521 53. Asia/Lucknow, India NDM-1, NDM-5 (2), NDM-6 (8), NDM-7 (3) 57 2014 Jul PMID: 24831713 54. Asia/India NDM-1/Acinetobacter baumannii 9 2014 Jul PMID: 24752257 55. Asia/India NDM-1/E. coli 1 2014 Apr PMID: 24739981 56. Asia/India NDM-1/K. Pneumonia 6 2014 Jan-Mar PMID: 24739834 57. Asia/Kolkata, India NDM-1/Klebsiella pneumoniae, Enterobacter cloacae 2 2014 Mar PMID: 24336426 58. Asia/Kolkata, India NDM-1/Vibrio fluvialis 27 2016 Oct PMID: 27649032 59. Asia/Maharashtra, India NDM-10/Klebsiella pneumonia 1 2016 Jan PMID: 26776144 60. Asia/Pune, India NDM-1(352), NDM-5(97), NDM-4(28), NDM-7(28)/E. coli 510 2016 Sep PMID: 27600040 61. Asia/Kolkata NDM-1/Vibrio fluvialis 27 2016 Oct PMID: 27649032 62. Asia/Middle East+ NDM-5/Escherichia coli 1 2016 May PMID: 27217442 63. Asia/Azerbaijan/Iran NDM-1/Enterobacteriaceae 7 2016 Nov PMID: 27655293 64. Asia/Japan NDM-7/Escherichia coli 1 2014 Dec PMID: 25193039 65. Asia/Japan NDM-3/Escherichia coli 1 2014 Jun PMID: 24687501 66. Asia/Japan NDM-4, NDM-5/ Klebsiella pneumonia 2 2016 Jun PMID: 27185797 67. Asia/Daejeon, Korea NDM-1/Acinetobacter pittii 2 2015 Sep PMID: 26206691 68. Asia/South Korea NDM-5/Klebsiella pneumonia 1 2015 Jun PMID: 25988911 69. Asia/South Korea NDM-5/Escherichia coli 3 2016 Jun PMID: 27049587 70. Asia/Korea NDM-1/Klebsiella pneumoniae 2 2016 Jan PMID: 26824953 71. Asia/Korea NDM-1/E coli 5 2016 Feb PMID: 26653860 72. Asia/South Korea NDM-9/Klebsiella variicola 3 2017 Jan PMID: 28087584 73. Asia/Lebanon NDM-1/Acinetobacter baumannii 4 2014 Apr PMID: 24560830 74. Asia/Lebanon NDM-1/Acinetobacter pittii 1 2016 Apr PMID: 27222717 75. Asia/Kathmandu, Nepal NDM-13/Escherichia coli 1 2015 Sep PMID: 26169399 76. Asia/Nepal NDM-12/E coli 1 2014 Oct PMID: 25092693 77. Asia/Nepal NDM-1/Providencia rettgeri 3 2014 Feb PMID: 24484534
Maulana Azad Library, Aligarh20 Muslim University Review of Literature
NDM-1/Klebsiella pneumoniae (8), E. coli (6), Enterobacter cloacae 78. Asia/Pakistan (2), Enterobacter aerogenes (5), Citrobacter freundii (4), 28 2015 Jun PMID: 25988236 Acinetobacter iwoffi (1), Providencia sp. (2) 79. Asia/Pakistan NDM-1/NA 12 2015 Apr PMID: 25764102 80. Asia/Pakistan NDM-1/Salmonella enterica serovarAgona 2 2015 Jan PMID: 25378577 NDM-1/Escherichia Coli (30), Enterobacter cloacae (21), Citrobacter freundii (4), Acinetobacter baumannii (3), Klebsiella 81. Asia/Pakistan 66 2014 Apr PMID: 24982081 Pneumonia (3), Pseudocitrobacter faecalis (2), Providencia rettgeri (2), Citrobacter 82. Asia/Philippines NDM-1/Klebsiella pneumonia 1 2016 Mar PMID: 27032000 83. Asia/Singapore NDM-1/Enterobacter cloacae 4 2015 Oct PMID: 26454748 84. Asia/Singapore NDM-1/Klebsiellapneumonia 2 2015 Aug PMID: 26308279 85. Asia/Singapore NDM-1/Escherichia coli 1 2013 Dec PMID: 24356827 86. Asia/Singapore NDM-1/Enterobacter cloacae 6 2016 Feb PMID: 26454748 87. Asia/Malaysia NDM-1/Acinetobacter pittii 1 2016 Feb PMID: 26742728 88. Asia/Malaysia NDM-1/Klebsiellapneumoniae, E. coli, Klebsiella ornithinolytica 6318 2015 Dec PMID: 26712667 89. Asia/Taiwan NDM-1/Klebsiella pneumoniae, E coli 2 2014 Aug PMID: 25144712 90. Asia/Taiwan NDM-1/E. coli 1 2015 Apr PMID: 25074627 91. Asia/Taiwan NDM-1/Escherichia coli 1 2013 Dec PMID: 25059771 92. Asia/Taiwan NDM-1/Escherichia coli 1 2013 Dec PMID: 24354657 93. Asia/Thailand NDM-1/Klebsiella pneumoniae (2), E. coli (1) 3 2014 Nov PMID: 25096073 NDM-1/K pneumoniae (3), E. cloacae (1), S. marcescens (1), K. 94. Asia/Gaziantep, Turkey 6 2015 May PMID: 26051720 oxytoca (1) 95. Asia/Istanbul, Turkey NDM-1/K. pneumoniae (4), E. cloacae (8) 12 2014 May PMID: 24550328 96. Asia/Istanbul, Turkey NDM-1/Klebsiella pneumoniae 7 2015 Nov PMID: 26354347 97. Asia/Istanbul, Turkey NDM-1/Klebsiella pneumoniae 8 2016 Feb PMID: 26860360 NDM-1/Klebsiella pneumoniae (22), Enterobacter cloacae (20), 98. Asia/Vietnam E. coli (15), Citrobacter freundii (9), K. oxytoca (1), E. aerogenes 45 2015 Jun PMID: 25732142 (1) and Providencia rettgeri (1). 99. Asia/Southern Vietnam NDM-1/Vibrio cholera 1 2015 May PMID: 25683557 100. Asia/Vietnam NDM-1/Acinetobacter baumannii 2 2015 Oct PMID: 26471294 101. Asia/Vietnam NDM-1/Acinetobacter baumannii 23 2016 Oct PMID: 27714593
Maulana Azad Library, Aligarh21 Muslim University Review of Literature
102. Asia/Vietnam NDM-1/Acinetobacter calcoaceticus- baumannii 1 2017 Feb PMID: 27714593 103. Asia/Slovakia NDM-1/Klebsiella pneumoniae 1 2014 Sep PMID: 25702288 104. Asia/Slovakia NDM-1/P. aeruginosa 6 2015 Feb PMID: 25343711 105. Asia/Saudi Arabia NDM-1/Acinetobacter baumannii 3 2016 May PMID: 27183378 106. Asia/Arabian Peninsula NDM-7/Escherichia coli 157 2017 Feb PMID: 28156193 107. Asia/Yemen NDM-1/Klebsiella pneumoniae (8) Enterobacter cloacae (2) 10 2014 Oct PMID: 25009193 108. Africa/North Africa, Algiers NDM-1/Acinetobacter baumannii 10 2015 Jun PMID: 26194827 109. Africa/Algeria NDM-1/Acinetobacter baumannii 11 2014 Nov PMID: 25240726 110. Africa/Algeria NDM-5/Escherichia coli 3 2014 Sep PMID: 24982080 111. Africa/Algeria NDM-1/Acinetobacter baumannii 32 2016 Jan PMID: 26615460 112. Africa/Algeria NDM-5/E. coli 1 2016 Jan PMID: 26741510 113. Africa/Algeria NDM-5/E. coli 3 2015 Sep PMID: 26566444 114. Africa/Algeria NDM-5/Escherichia coli 1 2016 Jun PMID: 26741510 115. Africa/Algeria NDM-1/A. baumannii (4), A. nosocomialis (1) 5 2016 Dec PMID: 28007519 116. Africa/Algeria NDM-1/Acinetobacter baumannii 1 2016 Dec PMID: 27835841 NDM-1/Klebsiella pneumoniae (28), Enterobacter cloacae (5), 117. Africa/Greater Johannesburg Area Klebsiella oxytoca (2), Serratia marcescens (2), Citrobacter 117 2015 Apr PMID: 25909482 amalonaticus (1) NDM-1/Enterobacter cloacae (2), Citrobacter freundii (1), Serratia 118. Africa/KwaZulu-Natal, South Africa 4 2014 Jul PMID: 24853768 marcescens (1) NDM-1/Acinetobacter baumannii, Pseudomonas aeruginosa, 119. Africa/Libya Pseudomonas putida, Escherichia coli, Klebsiella pneumoniae, 8 2015 Aug PMID: 26294290 Enterobacter gergoviae 120. Africa/Libya NDM-1/Acinetobacter baumannii 8 2016 Apr PMID: 27216382 121. Africa/Madagascar NDM-1/Klebsiella pneumonia 1 2015 Jun PMID: 25845871 122. Africa/Egypt NDM-1/Klebsiella pneumonia 8 2015 Dec PMID: 26686939 123. Africa/Egypt/Cairo NDM-1/NA 24 2016 Sep PMID: 27685673 124. Africa/Egypt NDM-1/K. pneumoniae, E. coli, P.aeruginosa, A. baumannii 24 2016 Dec PMID: 27685673 125. Africa/Tunisia NDM-1/Klebsiella pneumonia 1 2016 Sep PMID: 27659734 126. Africa/Tunisia NDM-1/A. baumannii 1 2017 Jan PMID: 28099062 127. Africa/Tunisia NDM-1/K. pneumonia 6 2016 Nov PMID: 27965626
Maulana Azad Library, Aligarh22 Muslim University Review of Literature
128. Africa/Tunisia NDM-1/K. pneumonia 1 2017 Jan PMID: 27659734 129. America/Riode Janeiro, Brazil NDM-1/Enterobacter hormaechei 1 2015 Apr PMID: 25473727 130. America/Argentina NDM-1/Acinetobacter bereziniae 1 2016 Mar PMID: 26966220 131. America/Brazil NDM-1/P. rettgeri (1), Enterobacter cloacae (3) 4 2015 Feb PMID: 25466163 132. America/Brazil NDM-1/Acinetobacter baumannii 1 2014 Dec PMID: 25288087 133. America/Porto Alegre, Brazil NDM-1/Enterobactercloacae (9), Morganella morganii (2) 11 2014 Aug PMID: 24857802 134. America/Brazil NDM-1/Enterobacter hormaechei 6 2014 Apr PMID: 24449772 135. America/Brazil NDM-1/Providencia rettgeri 1 2015 Jun PMID: 25989100 136. America/California NDM-1/K. pneumonia 4 2015 May PMID: 25977423 137. America/Colorado NDM-1/K. pneumonia 8 2014 Apr PMID: 24602944 138. America/Colorado NDM-1/NA 5 2014 Apr PMID: 24602952 139. America/Colorado NDM-1/K. pneumonia 6 2016 Dec PMID: 27977640 140. America/Florida NDM-1/Klebsiellapneumonia 1 2016 Apr PMID: 26983001 141. America/Ecuador NDM-1/Providencia rettgeri 1 2015 Dec PMID: 2784289 142. America/Atlanta, Georgia NDM-1/Escherichia coli 1 2015 Mar PMID: 25744985 143. America/Illinois NDM-1/Escherichia coli 39 2014 Oct PMID: 25291580 144. America/Jamaica NDM-1/Klebsiella pneumonia 1 2016 Feb PMID: 26927461 NDM-1/Escherichia coli (1), Enterobacter cloacae (1), Klebsiella 145. America/Mexico City 5 2015 Nov PMID: 26282410 pneumoniae (3) 146. America/Mexico NDM-1/Klebsiella pneumoniae 1 2014 Mar PMID: 24569387 147. America/Paraguay NDM-1/Acinetobacter pittii 2 2014 Sep PMID: 24793901 148. America/Pennsylvania NDM-1/K. pneumoniae, Escherichia coli 2 2014 Jan PMID: 24377764 149. America/Uruguay NDM-1/Morganella morganii 1 2015 Jan PMID: 25447717 150. Europe/Azerbaijan NDM-1/NA 7 2016 Sep PMID: 27655293 151. Europe/Bulgaria NDM-1/Escherichia coli 12 2014 Apr PMID: 24514099 152. Europe/Denmark NDM-7/Klebsiella pneumonia NDM-5/ Escherichia coli 1 2015 Nov PMID:26307465 153. Europe/Bulgaria NDM-1/Klebsiella pneumonia 2 2016 Jan PMID: 26817486 154. Europe/Bulgaria NDM-1/Klebsiella pneumonia 1 2015 Sep PMID: 26594376 155. Europe/Ukraine NDM-1/Klebsiella pneumoniae 1 2016 Apr PMID: 27129373 156. Europe/France NDM-1/Proteus mirabilis 1 2015 Jan PMID: 25239462 157. Europe/France NDM-1/Morganella morganii 1 2014 Oct PMID: 25081858 Maulana Azad Library, Aligarh23 Muslim University Review of Literature
158. Europe/France NDM-7/Escherichia coli 1 2016 Jun PMID: 27178253 159. Europe/France NDM-1/Acinetobacter pittii 1 2016 Dec PMID: 27999060 160. Europe/Germany NDM-1/S. marcescens 1 2015 Apr PMID: 25468904 161. Europe/Germany NDM-1/Klebsiella pneumoniae (1), Escherichia coli (1) 2 2016 May PMID: 27237423 162. Europe/Greece NDM-1/K. pneumonia 78 2014 Aug PMID: 24739146 163. Europe/Greece NDM-1/Acinetobacter baumannii 1 2016 Dec PMID: 27773496 164. Europe/Italy NDM-1/Klebsiellapneumonia 1 2015 Jun PMID: 26116560 165. Europe/Italy NDM-4/Escherichia coli 8 2014 Jun PMID: 24906230 166. Europe/Italy NDM-5/Escherichia coli 1 2017 Jan PMID: 28159670 167. Europe/Ireland NDM-1/Klebsiella pneumoniae (9), Escherichia coli (1) 10 2016 Dec PMID: 27624807 168. Europe/Croatia NDM-1/Citrobacterkoseri 1 2015 Oct PMID: 26484384 169. Europe/Croatia NDM-1/Klebsiella pneumoniae 7 2016 May PMID: 27174090 170. Europe/Poland NDM-1/Klebsiella pneumoniae 374 2015 Sep PMID: 26386745 171. Europe/Poland NDM-1/Klebsiella Escherichia coli 2 2015 Jun PMID: 26084313 172. Europe/Poland NDM-1/Klebsiella pneumoniae 1 2014 Sep PMID: 25242796 173. Europe/Romania NDM-1/E. cloacae 2 2014 Mar PMID: 24346066 174. Europe/Romania NDM-1/Klebsiella pneumoniae 8 2015 Nov PMID: 26599338 175. Europe/Serbia NDM-1/Pseudomonas aeruginosa 6 2014 Mar PMID: 24343100 176. Europe/Serbia NDM-1/Escherichia coli 1 2016 Apr PMID: 27074434 177. Europe/Turkey NDM-1/Acinetobacter baumannii 2 2015 Sep PMID: 26296677 178. Europe/Turkey NDM-1/Acinetobacter pittii 1 2014 Dec PMID:25096072 179. Europe/Turkey NDM-1/Klebsiella pneumoniae 4 2016 Sep PMID: 27942358 180. Europe/Turkey NDM-1/Klebsiella pneumoniae 2 2016 Dec PMID: 27939808 181. Europe/London NDM-1/Klebsiella spp. (180), Escherichia coli (80) 326 2014 Jul PMID: 24769387 182. Australia/Brisbane NDM-1/Klebsiella pneumoniae 2 2015 Mar PMID: 25758700 183. Australia/Perth NDM-1/Enterobacter cloacae 1 2014 Apr PMID: 24794661 184. Australia/New Zealand NDM-5/Klebsiella pneumoniae 1 2016 Dec PMID: 27999016 Source: [Khan et al., 2017].
Maulana Azad Library, Aligarh24 Muslim University Review of Literature
NDM-1 producers were found resistant to meropenem, imipenem, ertapenem, amikacin, tobramycin, gentamicin, and ciprofloxacin, while, isolates were found susceptible to tigecycline (MICs ≤1 mg/L) and to colistin (MICs ≤4 mg/L)
[Kumarasamy et al., 2010]. Non-clonal Indian isolates from Chennai had blaNDM-1 specifically on plasmids of size ranging between 50 to 350 kb, while another clone of K. pneumoniae isolated from Haryana was found possessing plasmid of predominately either 50 kb or 118 kb, suggesting the wide environmental distribution
of blaNDM-1 [Kumarasamy et al., 2010]. Plasmid profiling showed that a plasmid of
size 50 kb takes blaNDM-1 producing Enterobacteriaceae that were found resistant against almost all antibiotics except colistin and tigecycline [Kumarasamy et al., 2010]. In Europe, spreading of NDM-1 has been observed among A. baumannii isolates assigned to international clonal lineage and to the emerging genotypes ST85
and ST25 [Bonnin et al., 2012; Sahl et al., 2015]. The blaNDM-1 gene was inserted within a Tn125-like transposon that was either plasmid-located or chromosomally- located [Bonnin et al., 2012; Sahl et al., 2015].
According to the studies E. coli isolates carrying NDM resistant markers were also found in animal sources [Szmolka et al., 2013]. The example from such sources
include Acinetobacter lwoffii carrying blaNDM-1 gene on a plasmid, which was isolated
from a rectal swab of chicken [Wang et al., 2012]. The blaNDM gene isolated in dairy cattle is a matter of concern because it may lead to spread through the food chain. Sequence analysis revealed a gene demonstrating 100% homology among E. coli
(JQ348841.1) blaNDM-5 gene and 99% homology among E. coli (JQ348841.1) blaNDM-
4 in P. aeruginosa (HF546976.1), Raoultella ornithinolytica (JX680686.1), K. pneumoniae (KC178689.1), A. baumannii (KC404829.1, KC347597.1). Apart from this, NDM-1 producing K. pneumoniae and Enterobacter cloacae strains were detected from two patients with diabetic foot ulcers from the northern part of India in 2010 [Khan et al., 2012].
Depending on the percentage of victims affected with NDM-1 isolates in different Maulanaparts of theAzad globe, the Library, Indian subcontinent Aligarh has been proposed Muslim as the main University reservoir of NDM-1 producing bacteria [Khan et al., 2012], followed by the United Kingdom at second. Whereas, Japan, Belgium, China, Austria, France, Germany, Sweden, Norway, Netherland, Hong Kong, Australia, and Canada also serve as the secondary
reservoirs of blaNDM genes [Khan et al., 2012] as shown in table1.1. A normal average
25 Review of Literature
of 1000–1600 patients are admitted daily to hospitals around the world as a result of infections due to drug-resistant bacteria [Bush et al., 2010]. It is challenging to predict
the rate of spread of the gene encoding NDM-1, while the exchange of the blaNDM-1 gene among unrelated bacterial strains have been identified already among Enterobacteriaceae and A. baumannii [Kumarasamy et al., 2010]. An increase in population exchange worldwide and increased medical tourism may play a significant role in spreading uncontrolled NDM-1 related resistance globally.
1.3.11.3.4. NDM and clinical infections
NDM-1 is the most common variant with references of clinical infections. NDM-1 producers of Enterobacteriaceae cause a wide range of infections such as UTI, septicemia, pneumonia, diarrhea, peritonitis, device-associated and soft-tissue infections. Both hospital and community-acquired infections have been reported [Fallah et al., 2011].
Most infections with NDM-1 producers have been founded in adults, but blaNDM-1- producingEnterobacteriaceae was also reported from a neonatal intensive care unit (NICU) in India as well [Roy et al., 2010, 2011].
1.4. Microbiology of neonatal infections
The pattern of the bacterial pathogen responsible for neonatal sepsis has changed with time and varies from place to place. This is due to the changing pattern of antibiotic use and changes in lifestyle. There is a difference in the causative organisms for Neonatal sepsis between the developed and developing countries. Within developing countries, there are regional variations in the spectrum of organisms causing neonatal sepsis [Sivanandan et al., 2011].
In the United States, the National Institute of Child Health and Development (NICHD) reported that the common pathogens causing early-onset sepsis are MaulanaStreptococcus agalactiaeAzad (groupLibrary, B Streptococcus), Aligarh Haemophilus Muslim influenza University and Escherichia coli [Stoll et al., 2011]. GBS remains the most frequent pathogen in term infants, and E. coli the most significant pathogen in preterm babies with EOS [Stoll et al., 2011]. Similarly, a study from the United Kingdom has reported GBS to be the most frequent pathogen (31%) followed by nonpyogenic streptococci, coagulase-
26 Review of Literature
negative Staphylococcus (CoNS), and E. coli [Muller-Pebody et al., 2011]. In the developed countries, Gram-positive organisms account for around 70% of all Late- Onset Sepsis. The common pathogens causing LOS in very low birth weight (VLBW) infants include CoNS followed by Enterococcus spp., Staphylococcus aureus and GBS [Sivanandan et al., 2011]. About 18–20% of late-onset sepsis is produced by Gram-negative bacteria especially Enterobacteriaceae spp. including Klebsiella pneumoniae, E. coli and Acinetobacter baumannii.
In the developing world, E. coli (15%), Klebsiella species (25%) and S. aureus (18%) are the major microorganism in the first week of life, while Streptococcus pneumoniae (12%), S. aureus (14%), Salmonella species (13%) and Streptococcus pyogenes nontyphoidal are the most commonly reported organisms in LOS [Zaidi et al., 2009; Mulholland et al., 1999]. GBS were relatively uncommon (7%), although regional differences existed. In Asiatic countries, Gram-negative bacteria (E. coli, Klebsiella spp., Pseudomonas spp., Enterobacter spp., Salmonella spp., and Acinetobacter spp.) are the important causes of sepsis but GBS is reported to be extremely rare [Sivanandan et al., 2011]. Gram-negative enteric organisms of the Enterobacteriaceae family are common inhabitants of the neonatal intestine that may cause nosocomial sepsis. According to the National Neonatal Perinatal Database of India, E. coli, S. aureus and K. pneumoniae are the three most common organisms causing neonatal sepsis both in hospital and community [NNPD, 2003]. Gram-negative bacteria are also predominated (77%) among the infection in home-delivered babies. Furthermore, the causative organisms of EOS and LOS sepsis are similar particularly in a clinical setting in a developing country [Sundaram et al., 2009]. The bacteriological profile of neonatal sepsis is constantly under change with advances in the primary diagnosis and treatment of sepsis and the increased survival of preterm babies [Rathi et al., 2011].
Moreover, in the unit where this study was undertaken, Gram-negative etiology was predominant, with E. coli and K. pneumonia being the most common strain. MaulanaAcinetobacter Azad spp. emergedLibrary, as the second Aligarh most common Muslim cause of sepsis. University A relatively small proportion of infection was due to Gram-positive cocci and there was an emerging fungal infection due to yeasts. The microbial etiology of early onset and late onset sepsis was similar.
27 Review of Literature
1.4.1. Major pathogens in neonatal septicemia
Studies have shown that the most important pathogens linked with neonatal sepsis in developing countries, including India, are Enterobacteriaceae, especially Klebsiella VSS Enterobacter spp. and E. coli [Zaidi et al., 2005].
1.4.1.1. Klebsiellas spp.
Klebsiella is non-motile, rod-shaped, oxidase-negative, Gram-negative bacteria with a prominent polysaccharide capsule. This capsule encases the entire cell surface, accounts for the large appearance of the bacteria on Gram stain, and provides resistance against many host defense mechanisms [Ristuccia et al., 1984; Brisse et al., 2006]. The species are facultative anaerobes, and most strains can survive with citrate and glucose as their sole carbon sources and ammonia as their sole nitrogen source [Ristuccia et al., 1984; Brisse et al., 2006]. Klebsiella species are found everywhere in nature: in the soil, plants, water, insects, humans, and animals. They have no specific growth requirements and grow well on standard laboratory media, but grow best between 35 and 37°C and at pH 7.2. Klebsiella species are normally found in the mouth, human nose, and gastrointestinal tract as normal flora; however, they can also behave as opportunistic human pathogens [Bagley et al., 1985]. Today, 7 species with demonstrated similarities in DNA homology are known. These are (1) Klebsiella pneumoniae, (2) Klebsiella planticola, (3) Klebsiella oxytoca, (4) Klebsiella ozaenae, (5) Klebsiella ornithinolytica (6) Klebsiella rhinoscleromatis, and (7) Klebsiella terrigena. Among these K. pneumoniae is the most clinically important species of the group [Ristuccia et al., 1984; Brisse et al., 2006].
1.4.1.2. Infections by Klebsiella pneumoniae
Klebsiella organisms can lead to a wide range of disease states, notably pneumonia, septicemia, urinary tract infections, diarrhea, meningitis and soft tissue infections. The majority of human Klebsiella infections are caused by K. pneumoniae followed by K. Maulanaoxytoca [Ristuccia Azad et al., 1984;Library, Brisse et al.,Aligarh 2006]. K. pneumoniaeMuslim is theUniversity most common cause of nosocomial respiratory tract and premature intensive care infections, and the second-most frequent cause of urinary tract infections and bacteremia. Data from NNPD2002-2003 from India has shown K. pneumoniae as the major microorganism in both intramural as well as extramural neonates (27%-32%) [NNPD, 2005]. The ability of K. pneumoniae to colonize in the hospital environment,
28 Review of Literature
including carpeting, sinks and various surfaces, as well as the skin of patients and hospital staff, has been identified as a major factor in the spread of nosocomial infections. The ability of this organism to spread quickly may often lead to nosocomial outbreaks, especially in neonatal units [Hart, 1993]. Several unrelated infections and outbreaks of multidrug-resistant K. pneumoniae in NICUs of Italy [Bagattini et al., 2006], USA China [Yu et al., 2012], [Limbago et al., 2011], Brazil [Cassettari et al., 2009], Madagascar [Randrianirina et al., 2009], Ireland [McDermott et al., 2012], France [Birgy et al., 2011], Tunisia [Ben-Hamouda et al., 2004] Turkey [Mutlu et al., 2011], Karachi [Mahmood et al., 2002], India [Kothari et al., 2013; Mane et al., 2010; Viswanathan et al., 2012] etc, are often caused by new types of strains, the so-called ESBL-producers or carbapenemase-producers.
