DOCSLIB.ORG

UHRF1 Gene Silencing Inhibits Cell Proliferation and Promotes Cell

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
UHRF1 Gene Silencing Inhibits Cell Proliferation and Promotes Cell View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector Ge et al. Journal of Ovarian Research (2016) 9:42 DOI 10.1186/s13048-016-0253-8 RESEARCH Open Access UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells Ting-Ting Ge, Meng Yang, Zhuo Chen, Ge Lou* and Tao Gu Abstract Background: Up-regulation of UHRF1 has been observed in a variety of cancers and appears to serve as an independent prognostic factor. Objective: To explore the effect of UHRF1 gene silencing on apoptosis and proliferation of cervical squamous cell carcinoma (CSCC) CaSki cells. Methods: This study consisted of 47 CSCC tissues and 40 normal cervical tissues. The CaSki cells were assigned into Blank group (CaSki cells not transfected), NC group (CaSki cells transfected with control siRNA), and UHRF1 Silence group (CaSki cells transfected with UHRF1 siRNA). qRT-PCR and Western blot were used for UHRF1 mRNA and protein expressions, CKK-8 assay for cell proliferation, flow cytometry for cell cycle and apoptosis, Western blot for expressions of apoptosis-related proteins. Nude mice tumor transplant experiment was performed. Results: UHRF1 exhibited higher mRNA and protein expressions in the CSCC tissues than normal cervical tissues (both P < 0.05). The cell proliferation ability in the UHRF1 Silence group was reduced when compared with the Blank group and the NC group, the cells at S-G2M stage in the UHRF1 Silence group were dropped when compared with the Blank group and the NC group (P < 0.05), while the cells at G0/G1 stage were elevated (P < 0.05), and the proportion of Annexin V positive cells in the UHRF1 Silence group was increased in comparison with the Blank group and the NC group (P < 0.05). Nude mice tumor transplant experiment indicated that the growth rate and weight of tumor in the Blank group and NC group was higher and heavier than the UHRF1 Silence group (P < 0.05). Conclusion: UHRF1 showed a high expression in CSCC and UHRF1 silencing can reduce proliferation and enhance apoptosis of the CaSki cells. Keywords: UHRF1, Cervical squamous cell carcinoma, CaSki cell line, Proliferation, Apoptosis Background refers to persistent human papillomavirus (HPV) in- Cervical cancer is the third most commonly diagnosed fection, which is detected in 99 % of patients with gynecologic cancer and the fourth major cause of death- cervical tumors [3]. Interestingly, cervical cancer de- related cancer in females worldwide, accounting for 9 % velops in a multi-step process that implicates the of the total new diagnoses and 8 % of the total cancer- transformation of normal cervical epithelium into pre- associated deaths among females in 2008 [1]. In China, neoplastic cervical intraepithelial neoplasia (CIN) that ul- there were 87,982 new patients diagnosed as cervical timately progress to invasive cervical cancer cells [4]. cancer and 23,375 deaths in 2011, and this disease has Accounting for 70 ~ 80 % of cervical cancers, cervical become one of the heaviest health burdens among squamous cell carcinoma (CSCC) consists of cells which Chinese women [2]. The major cause of cervical cancer are recognizably squamous but different from each other in term of growth pattern or cytological morphology [3]. * Correspondence: [email protected] The latest study reported there is no apparent symptom Department of Gynecology, Harbin Medical University Cancer Hospital, No. of early cervical cancer, while locally advanced disease 150 Haping Road, Nangang District, Harbin 150040, Heilongjiang Province, may result in abnormal vaginal bleeding, pelvic pain, People’s Republic of China © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Ge et al. Journal of Ovarian Research (2016) 9:42 Page 2 of 9 and dyspareunia [3]. Clearly, an improved understand- Quantificational real-time polymerase chain reaction ing of the gene or molecular mechanisms via which (qRT-PCR) pre-invasive lesions have the capability of invading qRT-PCR was used for the detection of UHRF1 expres- the cervical stroma and eventually metastasis would sion level in 47 cases of CSCC tissues, 40 normal cer- exert significantly clinical influence. vical tissues and differenttransfected CaSki cells (Blank UHRF1 [ubiquitin-like, containing plant homeodo- group, NC group, and UHRF1 Silence group). The main (PHD) and really interesting new gene (RING) tissues were washed 3 times with phosphate buffered sa- finger domains 1], also known as ICBP90 or Np95, is line (PBS). After 72-h culture, the cells were washed a member of