View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector Ge et al. Journal of Ovarian Research (2016) 9:42 DOI 10.1186/s13048-016-0253-8 RESEARCH Open Access UHRF1 gene silencing inhibits cell proliferation and promotes cell apoptosis in human cervical squamous cell carcinoma CaSki cells Ting-Ting Ge, Meng Yang, Zhuo Chen, Ge Lou* and Tao Gu Abstract Background: Up-regulation of UHRF1 has been observed in a variety of cancers and appears to serve as an independent prognostic factor. Objective: To explore the effect of UHRF1 gene silencing on apoptosis and proliferation of cervical squamous cell carcinoma (CSCC) CaSki cells. Methods: This study consisted of 47 CSCC tissues and 40 normal cervical tissues. The CaSki cells were assigned into Blank group (CaSki cells not transfected), NC group (CaSki cells transfected with control siRNA), and UHRF1 Silence group (CaSki cells transfected with UHRF1 siRNA). qRT-PCR and Western blot were used for UHRF1 mRNA and protein expressions, CKK-8 assay for cell proliferation, flow cytometry for cell cycle and apoptosis, Western blot for expressions of apoptosis-related proteins. Nude mice tumor transplant experiment was performed. Results: UHRF1 exhibited higher mRNA and protein expressions in the CSCC tissues than normal cervical tissues (both P < 0.05). The cell proliferation ability in the UHRF1 Silence group was reduced when compared with the Blank group and the NC group, the cells at S-G2M stage in the UHRF1 Silence group were dropped when compared with the Blank group and the NC group (P < 0.05), while the cells at G0/G1 stage were elevated (P < 0.05), and the proportion of Annexin V positive cells in the UHRF1 Silence group was increased in comparison with the Blank group and the NC group (P < 0.05). Nude mice tumor transplant experiment indicated that the growth rate and weight of tumor in the Blank group and NC group was higher and heavier than the UHRF1 Silence group (P < 0.05). Conclusion: UHRF1 showed a high expression in CSCC and UHRF1 silencing can reduce proliferation and enhance apoptosis of the CaSki cells. Keywords: UHRF1, Cervical squamous cell carcinoma, CaSki cell line, Proliferation, Apoptosis Background refers to persistent human papillomavirus (HPV) in- Cervical cancer is the third most commonly diagnosed fection, which is detected in 99 % of patients with gynecologic cancer and the fourth major cause of death- cervical tumors [3]. Interestingly, cervical cancer de- related cancer in females worldwide, accounting for 9 % velops in a multi-step process that implicates the of the total new diagnoses and 8 % of the total cancer- transformation of normal cervical epithelium into pre- associated deaths among females in 2008 [1]. In China, neoplastic cervical intraepithelial neoplasia (CIN) that ul- there were 87,982 new patients diagnosed as cervical timately progress to invasive cervical cancer cells [4]. cancer and 23,375 deaths in 2011, and this disease has Accounting for 70 ~ 80 % of cervical cancers, cervical become one of the heaviest health burdens among squamous cell carcinoma (CSCC) consists of cells which Chinese women [2]. The major cause of cervical cancer are recognizably squamous but different from each other in term of growth pattern or cytological morphology [3]. * Correspondence: [email protected] The latest study reported there is no apparent symptom Department of Gynecology, Harbin Medical University Cancer Hospital, No. of early cervical cancer, while locally advanced disease 150 Haping Road, Nangang District, Harbin 150040, Heilongjiang Province, may result in abnormal vaginal bleeding, pelvic pain, People’s Republic of China © 2016 The Author(s). Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Ge et al. Journal of Ovarian Research (2016) 9:42 Page 2 of 9 and dyspareunia [3]. Clearly, an improved understand- Quantificational real-time polymerase chain reaction ing of the gene or molecular mechanisms via which (qRT-PCR) pre-invasive lesions have the capability of invading qRT-PCR was used for the detection of UHRF1 expres- the cervical stroma and eventually metastasis would sion level in 47 cases of CSCC tissues, 40 normal cer- exert significantly clinical influence. vical tissues and differenttransfected CaSki cells (Blank UHRF1 [ubiquitin-like, containing plant homeodo- group, NC group, and UHRF1 Silence group). The main (PHD) and really interesting new gene (RING) tissues were washed 3 times with phosphate buffered sa- finger domains 1], also known as ICBP90 or Np95, is line (PBS). After 72-h culture, the cells were washed a member of UHRF family and encode a 95-kDa nu- again with PBS for 3 times. The total RNA extraction clear