1.4.1.3. Infections by Escherichia coli
Escherichia coli is a Gram-negative, facultatively anaerobic, rod-shaped bacterium that is commonly found in the lower intestine of warm-blooded organisms (endotherms) [Singleton, 1999]. Most E. coli strains are harmless; however, some E. coli serotypes are pathogenic, meaning they can cause infection, either serious food poisoning resulting in diarrhea or illness outside of the intestinal tract. The harmless strains are part of the normal gut flora and can benefit their hosts by producing vitamin K2 [Bentley and Meganathan, 1982], which is required for post-translational modification of proteins involved in blood coagulation and bone metabolism and have been recognized as a protective agent against infection by pathogenic bacteria [Mann, 1999] and thus preventing colonization of the intestine with pathogenic bacteria [Hudault et al., 2001]. Fecal-oral transmission is the major route through which pathogenic isolates of the bacterium are exposed to the environment and cause disease, though cells are able to survive outside the body for a limited amount of time. The types of E. coli that can cause diarrhea can also be transmitted through contaminated water or food, or through contact with Human and animals [Reid et al., 2001]. Maulana Azad Library, Aligarh Muslim University 1.4.1.4. Clinical categories of E. coli
From a genetic and clinical perspective, E. coli strains of biological significance to humans can be broadly categorized as (1) Shiga toxin-producing E. coli (STEC)-may also be referred to as Verocytotoxin-producing E. coli (VTEC) or Enterohemorrhagic
29 Review of Literature
E. coli (EHEC), (2) Enteropathogenic E. coli (EPEC), (3) Enteroinvasive E. coli (EIEC), (4) Enterotoxigenic E. coli (ETEC), (5) Enteroaggregative E. coli (EAEC) and (6) Diffusely adherent E. coli (DAEC) [Singleton, 1999].
E. coli that have the ability to cause disease outside the intestine are termed as extra- intestinal pathogenic E. coli (ExPEC). E. coli can also be classified on the basis of their O: K: H serotypes, phylogroups (A, B1, B2, C, D, E, F) and sequence types (STs) [Maiden et al., 1998]. Most extra-intestinal infections due to E. coli are caused by isolates of phylogroup B2 and D which possess several virulence factors and can also be recognized by their characteristic O: K: H serotypes [Manges et al., 2012]. Phylogroups A and B1 are considered commensals and generally lack potential virulence factors [Picard et al., 1999]. Recent studies have shown that phylogroup C is closely related to B1, strains belonging to phylogroup F form a sister group to phylogroup B2 and phylogroup E consists of formerly unassigned E. coli isolates [Maiden et al., 1998].
1.4.1.5. Extra-intestinal infections due to E. coli
In terms of morbidity and mortality, ExPEC has a great impact on public health, with an economic cost of several billion dollars annually [Smith et al., 2007]. The ExPEC strains can cause disease at a number of anatomical locations through entry into a sterile extra-intestinal site from their locus of colonization (colon, vagina, and oropharynx) [Russo et al., 2003]. Most of the ExPEC strains are found in the B2 and D phylogenetic groups and have acquired various virulence genes (papA/papC, sfa/foc, afa/dra, iutA, kpsMT II) that allow them to induce extra-intestinal infections in both normal and compromised hosts. Similarly, when ExPEC are characterized by multi-locus sequence typing (MLST), specific lineages such as ST131, ST69 and ST117 appear to be responsible for a large proportion of human extraintestinal infections [Manges and Johnson, 2001, 2012].
The virulence factors and the clinical picture presented by uropathogenic E. coli Maulanainfections indicate Azad that these Library, pathogens are alsoAligarh ExPEC strains Muslim [Russo and Johnson,University 2002, 2005]. These uropathogenic E. coli cause 70–90% of community-acquired UTIs and 50% of nosocomial UTIs [Kucheria et al., 2005]. Community outbreaks of E. coli induced UTIs have been documented in Denmark, Spain, and the United Kingdom [Ramchandani et al., 2005].
30 Review of Literature
ExPEC strains account for 8% of the surgical site infections [Russo and Johnson, 2003]. In immunocompetent hosts, more severe diseases such as pyelonephritis, bacteremia, or meningitis are induced by group B2 ExPEC strains with a greater number of virulence factors, as compared to strains that cause milder diseases such as cystitis. The requirement for ExPEC virulence factors is considerably reduced when the host is immunocompromised due to age, immune status, or underlying disease.
1.4.1.6. ExPEC and neonatal sepsis
More than 50% of cases of neonatal meningitis caused by Gram-negative enteric organisms were due to ExPEC strains. The association of E. coli meningitis with the neonate is due to an immature immune system and not to greater susceptibility of the neonatal brain microvascular endothelial cells (BMECs) to E. coli binding, invasion, or transcytosis [Xie et al., 2004]. E. coli was found to be the most frequent cause of septicemia in infants of 1 year of age [Diekema et al., 2002]. E. coli was also the cause of nosocomial cases of pneumonia in United States hospitals and European hospitals [Emori and Gaynes, 1993, Fluit et al., 2001]. Neonates with E. coli induced sepsis had a lower birth weight, required an approximately 4-fold longer stay in intensive care, often required mechanical ventilation, and had an almost 3 times higher mortality compared to those neonates with septicemia caused by GBS [Mayor- Lynn et al., 2005].
1.4.1.7. Infections by Enterobacter species
The genus Enterobacter is the associated member of the coliform family of bacteria but does not belong to the fecal coliforms (or thermotolerant coliforms) group. The major species are E. cloacae, E. aerogenes and E. agglomerans. Enterobacter species rarely cause disease in healthy individuals. This opportunistic pathogen, similar to other members of the Enterobacteriaceae family, possesses an endotoxin known to Maulanaplay a majorAzad role Library, in the pathophysiology Aligarh of sepsis Muslim and its complications University in immunocompromised (usually hospitalized) patients and in those, were on ventilation. The most common sites of infections are the urinary and respiratory tracts [Singleton et al., 1999]. Frequently increasing infections seen due to Enterobacter, at intensive care units.
31 Review of Literature
Enterobacter infections are increasing in frequency, particularly in intensive care units (ICUs). Collected surveillance report between 1992 and 1999 resulted that Enterobacter was the fifth leading cause of ICU infections in the USA and a third most common cause of nosocomial pneumonia overall by the survey of the Centers for Disease Control (CDC) and The National Nosocomial Infection Surveillance (NNIS) [Brisse et al., 2006].
Enterobacter is well adapted to cause nosocomial infections, as it is ubiquitous in the environment and can survive on the skin and dry surfaces as well as replicate in contaminated fluids. Inadequate attention such as hand-washing ignoring can lead to the infection from patient to the patient caused by Enterobacter. Particularly, Enterobacter cloacae and Enterobacter aerogenes, are important nosocomial pathogens responsible for various infections, including bacteremia, lower respiratory tract infections, skin and soft-tissue infections, urinary tract infections (UTIs), endocarditis, intra-abdominal infections, septic arthritis, osteomyelitis, CNS, and ophthalmic infections. Risk factors for nosocomial Enterobacter infections include hospitalization of greater than 2 weeks, ICU care, invasive procedures in the past 72 hours, treatment with antibiotics like broad-spectrum cephalosporins or aminoglycosides in the past 30 days, and the presence of a central venous catheter [Brisse et al., 2006]. E. sakazakii was found to be reported as a causative agent of neonatal sepsis with meningitis [Mutlu et al., 2011].
Enterobacter species can also cause various community-acquired infections, including UTIs, skin and soft-tissue infections, and wound infections among others.
Contaminated enteral feedings, respiratory therapy, humidifiers equipment and hydrotherapy water in a burn unit cause infection which has been described, particularly through numerous Enterobacter [Singleton et al., 1999]. Physicians treating patients with Enterobacter infections are advised to avoid certain antibiotics, Maulanaparticularly third Azad-generation Library, cephalosporins, Aligarhbecause subsequent Muslim studies have University shown that prophylaxis with second and third generation cephalosporins has been associated with the selection of multi-resistant Enterobacter. Carbapenems and fourth generation cephalosporins are the best CSF penetrating agents against the Enterobacter [Sivanandan et al., 2011].
32 Review of Literature
1.5. Aims and objective of the study
To evaluate retrospectively the spread of NDM producing Enterobacteriaceae and their genetic basis in the neonatal intensive care unit of one of the north Indian tertiary care Hospitals.
To detect NDM variants among Enterobacter aerogenes from NICU of Indian Hospital.
To characterize NDM-1 producing rare species of Enterobacteriaceae family.
Study the carbapenem-resistant genes in the north Indian pediatrics patients to
know if blaNDM-1 and blaVIM-1 are disseminating through any rare species.
To investigate carbapenem-resistant K. pneumoniae (CRKP) from NICU of north Indian tertiary care Hospital to understand the clonal outbreak.
Maulana Azad Library, Aligarh Muslim University
33
Chapter 2 Material and Methods
Maulana Azad Library, Aligarh Muslim University
Material and Methods
2. MATERIAL AND METHODS
2.1. Antibiotic disc
Antimicrobial susceptibility test discs used in this study were purchased from Hi Media Laboratories, Pvt. Ltd., Mumbai, India.
S. No. Antimicrobial agents Antibiotic content per disc (mcg)
1. Imipenem (IMP) 10
2. Meropenem (MRP) 10
3. Doripenem (DOR) 10
4. Cefoxitin (CX) 30
5. Ceftazidime (CAZ) 30
6. Cefotaxime (CTX) 30
7. Cefepime (FEP) 30
8. Gentamicin (GEN) 10
9. Amikacin (AK) 30
10. Aztreonam (ATM) 30
11. Minocycline (MI) 30
12. Tigecycline (TGC) 30
13. Ciprofloxacin (CIP) 5
14. Levofloxacin (LE) 5
15. Cefoparazone/sulbactam (CFS) 75/10
Maulana16. AzadPolymyxin Library,-B (PB) 300 unit Aligarh Muslim University
17. Colistin (CL) 10
18. Imipenem/EDTA (IMP-E) 10/750
34 Material and Methods
2.2. Antibiotic powders
Antibiotic powder for the determination of minimum inhibitory concentrations (MISs) following antibiotics were procured from Sigma-Aldrich, St. Louis, USA.
1. Imipenem (IMP) 10. Amikacin (AK)
2. Meropenem (MRP) 11. Aztreonam (ATM)
3. Doripenem (DOR) 12. Minocycline (MI)
4. Cefoxitin (CX) 13. Tigecycline (TGC)
5. Ceftazidime (CAZ) 14. Ciprofloxacin (CIP)
6. Cefotaxime (CTX) 15. Levofloxacin (LE)
7. Cefuroxime (CXM) 16. Cefoparazone/sulbactam (CFS)
8. Cefepime (FEP) 17. Polymyxin-B (PB)
9. Gentamicin (GEN) 18. Colistin (CL)
2.3. Culture media
The culture media used in this thesis were purchased from Hi-Media Laboratories, Pvt. Ltd., Mumbai, India.
1. Luria-Bertani broth 2. Mueller-Hinton broth 3. Luria-Bertani agar 4. Mueller-Hinton agar
Maulana Azad Library, Aligarh Muslim University
35 Material and Methods
2.4. Some of the important reagent, chemical and kits
Reagent/chemical/kits Company name
DNA ladder New England Biolabs., USA
96-well microtitre plates Axiva, India
Acetone SRL, India
Agar Hi-Media, India
Agarose Sigma- Aldrich, USA
Bromo Phenol Blue Hi-Media, India
CARBA NP Kit BioMerieux, France
Chloroform SRL, India
Cotton swab Hi-Media, India
DNA loading Dye (6X) Thermo Fisher Scientific Inc., USA
DMSO SRL, India
EDTA Sigma-Aldrich, USA
Ethanol E. Merck, India
Ethidium bromide Sigma- Aldrich, USA
Gel extraction kit Thermo Fisher Scientific Inc., USA
Genomic DNA isolation kit Qiagen, Germany
Glacial Acetic acid Qualigens, India
Glycerol Sigma-Aldrich, USA MaulanaHi-Culture Azad collection Library, device HiAligarh-Media, India Muslim University HPLC water Qualigens, India
Isopropanol SRL INDIA
Mass Ruler DNA ladder Thermo Fisher Scientific Inc., USA
36 Material and Methods
MgCI2 SRL, India
Panel NMIC/ID-55 BD-Phoenix-100Tm
Phenol GeNei
PCR master‐mix Thermo Fisher Scientific Inc., USA
Plasmid DNA isolation kit Qiagen, Germany
Proteinase K SRL, India
R Nase Thermo Fisher Scientific Inc., USA
Sodium Acetate Hi-Media, India
Sodium Azide Hi-Media, India
Sodium Dodecyl Sulfate Sigma, USA
Sodium Hydroxide Pellets Fisher Scientific
Sucrose Pure SRL, India
Sterile disposable petri plates Hi-Media, India Sterile uricol for urine sample Hi-Media, India collection Tris Base Hi-Media, India
0.20 µm filter Millipore, USA
0.45 µm filter Millipore, USA
2.5. Collection of bacterial strains and hospital setting
All isolates presented in this thesis were screened from neonates admitted in neonatal intensive care unit (NICU) of Jawaharlal Nehru Medical College and Hospital Maulana(JNMCH), Aligarh Azad Muslim Library,University, Aligarh, Aligarh India, during Muslim the period, December University 2015 to April 2018. It is a tertiary care hospital of 1300 bed capacity, in which 90 beds were allotted for pediatric patients and 35 beds for the NICU. Patients enrolled in the study were those who enrolled in the active surveillance system (NICU stay 48 hours and weekly surveillance swabs were taken at least once). Neonates admitted to
37 Material and Methods
the ward before December 2015 and/or discharged after April 2017, were excluded. A single rectal swab was collected from each patient with the help of Hi-Culture collection device. The samples were spread over Luria Bertani agar (HiMedia Laboratories Pvt. Ltd.) plate and incubated at 37°C for 16 -20 hours. The colonies were isolated by the streak plate method using a sterile loop. All the pure culture isolates were cryopreserved at -80°C in 70% glycerol.
2.6. Ethical approval
A formal consent from the institutional ethical committee was taken and clearance was obtained from the institute’s ethics committee. Participants/guardians had provided written, informed consent to participate in the study. We have a specific format to get the consents of patients/ parents of minors. These formats were made according to the Institutional ethics committee’s guidelines. These forms are confidential and cannot be disclosed as per the guidelines. The institutional ethical committee has already approved. The name of committee/board is “Institutional Ethical Committee of Interdisciplinary Biotechnology Unit [Biot/307/01.06.13]”, Aligarh Muslim University, Aligarh, India.
2.7. Identification of isolates
The species-level identification of isolates was performed by using BD PhoenixTM 100 automated microbiology system (Becton, Dickinson & Co., Franklin Lakes, NJ). The ID section of Phoenix panel utilizes a series of conventional, chromogenic, and fluorogenic biochemical tests to determine the identification of the organism. These tests include fermentation, oxidation, degradation and hydrolysis of various substrates, and further validated by 16s rRNA sequencing [Shemesh et al., 2012].
2.8. Antimicrobial susceptibility testing and MICs
Antimicrobial susceptibility testing was performed on Mueller–Hinton agar plates with commercially available discs (Hi-Media, Mumbai, India) for different classes of Maulanaantimicrobials Azad such Library, as carbapenems Aligarh– imipenem (10µg), Muslim meropenem University (10µg) and doripenem (10µg); cephalosporins – cefotaxime (30µg), ceftazidime (30µg), and cefepime (30 µg); monobactam – aztreonam (30µg); fluoroquinolones – ciprofloxacin (5µg) and levofloxacin (5µg), aminoglycosides – amikacin (30µg), gentamicin (10µg) and polymyxin-B, colistin (10µg) by the Kirby Bauer disk diffusion method and
38 Material and Methods
results were interpreted according to CLSI-2016 guidelines. AST was also done by BD Phoenix TM-100 automated microbiology system. The Minimum Inhibitory Concentrations (MICs) for antimicrobial agents were determined by the micro broth dilution method following CLSI-2016 guidelines.
2.9. Detection of Metallo-β-Lactamase
MBL production was detected by the double-disk synergy test using two imipenem discs (10µg) (Hi-Media Laboratories Pvt. Ltd.), one containing 10μl of 0.1M anhydrous Ethylene Diamine Tetra-Acetic Acid (EDTA). The discs were placed 25mm apart on Mueller-Hinton agar plates.
2.10. Carba NP test for detection of carbapenemase
Carba NP test is a biochemical method used for the detection of carbapenemase activity in Enterobacteriaceae isolates. The assay used isolated bacterial colonies and is based on in vitro hydrolysis of a carbapenem, imipenem. It was 100% sensitive and specific compared with molecular-based techniques [Nordmann et al., 2012d].
2.11. Amplification of resistance genes by Polymerase chain reaction
For detection of the antibiotic-resistant gene, whole-cell DNA of strains was prepared by taking fresh colonies from a pure culture plate of CRKP isolates. Each colony was suspended in 100 µl of nuclease-free sterilized water and incubated at 95°C for 10 min followed by centrifugation at 8,000g at 4°C for 10 min. The supernatant was used as template to perform PCR (Applied Biosystems model-9902 Verity thermocycler) amplification was performed with a set of primers mentioned in table 2.1. Bacterial
whole-cell DNA was used to detect blaNDM and other resistant markers viz blaTEM,
blaOXA-48, blaOXA-1, blaOXA-9, blaVIM, blaSHV blaIMP, blaCMY, blaCTX-M-15, and blaKPC. PCR products were mixed with 5 µl of gel loading dye (0.25% bromophenol blue, 0.25% xylene cyanol, 30% glycerol) run on 1% agarose gels (Sigma, USA) was prepared in 1 X TAE (40mM Tris-acetate, 1mM EDTA) buffer. Ethidium Bromide Maulana(EtBr) was added Azad to a finalLibrary, concentration Aligarh of 0.5µg/ml Muslim and the images University were documented using a gel documentation system (Gel Doc).
39 Material and Methods
2.12. DNA sequencing
PCR generated fragments were purified from the gel using a Gene JET Gel Extraction Kit (Thermo Fisher Scientific) following the manufacturer’s protocol. The purified DNA fragments were sequenced at AgriGenom Labs Pvt. Ltd. (Kerala, India). To ascertain the NDM variant, the deduced protein sequence was aligned with NDM variants to confirm the amino acid substitution in the query sequence with respect to known variants using Clustal omega tool (http://www.ebi.a c.uk/Tools/msa/clustalo/). Furthermore, to identify the similarity between the amplified nucleotide sequence and the deduced protein sequences, online BLAST software (http://www.ncbi.nlm.nih.gov/BLAST/) was used and confirmed as NDM variant. These sequences have been submitted in the GeneBank nucleotide database.
2.13. Conjugation experiment
The transfer of resistant markers (blaNDM, blaCMY, blaOXA and blaSHV, blaVIM, blaCTXM-
15) was determined by conjugation, using an azide-resistant E. coli J53 strain as the recipient and isolates as donor [Walsh et al., 2011]. Transconjugants were screened on Luria-Bertani agar supplemented with ceftazidime (10 µg ml-1) (Sigma-Aldrich) and sodium azide (100 µg ml-1) (HiMedia Laboratories, India). The PCR amplification confirmed the transconjugants having resistant markers.
2.14. Molecular characterization of plasmid
Plasmid DNA extraction and molecular size of multiple plasmids were identified by Kieser method (Kieser et al., 1984). Plasmid incompatibility group was determined by a PCR-based replicon typing (PBRT) method. Plasmid DNA was amplified by five multiplex and three simplex PCRs using 18 pair of primers mentioned in table 2.1 [Carattoli et al., 2005] that are recognized as Inc replicon types: FIA, FIB, FIC, HI1, HI2, I1-Ic, L/M, N, P, W, T, A/C, K, B/O, X, Y, F and FIIA.
Maulana Azad Library, Aligarh Muslim University
40 Material and Methods
2.15. Genetic environment analysis
The ISAba125 element was first identified at upstream of blaNDM-1 in Acinetobacter
[Poirel et al., 2011]. Since this report mostly blaNDM has been found to be associated with ISAba125 element (either truncated or complete) among Enterobacteriaceae family e.g. Enterobacter cloacae [Liu et al., 2015], Escherichia coli [Nordmann et al., 2012e; Dortet et al., 2012], Klebsiella oxytoca, Klebsiella pneumoniae, and Citrobacter freundii [Qin et al., 2014] etc. Consequently, it was assumed that ISAba125 may act as a source of
mobilization of the blaNDM-1 producing Enterobacteriaceae. Furthermore, Poirel et al.,
have also identified bleomycin instantly downstream of the blaNDM-1. So, accordingly we
have also studied the genes present to downstream and upstream of blaNDM in the isolates (Figure 2.1) [Poirel et al., 2011].
Figure 2.1: A schematic representation for the PCR-based genetic environment analysis of blaNDM. Arrow shows the location of primer (Primer sequence is mentioned in table 2.1) 2.16. Integron analysis
The transconjugants of all the isolates, with blaNDM, were subjected to undergo integron analysis, using PCR amplification of 3`/5` conserved segment along with Int1 and Sul1 using a specific set of primers (Table2.1). Maulana2.17. Molecular Azad genotyping Library, of isolates Aligarh Muslim University The clonally relatedness between NDM producing isolates were investigated by enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) using the primers ERIC-Forward (5′ATGTAAGCTCCTGGGGATTAAC-3′) and ERIC-Reverse (5′AAGTAAGGACTGGGGTGAGCG-3′) [Versalovic et al., 1991].
41 Material and Methods
2.18. Generate dendrogram by using PyElph version 1.4 Software
Bio-Red Gel Doc system was used to scan gel image and analyzed the bands by PyElph version 1.4 Software to generate a dendrogram by the unweighted pair group method using arithmetic averages (UPGMA) clustering (PyElph) [Pavel et al., 2012].
PyElph is an open source Python depend on software for gel images analysis which can be used for various genetics or molecular biology studies. The software is able to assess genetic variations of the DNA molecules from different species or inhabitants. PyElph analyses gel image patterns of DNA genetic markers and make phylogenetic trees based on the information present in a gel image. So, the software can be successfully used for population genetics, taxonomic and phylogenetic studies. A most significant feature of PyElph is its interactive Graphical User Interface (GUI) which has a basic design that makes the program easy to use.
2.19. Multi-locus sequence typing (MLST)
MLST of the K. pneumoniae isolates was carried out to amplify seven conserved housekeeping genes gapA (glyceraldehyde 3-phosphate dehydrogenase), infB (translation initiation factor 2), mdh (malate dehydrogenase), pgi (phosphoglucose isomerase), phoE phosphorine E), rpoB (beta-subunit of RNA polymerase), and tonB (periplasmic energy transducer) and subjected to MLST. The PCR amplifications of the different MLST target genes were performed using relevant set of primers are listed in table 2.1. Amplification parameters included an initial denaturation at 95°C for 2 minute followed by 35 cycles of amplification comprising of denaturation (95°C for 1 minute), annealing (temperature of 50°C for all genes except for tonB (45°C) and gapA (60°C) and primer extension steps 72°C for 2 minute and a final extension of 5 minutes at 72°C. All the amplified PCR product were checked on 1.5% or 2% agarose gel with ethidium bromide staining and the amplicons were sequenced. The analysis of sequences obtained for each gene fragment was performed using MLST. The analysis of sequences obtained for each gene fragment was performed using MLST analysis website (https://bigsdb.pasteur.fr/klebsiella/klebsiella.html). For each Maulanafragment, Azad the sequences Library, obtained from Aligarh the clinical strainsMuslim were matched University and allele numbers were assigned to each unique sequence. Each isolate was defined by the combination of numbers corresponding to the alleles at the loci analyzed that is an allele profile or sequence type (ST). Sequences different even at a single nucleotide site were considered distinct alleles.
42 Material and Methods
Novel alleles and STs were submitted to the administrator of the database and assigned new sequence type. Minimum spanning tree was constructed using PHYLOViZ (https://online.phyloviz.net/index) online software.
PHYLOViZ is a platform-independent Java software that permits the combined analysis of sequence-based typing methods, including SNP data generated from sequence approaches, and linked epidemiological data. GoeBURST and its Minimum Spanning Tree expansion are used for visualizing the possible evolutionary associations between isolates.