UHRF family and encode a 95-kDa nu- again with PBS for 3 times. The total RNA extraction clear protein of 793 amino acids, with a single open was according to RNAiso Plus reagent kit (Takara Bio reading frame (ORF) [5]. It contains an N-terminal Inc., Dalian, China) and reverse transcription was oper- ubiquitylation-like domain, PHD, a SRA (SET and ated in conformity with PrimeScript RT reagent kit RING-associated) domain and a RING finger motif (Takara Bio Inc., Dalian, China). The SteponePlus PCR domain [6]. During the recent years, UHRF1 has re- (Applied Biosystem, Foster City, CA, USA) system ap- ceived great concerns as a novel diagnostic marker of plied for fluorescence quantitative test was following: cancer [7]. UHRF1 is featured by a SRA domain (Set cDNA solution 1.6 ul, 2X SYBR GREEN Taq PCR MIX and Ring Associated) only found in the UHRF family, (Takara Bio Inc., Dalian, China) 5 ul, PCR upstream and and up-regulation of UHRF1 has been observed in a downstream primers (10 uM, each 0.2 ul) and deuterium variety of cancers, such as lung cancer and bladder depleted water (DDW) 3 ul. Reaction condition was ini- cancer [8, 9]. Also, previous studies demonstrated tial denaturation at 95 °C for 5 min, 95 °C 10 s, 58 °C that the expression level of UHRF1 is closely associ- 10 s, and 72 °C for 10 s, 60 cycles and extension at 72 °C ated with clinical stage, metastatic and prognostic of for 10 min. The detection gene was UHRF1 (Gene ID bladder cancer and lung cancer [7, 9]. Furthermore, 29128) and internal reference gene was β-actin (Gene ID over-expression of UHRF1 is shown to contribute to 11461). The primers (Invitrogen Biotechnology Co. worse survival of laryngeal squamous cell carcinoma Shanghai, China) were listed in Table 1. The experiment (LSCC) and serve as an independent prognostic factor was repeated 3 times, and the average values were obtained. of LSCC [10]. Therefore, the present study aims at exploring the effects of silent UHRF1 on proliferation Western blot assay and apoptosis of human CSCC Caski cells and to After transfection of 3 days, the cells were washed, further study the related mechanism of cell apoptosis. added with Radio immunoprecipitation assay (RIPA) lysis buffer and protease inhibitor (Sigma, St. Louis, Methods USA) for homogenate, and centrifuged at 12,000 × g at Tissue collection and cell culture 4 °C for 10 min. After bicinchoninic acid (BCA) (Boi-rad A total of 47 cases of CSCC tissues and 40 cases of Laboratories, Inc, Hercules, California, USA) detection normal cervical tissues resected from benign tumors of the protein concentration, the supernatant was re- were collected from Harbin Medical University Cancer served at −80 °C. Western blot applied 10 % sodium Hospital from June 2013 to December 2015. The nor- dodecyl sulfate polyacrylamide gel electropheresis mal tissues were classified as the Control group and (SDS-PAGE) gel. Each well was added with 20 ug the CSCC tissues were as the CSCC group. The CSCC protein samples. The primary anti-bodies were Rabbit cell lines CaSki were obtained from cell bank of anti-human-UHRF1, Caspase3, Caspase8, Caspase9, Chinese Academy of Sciences. The cells were cultured Bax and Bcl-2 (Santa Cruz Biotechnology Inc., Santa in 90 % RPMI1640 (Gibco BRL Co. Led., New York, Cruz, CA, USA) and the cells were kept overnight at USA) and 10 % Fetal bovine serum (FBS) (Gibco BRL 4 °C. The secondary anti-body was POD-conjugated Life Technologies Inc., Grand Island, New York, USA). goat anti-rabbit (1:5000) and the cells were main- UHRF1 siRNA and control siRNA were purchased tained at room temperature for 30 min, which was from Santa Cruz (sc-76805, Santa Cruz Biotechnology added with horseradish peroxidase (HRP) (Boi-rad Inc., Santa Cruz, CA, USA). When the cells merged to 50 %, lentivirus diluted by medium solution were Table 1 PCR primer sequences added for transfection. After 24 h, the virus was aspi- Gene Primer sequence rated and normal solution was replaced. The cells were UHRF1 Forward: 5’- ACCAAGGTGGAGCCCTACAG -3’ classified into 3 groups: the Blank group (CaSki cells Reverse: 5’- CACTTTACTCAGGAACAACTGGAAC -3’ untransfected), the negative control (NC) group (CaSki β-actin Forward: 5’-CATCACGTACCAAACTTCAA-3’ cells transfected with control siRNA) and the UHRF1 Reverse: 5’-CATCACAGTACCGGATTGC-3’ Silence group (CaSki cells transfected with UHRF1 siRNA). Ge et al. Journal of Ovarian Research (2016) 9:42 Page 3 of 9 Laboratories,Inc,Hercules,California,USA).Image immunohistochemical analysis. Firstly, the paraffin Quant 350 and Image Quant TL-1 (GE Healthcare, sections were dewaxed and rehydrated and treated Fairfield, CT, USA) were applied to analyze the results.