protein of 793 amino acids, with a single open was according to RNAiso Plus reagent kit (Takara Bio reading frame (ORF) [5]. It contains an N-terminal Inc., Dalian, China) and reverse transcription was oper- ubiquitylation-like domain, PHD, a SRA (SET and ated in conformity with PrimeScript RT reagent kit RING-associated) domain and a RING finger motif (Takara Bio Inc., Dalian, China). The SteponePlus PCR domain [6]. During the recent years, UHRF1 has re- (Applied Biosystem, Foster City, CA, USA) system ap- ceived great concerns as a novel diagnostic marker of plied for fluorescence quantitative test was following: cancer [7]. UHRF1 is featured by a SRA domain (Set cDNA solution 1.6 ul, 2X SYBR GREEN Taq PCR MIX and Ring Associated) only found in the UHRF family, (Takara Bio Inc., Dalian, China) 5 ul, PCR upstream and and up-regulation of UHRF1 has been observed in a downstream primers (10 uM, each 0.2 ul) and deuterium variety of cancers, such as lung cancer and bladder depleted water (DDW) 3 ul. Reaction condition was ini- cancer [8, 9]. Also, previous studies demonstrated tial denaturation at 95 °C for 5 min, 95 °C 10 s, 58 °C that the expression level of UHRF1 is closely associ- 10 s, and 72 °C for 10 s, 60 cycles and extension at 72 °C ated with clinical stage, metastatic and prognostic of for 10 min. The detection gene was UHRF1 (Gene ID bladder cancer and lung cancer [7, 9]. Furthermore, 29128) and internal reference gene was β-actin (Gene ID over-expression of UHRF1 is shown to contribute to 11461). The primers (Invitrogen Biotechnology Co. worse survival of laryngeal squamous cell carcinoma Shanghai, China) were listed in Table 1. The experiment (LSCC) and serve as an independent prognostic factor was repeated 3 times, and the average values were obtained. of LSCC [10]. Therefore, the present study aims at exploring the effects of silent UHRF1 on proliferation Western blot assay and apoptosis of human CSCC Caski cells and to After transfection of 3 days, the cells were washed, further study the related mechanism of cell apoptosis. added with Radio immunoprecipitation assay (RIPA) lysis buffer and protease inhibitor (Sigma, St. Louis, Methods USA) for homogenate, and centrifuged at 12,000 × g at Tissue collection and cell culture 4 °C for 10 min. After bicinchoninic acid (BCA) (Boi-rad A total of 47 cases of CSCC tissues and 40 cases of Laboratories, Inc, Hercules, California, USA) detection normal cervical tissues resected from benign tumors of the protein concentration, the supernatant was re- were collected from Harbin Medical University Cancer served at −80 °C. Western blot applied 10 % sodium Hospital from June 2013 to December 2015. The nor- dodecyl sulfate polyacrylamide gel electropheresis mal tissues were classified as the Control group and (SDS-PAGE) gel. Each well was added with 20 ug the CSCC tissues were as the CSCC group. The CSCC protein samples. The primary anti-bodies were Rabbit cell lines CaSki were obtained from cell bank of anti-human-UHRF1, Caspase3, Caspase8, Caspase9, Chinese Academy of Sciences. The cells were cultured Bax and Bcl-2 (Santa Cruz Biotechnology Inc., Santa in 90 % RPMI1640 (Gibco BRL Co. Led., New York, Cruz, CA, USA) and the cells were kept overnight at USA) and 10 % Fetal bovine serum (FBS) (Gibco BRL 4 °C. The secondary anti-body was POD-conjugated Life Technologies Inc., Grand Island, New York, USA). goat anti-rabbit (1:5000) and the cells were main- UHRF1 siRNA and control siRNA were purchased tained at room temperature for 30 min, which was from Santa Cruz (sc-76805, Santa Cruz Biotechnology added with horseradish peroxidase (HRP) (Boi-rad Inc., Santa Cruz, CA, USA). When the cells merged to 50 %, lentivirus diluted by medium solution were Table 1 PCR primer sequences added for transfection. After 24 h, the virus was aspi- Gene Primer sequence rated and normal solution was replaced. The cells were UHRF1 Forward: 5’- ACCAAGGTGGAGCCCTACAG -3’ classified into 3 groups: the Blank group (CaSki cells Reverse: 5’- CACTTTACTCAGGAACAACTGGAAC -3’ untransfected), the negative control (NC) group (CaSki β-actin Forward: 5’-CATCACGTACCAAACTTCAA-3’ cells transfected with control siRNA) and the UHRF1 Reverse: 5’-CATCACAGTACCGGATTGC-3’ Silence group (CaSki cells transfected with UHRF1 siRNA). Ge et al. Journal of Ovarian Research (2016) 9:42 Page 3 of 9 Laboratories,Inc,Hercules,California,USA).Image immunohistochemical analysis. Firstly, the paraffin Quant 350 and Image Quant TL-1 (GE Healthcare, sections were dewaxed and rehydrated and treated Fairfield, CT, USA) were applied to analyze the results.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages9 Page
-
File Size-