Table 2.1: List of primers used in this study
Primer S. No. Sequence (5’-3’) References Name 1. NDM-Forward GGTTTGGCGATCTGGTTTTC Poirel et al., 2. NDM-Reverse CGGAATGGCTCATCACGATC 2011 3. Bleo-Reverse GGCGATGACAGCATCATCCG Do 4. ISAba125A TGTATATTTCTGTGACCCAC Do 5. ISAba125ext ACACCATTAGAGAAATTTGC Do 6. CMY-Forward ATAACCACCAGTCACGC DO 7. CMY-Reverse CAGTAGCGAGACTGCGCA 8. OXA-1-Forward TCAACTTTCAAGATCGCA DO 9. OXA-1-Reverse GTGTGTTTAGAATGGTGA 10. OXA-9-Forward TTCGTTTCCGCCACTCTCCC DO 11. OXA-9-Reverse ACGAGAATATCCTCTCGTGC OXA-48- 12. TTGGTGGCATCGATTATCGG Forward DO 13. OXA-48-Reverse GAGCACTTCTTTTGTGATGGC 14. SHV-Forward ATGCGTTATATTCGCCTGTGT DO 15. SHV-Reverse TTAGCGTTGCCAGTGCTCG 16. VIM- Forward GTTTGGTCGCATATCGCAAC DO 17. VIM- Reverse AATGCGCAGCACCAGGATAG Maulana18. TEM-Forward Azad GTATCCGCTCATGAGACAATA Library, Aligarh Muslim University DO 19. TEM- Reverse TCTAAAGTATATATGAGTAAACTTGGTCTG
20. CTX-M-Forward ATGTGCAGYACCAGTAARGT Pagani et al., 21. CTX-M-Reverse TGGGTRAARTARGTSACCAGA 2003 22. KPC-Forward CAGCTCATTCAAGGGCTTTC Ali et al., 2014
43 Material and Methods
23. KPC-Reverse AGTCATTTGCCGTGCCATAC 24. 5’CS GGCATCCAAGCAGCAAG M73819 25. 3’CS AAGCAGACTTGACCTGA 26. IntI-Forward CTACCTCTCACTAGTGAGGGGCGG U12338 27. IntI-Reverse GGGCAGCAGCGAAGTCGAGGC
28. SulI-Forward ATGGTGACGGTGTTCGGCAT Galimand et 29. SulI-Reverse CTAGGCATGATCTAACCCTC al., 2003
30. armA-Forward ATTTTAGATTTTGGTTGTGGC Galimand et 31. armA-Reverse ATCTCAGCTCTATCAATATCG al., 2003 16S rDNA- 32. CCTACGGGAGGCAGCAGTAG Forward This study 16S rDNA- 33. CAACAGAGCTTTACGATCCGAAA reverse 34. IncHI1- Forward GGAGCGATGGATTACTTCAGTAC Carattoli et al., 35. IncHI1- Reverse TGCCGTTTCACCTCGTGAGTA 2005 36. IncHI2- Forward TTTCTCCTGAGTCACCTGTTAACAC Do 37. IncHI2- Reverse GGCTCACTACCGTTGTCATCCT 38. IncI1- Forward CGAAAGCCGGACGGCAGAA Do 39. IncI1- Reverse TCGTCGTTCCGCCAAGTTCGT 40. IncX- Forward AACCTTAGAGGCTATTTAAGTTGCTGAT Do 41. IncX- Reverse TGAGAGTCAATTTTTATCTCATGTTTTAGC 42. IncL/M- Forward GGATGAAAACTATCAGCATCTGAAG Do 43. IncL/M- Reverse CTGCAGGGGCGATTCTTTAGG 44. IncN- Forward GTCTAACGAGCTTACCGAAG Do 45. IncN- Reverse GTTTCAACTCTGCCAAGTTC 46. IncFIA- Forward CCATGCTGGTTCTAGAGAAGGTG Do 47. IncFIA- Reverse GTATATCCTTACTGGCTTCCGCAG 48. IncFIB- Forward GGAGTTCTGACACACGATTTTCTG Do 49. IncFIB- Reverse CTCCCGTCGCTTCAGGGCATT 50. IncW- Forward CCTAAGAACAACAAAGCCCCCG Do Maulana51. IncWAzad- Reverse Library, GGTGCGCGGCATAGAACCGT Aligarh Muslim University 52. IncY- Forward AATTCAAACAACACTGTGCAGCCTG Do 53. IncY- Reverse GCGAGAATGGACGATTACAAAACTTT 54. IncP- Forward CTATGGCCCTGCAAACGCGCCAGAAA Do 55. IncP- Reverse TCACGCGCCAGGGCGCAGCC
44 Material and Methods
56. IncFIC- Forward GTGAACTGGCAGATGAGGAAGG Do 57. IncFIC- Reverse TTCTCCTCGTCGCCAAACTAGAT 58. IncA/C- Forward GAGAACCAAAGACAAAGACCTGGA Do 59. IncA/C- Reverse ACGACAAACCTGAATTGCCTCCTT 60. IncT- Forward TTGGCCTGTTTGTGCCTAAACCAT Do 61. IncF- Reverse CGTTGATTACACTTAGCTTTGGAC 62. IncFII- Forward CTGTCGTAAGCTGATGGC Do 63. IncFI1- Reverse CTCTGCCACAAACTTCAGC 64. IncF- Forward TGATCGTTTAAGGAATTTTG Do 65. IncF- Reverse GAAGATCAGTCACACCATCC 66. IncK- Forward GCGGTCCGGAAAGCCAGAAAAC Do 67. IncK- Reverse TCTTTCACGAGCCCGCCAAA 68. IncB/O- Forward GCGGTCCGGAAAGCCAGAAAAC Do 69. IncB/O- Reverse TCTGCGTTCCGCCAAGTTCGA
70. rpoB-Forward GGCGAAATGGCWGAGAACCA Diancourt et 71. rpoB-Reverse GAGTCTTCGAAGTTGTAACC al., 2005 72. gapA-Forward TGAAATATGACTCCACTCACGG Do 73. gapA- Reverse CTTCAGAAGCGGCTTTGATGGCTT 74. mdh- Forward CCCAACTCGCTTCAGGTTCAG Do 75. mdh-Reverse CCGTTTTTCCCCAGCAGCAG 76. pgi- Forward GAGAAAAACCTGCCTGTACTGCTGGC Do 77. pgi- Reverse CGCGCCACGCTTTATAGCGGTTAAT 78. phoE- Forward ACCTACCGCAACACCGACTTCTTCGG Do 79. phoE- Reverse TGATCAGAACTGGTAGGTGAT 80. infB-Forward CTCGCTGCTGGACTATATTCG Do 81. infB-Reverse CGCTTTCAGCTCAAGAACTTC 82. tonB- Forward CTTTATACCTCGGTACATCAGGTT Do 83. tonB- Reverse ATTCGCCGGCTGRGCRGAGAG Maulana Azad Library, Aligarh Muslim University
45
Chapter 3
Occurrence of blaNDM Variants among Enterobacteriaceae from A Neonatal Intensive Care Unit in a Northern India Hospital
Ahmad et. al., Frontiers in Microbiology 2018.
Maulana Azad Library, Aligarh Muslim University
Chapter 3
3.1. Introduction
The emergence of New-Delhi Metallo-β-lactamase (NDM) producers is a matter of concern. The spread of MBL-producing Enterobacteriaceae has increased from 2008 onward with the discovery of an ST14 Klebsiella pneumoniae with a new MBL gene,
blaNDM-1, from a 59-years old Swedish patient who received healthcare in New Delhi, India [Yong et al., 2009]. Indian subcontinent is the most endemic region for the spread of NDM-type MBLs. The prevalence rates of NDM-producing Enterobacteriaceae were found in the range of 5 to 18.5% in Indian and Pakistan hospitals [Bharadwaj, et al., 2012; Perry, et al., 2011]. In other regions (except the Balkan and Middle East countries), NDM-type MBLs are described mostly as periodic occurrences [Dortet et al., 2014]. Carbapenem-resistant microorganisms have become an alarming phenomenon in children [Logan, 2012]. A recently published study in the USA reported that the frequency of carbapenem resistance increased from 0 % in 1999–2000 to 0.47 % in 2010–2011 among Enterobacteriaceae isolates in children [Logan et al., 2015]. To date, 24 variants of NDM- type carbapenemases (NDM-1 to NDM-24) have been identified (http://www.lah ey.org/Studies/other.asp#table1). These variants were identified in expanded species of Gram-negative bacteria and were found to have variation either by multiple residues at different positions or by replacing single amino acid. Recently, an NDM-4, NDM-5 and NDM-7 producing Enterobacter aerogenes from NICU of Indian hospital were reported by our group [Ahmada et al., 2018]. The most widespread variants were found in Indian sub-continent, are NDM-1, NDM-4, NDM-5, NDM-6, and NDM-7 (Khan et al., 2017). Whereas, several types of carbapenemases, such as KPC, IMP, OXA-48, VIM and New Delhi metallo-β-lactamase (NDM), have been identified globally [Logan et al., 2017; Pitout et al., 2015].
NDM producing bacteria are resistant to almost all antibiotics, except polymyxins [Kumarasamy et al., 2010]. But, the hope of colistin and polymyxins as a treatment option has become limited after the discovery of MCR-1 gene in human and animals Maulana[Liu et al.,Azad 2016]. The Library, indiscriminate Aligarhnature of the gene Muslim encoding NDM University-1 has made major problem in neonatal intensive care units (NICU). In NICU, high consumption of antimicrobial agents, numerous indwelling devices, and staff rotativity, may further complicate the problem [Zaidi et al., 2005].
46 Chapter 3
In Enterobacteriaceae, blaNDM-1 is generally located on conjugative plasmids, ranging from 50 to 200 kb in size and belongs to several incompatibility groups, such as IncL/M, IncHI1, IncFIIs, IncF or untypable, enabling transfer and rapid dissemination of multidrug resistance [Poirel et al., 2011].
Our study was designed to evaluate retrospectively the spread of NDM producing Enterobacteriaceae and their genetic basis in the neonatal intensive care unit of one of the north Indian tertiary care hospital.
3.2. Experimental Outline
Clinical isolates were screened from rectal swab neonates admitted in Neonatal Intensive Care Unit (NICU) of Jawaharlal Nehru Medical College and Hospital (JNMCH), Aligarh Muslim University, Aligarh, India, during the period, December 2015 to January 2017. It is a tertiary care hospital of 1300 bed capacity, in which 90 beds were allotted for pediatric patients and 35 beds for the NICU. Patients enrolled in the study were those who enrolled in the active surveillance system (NICU stay 48 hours and weekly surveillance swabs were taken at least once). Neonates admitted to the ward before December 2015 and/or discharged after January 2017, were excluded. The identification of bacterial isolates was confirmed as outlined in section 2.7. Antimicrobial susceptibility testing was performed on Mueller–Hinton agar plates with commercially available antibiotic discs (Hi-Media, Mumbai, India) and (MICs) for antimicrobial agents were determined by the micro broth dilution method following CLSI guidelines as described in section 2.8. Metallo-β-lactamase (MBL) detection was performed as described in section 2.9. For the production of carbapenemase, Carba NP test was performed as mentioned in section 2.10. Detection of antibiotic resistance genes and the identification of variants was outline as described in section 2.11. Molecular characterization of plasmid was done as mentioned in section 2.14. Transfer of resistant marker determinants was checked by conjugation as described in section 2.13. Integrons analysis (section 2.16) was carried Maulanaout on transconjugants Azad of Library, all the isolates. AligarhERIC-PCR (section Muslim 2.17) and University genetic environment (section 2.15) of the blaNDM gene was also performed for the analysis of clonal relationship and genetic surrounding of the strains. PyElph version 1.4 Software was used to generate dendrogram by the unweighted pair group method using arithmetic averages (UPGMA) clustering (PyElph) as outlined in section 2.18.
47 Chapter 3
3.3. Results
3.3.1. Antimicrobial susceptibility, Metallo-β-lactamase (MBL) and MICs
Of 750 isolates, 44 were found to be New-Delhi Metallo-β-lactamase (NDM) producing Enterobacteriaceae strains. All NDM producing strains were found highly resistant antibiotics, including carbapenems (imipenem and meropenem), cephamycin (cefoxitin), extended-spectrum cephalosporins (ceftazidime and cefotaxime), aminoglycoside (gentamicin and amikacin), monobactam (aztreonam), tetracycline (minocycline and tigecycline), fluoroquinolone (ciprofloxacin), except polymyxin and colistin. MICs data revealed high values against all tested antibiotics which were found in the range of 128≥4096 µg ml-1 (Table 3.1). Metallo-β-lactamase (MBL) activity was present in all 44 NDM producing Enterobacteriaceae isolates (Table 3.2).
Table 3.1: Minimum Inhibitory Concentrations (MICs) values for NDM-producing Enterobacteriaceae isolated from NICU setting.
S. Isolate MIC (µg ml-1) No Id MRP IMP CTX CAZ CX CXM CIP FEP GEN ATM
1. AK-66 1024 >1024 2048 2048 2048 >1048 512 2048 1024 >1024
2. AK-67 1024 1024 >1024 2048 >2048 4096 >512 >2048 1024 1024
3. AK-69 1024 2048 4096 >2048 4096 >2048 1024 2048 >512 1024
4. AK-70 1024 >1024 4096 >2048 4096 2048 1024 4096 1024 >512
5. AK-71 >1024 2048 4096 4096 >2048 4096 512 2048 1024 1024
6. AK-72 512 1024 >1024 1024 2048 >1024 1024 4096 >512 1024
7. AK-74 1024 1024 2048 >1024 >2048 2048 1024 2048 >512 2048
8. AK-76 1024 >1024 2048 2048 >1024 2048 512 4096 1024 1024
9. AK-77 1024 1024 >1024 >1024 4096 >2048 1024 2048 1024 2048
10. AK-78 >1024 2048 4096 2048 >2048 4096 >512 2048 512 1024
11. AK-79 1024 1024 2048 >1024 >1024 2048 1024 4096 1024 2048 Maulana12. AK -Azad80 1024 Library,>1024 2048 >2048Aligarh 2048 4096Muslim 512 2048 University >512 1024 13. AK-81 1024 1024 >1024 2048 >2048 4096 1024 4096 512 2048
14. AK-82 >1024 2048 4096 >2048 4096 >2048 >512 2048 1024 >1024
15. AK-83 1024 1024 >1024 2048 4096 >2048 512 2048 >512 2048
16. AK-84 1024 2048 >2048 2048 >2048 4096 1024 >2048 512 >1024
48 Chapter 3
17. AK-85 1024 1024 2048 >1024 2048 >1024 512 2048 1024 2048
18. AK-86 512 1024 >1024 2048 2048 >2048 1024 2048 >512 2048
19. AK-87 1024 1024 2048 >2048 4096 2048 512 >2048 1024 >2048
20. AK-88 1024 >1024 2048 4096 >2048 2048 1024 2048 >512 2048
21. AK-89 512 >512 1024 1024 1024 >1024 512 1024 512 >1024
22. AK-90 512 1024 2048 >1024 2048 1024 512 1024 512 1024
23. AK-91 >512 1024 >1024 2048 >1024 2048 >512 2048 512 1024
24. AK-94 256 512 1024 >1024 2048 >1024 128 2048 >256 1024
25. AK-97 1024 1024 2048 >1024 2048 4096 >512 >1024 >512 >1024
26. AK-98 1024 >1024 2048 >1024 2048 4096 1024 2048 512 1024
27. AK-99 >512 1024 >1024 2048 2048 >1024 512 >1048 >512 1024
28. AK-100 1024 >1024 2048 >2048 4096 >1024 >512 2048 1024 1024
29. AK-101 512 1024 >1024 2048 >1024 2048 512 >1024 512 >512
30. AK-102 1024 >1024 2048 4096 >2048 4096 >512 2048 512 1024
31. AK-103 1024 1024 2048 >1024 2048 >2048 512 2048 >512 1024
32. AK-104 512 1024 >2048 2048 4096 4096 >512 >2048 512 1024
33. AK-105 256 512 1024 >1024 1024 2048 128 2048 >256 512
34. AK-106 1024 1024 >1024 2048 >1024 2048 512 2048 512 1024
35. AK-107 >1024 2048 >2048 4096 4096 >2048 1024 4096 >512 1024
36. AK-108 512 >512 1024 1024 2048 >1024 512 1024 >256 512
37. AK-109 1024 >1024 2048 >2048 4096 2048 512 >1024 >512 1024
38. AK-110 >1024 2048 4096 >2048 >2048 4096 1024 >2048 512 1024
39.. AK-111 1024 >1024 >2048 4096 2048 >2048 >512 4096 512 512
40. AK-112 1024 1024 >1024 2048 >1024 >2048 1024 >2048 >512 512
41. AK-113 1024 1024 2048 >1024 >2048 4096 >512 4096 512 1024
42. AK-114 1024 >1024 4096 2048 >2048 4096 >512 >2048 512 1024 Maulana43. AK-115 512Azad 1024 Library,2048 4096 >1024Aligarh 2048 1024 Muslim 4096 >512 University 1024 44. AK-116 512 >512 2048 1024 >2048 4096 >512 >2048 512 1024
MRM: meropenem, IPM: imipenem, CTX: cefotaxime, CAZ: ceftazidime, CX: cefoxitin CXM: cefuroxime, CIP: ciprofloxacin, FEP: cefepime, GEN: gentamicin, ATM: aztreonam.
49 Chapter 3
Table 3.2: Phenotypic and Genotypic Characterization of (NDM) producing Enterobacteriaceae isolates from NICU setting
Genetic Carba Metallo- No. of Organism Isolate Accession NDM Associated resistance environment of S.No NP β - plasmid/Molecular Plasmid type* Integron* name Id No. variant markers* blaNDM result lactamase size in kb* ISAba125 bleMBL 1. AK-69 KX231909 NDM-7 Positive Present OXA-1, CMY-1 38, 6, 4 FIA, FIC, F, K Class 1 Complete Present 2. AK-70 KX231910 NDM-5 Positive Present OXA-1 154, 38, 4 FIA, FIC, F, K Class 1 Truncated Present 3. AK-71 KX231911 NDM-5 Positive Present CMY-1 66, 38, 6, 4 FIA, FIB, F, K Class 1 Complete Present 4. AK-72 KX231912 NDM-5 Positive Present OXA-1 154, 66, 38, 6 FIA, FIC, F, K Class 1 Complete Present 5. AK-74 KX231914 NDM-5 Positive Present CMY-149 66, 38, 6 I, F, K Class 1 Complete Present 6. AK-76 KX231915 NDM-5 Positive Present OXA-1 154, 38 FIA, F, K Class 1 Complete Present FIA, FIB, I, B/O, 7. AK-77 KX231916 NDM-5 Positive Present OXA-1, CMY-149 66, 38, 6, 4 Class 1 Complete Present K
8. AK-79 KX231918 NDM-5 Positive Present OXA-1, CMY-1 38 FIA, FIB, F, K Class 1 Complete Present
9. AK-80 KX231919 NDM-5 Positive Present OXA-1 38, 2 FIA, FIB, F, K Class 1 Complete Present 10. AK-81 KX231920 NDM-5 Positive Present OXA-1, CMY-1 38, 6, 4 I, F, K Class 1 Truncated Present 11. AK-83 KX231922 NDM-7 Positive Present OXA-1, SHV-1 38, 25 FIA, FIB, F, K Class 1 Complete Present
12. AK-86 KX231925 NDM-5 Positive Present OXA-1, CMY-1 38, 6 FIA, F, K Class 1 Complete Present Escherichia Escherichia coli 13. AK-87 KX231926 NDM-5 Positive Present OXA-1 38, 6, 4 FIA, F, K Class 1 Complete Present 14. AK-88 KX231927 NDM-5 Positive Present OXA-1, OXA-9 154, 66 FIA, F, K Class 1 Complete Present 15. AK-90 KX231929 NDM-5 Positive Present OXA-1 38, 4 FIA, F, K ND Complete Present 16. AK-91 KX231930 NDM-5 Positive Present OXA-1 154, 66 FIA, F, I, K Class 1 Complete Present OXA-1, OXA-9, HI1, Y, FIA, FIB, 17. AK-105 KX999132 NDM-5 Positive Present 154, 66, 38 Class 1 Truncated Present CMY-1 F, K OXA-1, OXA-9, I, FIA, FIB, F, 18. AK-107 KX999134 NDM-4 Positive Present 66, 38 Class 1 Complete Present SHV-1 FIIA 19. AK-109 KX999136 NDM-5 Positive Present CMY-149 38, 6, 4 I, F, K Class 1 Complete Present 20. AK-116 KX999143 NDM-1 Positive Present SHV-2 154 FIA, FIC Class 1 Complete Present
Maulana Azad Library, Aligarh50 Muslim University Chapter 3
Genetic Carba Metallo- No. of Organism Isolate Accession NDM Associated resistance environment of S.No NP β - plasmid/Molecular Plasmid type* Integron* name Id No. variant markers* blaNDM result lactamase size in kb* ISAba125 bleMBL OXA-1, OXA-9, 21. AK-66 KX231906 NDM-1 Positive Present 38 FIIA, FIC. Class 1 Complete Present CMY-1 22. AK-78 KX231917 NDM-1 Positive Present OXA-1 148 FIIA Class 1 Truncated Present
23. AK-85 KX231924 NDM-1 Positive Present OXA-9, CMY-145 38, 6, 4 FIA, F, K Class 1 Complete Present
24. AK-89 KX231928 NDM-1 Positive Present OXA-1 38 FIIA Class 1 Complete Present
25. AK-94 KX999121 NDM-1 Positive Present CMY-145, SHV-1 154, 66, 38 Y, FIA, K, FIIA Class 1 Complete Present P, FIC, FIA, FIB, 26. AK-97 KX999124 NDM-4 Positive Present OXA-1, OXA-9 154, 66, 38, 6, 4 Class 1 Complete Present F, K OXA-1, OXA-9, 27. AK-98 KX999125 NDM-4 Positive Present 38, 6 K, FIIA Class 1 Truncated Present
CMY-1, SHV-1
OXA-1, OXA-9, 28. AK-99 KX999126 NDM-4 Positive Present 38, 6 K, FIIA Class 1 Truncated Present SHV-2 OXA-1, OXA-9, P, FIC, FIA, FIB, 29. AK-101 KX999128 NDM-4 Positive Present 154, 66, 38, 6, 4 Class 1 Complete Present CMY-145 F, K OXA-1, OXA-9, 30. AK-102 KX999129 NDM-5 Positive Present 154, 66, 38, FIIA Class 1 Complete Present CMY-4 31. AK-103 KX999130 NDM-4 Positive Present OXA-1, OXA-9 66 FIC, K ND Complete Present
Klebsiella pneumoniaeKlebsiella OXA-1, OXA-9, 32. AK-104 KX999131 NDM-4 Positive Present 38, 6, 4 P, FIC, K, FIIA Class 1 Complete Present CMY-4, SHV-1 OXA-1, OXA-9, 33. AK-106 KX999133 NDM-4 Positive Present 38, 6, 4 K Class 1 Complete Present SHV-2 OXA-1, OXA-9, 34. AK-110 KX999137 NDM-4 Positive Present 38, 6, 4 K, FIIA Class 1 Truncated Present CMY-145 35. AK-111 KX999138 NDM-4 Positive Present OXA-1, OXA-9 38, 6, 4 K, FIIA Class 1 Complete Present
36. AK-112 KX999139 NDM-1 Positive Present OXA-1 66, 38 K, FIIA Class 1 Truncated Present OXA-1, OXA-9, 37. AK-114 KX999141 NDM-4 Positive Present 66, 38 K, FIIA Class 1 Complete Present SHV-1 Y, FIA, FIB, F, 38. AK-115 KX999142 NDM-4 Positive Present OXA-1, OXA-9 38, 6 Class 1 Complete Present K, FIIA Maulana Azad Library, Aligarh51 Muslim University Chapter 3
Genetic Carba Metallo- No. of Organism Isolate Accession NDM Associated resistance environment of S.No NP β - plasmid/Molecular Plasmid type* Integron* name Id No. variant markers* blaNDM result lactamase size in kb* ISAba125 bleMBL OXA-9, SHV-1, 39. AK-82 KX231921 NDM-4 Positive Present 38 N, F, K Class 1 Complete Present Citrobacter CMY-149 freundii OXA-1, SHV-2, 40. AK-113 KX999140 NDM-1 Positive Present 66 FIC, K Class 1 Truncated Present CMY-149 Citrobacter 41. AK-84 KX231923 NDM-4 Positive Present OXA-1, CMY-145 38 F Class 1 Complete Present braakii Klebsiella I, Y, FIA, F, K, 42. AK-100 KX999127 NDM-4 Positive Present OXA-1, OXA-9 154, 66, 38 Class 1 Complete Present oxytoca FIIA Enterobacter OXA-1, OXA-9, 43. AK-108 KX999135 NDM-4 Positive Present 66,38 FIA, FIB Class 1 Truncated Present Cloacae CMY-149 Enterobacter 44. AK-67 KX231907 NDM-1 Positive Present OXA-1, SHV-2 154, 38, 6, 4 N, FIIA, FIC, K Class 1 Truncated Present aerogenes
*These features were also found on transconjugants.
Maulana Azad Library, Aligarh52 Muslim University Chapter 3
3.3.2. Isolate identification
Of 44 isolates, Escherichia coli (n=20; 45.5%), Klebsiella pneumoniae (n=18; 40.9%), Citrobacter freundii (n=2; 4.5%), Citrobacter braakii (n=1; 2.3%), Klebsiella oxytoca (n=1; 2.3%), Enterobacter cloacae (n=1; 2.3%), Enterobacter aerogenes (n=1; 2.2%), were identified (Table 3.2).
3.3.3. Carbapenemase production
All 44 NDM- producing Enterobacteriaceae isolates were found positive for Carba- NP test, indicating the production of a carbapenemase as shown in (Table 3.2.).
3.3.4. Detection of antibiotic resistance markers
PCR amplification and sequencing confirmed that all 44 isolates harbored blaNDM (Figure 3.2a 3.2b, 3.2c, 3.2d and 3.2e) of which NDM-1 (9; 20.45%), NDM-4 (16; 36.36%), NDM-5 (17; 38.64%) and NDM-7 (2; 4.55%) were found to be prevalent. Sequences
were submitted to the NCBI database (Table 3.2.). Further, blaCMY was detected in 20
isolates figure 3.3a and 3.3b (08; blaCMY-1, 02; blaCMY-4, 05; blaCMY-145 and 05; blaCMY-149)
figure 3.1 whereas, blaOXA-1 was detected in 37 isolates figure 3.1, and blaOXA-9 was found
in 20 isolates (Figure 3.1, 3.4a and 3.4b). Moreover, 07 blaSHV-1 and 05 blaSHV-2 were also
found in this study (Figure 3.1, Figure 3.5a and figure 3.5b). However, blaTEM, blaVIM,
and blaKPC were not detected in any of these isolates. Conjugation experiment further confirmed the presence of these resistance markers on plasmid in each isolate.