Load more

Recommended publications
  • Ubiquitination/Deubiquitination and Acetylation/Deacetylation
    Acta Pharmacologica Sinica (2011) 32: 139–140 npg © 2011 CPS and SIMM All rights reserved 1671-4083/11 $32.00 www.nature.com/aps Research Highlight Ubiquitination/deubiquitination and acetylation/ deacetylation: Making DNMT1 stability more coordinated Qi HONG, Zhi-ming SHAO* Acta Pharmacologica Sinica (2011) 32: 139–140; doi: 10.1038/aps.2011.3 n mammals, DNA methylation plays important role in human cancers[7, 8]. abundance of DNMT1 mutant lacking Ia crucial role in the regulation of Ubiquitin­proteasome pathway is sig­ the HAUSP interaction domain, but not gene expression, telomere length, cell nificant in the stability of DNMT1[8], but the full­length protein. These results differentiation, X chromosome inactiva­ ubiquitin­mediated protein degradation show the coordination between ubiquit­ tion, genomic imprinting and tumori­ can be enhanced or attenuated by some ination of DNMT1 by UHRF1 and deu­ genesis[1]. DNA methylation patterns modifications like acetylation/deacety­ biquitination by HAUSP. Furthermore, are established de novo by DNA meth­ lation, protein methylation/demethyla­ they found that knockdown of HDAC1 yltransferases (DNMTs) 3a and 3b, tion, phosphorylation and S­nitrosy­ increased DNMT1 acetylation, and whereas DNMT1 maintains the parent­ lation[9–11]. Estève et al demonstrated reduced DNMT1 abundance. Addition­ specific methylation from parental cells that SET7­mediated lysine methy lation ally, acetyltransferase Tip60 which was to their progeny[2]. After DNA replica­ of DNMT1 decreased DNMT1 level found to acetylate DNMT1 promoted its tion, the new DNA strand is unmethy­ by ubiquitin­mediated degradation[10]. ubiquitination, then destabilized it. At lated. Thus with the mother methylated Furthermore, an early study[12] showed last, Tip60 and HAUSP were found to strand, the DNA is hemimethylated.