Maulana Azad Library, Aligarh Muslim University
Figure 3.1: Showing the numbers of co-associate resistant marker of blaNDM among Enterobacteriaceae family isolates.
53 Chapter 3
Figure 3.2(a): Detection of blaNDM by PCR Amplification. Lane M, 10kb DNA ladder, lane 1-10 NDM producing Enterobacteriaceae isolates (AK- 66, AK-67, AK-69, AK-70, AK-71, AK-74, AK-76, AK-77 and AK- 78) lane PC, positive control; lane NC, negative control.
Maulana Azad Library, Aligarh Muslim University Figure 3.2(b): Detection of blaNDM by PCR Amplification. Lane M, 10kb DNA ladder, lane 11-20 NDM producing Enterobacteriaceae isolates (AK- 79, AK-80, AK-81, AK-82, AK-83, AK-84, AK-85, AK-86, AK-87 and AK-88), lane PC, positive control; lane NC, negative control.
54 Chapter 3
Figure 3.2 (c): Detection of blaNDM by PCR Amplification. Lane M, 10kb DNA ladder, lane 21-30 NDM producing Enterorobacteriaceae isolates (AK-89, AK-90, AK-91, AK-94, AK-97, AK-98, AK-99, AK-100, AK-101 and AK-102), lane PC, positive control; lane NC, negative control.
Maulana Azad Library, Aligarh Muslim University Figure 3.2(d): Detection of blaNDM by PCR Amplification. Lane M, 10kb DNA ladder, lane 31-37 NDM producing Enterobacteriaceae isolates (AK- 103, AK-104, AK-105, AK-106, AK-107, AK-108 and AK-109), lane PC, positive control; lane NC, negative control.
55 Chapter 3
Figure 3.2(e): Detection of blaNDM by PCR Amplification. Lane M, 10kb DNA ladder, lane 38-44 NDM producing Enterobacteriaceae isolates (AK- 110, AK-111, AK-112, AK-113, AK-114, AK-115 and AK-116), lane PC, positive control; lane NC, negative control.
Maulana Azad Library, Aligarh Muslim University
56 Chapter 3
Figure 3.3(a): Detection of blaCMY in 12 Enterobacteriaceae isolates (AK-66, AK-69, AK-71, AK-74, AK-77, AK-79, AK-81, AK-82, AK-84, AK-85, AK- 86 and AK-94) by PCR amplification. Lane M: Mass Ruler DNA ladder.
Maulana Azad Library, Aligarh Muslim University Figure 3.3(b): Detection of blaCMY in 08 Enterobacteriaceae isolates (AK-98, AK- 101, AK-102, AK-104, AK-105, AK-108, AK-109 and AK-110) by PCR amplification. Lane M: Mass Ruler DNA ladder, Lane PC: positive control, Lane NC: negative control.
57 Chapter 3
Figure 3.4(a): Detection of blaOXA-9 in 11 Enterobacteriaceae isolates (AK-66, AK- 82, AK-85, AK-88, AK-97, AK-98, AK-99, AK-100, AK-101, AK-102 and AK-103) by PCR amplification. Lane M: Mass Ruler DNA ladder, Lane PC: positive control, Lane NC: negative control.
Maulana Azad Library, Aligarh Muslim University Figure 3.4(b): Detection of blaOXA-9 in 09 Enterobacteriaceae isolates (AK-104, AK- 105, AK-106, AK-107, AK-108, AK-110, AK-111, AK-114 and AK- 115) by PCR amplification. Lane M: Mass Ruler DNA ladder, Lane PC: positive control, Lane NC: negative control.
58 Chapter 3
Figure 3.5(a): Detection of blaSHV in 10 Enterobacteriaceae isolates (AK-67, AK- 82, AK-83, AK-94, AK-98, AK-99, AK-104, AK-106, AK-107 and AK-113) by PCR amplification. Lane M: Mass Ruler DNA ladder, Lane PC: positive control, Lane NC: negative control.
Maulana Azad Library, Aligarh Muslim University
Figure 3.5(b): Detection of blaSHV in 02 Enterobacteriaceae isolates (AK-114 and AK-116) by PCR amplification. Lane M: Mass Ruler DNA ladder, Lane PC: positive control, Lane NC: negative control.
59 Chapter 3
3.3.5. Conjugation
The plasmidic location of resistant markers was determined by conjugation, using an azide-resistant E. coli J53 strain as the recipient. Transconjugants were obtained at the frequencies of 10-3 to 10-5 cells, showing that plasmid from the donors (Escherichia coli, Klebsiella pneumoniae, Citrobacter freundii, Citrobacter braakii, Klebsiella oxytoca, Enterobacter cloacae, Enterobacter aerogenes), were found stable in E. coli J53.
3.3.6. Replicon typing
These studied NDM producing isolates contained detectable plasmid size (154kb, 66kb, 38kb, 6kb, and 4kb) as shown in table 3.2. Number of plasmids were found in the isolates, 1(n=09), 2(n=14), 3(n=15), 4(n=04), 5(n=02) (Table 3.2.). PBRT method identified 12 of 18 replicons types in our study while, IncHI2, IncL/M, IncW, IncT, IncA/C and IncX were not detected in this study. IncK (n=36; 81.8), IncF (n=25; 56.8), IncFIA (n=24; 54.5), IncFIIA (n=16; 36.4), IncFIC (n=11; 25.0), IncFIB (n=11; 25.0), IncI1 (n=07; 15.0) IncY (n=04; 9.1%), IncP (n=03; 6.8%), IncN (n=02; 4.5%), IncHI1 (n=01; 2.3%) and IncB/O (n=01; 2.3%) figure 3.6 replicon types were predominant in the present study and IncFIA, IncFIC, IncF, IncK and IncFIB were found to be the most frequent types in this study.
3.3.7. Integron analysis
The transconjugants of all isolates harbored plasmid carrying class 1 integron, except two isolates (AK-90 and AK-103) table 3.2 which were confirmed by PCR amplification of 5’/3’ CS, IntI and SulI genes. We further confirmed that no resistant marker was present in the integron cassette as shown by a PCR using amplicon of 5’/3’ CS as a template.
Maulana Azad Library, Aligarh Muslim University
60 Chapter 3
Figure 3.6: Percent prevalence of plasmids replicon types of 44 NDM producing Enterobacteriaceae isolates.
Maulana Azad Library, Aligarh Muslim University
61 Chapter 3
3.3.8. Genetic relatedness of the carbapenem-resistant NDM producing Enterobacteriaceae isolates
ERIC-PCR analysis revealed no clonal relatedness among isolates except for the isolates AK-86 with AK-87, AK-71 with AK-72 and AK-112 with AK-114 (Figure 3.7).
Figure 3.7: ERIC PCR analysis of NDM producing isolates. Bio-Red Gel Doc system was used to analyze the bands by PyElph version 1.4 Software generate a dendrogram by the unweighted pair group method using arithmetic averages (UPGMA) clustering. Generated dendrogram showing the genetic relationship among NDM producing isolates.
Maulana3.3.9. Genetic Azad environment Library, of the blaAligarhNDM gene Muslim University
PCR based genetic environment analysis of blaNDM gene was performed and bleMBL was
found at downstream of blaNDM variants in all isolates (Table 3.2). A complete ISAba125
sequence was found at upstream of blaNDM in one blaNDM-1 (AK-116), one blaNDM-4 (AK-
107), thirteen blaNDM-5 (AK-71, AK-72, AK-74, AK-76, AK-77, AK-79, AK-80, AK-86,
62 Chapter 3
AK-87, AK-88, AK-90, AK-91 and AK-109, ) and two NDM-7 producing Escherichia coli (AK-69 and AK-83) were found. Further, complete ISAba125 was amplified in 4 isolates of NDM-1(AK-66, AK-85, AK-89 and AK-94), eight isolates of NDM-4 (AK- 97, AK-101, AK-103 AK-104, AK-106, AK-111, AK-114 and AK-115) and one, (AK- 102) NDM-5 producing Klebsiella pneumoniae (Figure 3.8). A complete ISAba125 was amplified in three isolates of NDM-4 producing Citrobacter freundii, Citrobacter braakii and Klebsiella oxytoca respectively (AK-84, AK-82 and AK-100). However, truncated ISAba125 was detected in three isolates of NDM-5 producing Escherichia coli (AK-70, AK-81 and AK-105). Moreover, 2; NDM-1 (AK-78, AK-112), 3; NDM-4 (AK-98, AK-99 and AK-110), producing Klebsiella pneumoniae and one NDM-1 (AK- 113) producing Citrobacter freundii, one NDM-4 (AK-108) producing Enterobacter cloacae and one (AK-67) NDM-1 producing Enterobacter aerogenes had truncated
ISAba125 at upstream of blaNDM (Table 3.2, Figure 3.8).
Figure 3.8: A schematic representation of genetic elements surrounding blaNDM. (I) In AK-69, AK-71, AK-72, AK-74, AK-76, AK-77, AK-79, AK-80, AK-83, AK-86, AK-87, AK-88, AK-90, AK-91, AK-107, AK- Maulana Azad109, AKLibrary,-116, AK-66, Aligarh AK-85, AK-89, Muslim AK-94, AK-97, University AK-101, AK- 102, AK-103, AK-104, AK-106, AK-111, AK-114, AK-115, AK-84, AK-82 and AK-100, complete element of ISAba125 at upstream and bleomycin gene at downstream to blaNDM was found. (II) In AK-70, AK-81, AK-105, AK-78, AK-98, AK-99, AK-110, AK-112, AK-113, AK-108 and AK-67, truncated ISAba125 at upstream and bleomycin gene at downstream to blaNDM was found.
63 Chapter 3
3.4. Discussion
Emergence of NDM-producing Enterobacteriaceae has become a globally serious concern. NDM producers led to limited therapeutic options hence it has become a threat to public health. Epidemiological investigation and surveillance of NDMs are of importance to clinical infection control. This study revealed outbreak of multiple
variants of blaNDM (9; blaNDM-1, 16; blaNDM-4, 17; blaNDM-5, and 2; blaNDM-7) in clinically important bacteria (20 Escherichia coli, 18 Klebsiella pneumoniae, 02 Citrobacter freundii, 01 Citrobacter braakii, 01 Klebsiella oxytoca, 01 Enterobacter cloacae, 01 Enterobacter aerogenes), as shown in figure 3.9.
Figure 3.9: The clustered bar graph presents the number of NDM variants (each is represented by its own bar) distributed among NDM-producing Enterobacteriaceae collected from NICU. The horizontal axis represents the NDM-producing Enterobacteriaceae while the vertical axis represents the number of NDM variants.
MaulanaIn Escherichia Azad coli theLibrary, predominant NDMAligarh variant was Muslim found to be bla UniversityNDM-1, followed by blaNDM-4, blaNDM-5 and blaNDM-7 (Figure 3.9). Although this is not the first description of these NDM variants being produced by Escherichia coli [Zhang et al., 2013; Qin et al., 2016; Zhu et al., 2016; Pal et al., 2017]. Moreover, in these strains existence of NDM and its variants, with CMY, OXA and SHV variants figure 3.10
64 Chapter 3
and other resistant determinants are documented. Of 20 NDM producing Escherichia
coli, one NDM-1 isolate (AK-116) was coexisting with blaSHV-2 and one NDM-4
isolate (AK-107) coexisting with blaOXA-1, blaOXA-9 and blaSHV-1. Further, two isolates
of NDM-7 (AK-69, AK-83) were associated with blaOXA-1, blaSHV-1, blaCMY-1 and
sixteen isolates of blaNDM-5 were linked to blaOXA-1, blaOXA-9, blaSHV-1, blaCMY-1 or
blaCMY1-49 in different combinations (Table 3.2 and figure 3.10).
120.00% OXA-1
100% 100.00% OXA-9 93.70% 93.70% 82.40% CMY-1 80.00%
66.70% CMY-4 60.00%
50% 50% CMY-145
40.00% 33.30% 31.30% CMY-149 29.40%
22.20% 22.20% 18.80% SHV-1 20.00% 17.60% 17.60% 11.10% 11.10% 12.50% 12.50% 6.30% 5.90% 11.10% 6.30% SHV-2 0% 0% 0% 0% 0% 0% 0% 0% 0% 0.00% NDM-1 NDM-4 NDM-5 NDM-7
Figure 3.10: Percentage of OXA-1, OXA-9, CMY-1, CMY-4, CMY-145, SHV-1, SHV-2 with NDM-1, NDM-4, NDM-5 and NDM-7 respectively.
The most prevalent NDM variants in Klebsiella pneumoniae is blaNDM-4, followed by
blaNDM-5 and blaNDM-1 (Figure 3.9). It has also been shown in earlier studies in Klebsiella pneumonia [Khalifa et al., 2016; Petersen-Morfin et al., 2017]. Of 18 NDM
producing Klebsiella pneumoniae, 6 were NDM-1 isolates, coexisting with blaOXA-1,
blaOXA-9, blaSHV-1, blaCMY-1 and blaCMY-145. Further, 11 NDM-4 isolates were found
associated with blaOXA-1, blaOXA-9, blaSHV-1, blaSHV-2, blaCMY-1, blaCMY-149 and blaOXA-1,
blaOXA-9, blaCMY-4 in association with blaNDM-5 (Table 3.2 and figure 3.10).
MaulanaCitrobacter Azad species Library,are rare opportunistic Aligarh nosocomial Muslim pathogens (RyanUniversity and Roy 2004). It normally causes urinary tract infections, bloodstream infections, intra- abdominal sepsis, brain abscesses, pneumonia and other neonatal infection, [Pepperell et al., 2002] such as meningitis, neonatal sepsis, joint infection or general bacteremia
(Doran, 1999). The principal NDM variant found in Citrobacter freundii was blaNDM-1
65 Chapter 3
which was followed by blaNDM-4. It is the first report of NDM-4 producing Citrobacter
freundii, (AK-82) co-associated with blaOXA-9, blaSHV-1 and blaCMY-149. Further,
Citrobacter freundii (AK-113) was also found to have blaOXA-1 blaSHV-2 and blaCMY-149
in association with blaNDM-1 (Table 3.2).
Moreover, for the first time NDM-4 producing Citrobacter braakii (AK-84), Klebsiella oxytoca (AK-100) and Enterobacter cloacae (AK-108) were identified in
association with blaOXA-1 and blaCMY-145, blaOXA-1 and blaOXA-9 and, blaOXA-1, blaOXA-9
and blaCMY-149, respectively.
We have also identified NDM-1 producing Enterobacter aerogenes co-associated
with blaOXA-1 and blaSHV-2 in AK-67. NDM-1 producing Citrobacter braakii, in Pakistan (Pesesky et al., 2015), NDM-1 producing Klebsiella oxytoca in China [Wang et al., 2017], NDM-1 producing Enterobacter cloacae in Turkey [Haciseyitoglu et al., 2017] and Coratia [Petrosillo et al., 2016], have been reported in earlier studies.
The transconjugants were stable and carried all the resistant determinants from the donor. Moreover, the presence of class 1 integron in all isolates except AK-90 and AK-103, suggests that the resistant markers can competently exchange among species leading to its spread in the hospital [Martinez-Freijo et al., 1998]. Presence of resistance genes on plasmids of varying sizes (4 to 154 kb) was identified in this study. Previous studies have proved to have these resistance genes on a plasmid of size 7 to 200 kb [Mshana et al., 2009]. The replicon typing revealed varying replicon types (IncFIA, IncFIB, IncFIC, IncFIIA, IncF, IncN, IncK, IncB/O, IncHI1, IncY,
IncI1 and IncP). In previous studies, blaNDM gene was shown to be associated with plasmid type (IncFIA IncFIB) [Gamal et al., 2016], (IncX3) [Zhang et al., 2016], (IncFIC, IncF and IncK) [Ahmad et al., 2018a], (IncB/O) (An et al., 2016), (IncHI1, IncN and IncFIIA) [Sartor et al., 2014], (IncY, IncA/C IncI1) [Kapmaz et al., 2016]. Moreover, the first time we have identified three NDM-4 producing Klebsiella pnemoniae with incompatibility group IncP in AK-97, AK-101 and AK-104 strains.
MaulanaComplete Azad ISAba125 Library, sequence was observedAligarh at upstream Muslim of blaNDM Universityin most of the isolates implies that this factor may play a main role in horizontal gene transfer of the
blaNDM among Enterobacteriaceae members [Poirel et al., 2011]. In all blaNDM
variants, bleMBL was found at its downstream. The occurrence of bleMBL, associated
with the blaNDM gene, suggests that they might have mobilized simultaneously from
66 Chapter 3
the same progenitor and is thought to protect blaNDM [Dortet et al., 2012]. These results suggest that the plasmids encoding for carbapenem-resistant NDM variants can easily spread among the Enterobacteriaceae isolates. These results are in conformity with previous reports that clarified the horizontal transfer of plasmids encoding for carbapenemases among Enterobacteriaceae including Klebsiella pneumoniae [Dortet et al., 2014; Jin et al., 2015].
The main findings of this study are summarized as:
This study revealed outbreak of multiple variants of blaNDM (9; blaNDM-1, 16;
blaNDM-4, 17; blaNDM-5, and 2; blaNDM-7) in clinically important bacteria (20 E. coli, 18 K. pneumoniae, 02 C. freundii, 01 C. braakii, 01 K. oxytoca, 01 E. cloacae, 01 E. aerogenes.
AzR Transfer of blaNDM to E. coli J53 confirmed that the gene was carried on plasmids, not in chromosome.
First reported NDM-4 producing C. freundii, (AK-82) co-associated with
blaOXA-9, blaSHV-1 and blaCMY-149.
The replicon typing revealed varying replicon types (IncFIA, IncFIB, IncFIC, IncFIIA, IncF, IncN, IncK, IncB/O, IncHI1, IncY, IncI1 and IncP).
First time identified NDM-4 producing C. braakii, K. oxytoca and E. cloacae were
identified co-associated with blaOXA-1, blaOXA-9, blaCMY-145, and blaCMY-149.
We have first time identified three NDM-4 producing Klebsiella pnemoniae with incompatibility group IncP in AK-97, AK-101 and AK-104 strains.
Complete ISAba125 sequence was observed at upstream of blaNDM in most of the isolates.
3.5. Conclusion
Carbapenem-resistance among Enterobacteriaceae has been considered as one of the Maulanamost significant Azadmenaces to Library,global healthcare, Aligarh and the prevalence Muslim of NDM variants University in Enterobacteriaceae has further increased the threat. Therefore, the early detection of
the blaNDM possessing Enterobacteriaceae isolates with any decreased sensitivity to the carbapenems is crucial for the choice of the most appropriate antibiotic therapy and the application of efficient infection control measures. The emergence of such
67 Chapter 3
resistance patterns may be reduced by the restricted implementation of antibiotics, especially for carbapenems and cephalosporins. Moreover, a strong infection control management in the hospital is necessary to check such infection.
Maulana Azad Library, Aligarh Muslim University
68
Chapter 4 Isolation and Characterization of NDM Producing Bacterial (E. Aerogenes, C. Lepagi, and M. Wisconsensis) in the NICU of Indian Hospital
Ahmad et. al., Microbial Drug Resistance 2018. Ahmad et. al., International Journal of Antimicrobial Agents 2017. Ahmad et. al., Journal of Infection in Developing Countries 2019.
Maulana Azad Library, Aligarh Muslim University
Chapter 4
4.1. Objective: To detect NDM variants among Enterobacter aerogenes from NICU of Indian Hospital.
4.1.1. Introduction
Infections caused by CRE (Carbapenem-resistant Enterobacteriaceae) are one of the most serious health threats for humans and animals, worldwide [Tängdén et al., 2015]. Carbapenems are often considered as antibiotics of last resort for treatment of bacterial infections. The emergence of New Delhi Metallo β-lactamase (NDM) variants causes difficult to treat infections in clinical settings. NDM-1 was first identified in Klebsiella pneumoniae, isolated from a 59-years old man who returned to Sweden after hospitalization in India during January 2008 [Yong et al., 2009]. The NDM producing bacteria are resistant to almost all available antibiotics except polymyxins, [Kumarasamy et al., 2010; Moellering et al., 2010] however, after the discovery of MCR-1 in animals and humans, identified in China, the hope of polymyxins and colistin as treatment options to control these infections is now limited [Liu et., 2016]. A total of 24 known variants of NDM have been identified so far (http://www.lahey.org/Studies/other.asp#table1). These variants were identified in diversified species of Gram-negative bacteria and were found to have variation either by replacing single amino acid or multiple residues at different positions. In India, the most prevalent variants were found as, NDM-1, NDM-4, NDM-5, NDM-6, and NDM-7. The NDM-4 was first detected in Escherichia coli isolated from a urinary sample of a patient previously hospitalized in India. A single amino acid substitution at position 154 (Met→Leu) was found in NDM-4 compared to NDM-1 which may cause increased carbapenemase activity, [Nordmann et al., 2012d] Another variant, NDM-5 was first identified in a multidrug-resistant Escherichia coli isolated from a patient in the United Kingdom who had a history of hospitalization in India [Hornsey et al., 2011]. NDM-5 differs from NDM-1 by substitutions at positions 88 (Val→Leu) and 154 (Met→Leu). NDM-6 was identified in E. coli with single amino acid substitution at position 233 (Ala→Val) [Williamson et al., 2012]. NDM-7 was first identified in MaulanaEscherichia Azad coli having Library, two amino acid Aligarh substitutions at positionMuslim 130 (Asp→Asn) University and 154 (Met →Leu) [Göttig et al., 2013].
In view of the current spread of NDM producing bacterial strains, we have undertaken an initiative to identify and characterize these markers in NICU of one of the tertiary care hospitals of north India.
69 Chapter 4
4.1.2. Experimental outline
Clinical isolates were screened from rectal swab neonates admitted in neonatal intensive care unit (NICU) of Jawaharlal Nehru Medical College and Hospital (JNMCH), Aligarh Muslim University, Aligarh, India, during the period, November 2015 to October 2016. It is a tertiary care hospital of 1300 bed capacity, in which 90 beds were allotted for pediatric patients and 35 beds for the NICU. In this study we characterize three Enterobacter arogenes isolates (AK-93, AK94 and AK-95). The species level prediction of bacterial isolates was carried out by 16S rRNA sequencing as mentioned in section 2.7. Antimicrobial susceptibility testing was determined by the standard disc diffusion method and (MICs) for antimicrobial agents were performed by the micro broth dilution method following CLSI guidelines as described in section 2.8. Metallo-β-lactamase (MBL) detection was performed as described in section 2.9. Carba NP test was performed as mentioned in section 2.10. Detection of resistance genes and the identification of variants was performed as described in section 2.11. Plasmid location of resistance determinants was confirmed as mentioned in section 2.13. Replicon typing (section 2.14) and integrons analysis (section 2.16) were carried out on transconjugants of all three isolates. ERIC-PCR (section 2.17) and
genetic environment (section 2.15) of the blaNDM gene was also performed for the analysis of clonal relationship and genetic surrounding of the strains.
4.1.3. Results
4.1.3.1. Isolate identification, antimicrobial susceptibility test and MICs
In this study we identified three E. arogenes isolates (AK-93, AK94 and AK-95)
carrying blaNDM-4, blaNDM-5, and blaNDM-7 isolated from NICU setting (Table 4.1.1). These three isolates were found highly resistant to frequently used antibiotics in clinical settings vis-à-vis carbapenems (imipenem and meropenem), extended- spectrum cephalosporins (cefoxitin, ceftazidime, and cefotaxime), aminoglycoside (gentamicin and amikacin), monobactam (aztreonam), tetracycline (minocycline and Maulanatigecycline) fluoroquinolone, Azad Library, (ciprofloxacin), Aligarh polymyxin, Muslim colistin β-lactam/β University- lactamase inhibitor (cefoperazone/sulbactam) as shown in table 4.1.1. The minimum inhibitory concentrations (MICs) results were shown in table 4.1.2.
70 Chapter 4
Table 4.1.1: Phenotypes and genotypes characterization of NDM-4, NDM-5 and NDM-7 producing Enterobacter aerogenes and its transconjugants isolated NICU Patients
Plasmid Associated resistance markers type Isolate NDM Antibiotics name Id. Variants
IPM MEM CAZ CTX CX ATM GEN AMK MI TGC CIP CL PB CFS
OXA-1, OXA-9, SHV-1, FIA, FIB, I, F, K, A/C, AK-93 NDM-4 R R R R R R R R R R R S S R VIM-2 FII
AK-95 NDM-5 R R R R R R R R R R R S S R OXA-1, OXA-9, CMY-149 FIA, FIB, I, Y, F, K, FII
AK-96 NDM-7 R R R R R R R R R R R S S R OXA- 1, OXA-9, CMY-145 FIA, FIB, I, Y, F, K
OXA-1, OXA-9, SHV-1, FIA, FIB, I, F, K, A/C, AK-93(T) NDM-4 R R R R R R R R R R R S S R VIM-2 FII
AK- NDM-5 R R R R R R R R R R R S S R OXA-1, OXA-9, CMY-149 FIA, FIB, I, Y, F, K, FII 95(T)
AK- NDM-7 R R R R R R R R R R R S S R OXA- 1, OXA-9, CMY-145 FIA, FIB, I, Y, F, K 96(T)
Abbreviations: (T): Transconjugation, IPM: imipenem, MEM: meropenem, CAZ: ceftazidime, CTX: cefotaxime, CX: cefoxitin, ATM: aztreonam, GEN: gentamicin, AMK: amikacin, MI: minocycline, TGC: tegecycline, CIP: ciprofloxacin, CL: colistin, PB: polymyxin B, CFS: cefoparazone/sulbactam, *R: Resistant, S: Susceptible
Maulana Azad Library, Aligarh71 Muslim University Chapter 4
Table 4.1.2: Characterization of NDM-4, NDM-5 and NDM-7 producing Enterobacter aerogenes isolates NICU Patients
Genetic environment of blaNDM MIC (µg/ml) Gene Bank NDM Isolate Carba Metallo- β- accession Variants Integron Id NP Test lactamase No. type ISAba125 bleMBL
IPM MEM CX CFM CAZ CTX CFS CIP GEN ATM
AK-93 KX999120 Positive Present NDM-4 256 >256 1024 1024 >1024 1024 1024 >1024 >1024 512 Class-1 Complete Present
AK-95 KX999122 Positive Present NDM-5 256 512 >1024 1024 1024 1024 >512 >1024 >1024 >512 Class-1 Complete Present
AK-96 KX999123 Positive Present NDM-7 >256 512 >1024 >1024 1024 >1024 1024 >1024 >1024 512 Class-1 Complete Present
Abbreviations: IPM: imipenem, MEM: meropenem, CX: cefoxitin, CFM: cefexime, CAZ: ceftazidime, CTX: cefotaxime, CFS: cefoparazone/sulbactam, CIP: ciprofloxacin GEN: gentamicin, ATM: aztreonam.
Maulana Azad Library, Aligarh72 Muslim University Chapter 4
4.1.3.2 Metallo-β-lactamase (MBL) production
Three strains of Enterobacter aerogenes, namely AK-93, AK-95 and AK-96 were showing Metallo-β-lactamase (MBL) production (Table 4.1.2 and Figure 4.1.1). If the difference between zones of inhibition of IMP & IMP-EDTA is between 8-15mm, it confirms MBL production.
AK 93 AK 95
AK 96
Figure 4.1.1: Strains AK-93, AK-95 and AK-96 showing Metallo-β-lactamase Maulana Azad(MBL) Library, production. Aligarh Muslim University
73 Chapter 4
4.1.3.3. Carba NP test
Three strains of Enterobacter aerogenes, namely AK-93, AK-95 and AK-96 were showing positive for Carba NP test. A positive Carba NP test indicated the production of a carbapenemase (Table 4.1.2 and Figure 4.1.2).
Figure 4.1.2. Strains AK-93, AK-95 and AK-96 showing carbapenemase production, PC; positive control, NC; Negative control.
4.1.3.4 Identification and Genetic context of blaNDM-4, blaNDM-5 and blaNDM-7
PCR amplification and sequencing confirmed that AK-93, AK-95 and AK-96 were NDM-4, NDM-5 and NDM-7 producing strains of E. aerogenes, respectively (Figure 4.1.3). The accession numbers of these sequences submitted to the NCBI database are
given in table 4.1.2. The blaOXA-1, blaOXA-9, blaSHV-1, blaVIM-2 were also found to be co-
associated with blaNDM-4 in AK-93, blaOXA-1, blaOXA-9, blaCMY-149 were found co- Maulanaassociated Azad with bla NDMLibrary,-5 in AK-95 and Aligarh blaOXA-1, bla OXAMuslim-9 and blaCMY University-145 were found co-associated with blaNDM-7 in AK-96 (Table 4.1.2, Figure 4.1.3, Figure 4.1.4, Figure 4.1.5, Figure 4.1.6 and Figure 4.1.7). Conjugation experiment further confirmed the presence of these resistant markers on the plasmid in each isolate. All three isolates were found to carry class 1 integron on the plasmid.
74 Chapter 4
4.1.3.5 Genetic environment analysis
PCR based genetic environment analysis of blaNDM variants was performed and found
bleMBL to downstream of all three blaNDM variants in this study. The complete
ISAba125 sequence was present at upstream to blaNDM variants (Table 4.1.2).
4.1.3.6 Molecular typing
NDM variants blaNDM-4, blaNDM-5 and blaNDM-7 producing, three E. aerogenes strains isolated from NICU were found clonally non-related (Figure 4.8).
4.1.3.7 Replicon typing
AK-93 were carrying plasmid of incompatibility FIA, FIB, I, F, K, A/C and FII types, while, AK-95 were found to have a plasmid of incompatibility, FIA, FIB, I, Y, F, K, and FII types. Incompatibility FIA, FIB, I, Y, F and K types of plasmids were observed in AK-96. All three isolates were carrying different types of incompatibility plasmids (Table 4.1.1).
Maulana Azad Library, Aligarh Muslim University Figure 4.1.3: PCR Amplification of blaNDM and its transconjugates. Lane M, DNA ladder, lane (AK-93, AK-95, AK-96, AK-93(T), AK-95(T), AK-96(T) NDM producing Enterobacter aerogens isolates lane PC, positive control; lane NC, negative control.
75 Chapter 4
Figure 4.1.4: PCR Amplification of blaOXA-9 and its transconjugates. Lane M, DNA ladder, lane (AK-93, AK-95, AK-96, AK-93(T), AK-95(T), AK-96(T) OXA-9 producing Enterobacter aerogens isolates lane PC, positive control; lane NC, negative control.
Maulana Azad Library, Aligarh Muslim University
Figure 4.1.5: PCR Amplification of blaOXA-1 and its transconjugates. Lane M, DNA ladder, lane (AK-93, AK-95, AK-96, AK-93(T), AK-95(T), AK-96(T) OXA-1 producing Enterobacter aerogens isolates lane PC, positive control; lane NC, negative control.
76 Chapter 4
Figure 4.1.6: PCR Amplification of blaSHV and its transconjugates. Lane M, DNA ladder, lane (AK-93 and AK-93(T) SHV producing Enterobacter aerogens isolates lane PC, positive control; lane NC, negative control.
Maulana Azad Library, Aligarh Muslim University
Figure 4.1.7: PCR Amplification of blaVIM and it transconjugate. Lane M, DNA ladder, lane (AK-93, and AK-93(T) VIM producing Enterobacter aerogens isolates lane PC, positive control; lane NC, negative control.
77 Chapter 4
Figure 4.1.8: ERIC-PCR Amplification. Lane M, DNA ladder, lane (AK-93, AK-95 and AK-96), Enterobacter aerogens isolates.
Maulana Azad Library, Aligarh Muslim University
78 Chapter 4
4.1.4. Discussion
Enterobacter is a genus of the family Enterobacteriaceae, consisting of common Gram-negative, facultative anaerobic, rod-shaped and non-spore-forming bacteria. Enterobacter aerogenes is recognized as an important bacterial pathogen in hospital- acquired infections [Jarvis et al., 1992]. It has already been reported earlier to carry
blaNDM-1 along with other resistant markers [Shen et al., 2016; Tran et al., 2015; Khajuria et al., 2014]. But it is the first time our study revealed the prevalence of these
variants in E. aerogenes. It further showed that AK-93 was found to have blaNDM-4,
associated with blaOXA-1, blaOXA-9, blaSHV-1, blaVIM-2, AK-95 was found to have blaNDM-
5 associated with blaOXA-1, blaOXA-9, blaCMY-149 and AK-96 was found to have blaNDM-7,
associated with blaOXA-1, blaOXA-9 and blaCMY-145 (Table 4.1.1).
Multiple plasmids of varying incompatibility were found in each of the strain of Enterobacter aerogenes in this study as reported in table 4.1.1. It has been reported earlier that E. coli strains were found to harbor different plasmid types (IncK, IncF, IncX3) [Nordmann et al., 2012e; Khan et al., 2014; Qin et al., 2016] (IncFIA, IncFIB, INcX3, IncN, IncFII) [Nakano et al., 2014; Pitart et al., 2015; Gamal et al., 2016; Li et
al., 2016] and (IncX3) [Wang et al., 2016a], carrying blaNDM-4, blaNDM-5 and blaNDM-7,
respectively. Acquisition of complete ISAba125 sequence at upstream of blaNDM in most of the isolates implies that this element may be playing an important role in the
transfer of the blaNDM among Enterobacteriaceae isolates [Poirel et al., 2011]. All
three isolates were found to have bleomycin gene (bleMBL), downstream to the blaNDM.
The association of bleMBL and blaNDM genes suggest that they might have mobilized
together to form a common progenitor to protect blaNDM [Dortet et al., 2012]. The presence of ISAba125 in these isolates are in accordance with earlier reports [Ahmad et al., 2017; Khan et al., 2014]. Hence, it depicts that no change was found in the
genetic environment of blaNDM in all three clinical strains under investigation.
4.1.5. Nucleotide sequence Accession numbers
MaulanaThe nucleotide Azad sequences Library, of the three Aligarh NDM variants Muslim containing E. aerogenesUniversity have been submitted in the GenBank database and Accession No. are KX999120,
KX999122, and KX999123 for blaNDM-4, blaNDM-5 and blaNDM-7, respectively.
79 Chapter 4
The main findings of this study are summarized as:
This is the first report of blaNDM-4, blaNDM-5 and blaNDM-7 in E. arogenes species, isolated from the NICU of tertiary care hospital in India.
NDM-4 producing E. aerogenes associated with blaOXA 1, blaOXA-9, blaSHV-1
and blaVIM-2, in AK-93 strain.
NDM-5 producing E. aerogenes associated with blaOXA-1, blaOXA-9, and
blaCMY-149 in AK-95 strain.
NDM-7 producing E. aerogenes co-associated with blaOXA-1, blaOXA-9 and
blaCMY-145 in AK-96 strain.
4.1.6. Conclusion
The study is clinically significant for physicians to understand the spread of resistant
markers and infections in hospital settings. We have first time identified blaNDM-4, blaNDM-
5 and blaNDM-7 producing three E. aerogenes strains isolated from NICU. Hence, it is utmost important to think sensibly about infection control in hospital settings.
Maulana Azad Library, Aligarh Muslim University
80 Chapter 4
4.2. Objective: To characterize NDM-1 among rare species of Enterobacteriaceae family
4.2.1. Introduction
Cedecea lapagei is a gram-negative, facultative anaerobic, non-spore-forming bacteria, belongs to the family Enterobacteriaceae, first isolated by Centers for Disease Control (CDC) Laboratories in 1981. It has been reported as a pathogen in few cases of bacterial peritonitis, wound infection, chemicals burns and pneumonia [Salazar et al., 2013]. NDM-1(New Delhi Metallo-lactamase) was first reported in 2009 in Klebsiella pneumoniae and Escherichia coli isolated from a patient traveling from Sweden who had received medical care in New Delhi, India [Yong et al., 2009].
4.2.2. Case Presentation
Here, we have reported the presence of a clinically significant NDM-1 producing C. lepagei in a 26 days old female baby, admitted in pediatrics ICU of 1300 bedded tertiary care hospital in Aligarh, India. She was diagnosed preterm, late-onset sepsis, apnea and hypocalcemia and was treated with Cefotaxim and epsolin with no recovery as observed after the first week. Amikacin was also added in treatment along with cefotaxime for another one week. Baby started recovering after 14 days. A blood sample was characterized, NDM-1 producing Cedecea lapagei was detected, as a first report to the best of our knowledge.
The identity of isolated strain (AK68) was confirmed by BD Phonix 100 Automated Microbiology System using panel NMIC/ID-55 (Gram-negative susceptibility card) followed by 16s rDNA sequencing. Further, the antimicrobial susceptibility was determined by the standard disc diffusion method using Mueller Hinton agar as per the Clinical and Laboratory Standards Institute guidelines. The strain was found to be resistant to imipenem, meropenem, aztreonam, ceftazidime, cefotaxime, cefoxitin, Cefepime, Cefoperazone/sulbactam. Moreover, detection of Metallo-β-lactamase Maulanaactivity wasAzad performed Library, by using two imAligarhipenem disc (10Muslim mg), one containing University 10 µl of 0.1M anhydrous EDTA. The discs were placed 25mm apart on Mueller-Hinton plates [Khan et al., 2014]. MIC was performed following CLSI guidelines and results are shown in table 4.2.1. MIC data showed high resistance against β-lactams.
81 Chapter 4
Table 4.2.1: MICs and genetic profile of NDM-1 producing Cedecea lepagei
Genetic Organism Strain Accession environment of name Name No. MIC (µg ml-1) blaNDM-1
Upstream Downstream IMP MEM ATM CAZ CTX FOX CPM SCP of blaNDM of blaNDM
Cedecea
lepagei AK- ISAba125 ble KX231908 512 >256 >1024 >1024 >1024 >1024 128 64 MBL 68 complete absent
IPM, imipenem; MEM, meropenem; ATM, aztreonam; CAZ, ceftazidime; CTX, cefotaxime; FOX, cefoxitin; CPM, Cefepime; SCP, Cefoperazone/sulbactum
PCR amplification of whole DNA from AK68 strain using primers as mentioned in table 4.2.1. The amplified product after purification was then sent for sequencing (SciGenom Labs Pvt. Ltd. kakanad, Cochin Kerala 682037, India). The obtained sequence was
identified as the blaNDM-1 by sequence analysis using BLAST (www.ncbi.nlm.nih.gov).
Other markers (blaVIM, blaOXA-1, blaOXA-9, blaCMY, blaSHV, blaCTX-M, blaTEM, blaIMP, blaKPC,)
were also checked for the presence in association with blaNDM-1. But, only blaSHV, was
found in coexistence with blaNDM-1 (Figure 4.2.1 and Figure 4.2.2).
Maulana Azad Library, Aligarh Muslim University
Figure 4.2.1: PCR Amplification of blaNDM-1 and its transconjugant Lane M, DNA ladder, lane (AK-68, and AK-68(T) NDM-1 producing Cedecea lapagei isolates, lane PC, positive control; lane NC, negative control.
82 Chapter 4
Figure 4.2.2: PCR Amplification of blaSHV-1 and its transconjugant. Lane M, DNA ladder, lane (AK-68, and AK-68(T) SHV-1 producing Cedecea lapagei isolates, lane PC, positive control; lane NC, negative control.
The genetic environment was analyzed for the presence of insertion sequence (IS)
known to be associated with the blaNDM-1 in Enterobacteriaceae [Poirel et al., 2011]. Primers targeting the IS element Aba125 identified a complete ISAba125 upstream of
the blaNDM-1 in the AK68 strain. A bleomycin resistance gene bleMBL, was not
identified downstream to the blaNDM-1 which is unusual feature compared to earlier
known species carrying blaNDM-1 [Khan et al., 2014] and needs to be further characterized. Plasmid incompatibility group was determined by a PCR-based replicon typing (PBRT) method. The strain was untypeable. The conjugal transfer was performed using C. lepagei AK68 as donor and azide resistant Escherichia coli J53 Maulanastrain as Azadthe recipient Library, on selection media Aligarh with cefoxitin Muslim (10µg ml-1) and University sodium azide -1 (100 µg ml ). Conjugation confirmed the presence of blaNDM-1 on the plasmid.
83 Chapter 4
4.2.3. Nucleotide sequence accession number
The sequence of blaNDM-1 determined in this strain was submitted in Gene Bank with accession no. KX231908.
4.2.4. Conclusion
This was the first case of NDM-1 producing Cedecea lapagei strain isolated from a neonate admitted in Pediatrics ICU of one of the north Indian Hospitals. Hence it is an urgent need to follow a proper surveillance study to control further spread of NDM-1 in evolving new species.
Maulana Azad Library, Aligarh Muslim University
84 Chapter 4
4.3. Objective: To characterize carbapenem-resistant genes in the north Indian
pediatrics patients to know if blaNDM-1 and blaVIM-1 are disseminating through any rare species.
4.3.1. Introduction
Moellerella wisconsensis, a rare fermentative Gram-negative bacillus family of Enterobacteriaceae, was recognized as a new species in 1980 and belongs to enteric group 46 by the Centres for Disease [Hickman-Brenner et.al, 1984]. We are passing through a phase which will end up to pre-antibiotic era due to a resistance developed against all classes of antibiotics in bacterial strains, in both, community and hospital settings. The resulting outbreaks in NDM-1-producing Enterobacteriaceae may lead newborn population of Indian subcontinent at risk [Stoesser et al., 2014; Datta et.al 2014]. Moreover, the discovery of VIM-1 (Verona integron-encoded MBL-1) in Pseudomonas aeruginosa from Italy in 1996 [Lauretti et al., 1999] leads to the emergence of cases involving acquired VIM carbapenemases in both adults and children throughout South America, Europe and Asia [Cornaglia et al., 2011]. The epidemiology of CRE within the neonatal population warrants separate consideration as they are among the mainly vulnerable pediatric patients. A previous report from India marked the levels of carbapenem-resistance up to 13% for K. Pneumonia and 33% for E. coli while 14% were reported as NDM-1 producing Enterobacteriaceae in NICU settings [Datta et al., 2014]. Further, a large number of NDM-1 producing Enterobacteriaceae were detected in the NICU setting of Nepal with 64% mortality rate [Stoesser et al., 2014]. The only tested antibiotic in the susceptibility range was colistin, whose action is now hampered by the emergence of MCR-1 marker [Liu et al., 2016]. It has become a great challenge for physicians to control such infections caused by these strains. The emergence of NDM-1 and its variants has become common in nosocomial as well as community-acquired infections, leading to difficulty in infection control [Wang et al., 2016b].
MaulanaThe focus Azad of this study Library, was to characterize Aligarh carbapenem Muslim-resistant genes University in the north Indian pediatrics patients. Therefore, we have screened carbapenem-resistance
bacterial strain in NICU from one of the north Indian Hospitals to know if blaNDM-1
and blaVIM-1 are disseminating through any rare species.
85 Chapter 4
4.3.2. Case Presentation
Herein, we reported co-existence of blaNDM-1 and blaVIM-1 among M. wisconsensis in a 14-days-old, low birth weight (1.395 kg) female child who was admitted to the neonatal intensive care unit (NICU) of tertiary care hospital in Aligarh town of India. The patient was diagnosed to have diarrhoea and was treated with cefotaxime (50 mg/kg body weight) with no recovery after a week. Amikacin (15 mg/kg body weight) was also added with cefotaxime for one more week. The baby was not recovered even after 10 days. A rectal swab was collected after 10 days stay in NICU and the culture was found positive for NDM-1 and VIM-1 producing M. wisconsensis as a first report.
Species identification of the isolated strain (AK-92) was performed through BD PhoenixTM-100 Automated Microbiology System using panel NMIC/ID-55 (Gram- negative susceptibility card) and further confirmed by 16S rRNA sequencing using primers as described perversely [Shemesh et al., 2007]. A carbapenemase activity was detected by Carba NP test as described earlier [Nordmann et al., 2007]. Antimicrobial susceptibility testing was performed on Mueller-Hinton agar plates by the disk diffusion method according to the (CLSI) guidelines [CLSI 2014]. The strain was found to be resistant to carbapenems (imipenem, meropenem and doripenem), extended-spectrum cephalosporins (ceftazidime, cefoxitin and cefotaxime), aminoglycoside (amikacin), monobactam (aztreonam), polymyxin-B and colistin. Moreover, the minimum inhibitory concentrations were also determined against this strain and its transconjugantas shown in table 4.3.1. Detection of Metallo-β-lactamase activity was performed by using two imipenem discs (10 µg), one containing 10 µl of 0.1M anhydrous Ethylene Diamine Tetra-Acetic Acid (EDTA) [Ahmad et al., 2017].
Maulana Azad Library, Aligarh Muslim University
86 Chapter 4
Table 4.3.1: Phenotype and genotype characterization of NDM-1 and VIM-1 producing Moellerella wisconsensis isolated from NICU and its transconjugant
Metallo- Carbapene Isolate Organism Carba NP Plasmi Plasmid Genetic environment β- m Resistant MIC (µg ml-1) Id name Test d size Inc of bla lactamase Gene NDM
ISAba IMP MEM CX CFS CIP GEN ATM CL PB ble 125 MBL
M. bla , 154 kb, AK-92 Present Positive NDM-1 >256 256 1024 512 1024 512 256 128 128 IncW Present Present wiscosensis blaVIM-1 66kb
Escherichia bla AK-92. T present positive NDM-1, 256 128 1024 256 256 512 128 128 128 154kb IncW Present Present coli J53 blaVIM-1
T: transconjugates IPM: imipenem, MEM: meropenem, CX: cefoxitin CFS: cefoparazone/sulbactam, CIP: ciprofloxacin, GEN: gentamicin, ATM: aztreonam, CL: colistin, PB: polymyxin-B.
Maulana Azad Library, Aligarh87 Muslim University Chapter 4
PCR amplification of DNA from strain AK-92 and its transconjugant, using primers
as mentioned in (Table 2.1.), revealed the presence of (blaNDM-1, blaOXA-1, blaOXA-9,
blaTEM, blaSHV, blaVIM and blaCTX-M). In this strain, only blaNDM and blaVIM were amplified (Figure 4.3.1. and Figure 4.3.2.). The amplified product was sent for sequencing (AgriGenom Labs Pvt. Ltd., Kerala, India) and nucleotide sequences were analyzed with software available at the National Centre for Biotechnology
Information website (www.ncbi.nlm.nih.gov). The blaVIM-1 was found to be associated
with blaNDM-1.
Figure 4.3.1: Amplification of blaNDM-1 and its transconjugants, Lane M, DNA ladder, lane AK-92, and AK-92(T) NDM-1 producing Moellerella wisconsensis isolates, lane PC, positive control; lane NC, negative control.
Maulana Azad Library, Aligarh Muslim University
88 Chapter 4
Figure 4.3.2: Amplification of blaVIM-1 and its transconjugants, Lane M, DNA ladder, lane AK-92, and AK-92(T) VIM-1 producing Moellerella wisconsensis isolates, lane PC, positive control; lane NC, negative control.
Conjugation assay was performed using M. wisconsensis AK-92 as a donor and azide- resistant E. coli J53 strain as a recipient of the selection medium with ceftazidime
(10μg/mL) and sodium azide (100μg/mL). Conjugation confirmed blaNDM-1 and blaVIM-1 located on the plasmid. Isolation and characterization of plasmid revealed that the NDM-1 and VIM-1 producing M. wisconsensis strain harboured two plasmids of different molecular size (66 and 154 kb). Of two, 154 kb plasmids were found in transconjugant after conjugation table 4.3.1. The plasmid incompatibility group was determined by PCR based replicon typing (PBRT) method [Carattoli et al., 2005], which revealed the presence
of IncW type plasmid, carrying blaNDM-1, and blaVIM-1 (Table 4.3.1.). The genetic environment of this strain (AK-92) was evaluated for the presence of an insertion sequence
(IS), linked with the blaNDM-1 in Enterobacteriaceae. The analysis was performed with four sets of PCR amplification reactions: Reaction 1: NDM forward and NDM reverse; MaulanaReaction Azad2: NDM forward Library, and bleomycin Aligarh reverse; Reaction Muslim 3: ISAba125 Universityext and NDM reverse; Reaction 4: ISAba125A and NDM reverse; Primers: NDM forward: 5′- GGTTTGGCGATCTGGTTTTC-3′; NDM reverse: 5′-CGGAATGGCTCATCAGATC- 3′; bleomycin reverse:5′-GGCGATGACAGCATCATCCG-3′; ISAba125A: 5′- TGTATATTTCTGTGACCCAC-3′; ISAba125ext: 5′-ACACCATTAGAGAAA TTTGC-3′.
89 Chapter 4
4.3.3. Discussion
The emergence of NDM-1-producing Enterobacteriaceae has disseminated worldwide from the Indian subcontinent brought about problems regarding treatment and control.
Our group previous study showed that blaNDM gene had disseminated in the NICU via different Gram-Negative Bacilli (E. coli, Citrobacter freundii, Citrobacter braakii,
Klebsiella oxytoca, Enterobacter cloacae, Enterobacter aerogenes) harboring blaNDM
[Ahmad et al., 2018b]. An earlier study reported that the blaNDM is carried by various types of plasmids incompatibility such as IncA/C, IncF, IncN, IncL/M or untypable/IncR, and is rarely found to be chromosomally integrated [Poirel et al.,
2011]. Non-clonal Indian isolates from Chennai harbor blaNDM-1, exclusively on plasmids ranging from 50 to 350 kb, whereas strain of K. pneumonia isolated in Haryana was found to have a plasmid size of either 118 kb or 50 kb, suggesting the
wide spread of blaNDM-1. Plasmid profiling showed that a plasmid of size 50 kb carries
blaNDM-1 in Enterobacteriaceae, which were found resistant to almost all antimicrobials except tigecycline and colistin [Kumarasamy et al., 2010]. Here, we report that the NDM-1 and VIM-1 producing M. wisconsensis strain harboured two plasmids of different molecular size (66 and 154 kb). Of two, 154 kb plasmids were
found in transconjugant after conjugation and the plasmid harbouring the blaNDM-1 and
blaVIM-1 belonged to the IncW type table 4.3.1., which was different from previously replicon type reported in India.
Recent studies from Greek demonstrated the co-production of NDM-1 and VIM-1 in a K. pneumoniae [Papagiannitsis et al., 2017]. While in our study, we found co-
expression of blaNDM-1 with blaVIM-1 producing M. wisconsensis from neonate admitted in NICU of the north Indian hospital.
In genetic environment analysis, we found complete ISAba125 upstream and bleMBL
downstream of blaNDM-1 in strain AK-92. The bleomycin resistance gene bleMBL
downstream of blaNDM, encodes a putative bleomycin (an antitumor drug resistance Maulanaprotein) asAzad reported previouslyLibrary, [Poirel Aligarh et al., 2011]. In Muslim earlier studies ofUniversity our group on genetic analysis, a truncated ISAba125 with bleMBL in Cedecea lapagei was observed
[Ahmad et al., 2017] whereas, another study showed complete ISAba125 with bleMBL in three different strains of Enterobacter aerogenes [Ahmad et al., 2018a].
90 Chapter 4
4.3.4. Nucleotide sequence accession number
The sequence of blaNDM-1 determined in this study has been assigned Gene Bank accession no.KX999119.
4.3.5. Conclusion
The study revealed detection of NDM-1 and VIM-1 in Moellerella wisconsensis in NICU, as a first report. It is alarming to the health care workers and hospital personals to control infections. Hence, it has become important to look into the matter more sensibly in order to control its spread in the community as well as hospital settings, especially in NICU. Moreover, hospitals should work on infection control measurements.
Maulana Azad Library, Aligarh Muslim University
91
Chapter 5 Molecular Characterization of Novel Sequence type of Carbapenem-resistant NDM-1 Producing Klebsiella Pneumoniae in NICU of Indian Hospital
Ahmad et. al., International Journal of Antimicrobial Agents 2019.