    [Show full text]
  • 1 AGING Supplementary Table 2
    SUPPLEMENTARY TABLES Supplementary Table 1. Details of the eight domain chains of KIAA0101. Serial IDENTITY MAX IN COMP- INTERFACE ID POSITION RESOLUTION EXPERIMENT TYPE number START STOP SCORE IDENTITY LEX WITH CAVITY A 4D2G_D 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ B 4D2G_E 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ C 6EHT_D 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ D 6EHT_E 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ E 6GWS_D 41-72 41 72 100 100 3.2Å PCNA X-RAY DIFFRACTION √ F 6GWS_E 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ G 6GWS_F 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ H 6IIW_B 2-11 2 11 100 100 1.699Å UHRF1 X-RAY DIFFRACTION √ www.aging-us.com 1 AGING Supplementary Table 2. Significantly enriched gene ontology (GO) annotations (cellular components) of KIAA0101 in lung adenocarcinoma (LinkedOmics). Leading Description FDR Leading Edge Gene EdgeNum RAD51, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, CENPW, HJURP, NDC80, CDCA5, NCAPH, BUB1, ZWILCH, CENPK, KIF2C, AURKA, CENPN, TOP2A, CENPM, PLK1, ERCC6L, CDT1, CHEK1, SPAG5, CENPH, condensed 66 0 SPC24, NUP37, BLM, CENPE, BUB3, CDK2, FANCD2, CENPO, CENPF, BRCA1, DSN1, chromosome MKI67, NCAPG2, H2AFX, HMGB2, SUV39H1, CBX3, TUBG1, KNTC1, PPP1CC, SMC2, BANF1, NCAPD2, SKA2, NUP107, BRCA2, NUP85, ITGB3BP, SYCE2, TOPBP1, DMC1, SMC4, INCENP. RAD51, OIP5, CDK1, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, ESCO2, CENPW, HJURP, TTK, NDC80, CDCA5, BUB1, ZWILCH, CENPK, KIF2C, AURKA, DSCC1, CENPN, CDCA8, CENPM, PLK1, MCM6, ERCC6L, CDT1, HELLS, CHEK1, SPAG5, CENPH, PCNA, SPC24, CENPI, NUP37, FEN1, chromosomal 94 0 CENPL, BLM, KIF18A, CENPE, MCM4, BUB3, SUV39H2, MCM2, CDK2, PIF1, DNA2, region CENPO, CENPF, CHEK2, DSN1, H2AFX, MCM7, SUV39H1, MTBP, CBX3, RECQL4, KNTC1, PPP1CC, CENPP, CENPQ, PTGES3, NCAPD2, DYNLL1, SKA2, HAT1, NUP107, MCM5, MCM3, MSH2, BRCA2, NUP85, SSB, ITGB3BP, DMC1, INCENP, THOC3, XPO1, APEX1, XRCC5, KIF22, DCLRE1A, SEH1L, XRCC3, NSMCE2, RAD21.
    [Show full text]
  • UHRF1 Depletion Suppresses Growth of Gallbladder Cancer Cells Through Induction of Apoptosis and Cell Cycle Arrest
    ONCOLOGY REPORTS 31: 2635-2643, 2014 UHRF1 depletion suppresses growth of gallbladder cancer cells through induction of apoptosis and cell cycle arrest YIYU QIN1, JIANDONG WANG1, WEI GONG1, MINGDI ZHANG1, ZHAOHUI TANG1, JUN ZHANG2 and ZHIWEI QUAN1 1Department of General Surgery and 2Ministry of Education-Shanghai Key Laboratory of Children's Environmental Health, Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine, Shanghai 200092, P.R. China Received December 28, 2013; Accepted February 21, 2014 DOI: 10.3892/or.2014.3145 Abstract. Ubiquitin-like containing PHD and RING finger proliferation and migration of GBC cells and may serve as a domains 1 (UHRF1), overexpressed in various human biomarker or even a therapeutic target for GBC. malignancies, functions as an important regulator in cell proliferation and epigenetic regulation. Depletion of UHRF1 Introduction has shown potential antitumor activities in several types of cancer. However, the role of UHRF1 in gallbladder cancer Gallbladder cancer (GBC) represents the most frequent and (GBC) has not been investigated. RT-PCR, western blotting aggressive type among biliary tract malignancies. Although and immunohistochemistry were performed to examine recent advances have been made in the diagnosis and treatment, UHRF1 expression at mRNA and protein levels in GBC tissues GBC has a poor overall prognosis with a 5-year survival rate and cell lines. UHRF1 siRNA and UHRF1 shRNA were used <10% (1). Currently, radical resection remains the mainstay of to deplete the expression of UHRF1. The results showed treatment for GBC. However, due to lacking typical symptoms that UHRF1 was overexpressed in GBC and its expression and specific biomarkers, most GBC patients are diagnosed correlated with advanced TNM stage and presence of lymph at advanced stages with unresectable tumors.