Maulana Azad Library, Aligarh Muslim University
Chapter 5
5.1. Introduction
Klebsiella pneumoniae is one of the most common causative organisms of neonatal infections in hospitalized immunocompromised patients admitted to neonatal intensive-care units (NICU), where it may cause outbreaks of infections resulting in adverse outcomes, including death, in affected infants as well as higher healthcare costs [Stone et al., 2003]. Moreover, K. pneumoniae is the most commonly implicated pathogen responsible for neonatal sepsis. Recently, multidrug-resistant (MDR) K. pneumoniae outbreaks in NICU had been reported from developing countries [Jin et al., 2015; Gray et al., 2012]. India has the highest neonatal mortality rate due to neonatal sepsis caused by bacterial resistance to first-line antibiotics. Approximately one-fifth of total neonates died with sepsis in the hospital, and the mortality rate is 50% for those with culture-proven sepsis [PHFI, 2014]. Metallo-β-lactamase and carbapenemase producing K. pneumoniae strains make the clinical management of these infections more challenging. According to the Centre for Disease Dynamics, Economics and Policy (CDDEP), up to 60% of the Indian K. pneumoniae isolates were resistant to carbapenems and 80% resistant to cephalosporins. India has witnessed an increase in carbapenem-resistance rates from 9% in 2008 to 44% in 2010 [Parveen et al., 2010]. In Italy, the prevalence of carbapenem-resistant K. pneumoniae (CRKP) isolates, non-existent in 2008, has risen to 60% in 2013 (CDDEP). This rapid increase in carbapenem-resistance reflects a worrisome trend.
Furthermore, several carbapenemase encoding genes have been described in K. pneumoniae species, including class A β-lactamase KPC, class B β-lactamases New Delhi Metallo-β-lactamase (NDM-1), IMP, VIM, and class D β-lactamase OXA-48 [Berrazeg et al., 2013]. NDM-1 emerged in 2009 and since then it has been spread globally in the most important reservoir of NDM-1-producing bacteria i.e. the Indian subcontinent and the Balkan region [Dortet et al., 2014]. The Ambler class D β- lactamase OXA-48 producing K. pneumoniae first time isolated from a patient in MaulanaTurkey inAzad 2001 [Poirel Library, et al., 2004 Aligarh]. The aim of Muslim this study was University to investigate carbapenem-resistant K. pneumoniae (CRKP) from NICU of north Indian tertiary care Hospital to understand the clonal outbreak.
92 Chapter 5
5.2. Experimental outline
From October 2016 to April 2017, seventeen non-duplicated carbapenem-resistant K. pneumoniae were included in this study, isolated from neonates admitted to the NICU of Jawaharlal Nehru Medical College and Hospital (JNMCH), Aligarh Muslim University, Aligarh. It is a tertiary care unit of 1300 bed capacity, in which 90 beds were allotted for pediatric patients and 35 beds for the NICU. Microbiological characteristics of the seventeen carbapenem-resistant K. pneumoniae isolates, including the date of isolation, neonate age, sex, birth weight were collected. The identification of bacterial isolates was confirmed as outlined in section 2.7. Antimicrobial susceptibility of the isolates was determined by the disc diffusion and micro-dilution method as described in section 2.8. Carba NP test and double disk synergy test (DDST) were performed for the detection of carbapenemase and Metallo- β-lactamase producing K. pneumonia as mentioned in section 2.9 and 2.10. Antibiotic resistant markers were detected by PCR and sequencing methods as described 2.11 and 2.12. Molecular characterization of plasmid was done as mentioned in section 2.14. Conjugation experiments were performed to determine the transferability of the plasmids as described in section 2.13. The Genetic Environment analysis was
performed to know the genes present upstream and downstream of blaNDM, as described section 2.15. MLST of the K. pneumoniae isolates was carried out to amplify seven conserved housekeeping genes (gapA, infB, mdh,pgi, phoE, rpoB and tonB) using adequate primers (http://bigsdb.paste ur.fr/klebsiella/primers_used.html) and protocols available at the MLST Pasteur website.
(http://bigsdb.web.pasteur.fr/klebsiella/klebsiella.html). Alleles and sequence types (STs) are available on the MLST online database. Novel alleles and STs were submitted to the administrator of the database and assigned new sequence type. Minimum spanning tree was constructed using PHYLOViZ (https://online.phyloviz.net/index) online software. Maulana5.3. Results Azad Library, Aligarh Muslim University 5.3.1. Clinical characteristics of the carbapenem-resistant K. pneumoniae isolates
Microbiological characteristics of the seventeen carbapenem-resistant K. pneumoniae isolates, including the date of isolation, neonate age, sex, birth weight as shown in
93 Chapter 5
table 5.1. The isolates were collected from 17 newborns of low birth weight (07 males and 10 females) with an average age of 5 days (01-11 days).
5.3.2. Antibacterial susceptibility, MICs and Metallo-β-Lactamase (MBL) production
The antimicrobial susceptibility profiles of the CRKP isolates are listed in (Table 5.1.). All 17 isolates were resistant to at least three classes of antibiotics and they were considered MDR. The MICs of carbapenem agents for all isolates are shown in table 5.1. Metallo-β-lactamase (MBL) activity was found in all 17 carbapenem-resistant K. pneumoniae isolates (Table 5.1.).
5.3.3. Carbapenemase Production
All 17 K. pnemoniae isolates were found positive for Carba-NP test, indicating the production of a carbapenemase as shown in table 5.1.
5.3.4. Detection of antibiotic resistance genes
PCR amplification and sequencing confirmed that all CRKP isolates harbored blaNDM
(Figure 5.1a and 5.1b) (of which thirteen were blaNDM-1, one blaNDM-4, and three
blaNDM-5). These NDM sequences were submitted to the NCBI database. Of the 17
blaNDM producing isolates, 76.5 % (13/17) blaCTX-M-15 (Figure 5.2a and 5.2b), 41.2 %
(7/17) blaOXA-48 (Figure 5.3.), 41.2 % (7/17) blaCMY-1 (Figure 5.4.) and 29.4 % (5/17)
blaSHV-1 (Figure 5.5.), respectively, were co-associated with blaNDM as shown in (Table 5.2. and Figure 5.6.).
5.3.5. Genetic environment of the blaNDM
PCR-based Genetic environment analysis of the blaNDM gene was performed,
bleomycin resistance gene (bleMBL) was found downstream of blaNDM in all isolates
(Table 5.2.). The complete ISAba125 sequence was found upstream of blaNDM-1 in eleven strains (AK-121, AK-125, AK-126, AK-130, AK-133, AK-139, AK-140, AK- Maulana144, AK Azad-145, AK -Library,147 and AK-149), Aligarh one NDM -4Muslim (AK-119) and University two NDM-5 producing strains (AK-134 and AK-146). Furthermore, two blaNDM-1 (AK-142 and
AK-143) and one blaNDM-5 (AK-158) carrying K. pneumoniae had truncated
ISAba125, upstream of blaNDM (Table 5.2.).
94 Chapter 5
Table 5.1: Demographic and phenotypic charectrization of carbapenem-resistant Klebsiella pneumoniae (CRKP) isolates
MIC (µg/ml) Date of Age Birth Carba Isolate ID Ward MBL Antimicrobial Resistant Phenotype Isolation (Days)/sex Weight NP MRP IMP DOR AK-119 13-10-2016 1/M NICU 1.910 Positive Present 1024 >1024 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-121 13-10-2016 8/M NICU 1.720 Positive Present 512 >512 512 IMP, MRP, DOR, CTX, CAZ, CPM, CIP, LE, AK, GEN AK-125 07-11-2016 3/F NICU 2.440 Positive Present 512 1024 512 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-126 07-11-2016 4/F NICU 2.310 Positive Present >1024 2048 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-130 25-01-2017 6/F NICU 2.050 Positive Present 256 512 512 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-133 31-01-2017 5/F NICU 1.420 Positive Present 1024 1024 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-134 31-01-2017 4/F NICU 1.620 Positive Present 1024 >1024 1024 IMP, MRP, DOR, CTX, CAZ, CPM, CIP, LE, AK, GEN AK-139 31-01-2017 6/M NICU 1.810 Positive Present >512 1024 >1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-140 01-04-2017 2/F NICU 1.300 Positive Present 1024 2048 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-142 01-04-2017 2/M NICU 1.270 Positive Present 512 1024 >512 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-143 01-04-2017 11/M NICU 1.195 Positive Present 512 1024 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-144 01-04-2017 7/F NICU 1.590 Positive Present 1024 1024 >512 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-145 01-04-2017 7/M NICU 1.470 Positive Present 512 1024 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-146 01-04-2017 2/M NICU 2.475 Positive Present 256 512 512 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-147 01-04-2017 3/F NICU 2.100 Positive Present 1024 2048 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-149 01-04-2017 11/F NICU 1.220 Positive Present >1024 2048 1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN AK-158 01-04-2017 5/F NICU 1.510 Positive Present 1024 2048 >1024 IMP, MRP, DOR, CTX, CAZ, CPM, AT, CIP, LE, AK, GEN
MBL: Metallo-β-lactamase, IMP: imipenem, MRP: meropenem, DOR: doripenem, CTX: cefotaxime, CAZ: ceftazidime, CPM: cefepime, AT: aztreonam, CIP: ciprofloxacin, LE: levofloxacin, AK: amikacin, GEN: gentamicin.
Maulana Azad Library, Aligarh95 Muslim University Chapter 5
Table 5.2: Genetic characterization of carbapenem-resistant Klebsiella pneumoniae (CRKP) isolates
Genetic environment Strain Carbapenemase Associated resistant Size of Sequence Type Inc group of blaNDM Name gene marker Plasmid (kb) ISAba125 bleMBL AK-119 NDM-4, OXA-48 ST-16 X CTX-M-15, SHV-1 6 Complete Present AK-121 NDM-1 ST-15 A/C , X CTX-M-15, CMY-1 6,38 Complete Present AK-125 NDM-1 ST-15 FIA, A/C, X CTX-M-15 4, 6 Complete Present AK-126 NDM-1, OXA-48 ST-16 FIA, A/C CTX-M-15 4, 6 Complete Present AK-130 NDM-1 ST-15 A/C, Y CTX-M-15 6, 38 Complete Present AK-133 NDM-1 ST-657 FIIAs, A/C, X CTX-M-15 4, 6, 38 Complete Present AK-134 NDM-5 ST-15 FIIAs CTX-M-15 38 Complete Present AK-139 NDM-1, OXA-48 ST-16 UT CTX-M-15 6 Complete Present AK-140 NDM-1, OXA-48 ST-16 FIC CTX-M-15 6, 38 Complete Present CTX-M-15, SHV-1, AK-142 NDM-1 ST-3344* FIIAs, A/C, F, K, X 4, 6, 38 Truncated Present CMY-1 AK-143 NDM-1 ST-3344* FIIAs, A/C, F, K, X CTX-M-15, CMY-1 4, 6, 38 Truncated Present AK-144 NDM-1 ST-15 FIA, FIB, A/C, F, X SHV-1, CMY-1 4, 38 Complete Present CTX-M-15, SHV-1 AK-145 NDM-1 ST-15 FIA, FIB, A/C, F, X 4, 38 Complete Present CMY-1 AK-146 NDM-5 ST-15 A/C CMY-1 38 Complete Present AK-147 NDM-1, OXA-48 ST-11 FIIAs, A/C, F, X, W - 4, 6, 38 Complete Present AK-149 NDM-1, OXA-48 ST-16 F, K SHV-1 38 Complete Present AK-158 NDM-5, OXA-48 ST-873 FIA, FIB, A/C, F, K CTX-M-15, CMY-1 4, 6, 38 Truncated Present
UT: Untypable , *Novel Sequence Type.
Maulana Azad Library, Aligarh96 Muslim University Chapter 5
Figure 5.1 (a): Detection of blaNDM in 10 Klebsiella pneumoniae isolates by PCR Amplification. Lane M, 10kb DNA ladder, lane 1-10 (AK- 119, AK- 121, AK-125, AK-126, AK-130, AK-133, AK-134, AK-139, AK- 140, AK-142) NDM producing isolates lane P, positive control; lane N, negative control.
Maulana Azad Library, Aligarh Muslim University
Figure 5.1 (b): Detection of blaNDM in 07 Klebsiella pneumoniae isolates by PCR Amplification. Lane M, 10kb DNA ladder, lane 11-17 (AK-143, AK-144, AK-145, AK-146, AK-147, AK-149, AK-158) NDM producing isolates lane P, positive control; lane N, negative control.
97 Chapter 5
Figure 5.2(a): Detection of blaCTXM-15 in 07 Klebsiella pneumoniae isolates (AK-119, AK-121, AK-125, AK-126, AK-130, AK-133 and AK-134) by PCR amplification. Lane M: DNA ladder, Lane PC: positive control.
Maulana Azad Library, Aligarh Muslim University
Figure 5.2(b):Detection of blaCTXM-15 in 06 Klebsiella pneumoniae isolates (AK-139, AK-140, AK-142, AK-143, AK-145 and AK-158) by PCR amplification. Lane M: DNA ladder, Lane PC: positive control, Lane NC: negative
98 Chapter 5
Figure 5.3: Detection of blaOXA-48 in 07 Klebsiella pneumoniae isolates (AK-119, AK-126, AK-139, AK-140, AK-147, AK-149 and AK-158) by PCR amplification. Lane M: DNA ladder, Lane PC: positive control, Lane NC: negative control.
Maulana Azad Library, Aligarh Muslim University Figure 5.4: Detection of blaCMY in 07 Klebsiella pneumoniae isolates (AK-121, AK-142, AK-143, AK-144, AK-145, AK-146 and AK-158) by PCR amplification. Lane M: DNA ladder, Lane PC: positive control, Lane NC: negative control.
99 Chapter 5
Figure 5.5: Detection of blaSHV in 05 Klebsiella pneumoniae isolates (AK-119, AK-142, AK-144, AK-145 and AK-149) by PCR amplification. Lane M: DNA ladder, Lane PC: positive control, Lane NC: negative control.
Maulana Azad Library, Aligarh Muslim University
Figure 5.6: Percentage of resistant markers among carbapenem-resistant Klebsiella pneumoniae (CRKP) isolates.
100 Chapter 5
5.3.6. Plasmid analysis
These carbapenem-resistant K. pnemoniae (CRKP) were found to carry detectable plasmids of size (38kb, 6kb and 4kb) as shown in table 5.2. PBRT detected ten plasmid replicon types in the 17 CRKP isolates (IncFIA, IncFIB, IncFIIAs, IncFIC, IncA/C, IncF, IncK, IncX, IncW and IncY). Sixteen isolates carried one or more plasmid replicons, whereas AK-139 isolate was found untypable. Replicon types [IncA/C (n=12), IncX (n=09), IncF (n=07), IncFIIAs (n=05), IncFIA (n=05), IncK (n=04), IncFIB (n=03), IncFIC (n=01), IncW (n=01), and IncY (n=01)] were found predominant in this study. Most frequent type replicons were IncA/C, IncX and IncF.
Figure 5.7: Distribution of plsmid replicon types of 17 carbapenem-resistant Klebsiella pneumoniae (CRKP) isolates.
5.3.7. Molecular typing
Amplification of seven conserved housekeeping genes gapA (Figure 5.8.), infB (Figure 5.9.), mdh (Figure 5.10.), pgi (Figure 5.11.), phoE (Figure 5.12.), rpoB Maulana(Figure 5.13Azad.) and tonB Library, (Figure 5.14. ) Aligarhof 17 K. pneumoniae Muslim isolates University MLST analysis revealed two suspected outbreak isolates which shared a new allelic profile (2-1-2-2-4-31-4), assigned as novel ST3344 (Table 5.3) as a first report. Among the 17 carbapenem-resistant, K. pneumoniae (CRKP) isolates, 6 STs were identified, including ST15 (7 isolates), ST16 (5 isolates), ST11 (1 isolate), ST657 (1
101 Chapter 5
isolate), ST873 (1 isolate), and ST3344 (2 isolates) (Table 5.3). Our study revealed that NDM producers were detected on ST15, ST657 and ST3344. Whereas, the strains carrying NDM in association with OXA-48 belonged to ST11, ST16 and ST873.
Figure 5.8: PCR Amplification of MLST gapA gene. Lane M: DNA ladder, lane (AK-119 to AK-158) Klebsiella pneumoniae isolates, lane PC: positive control, lane NC: negative control.
Maulana Azad Library, Aligarh Muslim University Figure 5.9: PCR Amplification of MLST infB gene. Lane M: DNA ladder, lane (AK-119 to AK-158) Klebsiella pneumoniae isolates lane, PC: positive control, lane NC: negative control.
102 Chapter 5
Figure 5.10: PCR Amplification of MLST mdh gene. Lane M: DNA ladder, lane (AK-119 to AK-158) Klebsiella pneumoniae isolates lane, PC: positive control, lane NC: negative control.
Figure 5.11: PCR Amplification of MLST pgi gene. Lane M: DNA ladder, lane (AK-119 to AK-158) Klebsiella pneumoniae isolates lane, PC: positive control, lane NC: negative control. Maulana Azad Library, Aligarh Muslim University
103 Chapter 5
Figure 5.12: PCR Amplification of MLST phoE gene. Lane M: DNA ladder, lane (AK-119 to AK-158) Klebsiella pneumoniae isolates lane, PC: positive control, lane NC: negative control.
Figure 5.13: PCR Amplification of MLST rpo gene. Lane M: DNA ladder, lane (AK-119 to AK-158) Klebsiella pneumoniae isolates lane, PC: positive control, lane NC: negative control. Maulana Azad Library, Aligarh Muslim University
104 Chapter 5
Figure 5.14: PCR Amplification of MLST tonB gene. Lane M: DNA ladder, lane (AK-119 to AK-158) Klebsiella pneumoniae isolates lane, PC: positive control, lane NC: negative control.
Maulana Azad Library, Aligarh Muslim University
105 Chapter 5
Table 5.3: MLST profile of 17 carbapenem–resistant K. pneumoniae CRKP isolates
Strain Name gapA infB mdh pgi phoE rpoB tonB ST
AK-119 2 1 2 1 4 4 4 ST-16
AK-121 1 1 1 1 1 1 1 ST-15
AK-125 1 1 1 1 1 1 1 ST-15
AK-126 2 1 2 1 4 4 4 ST-16
AK-130 1 1 1 1 1 1 1 ST-15
AK-133 2 1 2 1 10 4 4 ST-657
AK-134 1 1 1 1 1 1 1 ST-15
AK-139 2 1 2 1 4 4 4 ST-16
AK-140 2 1 2 1 4 4 4 ST-16
AK-142 2 1 2 2 4 31 4 ST-3344*
AK-143 2 1 2 2 4 31 4 ST-3344*
AK-144 1 1 1 1 1 1 1 ST-15
AK-145 1 1 1 1 1 1 1 ST-15
AK-146 1 1 1 1 1 1 1 ST-15
AK-147 3 3 1 1 1 1 4 ST-11
AK-149 2 1 2 1 4 4 4 ST-16
AK-158 14 1 2 1 7 4 182 ST-873
*Novel ST type
5.4. Discussion
In this study, we have identified novel ST3344 in two K. pneumoniae strains (AK-142 and AK-143) carrying NDM-1, whereas all the carbapenem-resistant K. pneumoniae (CRKP) isolates were susceptible to colistin and Polymyxin-B. However, because of their nephrotoxic effect, they are not recommended for the treatment [Hamzan et al., Maulana2015]. InAzad the absence Library, of effective antibioticAligarh treatment, Muslim early monitoring University of CRKP infection or colonization on admission may play a more important role for timely control of the increase of CRKP. Infectious diseases caused by NDM-1-producing isolates were known to be associated with significant morbidity and mortality, it is even worse among the pediatric population due to limited therapeutic option.
106 Chapter 5
This study revealed 17 CRKP isolates with four diverse carbapenemase genes
(blaNDM, blaOXA-48, blaCMY-1, and blaSHV-1). This study further highlights the
prevalence of CRKP with blaNDM and blaOXA-48 genes together or alone, in NICU of
north Indian tertiary care hospital. The blaNDM and blaOXA-48 co-producing strains exhibited high MIC values against carbapenems. The dissemination of K. pneumoniae
isolates harboring carbapenem-resistant genes, in particular, blaNDM and blaOXA-48 continues reported their emergence across the world, especially in European and Asian countries [Sidjabat et al., 2015; Guo et al., 2016].
PHYLOViZ-generated minimum-spanning tree is based on the allele number matrix of the gene loci included in the K. pneumoniae MLST scheme. Black numbers in the circles indicate the MLST sequence type. Red numbers along the linking lines indicate the absolute distance as shown in figure 5.15. The MLST analysis revealed the occurrence of seven ST15 K. pneumoniae strains in which five were NDM-1 and
two were NDM-5 producers. ST16 was the second most common ST carrying blaNDM
with blaOXA-48 producing K. pneumoniae.
Maulana Azad Library, Aligarh Muslim University
Figure 5.15: PHYLOViZ-generated minimum-spanning tree is based on the allele number matrix of the gene loci included in the K. pneumoniae MLST scheme. Black numbers in the circles indicate the MLST sequence type. Red numbers along the linking lines indicate the absolute distance.
107 Chapter 5
The co-production of these two markers in ST16 accounted for its high resistance to carbapenems (Table 5.1.). Over 50% of NDM-producing K. pneumoniae isolates in India, belonged to either ST11 or ST147 [Lascols et al., 2013]. In the previous studies NDM-1-producing K. pneumoniae clinical isolates from India, Sweden and the UK showed that the most frequently detected sequence types, were ST14, ST11, ST149, ST231, and ST147 [17]. Moreover, ST14, ST15, ST101, ST147, and ST405 clones in OXA-48 producing K. pneumoniae have been reported in many countries, such as the India [Lascols et al., 2013], Spain [Cubero et al., 2015], USA [Lascols et al., 2013] and Germany [Göttig et al., 2015]. Our study represents the first detection of NDM-1 producing ST3344 K. pneumoniae isolates in the neonatal intensive care unit.
In the previous study, blaNDM-1 has been identified on various transferable plasmids (IncFII, IncA/C, IncN or untypeable plasmids) [Voulgari et al., 2014]. Moreover, the
blaOXA-48 was also reported to transfer through different plasmid types, IncL/M, IncN, IncA/C or untypeable [Guo et al., 2016]. This study explored varying replicon types (IncFIA, IncFIB, IncFIIAs, IncFIC, IncA/C, IncF, IncK, IncX, IncW and IncY), in these NDM-producing K. pneumoniae strain.
The complete ISAba125 on upstream of blaNDM in the majority of the isolates implies
its function in horizontal gene transfer of blaNDM producing Enterobacteriaceae family [Poirel et al., 2011]. Moreover, in the present study, all 17 CRKP isolates carried the
bleomycin resistance gene (bleMBL) downstream of blaNDM. The high prevalence of
association of the bleMBL and blaNDM genes suggests that they may have mobilized
together from a common progenitor, which many thought to protect blaNDM [Ahmad et al., 2018b].
The main findings of this study are summarized as:
We described a first report of NDM-1 producing ST3344 as novel sequence type in two K. pneumoniae isolated from NICU setting.
Maulana The Azad co-producing Library, strains of NDM Aligarh and OXA- 48Muslim exhibited high University MICs value of carbapenems in this study.
Genetic Environment analysis revealed ISAba125 and bleomycin genes flanking to
all blaNDM variants.
K. pneumoniae ST16 was associated with co-production of blaOXA-48 and blaNDM.
108 Chapter 5
5.5. Conclusion
This is the first report of novel ST3344 in two NDM-1 producing K. pneumoniae isolates from neonates admitted in NICU of one of the North Indian Hospitals.
Moreover, these strains were also found to carry blaCTX-M-15, blaCMY-1 and blaSHV-1. The Genetic feature of these two novel ST3344 clones and their resistance profile may help in patient management in the hospital setting. The vulnerability to colonization and infection with CRKP isolates among neonates highlights the necessity of intervention with strict infection-control measures, including proper hand sanitation, contact precautions and cohort nursing care to decrease the cross-infection and avoid the quick spread or clonal dissemination of carbapenem-resistant K. pneumoniae strains in NICU setting.
Maulana Azad Library, Aligarh Muslim University
109
Chapter 6 Conclusion
Maulana Azad Library, Aligarh Muslim University
Conclusion
HIGHLIGHTS OF THE STUDY
First reported NDM-4 producing Citrobacter freundii, (AK-82) co-associated with
blaOXA-9, blaSHV-1 and blaCMY-149.
First time identified NDM-4 producing Citrobacter braakii (AK-84), Klebsiella
oxytoca (AK-100) and Enterobacter cloacae (AK-108) in association with blaOXA-1
and blaCMY-145, blaOXA-1 and blaOXA-9 and, blaOXA-1, blaOXA-9 and blaCMY-149, respectively.
We have first time identified three NDM-4 producing Klebsiella pnemoniae with incompatibility group IncP in AK-97, AK-101 and AK-104 strains.
This study revealed outbreak of multiple variants of blaNDM (9; blaNDM-1, 16; blaNDM-4,
17; blaNDM-5, and 2; blaNDM-7) in clinically important bacteria (20 Escherichia coli, 18 Klebsiella pneumoniae, 02 Citrobacter freundii, 01 Citrobacter braakii, 01 Klebsiella oxytoca, 01 Enterobacter cloacae, 01 Enterobacter aerogenes).
First reported New Delhi Metallo-β-lactamase-1 producing Cedecea lepagei was identified.
This study also first time reported blaNDM-4, blaNDM-5 and blaNDM-7 in E. arogenes species, isolated from the NICU of tertiary care hospital in India.
We describe first time a novel ST3344 in two NDM-1 producing K. pneumoniae isolates from neonates admitted in NICU of one of the North Indian Hospitals.
Moreover, these strains were also found to carry blaCTX-M-15, blaCMY-1 and blaSHV-1.
We have first time identified the co-producing strains of NDM and OXA-48 exhibited high MICs value of carbapenems.