    [Show full text]
  • Uhrf1-Mediated Tnf-Α Gene Methylation Controls
    Uhrf1-Mediated Tnf-α Gene Methylation Controls Proinflammatory Macrophages in Experimental Colitis Resembling Inflammatory Bowel Disease This information is current as of September 30, 2021. Shanshan Qi, Yongkui Li, Zheng Dai, Mengxi Xiang, Guobin Wang, Lin Wang and Zheng Wang J Immunol published online 14 October 2019 http://www.jimmunol.org/content/early/2019/10/12/jimmun ol.1900467 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2019/10/12/jimmunol.190046 Material 7.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 30, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2019 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published October 14, 2019, doi:10.4049/jimmunol.1900467 The Journal of Immunology Uhrf1-Mediated Tnf-a Gene Methylation Controls Proinflammatory Macrophages in Experimental Colitis Resembling Inflammatory Bowel Disease Shanshan Qi,*,1 Yongkui Li,*,1 Zheng Dai,* Mengxi Xiang,* Guobin Wang,*,† Lin Wang,*,‡ and Zheng Wang*,† Macrophages drive the pathological process of inflammatory bowel diseases (IBD) mostly by secreting proinflammatory cytokines, such as Tnf-a.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.
    [Show full text]
  • M Phase Phosphorylation of the Epigenetic Regulator UHRF1 Regulates Its Physical Association with the Deubiquitylase USP7 and Stability
    M phase phosphorylation of the epigenetic regulator UHRF1 regulates its physical association with the deubiquitylase USP7 and stability Honghui Maa,1, Hao Chena,1, Xue Guoa,1, Zhentian Wanga, Mathew E. Sowab, Lijuan Zhenga, Shibin Hua, Pingyao Zenga, Rui Guoa, Jianbo Diaoa, Fei Lanc, J. Wade Harperb, Yujiang Geno Shia,d, Yanhui Xua,e,2, and Yang Shia,b,f,g,2 aLaboratory of Epigenetics, Institute of Biomedical Sciences, and Department of Biochemistry, Fudan University Medical School, 138 Yixue Yuan Road, Shanghai 200032, China; bDepartment of Cell Biology, Harvard Medical School, 77 Avenue Louis Pasteur, Boston, MA 02115; cConstellation Pharmaceuticals, 215 First Street, Cambridge, MA 02140; dEndocrinology Division, Brigham and Women Hospital, Harvard Medical School, Boston, MA 02115; eState Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China; fDepartment of Biochemistry, Fudan University Medical School, 138 Yixue Yuan Road, Shanghai 200032, China; and gDivision of Newborn Medicine and Program in Epigenetics, Department of Medicine, Children’s Hospital, Harvard Medical School, 300 Longwood Avenue, Boston, MA 02115 Edited by Tony Hunter, The Salk Institute for Biological Studies, La Jolla, CA, and approved January 27, 2012 (received for review October 7, 2011) UHRF1 (Ubiquitin-like, with PHD and RING finger domains 1) plays question, we have recently undertaken a proteomics approach an important role in DNA CpG methylation, heterochromatin and identified a cell cycle signaling-regulated physical interaction function and gene expression. Overexpression of UHRF1 has been of UHRF1 with the deubiquitylase USP7 (HAUSP) (8, 9) and suggested to contribute to tumorigenesis. However, regulation of demonstrated that it is important for protecting UHRF1 from UHRF1 is largely unknown.
    [Show full text]
  • P90 and UHRF1, Two Novel Regulators of the P53 Signaling Pathway
    p90 and UHRF1, Two Novel Regulators of the p53 Signaling Pathway Chao Dai Submitted in partial fulfillment of the Requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 ©2013 Chao Dai All Rights Reserved ABSTRACT p90 and UHRF1, Two Novel Regulators of the p53 Signaling Pathway Chao Dai To ensure proper and differentiated regulation of stress response pathways, the p53 tumor suppressor calls for an intricate network of control of activation and fine tuning of transcription activity, which is offered largely through post- translational modifications. Accumulating evidence supports the indispensability of acetylation in the activation of p53 function and indicates modulation of cell fate decision; however the underlying molecular mechanisms are not well understood and identification of the regulatory mechanisms controlling p53 acetylation remains an important step in furthering the understanding of p53 regulation in vivo. In this study we identify p90 and UHRF1 as two novel members of the p53 regulatory network upstream of TIP60-mediated p53 acetylation. Through biochemical purification, p90 was identified as a unique regulator for p53. p90 (also called CCDC8, coiled-coil domain containing 8) interacts with p53 both in vitro and in vivo. Depletion of p90 by RNAi has no obvious effect on p53 stability or p53-mediated activation of p21, but specifically abrogates PUMA activation. Moreover, p90 also interacts with the TIP60 acetyltransferase and stimulates TIP60-dependent Lys120 acetylation of p53, therefore enhancing the apoptotic response of p53. These data reveal p90 as an upstream regulator of the Tip60-p53 interaction and demonstrate that p90 is specifically required for p53- mediated apoptosis upon DNA damage.
    [Show full text]
  • Coordinated Dialogue Between UHRF1 and DNMT1 to Ensure Faithful Inheritance of Methylated DNA Patterns
    G C A T T A C G G C A T genes Review Coordinated Dialogue between UHRF1 and DNMT1 to Ensure Faithful Inheritance of Methylated DNA Patterns Christian Bronner 1,*, Mahmoud Alhosin 2, Ali Hamiche 1 and Marc Mousli 3 1 Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), Université de Strasbourg, INSERM U1258 CNRS UMR 7104, 1 rue Laurent Fries, 67404, Illkirch, France; [email protected] 2 Department of Biochemistry, Faculty of Science and Cancer and Mutagenesis Unit, King Fahd Medical Research Center, King Abdulaziz University, Jeddah, Saudi Arabia; [email protected] 3 Laboratoire de Bioimagerie et Pathologies, Faculté de Pharmacie, Université de Strasbourg, CNRS UMR 7021, 67401 Illkirch, France; [email protected] * Correspondence: [email protected]; Tel.: +33-88-65-33-48 Received: 26 November 2018; Accepted: 11 January 2019; Published: 18 January 2019 Abstract: DNA methylation, catalyzed by DNA methyltransferases (DNMTs), is an epigenetic mark that needs to be faithfully replicated during mitosis in order to maintain cell phenotype during successive cell divisions. This epigenetic mark is located on the 50-carbon of the cytosine mainly within cytosine–phosphate–guanine (CpG) dinucleotides. DNA methylation is asymmetrically positioned on both DNA strands, temporarily generating a hemi-methylated state after DNA replication. Hemi-methylation is a particular status of DNA that is recognized by ubiquitin-like containing plant homeodomain (PHD) and really interesting new gene (RING) finger domains 1 (UHRF1) through its SET- (Su(var)3-9, Enhancer-of-zeste and Trithorax) and RING-associated (SRA) domain. This interaction is considered to be involved in the recruitment of DNMT1 to chromatin in order to methylate the adequate cytosine on the newly synthetized DNA strand.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Download Product Insert (PDF)
    PRODUCT INFORMATION UHRF1 PHD domain (human recombinant) Item No. 14777 Overview and Properties Synonyms: E3 Ubiquitin-protein Ligase UHRF1, Inverted CCAAT Box Binding Protein of 90 kDa, Nuclear Protein 95, RING Finger Protein 106, Transcription Factor ICBP90, Ubiquitin-like PHD and RING Finger Domain-containing Protein 1 Source: Recombinant N-terminal GST-tagged protein expressed in E. coli Amino Acids: 298-366 Uniprot No.: Q96T88 Molecular Weight: 35.5 kDa Storage: -80°C (as supplied) Stability: ≥1 year Purity: batch specific (≥95% estimated by SDS-PAGE) Supplied in: 50 mM Tris, pH 8.0, containing 150 mM sodium chloride and 20% glycerol Endotoxin Testing: < 1.0 EU/μg, determined by the LAL endotoxin assay Protein Concentration: 1.0 mg/ml Activity: batch specific U/ml Specific Activity: batch specific U/mg Information represents the product specifications. Batch specific analytical results are provided on each certificate of analysis. Image 1 2 3 4 5 250 kDa · · · · · · · 150 kDa · · · · · · · 100 kDa · · · · · · · 75 kDa · · · · · · · 50 kDa · · · · · · · 37 kDa · · · · · · · 25 kDa · · · · · · · 20 kDa · · · · · · · Lane 1: MW Markers Lane 2: UHRF1 PHD domain (1 µg) Lane 3: UHRF1 PHD domain (2 µg) Lane 4: UHRF1 PHD domain (5 µg) Lane 5: UHRF1 PHD domain (10 µg) WARNING CAYMAN CHEMICAL THIS PRODUCT IS FOR RESEARCH ONLY - NOT FOR HUMAN OR VETERINARY DIAGNOSTIC OR THERAPEUTIC USE. 1180 EAST ELLSWORTH RD SAFETY DATA ANN ARBOR, MI 48108 · USA This material should be considered hazardous until further information becomes available. Do not ingest, inhale, get in eyes, on skin, or on clothing. Wash thoroughly after handling. Before use, the user must review the complete Safety Data Sheet, which has been sent via email to your institution.