This study explored varying replicon types (IncFIA, IncFIB, IncFIIAs, IncFIC, IncA/C, IncF, IncK, IncX, IncW and IncY), in NDM-producing K. pneumoniae Maulanastrain Azads. Library, Aligarh Muslim University
Co-existence of blaNDM-1 and blaVIM-1 producing Moellerella wisconsensis in NICU of North Indian Hospital: a first report.
110
Bibliography
Maulana Azad Library, Aligarh Muslim University
Bibliography
BIBLIOGRAPHY
Ahmad N, Ali SM, Khan AU. (2017) First reported New Delhi metallo-β-lactamase- 1-producing Cedecea lapagei. Int J Antimicrob Agents 49:118-9.
Ahmad N, Ali SM, Khan AU. (2018a) Detection of New Delhi Metallo-β-Lactamase Variants NDM-4, NDM-5, and NDM-7 in Enterobacter aerogenes isolated from a Neonatal Intensive Care Unit of a North India Hospital: A First Report. Microb Drug Resist 24: 161-65.
Ahmad N, Khalid S, Ali SM, Khan AU. (2018b) Occurrence of blaNDM variants among enterobacteriaceae from a neonatal intensive care unit in a Northern India hospital. Front Microbiol 9: 407.
Ali SZ, Ali SM, Khan AU. (2014) Prevalence of IncI1-Iγ and IncFIA-FIB type plasmids in extended-spectrum β-lactamase-producing Klebsiella pneumoniae strains isolated from the NICU of a North Indian hospital. Microbiol 160: 1153-1161.
Al-Zahrani IA. (2018) Routine detection of carbapenem-resistant gram-negative bacilli in clinical laboratories: A review of current challenges. Saudi medical journal. 39:861.
Ambler RP, Coulson AF, Frere JM, Ghuysen JM, Joris B, Forsman M, Levesque RC, Tiraby G, Waley SG. (1991) A standard numbering scheme for the class A β- lactamases. Biochem 15: 269 270.
An J, Guo L, Zhou L, Ma Y, Luo Y, Tao C, Yang J. (2016) NDM-producing Enterobacteriaceae in a Chinese hospital, 2014–2015: identification of NDM-
producing Citrobacter werkmanii and acquisition of blaNDM-1 carrying plasmid in vivo in a clinical Escherichia coli isolate. J Med microbial 65: 1253-9.
Anderson B, Nicholas S, Sprague B, Campos J, Short B, Singh N. (2008) Molecular Maulanaand Azad descriptive Library, epidemiology Aligarh of multidrug -resistantMuslim Enterobacteriaceae University in hospitalized infants. Infect Control Hosp Epidemiol 29: 250–5.
Arias CA, Murray BE. (2009) Antibiotic-resistant bugs in the 21st century—a clinical super-challenge. N Engl J Med 360:439-43.
111 Bibliography
Bagattini M, Crivaro V, Di Popolo A, Gentile F, Scarcella A, Triassi M, Villari P, Zarrilli R.(2006) Molecular epidemiology of extended-spectrum beta- lactamase-producing Klebsiella pneumoniae in a neonatal intensive care unit. J Antimicrob Chemother 57: 979-82.
Bagley ST. (1985) Habitat association of Klebsiella species. Infect Control. 6 (2): 52–8.
Barancheshme F, Munir M. (2018) Strategies to combat antibiotic resistance in the wastewater treatment plants. Front Microbiol 8: 2603.
Ben-Hamouda T, Foulon T, Ben-Mahrez K. (2004) Involvement of SHV-12 and SHV-2a encoding plasmids in outbreaks of extended-spectrum β-lactamase- producing Klebsiella pneumoniae in a Tunisian neonatal ward. Microb Drug Resist 10: 132-8.
Bentley R and Meganathan R. (1982) Biosynthesis of vitamin K (menaquinone) in bacteria. Microbiol Rev 46: 241–80.
Berrazeg M, Diene SM, Drissi M, Kempf M, Richet H, Landraud L, Rolain JM. (2013) Biotyping of multidrug-resistant Klebsiella pneumoniae clinical isolates from France and Algeria using MALDI-TOF MS. PloS one 8: e61428.
Bharadwaj R, Joshi S, Dohe V, Gaikwad V, Kulkarni G, Shouche Y. (2012) Prevalence of New Delhi metallo-β-lactamase (NDM-1)-positive bacteria in a tertiary care centre in Pune, India. Int J Antimicrob Agents 39: 265-6.
Birgy A, Doit C, Mariani-Kurkdjian P, Genel N, Faye A, Arlet G, Bingen E. (2011) Detection of Colonization by VIM-1- Producing Klebsiella pneumoniae and NDM-1-Producing Escherichia coli in Two Children Returning to France. J Clin Microbiol 49: 3085-7.
Bogaerts P, Verroken A, Jans B, Denis O, Glupczynski Y. (2010) Global spread of New Delhi metallo-beta-lactamase 1. Lancet Infect Dis 10: 831–2.
Bonfiglio G, Russo G, Nicoletti G. (2002) Recent developments in carbapenems. MaulanaExpert Opin Azad Investig Library, Drugs 11: 529– 544.Aligarh Muslim University Bonnin RA, Poirel L, Naas T, Pirs M, Seme K, Schrenzel J, Nordmann P. (2012) Dissemination of New Delhi metallo-β-lactamase-1-producing Acinetobacter baumannii in Europe. Clin Microbiol Infect 18: E362–5.
112 Bibliography
Bonomo RA. (2017) β-Lactamases: a focus on current challenges. Cold Spring Harb Perspect Med 7: a025239.
Brisse S, Grimont F & Grimont PAD. Prokaryotes. New York, NY: Springer New York. 2006 pp. 159–196.
Bush K, Bradford PA. (2016) β-Lactams and β-lactamase inhibitors: an overview. Cold Spring Harb Perspect Med 6: a025247.
Bush K, Jacoby GA. (2010) Updated functional classification of beta-lactamases. Antimicrob Agents Chemother 54: 969–76.
Carattoli A, Bertini A, Villa L (2005) Identification of plasmids by PCR-based replicon typing. J Microbiol Methods 63: 219-28.
Cassettari VC, Da Silveira IR, Dropa M, Lincopan N, Mamizuka EM, Matté MH, Matté GR, Menezes PR. (2009) Risk factors for colonisation of newborn infants during an outbreak of extended-spectrum β-lactamase-producing Klebsiella pneumoniae in an intermediate-risk neonatal unit. J Hosp Infect 71: 340-7.
Cassir N, Rolain JM, Brouqui P. (2014) A new strategy to fight antimicrobial resistance: the revival of old antibiotics. Front Microbiol 5: 551.
Chambers HF. Other B-lactam antibiotics. In: Mandell GL, Bennett JE, Dolin R, eds. (2005) Principles and practice of infectious diseases. Philadelphia, PA: Elsevier Churchill Livingstone 311–317.
Chen S, Hu F, Liu Y, Zhu D, Wang H, Zhang Y. (2012) Detection and spread of carbapenem resistant Citrobacter freundii in a teaching hospital in China. A J Infect Control 39: e55-60.
CLSI. (2016) Performance standards for antimicrobial susceptibility testing: Twenty- six Informational Supplement M100-S26. Clinical and Laboratory Standards Institute Wayne, PA, USA. MaulanaCodjoe F,Azad Donkor E. Library, Carbapenem resistance: Aligarh a review. Muslim Medical Sciences. University 2018:1. Cornaglia G, Giamarellou H, Rossolini AM. (2011) Metallo-β-lactamases: a last frontier for β-lactams? Lancet Infect Dis 11: 381–93.
Cubero M, Cuervo G, Dominguez MÁ, Tubau F, Martí S, Sevillano E, Gallego L, Ayats J, Peña C, Pujol M, Liñares J. (2015) Carbapenem-resistant and
113 Bibliography
carbapenem-susceptible isogenic isolates of Klebsiella pneumoniae ST101 causing infection in a tertiary hospital. BMC microbial 15: 1.
Datta S, Roy S, Chatterjee S, Saha A, Sen B, Pal T, Som T, Basu S. (2014) A five- year experience of carbapenem resistance in Enterobacteriaceae causing neonatal septicaemia: predominance of NDM-1. PLoS One 9: e112101.
Developing countries PHFI, AIIMS, SC. State of India‘s Newborns (SOIN) 2014-a report. (Eds) Zodpey S, Paul VK.Public Health Foundation of India, All India Institute of Medical Sciences and Save the Children. New Delhi, India; 2014.
Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. (2005) Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microb 43:4178- 82.
Diekema DJ, Pfaller MA, Jones RN and SENTRY Participants Group. (2002) Age- related trends in pathogen frequency and antimicrobial susceptibility of bloodstream isolates in North America SENTRY Antimicrobial Surveillance Program, 1997–2000. Int J Antimicrob Agents 20: 412–18.
Doran, T.I. (1999) The role of Citrobacter in clinical disease of children: Review. Clin Infect Dis 28: 384-94.
Dortet L, Nordmann P, Poirel L. (2012) Association of the emerging carbapenemase NDM-1 with a bleomycin resistance protein in Enterobacteriaceae and Acinetobacter baumannii. Antimicrob Agents Chemother 56: 1693-1697.
Dortet L, Poirel L, Nordmann P. (2014) Worldwide dissemination of the NDM-type carbapenemases in Gram-negative bacteria. Biomed Res Int 26: 2014.
Elizabeth Pisani. Antimicrobial resistance: What does medicine quality have to do with it? 2015(file:///C:/Users/AHMAD/Downloads/ElizabethPisaniMedicinesQualitypaper -Dr.%20Elizabeth%20Pisani%20et.%20Al%202015.pdf).
Emori TG, Gaynes RP. (1993) An overview of nosocomial infections, including the role of the microbiology laboratory. Clin Microbiol Rev 6: 428–42. Maulana Azad Library, Aligarh Muslim University Enterobacteriaceae. Emer Infect Dis 17: 1791-1798.
Fallah F, Taherpour A, Hakemi Vala M, Hashemi A. (2011) Global spread of New Delhi metallo betalactamase-1 (NDM-1). Iran J Clin Infect Dis Vol. 6 No. 4.
114 Bibliography
Fluit AC, Schmitz FJ, Verhoef J. (2001) Frequency of isolation of pathogens from bloodstream, nosocomial pneumonia, skin and soft tissue, and urinary tract infections occurring in European patients. Eur J Clin Microbiol Infect Dis 20: 188–191.
Frieri M, Kumar K, Boutin A.(2017) Antibiotic resistance. J Infect Public Health 10:369-78.
Fujimoto K, Takemoto K, Hatano K, Nakai T, Terashita S, Matsumoto M, Eriguchi Y, Eguchi K, Shimizudani T, Sato K, Kanazawa K. (2013) Novel carbapenem antibiotics for parenteral and oral applications: in vitro and in vivo activities of 2-aryl carbapenems and their pharmacokinetics in laboratory animals. Antimicrob Agents Chemother 57: 697-707.
Fyfe C, Grossman TH, Kerstein K, Sutcliffe J. (2016) Resistance to macrolide antibiotics in public health pathogens. Cold Spring Harb Perspect Med 6: a025395.
Gales AC, Azevedo HD, Cereda RF, Girardello R, Xavier DE, (2011) INVITA-A- DORI Brazilian Study Group. Antimicrobial activity of doripenem against Gram-negative pathogens: results from INVITA-A-DORI Brazilian study. Braz J Infect Dis 15: 513-20.
Gales AC, Jones RN, Turnidge J, Rennie R, Ramphal R. (2001) Characterization of Pseudomonas aeruginosa isolates: occurrence rates, antimicrobial susceptibility patterns and molecular typing in the Global SENTRY antimicrobial surveillance program, 1997-1999. Clin Infect Dis 32: S146-55.
Galimand M, Courvalin P, and Lambert T. (2003) Plasmid-mediated high-level resistance to aminoglycosides in Enterobacteriaceae due to 16S rRNA methylation. Antimicrob Agents Chemother 47:2565–71.
Gamal D, Fernández-Martínez M, El-Defrawy I, Ocampo-Sosa AA, Martínez- Martínez L. (2016) First identification of NDM-5 associated with OXA-181 in MaulanaEscherichia Azad coliLibrary, from Egypt. EmerAligarh Microb infect Muslim 5: 30. University
Giske CG, Fröding I, Hasan CM, Turlej-Rogacka A, Toleman M, Livermore D, Woodford N, Walsh TR. (2012) Diverse sequence types of Klebsiella pneumoniae contribute to the dissemination of blaNDM-1 in India, Sweden and the UK. Antimicrob Agents Chemother 21: AAC-06142.
115 Bibliography
Göttig S, Gruber TM, Stecher B, Wichelhaus TA, Kempf VA. (2015) In vivo horizontal gene transfer of the carbapenemase OXA-48 during a nosocomial outbreak. Clin Infect Dis 60: 1808-15.
Göttig S, Hamprecht AG, Christ S, Kempf VA, Wichelhaus TA. (2013) Detection of NDM-7 in Germany, a new variant of the New Delhi metallo-β-lactamase with increased carbapenemase activity. Antimicrob. Agents Chemother 68: 1737-1740.
Gray J, Arvelo W, McCracken J, Lopez B, Lessa FC, Kitchel B, Wong B, Reyes L, Lindblade K. (2012) An outbreak of Klebsiella pneumoniae late-onset sepsis in a neonatal intensive care unit in Guatemala. Am J Infect Control 40: 516-20.
Guo L, An J, Ma Y, Ye L, Luo Y, Tao C, Yang J. (2016) Nosocomial outbreak of OXA-48-producing Klebsiella pneumoniae in a Chinese hospital: clonal transmission of ST147 and ST383. PLoS One 11: e0160754.
Haciseyitoglu D, Dokutan A, Abulaila A, Erdem F, Cag Y, Ozer S, Aktas Z. (2017) The First Enterobacter cloacae Co-Producing NDM and OXA-48 Carbapenemases and Interhospital Spread of OXA-48 and NDM-Producing Klebsiella pneumoniae in Turkey. Clin lab 63: 1213.
Hamzan NI, Yean CY, Rahman RA, Hasan H, Rahman ZA. (2015) Detection of blaIMP-4 and blaNDM-1 harboring Klebsiella pneumoniae isolates in a university hospital in Malaysia. Emerg health threats journal 8: 26011.
Hart CA. (1993) Klebsiellae and neonates. J Hosp Infect 23: 83–6.
Hashizume T, Ishino F, Nakagawa JI, Tamaki S, Matsuhashi M. (1984) Studies on the mechanism of action of imipenem (N-formimidoylthienamycin) in vitro: binding to the penicillin-binding proteins (PBPs) in Escherichia coli and Pseudomonas aeruginosa, and inhibition of enzyme activities due to the PBPs in E. coli. J Antibiot (Tokyo) 37: 394–400.
Hellinger WC, Brewer NS. (1999) Carbapenems and monobactams: imipenem, meropenem, and aztreonam. Mayo Clin Proc 74: 420–434.
MaulanaHickman-Brenner Azad FW, Huntley Library,-Carter GP, Saitoh Aligarh Y, Steigerwalt Muslim AG, Farmer JJ, UniversityBrenner DJ. (1984) Moellerella wisconsensis, a new genus and species of Enterobacteriaceae found in human stool specimens. J Clin Microbio l19: 460-63.
116 Bibliography
Hornsey, M., L. Phee, and D. W. Wareham. (2011) A novel variant, NDM-5, of the New Delhi metallo-β-lactamase in a multidrug-resistant Escherichia coli ST648 isolate recovered from a patient in the United Kingdom. Antimicrob Agents Chemother 55: 5952-5954.
Hu H, Hu Y, Pan Y, Liang H, Wang H, Wang X, Hao Q, Yang X, Yang X, Xiao X, Luan C. (2012) Novel plasmid and its variant harboring both a bla(NDM-1) gene and type IV secretion system in clinical isolates of Acinetobacter lwoffii. Antimicrob Agents Chemother 56: 1698–702.
Hudault S, Guignot J, Servin AL. (2001) Escherichia coli strains colonising the gastrointestinal tract protect germfree mice against Salmonella typhimurium infection. Gut 49: 47–55.
Jarvis WR, Martone WJ. (1992) Predominant pathogens in hospital infections. J Antimicrob Chemother 29: 19-24.
Jin Y, Shao C, Li J, Fan H, Bai Y, Wang Y. (2015) Outbreak of multidrug resistant NDM-1-producing Klebsiella pneumoniae from a neonatal unit in Shandong Province, China. PLoS One 10: e0119571.
Johnson JR, Russo TA. (2005) Molecular epidemiology of extraintestinal pathogenic (uropathogenic) Escherichia coli. Int J Med Microbiol 295: 383–404.
Kaase M, Nordmann P, Wichelhaus TA, Gatermann SG, Bonnin RA, Poirel L. (2011) NDM-2 carbapenemase in Acinetobacter baumannii from Egypt. J Antimicrob Chemother 66: 1260–2.
Kapmaz M, Erdem F, Abulaila A, Yeniaras E, Oncul O, Aktas Z. (2016) First detection of NDM-1 with CTX-M-9, TEM, SHV and rmtC in Escherichia coli ST471 carrying IncI2, A/C and Y plasmids from clinical isolates in Turkey. J Glob Antimicrob Resist 7: 152-3.
Kateete DP, Nakanjako R, Namugenyi J, Erume J, Joloba ML, Najjuka CF. (2016) MaulanaCarbapenem Azad Library,resistant Pseudomonas Aligarh aeruginosa Muslim and Acinetobacter University baumannii at Mulago Hospital in Kampala, Uganda (2007–2009). Springer Plus 5: 1308.
Kattan JN, Villegas MV and Quinn JP. (2008) New developments in carbapenems. Clin Microbiol Infect 14: 1102–1111.
117 Bibliography
Keating GM, Perry CM. (2005) Ertapenem: a review of its use in the treatment of bacterial infections. Drugs 65: 2151–2178.
Khajuria A, Praharaj AK, Kumar M, Grover N. (2014) Carbapenem resistance among Enterobacter species in a tertiary care hospital in central India. Chemother Res Pract 2014.
Khalifa HO, Soliman AM, Ahmed,AM, Shimamoto T, Shimamoto T. (2016) NDM-4 and NDM-5 Producing Klebsiella pneumoniae Coinfection in a 6-Month-Old Infant. Antimicrob Agents chemother 60: 4416-7.
Khan AU, Maryam L, Zarrilli R. (2017) Structure, Genetics and Worldwide Spread of New Delhi Metallo-β-lactamase (NDM): a threat to public health. BMC Microbiol 17: 101.
Khan AU, Nordmann P. (2012) NDM-1-producing Enterobacter cloacae and Klebsiella pneumoniae from diabetic foot ulcers in India. J Med Microbiol 61: 454-56.
Khan, AU, Parvez S. (2014) Detection of blaNDM-4 in Escherichia coli from hospital sewage. J Med Microbiol 63: 1404-1406.
Kieser, T. (1984) Factors affecting the isolation of CCC DNA from Streptomyces lividans and Escherichia coli. Plasmid 12: 19-36.
Kothari C, Gaind R, Singh LC, Sinha A, Kumari V, Arya S, Chellani H, Saxena S, Deb M. (2013)Community acquisition of β-lactamase producing Enterobacteriaceae in neonatal gut. BMC Microbiol 13: 136.
Kucheria R, Dasgupta P, Sacks SH, Khan MS, Sheerin NS. (2005) Urinary tract infections: new insights into a common problem. Postgrad Med J 81: 83–86.
Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, Chaudhary U, Doumith M, Giske CG, Irfan S, Krishnan P. (2010) Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a Maulanamolecular, Azad biological, Library, and epidemiological Aligarh study. Lancet Muslim Infect Dis 10: University 597–2. Lascols C, Peirano G, Hackel M, Laupland KB, Pitout JD. (2013) Surveillance and molecular epidemiology of Klebsiella pneumoniae isolates that produce carbapenemases: first report of OXA-48-like enzymes in North America. Antimicrob Agents Chemother 57: 130–6.
118 Bibliography
Lauretti L, Riccio ML, Mazzariol A, Cornaglia G, Amicosante G, Fontana R, Rossolini GM (1999) Cloning and characterization of blaVIM, a new integron-borne metallo-beta-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob Agents Chemother 43:1584–90.
Laxminarayan R, Matsoso P, Pant S, Brower C, Røttingen JA, Klugman K, Davies S. (2016)Access to effective antimicrobials: a worldwide challenge. The Lancet 387: 168-75.
Leiros HK, Borra PS, Brandsdal BO, Edvardsen KS, Spencer J, Walsh TR, Samuelsen Ø. (2012) Crystal Structure of the Mobile Metallo-β-Lactamase AIM-1 from Pseudomonas aeruginosa: insights into antibiotic binding and the role of Gln157. Antimicrob Agents Chemother 56: 4341–4353.
Li B, Webster TJ. (2018) Bacteria antibiotic resistance: New challenges and opportunities for implant‐associated orthopedic infections. Journal of Orthopaedic Research® 36: 22-32.
Li X, Mu X, Yang Y, Hua X, Yang Q, Wang N, Du X, Ruan Z, Shen X, Yu Y. (2016) Rapid emergence of high-level tigecycline resistance in Escherichia coli
strains harbouring blaNDM-5 in vivo. Int J Antimicrob Agents 47: 324-327. Limbago BM, Rasheed JK, Anderson KF, Zhu W, Kitchel B, Watz N, Munro S, Gans H, Banaei N, Kallen AJ. (2011) IMP-Producing Carbapenem-Resistant Klebsiella pneumonia in the United States. J Clin Microbiol 49: 4239-45.
Lin YC, Hsia KC, Chen YC, Sheng WH, Chang SC, Liao MH, Li SY. (2010) Genetic basis of multidrug resistance in Acinetobacter clinical isolates in Taiwan. Antimicrob Agents Chemother 54: 2078–84.
Liu C, Qin S, Xu H, Xu L, Zhao D, Liu X, Lang S, Feng X, Liu HM. (2015) New Delhi metallo-β-lactamase 1 (NDM-1), the dominant carbapenemase detected in carbapenem-resistant Enterobacter cloacae from Henan Province, China. PloS one 10 :e0135044.
Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, MaulanaHuang Azad X, Yu Library, LF. (2016) Emergence Aligarh of plasmid Muslim-mediated colis Universitytin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis 16:161-8.
Livermore DM. (2002) Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: our worst nightmare? Clin infect Dis 34: 634-40.
119 Bibliography
Logan LK, Renschler JP, Gandra S, Weinstein RA, Laxminarayan R. Centers for Disease Control and Prevention Epicenters Program. (2015) Carbapenem- resistant Enterobacteriaceae in children, United States, 1999–2012. Emerg Infect Dis 11: 2014-2021.
Logan LK, Weinstein RA. (2017) The epidemiology of carbapenem resistant Enterobacteriaceae: the impact and evolution of a global menace. J Infect Dis 215: S28–S36.
Logan, LK. (2012) Carbapenem-resistant enterobacteriaceae: an emerging problem in children. Clin Infect Dis 55: 852–859.
Lomovskaya O, Warren MS, Lee A, Galazzo J, Fronko R, Lee MA, Blais J, Cho D, Chamberland S, Renau T, Leger R. (2001) Identification and characterization of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for combination therapy. Antimicrob Agents Chemother 45: 105-116.
Lood R, Ertürk G, Mattiasson B. (2017) Revisiting antibiotic resistance spreading in wastewater treatment plants–bacteriophages as a much neglected potential transmission vehicle. Front Microbiol 8: 2298.
Lynch III JP, Clark NM, Zhanel GG. (2013) Evolution of antimicrobial resistance among Enterobacteriaceae (focus on extended spectrum β-lactamases and carbapenemases). Expert Opin Pharmacother 14:199-210.
Mahmood A, Karamat KA, Butt T. (2002) Neonatal sepsis: high antibiotic resistance of the bacterial pathogens in a neonatal intensive care unit in Karachi. J Pak Med Assoc 52: 348-50.
Maiden MC, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R, Zhang Q, Zhou J, Zurth K, Caugant DA, Feavers IM. (1998) Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proceedings of the National Academy of Sciences USA 95: 3140–3145. Maulana Azad Library, Aligarh Muslim University Mane AK, Nagdeo NV, Thombare VR. (2010) Study of neonatal septicemia in a tertiary care Hospital in rural NAGPUR. J Renin Angiotensin Aldosterone Syst 25: 19-24.
120 Bibliography
Manges AR and Johnson JR. (2012) Food-borne origins of Escherichia coli causing extraintestinal infections. Clin Infect Dis 55: 712–719.
Manges AR, Johnson JR, Foxman B, O'bryan TT, Fullerton KE, Riley LW. (2001) Widespread distribution of urinary tract infections caused by a multidrug- resistant Escherichia coli clonal group. N Engl J Med 345: 1007–1013.
Mann KG. (1999) Biochemistry and physiology of blood coagulation. Thromb Haemost 82: 165-74.
Martinez-Freijo P, Fluit AC, Schmitz FJ, Grek VS, Verhoef J, Jones ME. (1998) Class I integrons in Gram-negative isolates from different European hospitals and association with decreased susceptibility to multiple antibiotic compounds. J Antimicrob Chemother 42: 689-96.
Mayor-Lynn K, González-Quintero VH, O'sullivan MJ, Hartstein AI, Roger S, Tamayo M. (2005) Comparison of early onset neonatal sepsis caused by Escherichia coli and group B Streptococcus. Am J Obstet Gynecol 192: 1437–1439.
McDermott H, Morris D, McArdle E, O'Mahony G, Kelly S, Cormican M, Cunney R. (2011) Isolation of NDM-1 producing Klebsiella pnemoniae in Ireland, Euro Surveill 17: 20087.
Meletis G. (2016) Carbapenem resistance: overview of the problem and future perspectives. Ther Adv Infect Dis 3:15-21..
Miriagou V, Cornaglia G, Edelstein M, Galani I, Giske CG, Gniadkowski M, Malamou-Lada E, Martinez-Martinez L, Navarro F, Nordmann P, Peixe L. (2010) Acquired carbapenemases in Gram-negative bacterial pathogens: detection and surveillance issues. Clin Microbiol Infect 16: 112–22.
Moellering Jr RC. (2010) NDM-1 a cause for worldwide concern. N Engl J Med 363: 2377-2379.
Mshana SE, Imirzalioglu, C, Hossain, H, Hain T, Domann E, Chakraborty T. (2009) MaulanaConjugative Azad IncFILibrary, plasmids carrying Aligarh CTXM- 15Muslim among Escherichia University coli ESBL producing isolates at a University hospital in Germany. BMC Infect Dis 9: 97.
Muller-Pebody B, Johnson AP, Heath PT, Gilbert RE, Henderson KL, Sharland M, iCAP Group (Improving Antibiotic Prescribing in Primary Care. (2011)
121 Bibliography
Empirical treatment of neonatal sepsis: are the current guidelines adequate? Archives of Disease in Childhood: Fetal and Neonatal Edition 96: F4–F8.
Munita JM, Arias CA. (2016) Mechanisms of antibiotic resistance. Microbiol spectr 4.
Mutlu M, Aslan Y, Saygin B, Yilmaz G, Bayramoğlu G, Köksal I. (2011) Neonatal Sepsis Caused by Gram-negative Bacteria in a Neonatal Intensive Care Unit: A Six Years Analysis. HK J Paediatr (new series) 16: 253-257.
Nakano R, Nakano A, Hikosaka K, Kawakami S, Matsunaga N, Asahara M, Ishigaki S, Furukawa T, Suzuki M, Shibayama K, Ono Y. (2014) First report of metallo-β-lactamase NDM-5-producing Escherichia coli in Japan. Antimicrob Agents Chemother 58: 7611-7612.
National Neonatal-Perinatal Database (NNPD) Report 2002–2003. India: National Neonatology Forum. 2005.
Nordmann P, Boulanger, AE and. Poirel L. (2012e) NDM-4 metallo-β-lactamase with increased carbapenemase activity from Escherichia coli. Antimicrob Agents Chemother 56: 2184-2186.
Nordmann P, Cornaglia G. (2012b) Carbapenemase-producing Enterobacteriaceae: a call for action! Clin Microbiol Infect 18: 411–412.
Nordmann P, Cuzon G, Naas T. (2009) The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9: 228–36.
Nordmann P, Dortet L, Poirel L. (2012a) Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends Mol Med 18: 263-272.
Nordmann P, Gniadkowski M, Giske CG, Poirel L, Woodford N, Miriagou V, on Carbapenemases EN. (2012c) Identification and screening of carbapenemase- producing Enterobacteriaceae. Clin Microbiol Infect 18: 432-8.
Nordmann P, Nass T, Poirel L. (2011) Global spread of carbapenemase producing MaulanaEnterobac Azadteriaceae. EmerLibrary, Infect Dis 17:Aligarh 1791-1798. Muslim University Nordmann P, Poirel L, Dortet L. (2012d) Rapid detection of carbapenemase- producing Enterobacteriaceae. Emerg Infect Dis 18: 1503-1507.
Pagani L, Dell‘Amico E, Migliavacca R, D‘Andrea MM, Giacobone E, Amicosante G. et al. (2003) Multiple CTX-M-type extended-spectrum betalactamases in
122 Bibliography
nosocomial isolates of Enterobacteriaceae from a hospital in northern Italy. J Clin Microbiol 41: 4264–9.
Pai H, Kim JW, Kim J, Lee JH, Choe KW, Gotoh N. (2001) Carbapenem resistance mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother 45: 480-484.
Pál T, Ghazawi A, Darwish D, Villa L, Carattoli A, Hashmey R, Aldeesi Z, Jamal W, Rotimi V, Al-Jardani A, Al-Abri SS. (2017) Characterization of NDM-7 Carbapenemase-Producing Escherichia coli Isolates in the Arabian Peninsula. Microb Drug Resist 23: 871-8.
Papagiannitsis CC, Malli E, Florou Z, Sarrou S, Hrabak J, Mantzarlis K, Zakynthinos E, Petinaki E. (2017) Emergence of sequence type 11 Klebsiella pneumoniae coproducing NDM-1 and VIM-1 metallo-β-lactamases in a Greek hospital. Diagn Microbiol Infect Dis 87: 295-7.
Papp-Wallace KM, Endimiani A, Taracila MA, Bonomo RA. (2011) Carbapenems: past, present, and future. Antimicrob Agents Chemother 55: 4943-60.
Parveen RM, Harish BN, Parija SC. (2010) Emerging carbapenem resistance among nosocomial isolates of Klebsiella pneumoniae in South India. Int J Pharma Bio Sci.
Pavel AB, Vasile CI. (2012) PyElph-a software tool for gel images analysis and phylogenetics. BMC bioinformatics 13: 9.
Pepperell C, Kus JV, Gardam MA, Humar A, Burrows LL. (2002) Low-Virulence Citrobacter Species Encode Resistance to Multiple Antimicrobials. Antimicrob Agents Chemother 46: 3555-60.
Perry JD, Naqvi SH, Mirza IA, Alizai SA, Hussain A, Ghirardi S, Orenga S, Wilkinson K, Woodford N, Zhang J, Livermore DM. (2011) Prevalence of faecal carriage of Enterobacteriaceae with NDM-1 carbapenemase at military hospitals in Pakistan, and evaluation of two chromogenic media. J Antimicrob Chemother 66: 2288-94.
MaulanaPesesky AzadMW, Hussain Library, T, Wallace M, Aligarh Wang B, Andleeb Muslim S, Burnham UniversityCA, Dantas G. (2015) KPC and NDM-1 genes in related Enterobacteriaceae strains and plasmids from Pakistan and the United States. Emerg Infect Dis 21: 1034-7.
Petersen-Morfin S, Bocanegra-Ibarias P, Morfin-Otero R, Garza-González E, Perez- Gomez HR, González-Diaz E, Esparza-Ahumada S, León-Garnica G,
123 Bibliography
Amezcua-Salazar G, Rodriguez-Noriega E. (2017) New Delhi Metallo-Beta- Lactamase (NDM-1)-Producing Klebsiella pneumoniae Isolated from a Burned Patient. Am J Case Rep 18: 805.
Petrosillo N, Vranić-Ladavac M, Feudi C, Villa L, Fortini D, Barišić N, Bedenić B, Ladavac R, D‘Arezzo S, Andrašević AT, Capone A. (2016) Spread of
Enterobacter cloacae carrying blaNDM-1, blaCTX-M-15, blaSHV-12 and plasmid- mediated quinolone resistance genes in a surgical intensive care unit in Croatia. J Glob Antimicrob resist 4: 44-8.
Picard B, Garcia JS, Gouriou S, Duriez P, Brahimi N, Bingen E, Elion J, Denamur E. (1999)The link between phylogeny and virulence in Escherichia coli extraintestinal infection. Infect Immun 67: 546–553.
Pitart C, Solé M, Roca I, Román A, Moreno A, Vila J, Marco F. (2015) Molecular characterization of blaNDM-5 carried on an IncFII plasmid in an Escherichia coli isolate from a nontraveler patient in Spain. Antimicrob Agents Chemother 59: 659-662.
Pitout JD. Nordmann P, Poirel L. (2015) Carbapenemase-producing Klebsiella pneumoniae, a key pathogen set for global nosocomial dominance. Antimicrob Agents Chemother; 59:5873-84.
Poirel L, Dortet L, Bernabeu S, Nordmann P. (2011) Genetic features of blaNDM-1 positive Enterobacteriaceae. Antimicrob Agents Chemother 55: 5403–7.
Poirel L, Héritier C, Tolün V, Nordmann P. (2004) Emergence of oxacillinase- mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother 48:15–22.
Poulakou G, Lagou S, Karageorgopoulos DE, Dimopoulos G. (2018) New treatments of multidrug-resistant Gram-negative ventilator-associated pneumonia. Ann Transl Med 6.pp. 159–196.
Qin S, Zhou M, Zhang Q, Tao H, Ye Y, Chen H, Xu L, Xu H, Wang P, Feng X. Maulana(2016) FirstAzad identification Library, of NDM- Aligarh4-producing Escherichia Muslim coli ST410 University in China. Emerg Microb infect 5:118.
Quale J, Bratu S, Landman D, Heddurshetti R. (2003) Molecular epidemiology and mechanisms of carbapenem resistance in Acinetobacter baumannii endemic in New York city. Clin Infcet Dis 37: 214-20.
124 Bibliography
Queenan AM, Bush K. (2007) Carbapenemases: the versatile β-lactamases. Clin Microb Rev 20: 440-458.
Ramchandani M, Manges AR, DebRoy C, Smith SP, Johnson JR, Riley LW. (2005) Possible animal origin of human-associated multi-resistant, uropathogenic Escherichia coli. Clin Infect Dis 40: 251–257.
Randrianirina F, Vedy S, Rakotovao D, Ramarokoto CE, Ratsitohaina H, Carod JF, Ratsima E, Morillon M, Talarmin A. (2009) Role of contaminated aspiration tubes in nosocomial outbreak of Klebsiella pneumoniae producing SHV-2 and CTX-M-15 extendedspectrum β-lactamases. J Hosp Infect 72: 23-9.
Rathi MR, De AS, Mathur MM. (2011) Neonatal Septicemia due to Acinetobacter species and their Antimicrobial Susceptibility Pattern. Indian Medical Gazette 10: 391.
Reid G, Howard J, Gan BS. (2001) Can bacterial interference prevent infection? Trends Microbiol 9: 424–428.
Report of the National Neonatal Perinatal Database (NNPD) National Neonatology Forum 2003
Ristuccia AP; Burke AC. (1984) "Klebsiella". Top Clin Microbiol 5: 343–348.
Rodrigues C. (2011) Carbapenem-resistant Enterobacteriaceae: a reality check. Regional Health Forum 15: 83-86.
Rodriguez-Martinez J M, Poirel L, Nordmann P. (2009) Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother 53:4783–4788.
Rolain JM, Parola P, Cornaglia G. (2010) New Delhi metallo-beta-lactamase (NDM- 1): towards a new pandemia? Clin Microbiol Infect 16: 1699–701.
Roy S, Viswanathan R, Singh A, Das P, Basu S.(2010) Gut colonization by multidrug-resistant and carbapenem-resistant Acinetobacter baumannii in Maulananeonates. Azad Eur Library, J Clin Microbiol Aligarh Infect Dis 29: 1495Muslim–500. University Roy S, Viswanathan R, Singh AK, Das P, Basu S. (2011) Sepsis in neonates due to imipenem-resistant Klebsiella pneumoniae producing NDM-1 in India. J Agents Chemother 66:1411-3.
125 Bibliography
Russo TA, Johnson JR. (2000) A proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli: ExPEC. J Infect Dis 181: 1753–4.
Russo TA, Johnson JR. (2003) Medical and economic impact of extraintestinal infections due to Escherichia coli: focus on an increasingly important endemic problem. Microbes Infect 5: 449–456.
Ryan, K.J., Ray, C.G., ed. (2004) ―An Introduction to Infectious diseases‖. USA: McGraw-Hill 4th ed. Sherris Med Microb: 343-371.
Sahl JW, Del Franco M, Pournaras S, Colman RE, Karah N, Dijkshoorn L, Zarrilli R. (2015) Prevalence of extended-spectrum beta-lactamase genes in Acinetobacter baumannii strains isolated from nosocomial infections in Tehran, Iran. GMS Hyg Infect Control. 5: 15188.
Salazar G, Almeida A, Gomez M. (2013) Cedecea lapagei traumatic wound infection: case report and literature review. Rev Chilena Infectrol 30: 86-89.
Sartor AL, Raza MW, Abbasi SA, Day KM, Perry JD, Paterson DL, Sidjabat HE. (2014) Molecular epidemiology of NDM-1-producing Enterobacteriaceae and Acinetobacter baumannii isolates from Pakistan. Antimicrob Agents Chemother 58:5589-93.
Shah PM, Isaacs RD. (2003) Ertapenem, the first of a new group of carbapenems. J Antimicrob Chemother 52: 538–542.
Shemesh M, Tam A, Steinberg D. (2012) Expression of biofilm-associated genes of Streptococcus mutans in response to glucose and sucrose. J Med Microbiol 56: 1528-1535.
Shen Y, Xiao WQ, Gong JM, Pan J, Xu QX. (2016) Detection of New Delhi Metallo-
Beta-Lactamase (Encoded by NDM-1) in Enterobacter aerogenes in China. J Clin Lab Anal 31 :e22044.
Sidjabat HE, Townell N, Nimmo GR, George NM, Robson J, Vohra R, Davis L, MaulanaHeney C,Azad Paterson Library, DL. (2015) Dominance Aligarh of IMP -Muslim4-producing E. University cloacae amongst carbapenemase-producing Enterobacteriaceae in Australia. Antimicrob Agents Chemother 59: 4059-66.
Singleton P (1999). Bacteria in Biology, Biotechnology and Medicine (5th ed.). Wiley. pp. 444–454.
126 Bibliography
Sivanandan S, Soraisham AS, Swarnam K. (2011) Choice and duration of antimicrobial therapy for neonatal sepsis and meningitis. Int J Pediatr 712150.
Smith JL, Fratamico PM, Gunther NW. (2007) Extraintestinal pathogenic Escherichia coli (ExPEC): The ‗other bad E. coli‘. J Lab Clin Med 139: 155–62.
Stoesser N, Giess A, Batty EM, Sheppard AE, Walker AS, Wilson DJ, Didelot X, Bashir A, Sebra R, Kasarskis A, Sthapit B. (2014) Genome sequencing of an extended series of NDM producing Klebsiella pneumoniae isolates from neonatal infections in a Nepali hospital characterizes the extent of community versus hospital-associated transmission in an endemic setting. Antimicrob Agents Chemother 29: AAC-03900.
Stoll BJ, Hansen NI, Sánchez PJ, Faix RG, Poindexter BB, Van Meurs KP, Bizzarro MJ, Goldberg RN, Frantz ID, Hale EC, Shankaran S. (2011) Early onset neonatal sepsis: the burden of group Streptococcal and E. coli disease continues. Pediatrics 127: 817–826.
Stone PW, Gupta A, Loughrey M, Della-Latta P, Cimiotti J, Larson E, Rubenstein D, Saiman L. (2003) Attributable costs and length of stay of an extended- spectrum beta-lactamase-producing Klebsiella pneumoniae outbreak in a neonatal intensive care unit. Infect Control Hosp Epidemiol 24: 601-6.
Sundaram V, Kumar P, Dutta S, Mukhopadhyay K, Ray P, Gautam V, Narang A. (2009) Blood culture confirmed bacterial sepsis in neonates in a north Indian tertiary care center: changes over the last decade. Jpn J Infect Dis 62: 46-50.
Szmolka A, Nagy B. (2013) Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Front Microbiol 4: 258.
Tängdén T, Giske CG. (2015) Global dissemination of extensively drug-resistant carbapenemase-producing Enterobacteriaceae clinical perspectives on detection, treatment and infection control. J Intern Med 277: 501-512.
MaulanaTran HH, Azad Ehsani S, Library,Shibayama K, Matsui Aligarh M, Suzuki MuslimS, Nguyen MB, UniversityTran DN, Tran VP, Tran DL, Nguyen HT, Dang DA. (2015) Common isolation of New Delhi metallo-beta-lactamase 1-producing Enterobacteriaceae in a large surgical hospital in Vietnam. Eur J Clin Microbiol Infect Dis 34:1247-1254.
127 Bibliography
Tzouvelekis LS, Markogiannakis A, Psichogiou M, Tassios PT, Daikos GL. (2012) Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimension. Clin Microb Rev 2594: 682-707.
Unal S, Garcia-Rodriguez JA. (2005) Activity of meropenem and comparators against Pseudomonas aeruginosa and Acinetobacter spp. isolated in the MYSTIC Program, 2002–2004. Diagn Microbiol Infect Dis 53: 265–271.
Versalovic J, Koeuth P, Lupski R. (1991) Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res 24: 6823–31.
Viswanathan R, Singh AK, Basu S, Chatterjee S, Sardar S, Isaacs D. (2012) Multidrug resistant gram negative bacilli causing early neonatal sepsis in India. Arch Dis Child Fetal Neonatal Ed 97: F182–F187.
Voulgari E, Gartzonika C, Vrioni G, Politi L, Priavali E, Levidiotou-Stefanou S, Tsakris A. (2014) The Balkan region: NDM-1-producing Klebsiella pneumoniae ST11 clonal strain causing outbreaks in Greece. J Antimicrob Chemother 69: 2091-7.
Wallace KMP, Endimiani A, Taracila MA, Bonomo RA. (2011) Carbapenems : past, present and future. Antimicrob Agents Chemother 55: 4943-4960.
Walsh TR, Weeks J, Livermore DM, Toleman, MA. (2011) Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis 11:355-62.
Walsh TR. (2010) Emerging carbapenemases: a global perspective. Int J Antimicrob Agents. 36S3: S8–S14.
Wang J, Yuan M, Chen H, Chen X, Jia Y, Zhu X, Bai L, Bai X, Fanning S, Lu J, Li J. (2017) First report of Klebsiella oxytoca strain simultaneously producing NDM-1, IMP-4 and KPC-2 carbapenemases. Antimicrob Agents Chemother Maulana61: 00877 Azad-17. Library, Aligarh Muslim University Wang LH, Liu PP, Wei DD, Liu Y, Wan LG, Xiang TX, Zhang YJ. (2016a) Clinical isolates of uropathogenic Escherichia Galimand ST131 producing NDM-7 metallo-β-lactamase in China. J Antimicrob Chemother 48:41-5.
128 Bibliography
Wang Q, Zhang Y, Yao X, Xian H, Liu Y, Li H, Chen H, Wang X, Wang R, Zhao C, Cao B. (2016b) Risk factors and clinical outcomes for carbapenem-resistant Enterobacteriaceae nosocomial infections. Eur J ClinMicrobiol Infec Dis 35: 1679-89.
Wang Y, Wu C, Zhang Q, Qi J, Liu H, Wang Y, He T, Ma L, Lai J, Shen Z, Liu Y. (2012) Identification of New Delhi metallo-beta-lactamase 1 in Acinetobacter lwoffii of food animal origin. PLoS One 7: e37152.
WHO Young Infants Study Group. (199) Bacterial etiology of serious infections in young infants in developing countries: results of a multicenter study. Pediatric Infectious Disease Journal 18: S17–S22.
Williamson DA, Sidjabat HE, Freeman JT, Roberts SA, Silvey A, Woodhouse R, Mowat E, Dyet K, Paterson DL, Blackmore T, Burns A. (2012) Identification and molecular characterization of New Delhi metallo-β-lactamase-1 (NDM-1) and NDM-6-producing Enterobacteriaceae from New Zealand hospitals. Int J Antimicrob Agents 39: 529-533.
Wright GD. (2005) Bacterial resistance to antibiotics: enzymatic degradation and modification. Adv Drug Deliv Rev 57:1451-70.
Wu W, Feng Y, Tang G, Qiao F, McNally A, Zong Z. (2019) NDM Metallo-β- Lactamases and Their Bacterial Producers in Health Care Settings. Clin Microbiol Rev 32:e00115-18.
Xie Y, Kim KJ, Kim KS. (2004) Current concepts on Escherichia coli K1 translocation of the blood-brain barrier. FEMS Immunol Med Microbiol 42: 271–279.
Yang FC, Yan JJ, Hung KH, Wu JJ. (2012) Characterization of ertapenem resistant Enterobacter cloacae in a Taiwanese university hospital. J Clin Microb 50: 223-6. MaulanaYong D, Azad Toleman MA,Library, Giske CG, Cho Aligarh HS, Sundman Muslim K, Lee K, Walsh University TR. (2009) Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 53: 5046-54.
129 Bibliography
Yu F, Ying Q, Chen C, Li T, Ding B, Liu Y, Lu Y, Qin Z, Parsons C, Salgado C, Qu D. (2012) Outbreak of pulmonary infection caused by Klebsiella pneumoniae isolates harbouring blaIMP-4 and blaDHA-1 in a neonatal intensive care unit in China. J Med Microbiol 61: 984-9.
Zaidi AK, Huskins WC, Thaver D, Bhutta ZA, Abbas Z, Goldmann DA. (2005) Hospital-acquired neonatal infections in developing countries. Lancet 365: 1175-1188.
Zaidi AK, Thaver D, Ali SA, Khan TA. (2009) Pathogens associated with sepsis in newborns and young infants in developing countries. Pediatric Infectious Disease Journal 28: S10–S18.
Zhang F, Xie L, Wang X, Han L, Guo X, Ni Y, Qu H, Sun J. (2016) Further Spread of
blaNDM-5 in Enterobacteriaceae via IncX3 Plasmids in Shanghai, China. Front Microbial 7: 424.
Zhang X, Lou D, Xu Y, Shang Y, Li D, Huang X, Li Y, Hu L, Wang L, Yu F. (2013)
First identification of coexistence of blaNDM-1 and blaCMY-42 among Escherichia coli ST167 clinical isolates. BMC Microbiol 13: 282.
Zhu YQ, Zhao JY, Cha Xu HZ, Jia N, Li YN. (2016) Identification of an NDM-5- producing Escherichia coli sequence type 167 in a neonatal patient in China. Sci Rep 6: 29934.
Zmarlicka MT, Nailor MD, Nicolau DP. (2015) Impact of the New Delhi metallo- beta-lactamase on beta-lactam antibiotics. Infect Drug Resist 8: 297–309.
Maulana Azad Library, Aligarh Muslim University
130
List of Publications
Maulana Azad Library, Aligarh Muslim University
List of Publications
List of Publications
Nayeem Ahmad Shamsi Khalid, Syed M. Ali, and Asad U. Khan. "Occurrence of blaNDM variants among Enterobacteriaceae from a neonatal intensive care unit in a Northern India hospital." Frontiers in Microbiology. 2018; 9: 407.
Nayeem Ahmad Syed M. Ali, and Asad U. Khan. Detection of New Delhi metallo-β-lactamase variants NDM-4, NDM-5, and NDM-7 in Enterobacter aerogenes isolated from a neonatal intensive care unit of a North India Hospital: a first report. Microbial Drug Resistance. 2018; 24:161-5.
Nayeem Ahmad, Syed Manazir Ali, and Asad U. Khan. "First reported New Delhi Metallo-β-lactamase-1-producing Cedecea lapagei." International Journal of Antimicrobial Agents. 2017; 49:118-119.
Nayeem Ahmad, Syed Manazir Ali, and Asad U. Khan. Co-existence of blaNDM-1
and blaVIM-1 producing Moellerella wisconsensis in NICU of North Indian Hospital: a first report. Accepted in Journal of Infection in Developing Countries. 24 January 2019.
Nayeem Ahmad, Syed Manazir Ali, and Asad U. Khan. Molecular characterization of novel sequence type of carbapenem-resistant NDM-1 producing Klebsiella pneumoniae in NICU of Indian Hospital. International Journal of Antimicrobial Agents. 2019; 53:525-529.
Azna Zuberi Nayeem Ahmad and Asad U. Khan. "crisPri induced suppression of Fimbriae gene (fimH) of a Uropathogenic Escherichia coli: an approach to inhibit Microbial Biofilms." Frontiers in Immunology. 2017; 8: 1552.
Shamsi Khalid, Nayeem Ahmad and Asad U. Khan. Outbreak of efficiently transferred carbapenem-resistant NDM-producing Gram-negative bacilli isolated from NICU of an Indian Hospital. Under review in Microbial Drug Resistance. Maulana Azad Library, Aligarh Muslim University
List of Publications
List of Published Gene Sequences
NDM-1: Accession No.: KX231906, KX231907, KX231908, KX231913, KX231917, KX231924, KX231928, KX999119, KX999121, KX999139, KX999140, KX999143, MF360082, MF360086, MF360087, MF360088, MF360089, MF360091, MF360093, MF360094, MF360096, MF360098, MF360100, MH064484, MH064485, MH064486, MH064487, MH064488, MH064489, MH064491, MH064493, MH211124, MH064494, MH211125, MH211126, MH064495, MH211127, MH211128, MH211129, MH211130, MH211131, MH211132, MH211133, MH211134, MH211135.
NDM-4: Accession No.: KX231921, KX231923, KX231929, KX231930, KX999120, KX999124, KX999125, KX999126, KX999127, KX999128, KX999130, KX999131, KX999133, KX999134, KX999135, KX999137, KX999138, KX999141, KX999142, MF360080, MH064496.
NDM-5: Accession No.: KX231910, KX231911, KX231914, KX231915, KX231916, KX231918, KX231919, KX231920, KX231925, KX231926, KX231927, KX999122, KX999129, KX999132, KX999136, MF360081, MF360083, MF360084, MF360085, MF360090, MF360092, MF360095, MF360097, MF360099, MH064490, MH064492, MH211136, MH064497, MH064498, MG866171, MG866172, MG866173, MG866174, MH211137, MH211138, MH211139.
NDM-7: Accession No.: KX231909, KX231922, KX999123, MH211140.
Maulana Azad Library, Aligarh Muslim University
Conferences Attended
Maulana Azad Library, Aligarh Muslim University
List of Publications
Conferences Attended
Presented Poster entitled “Molecular characterization of novel sequence type of carbapenem-resistant NDM-1 producing Klebsiella pneumoniae in NICU of Indian Hospital” in the “International conference future diagnostic, therapeutic and theranostics modalities” held at Interdisciplinary Biotechnology Unit, AMU, Aligarh, from 29th-31st December 2018.
Presented Poster entitled “Dissemination of a novel sequence (ST3344) of carbapenem-resistant NDM-1 producing Klebsiella pneumoniae in NICU of north Indian Hospital” in the “International Symposium for Infectious Diseases” held at Regional center for Biotechnology Faridabad and Jamia hamdard University Delhi from 12th-14th November 2018.
Maulana Azad Library, Aligarh Muslim University