    [Show full text]
  • UHRF1 and the DNA Damage Response
    UHRF1 and the DNA damage response by Helena Sumantrai Mistry A thesis submitted in conformity with the requirements For the Degree of Doctor of Philosophy Graduate Department of Pharmacology & Toxicology University of Toronto ©Copyright by Helena Sumantrai Mistry 2011 UHRF1 and the DNA damage response Helena Sumantrai Mistry Doctor of Philosophy, 2011 Graduate Department of Pharmacology & Toxicology University of Toronto THESIS ABSTRACT Our DNA is under constant threat from endogenous and exogenous damaging agents. Our cells have evolved a network of signaling pathways and repair mechanisms that detect and counteract this threat, collectively referred to as the DNA damage response. Cells that lose the ability to cope with DNA damage risk the acquisition of deleterious changes to DNA sequence or structure. I initially set out to identify and characterize candidate proteins that interact with Mus81- Eme1, an endonuclease that processes DNA intermediates that arise from aberrant or stalled DNA replication. I focused on one interesting candidate protein known as Nuclear protein 95 (Np95) which now is called UHRF1 (Ubiquitin-like, containing PHD and RING finger domains, 1). Although previous studies demonstrate the importance of Mus81-Eme1 enzyme in DNA repair, genome integrity, and tumor suppression, little is known about how the enzyme acts together with other components of signaling pathways that comprise the DNA damage response. My findings in chapter two characterized this interaction and linked Mus81-Eme1 with UHRF1 in the cellular response to DNA damage. Although UHRF1 levels have been linked with sensitivity to antineoplastic agents, a direct role for UHRF1 in the DNA damage response had not been elucidated or reported.
    [Show full text]
  • Exogenous Expression of UHRF1 Promotes Proliferation and Metastasis of Breast Cancer Cells
    ONCOLOGY REPORTS 28: 375-383, 2012 Exogenous expression of UHRF1 promotes proliferation and metastasis of breast cancer cells XIN-LI LI1*, JIU-HONG XU3*, JI-HUA NIE1 and SAI-JUN FAN2 1School of Public Health, and 2School of Radiation Medicine and Protection, Medical College of Soochow University, Suzhou 215123, Jiangsu; 3Department of Radiotherapy, The First Affiliated Hospital of Soochow University, Suzhou 215006, Jiangsu, P.R. China Received January 25, 2012; Accepted April 5, 2012 DOI: 10.3892/or.2012.1792 Abstract. In the present study, we investigated the role of interacting with PTEN and maspin. Thus, UHRF1 may serve UHRF1 (ubiquitin-like protein containing PHD and RING as a new therapy target for breast cancer. finger domains 1) in proliferation, invasion and migra- tion of breast cancer cells, and the potential mechanisms Introduction were also explored. Cell proliferation was examined by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium Breast cancer is one of the most common diseases among bromide (MTT) assay; cell cycle distribution and apoptosis women world-wide, and more than 1/3 breast cancer patients were evaluated using flow cytometry; protein expression was run high risk of recurrence and migration per year, which determined by western blotting; angiogenesis of xenografts is the main reason that leads to poor clinical outcomes and was assessed by microvessel density (MVD); cell invasion was caused death of patients. Furthermore, in China the incidence measured using transwell chamber; cell migration was deter- of young breast cancer patients is increasing, thus it is impera- mined by wound scratching assay. Our results demonstrated tive to find more effective treatment to prevent metastasis of that UHRF1 transfection conferred serum independence to breast cancer patients.
    [Show full text]