BD4 (DEFB104A) (NM 080389) Human Untagged Clone Product Data

Total Page：16

File Type：pdf, Size：1020Kb

BD4 (DEFB104A) (NM 080389) Human Untagged Clone Product Data

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC305782 BD4 (DEFB104A) (NM_080389) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: BD4 (DEFB104A) (NM_080389) Human Untagged Clone Tag: Tag Free Symbol: DEFB104A Synonyms: BD-4; DEFB-4; DEFB4; DEFB104; hBD-4 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_080389, the custom clone sequence may differ by one or more nucleotides ATGCAGAGACTTGTGCTGCTATTAGCCATTTCTCTTCTACTCTATCAAGATCTTCCAGTGAGAAGCGAAT TTGAATTGGACAGAATATGTGGTTATGGGACTGCCCGTTGCCGGAAGAAATGTCGCAGCCAAGAATACAG AATTGGAAGATGTCCCAACACCTATGCATGCTGTTTGAGAAAATGGGATGAGAGCTTACTGAATCGTACA AAACCCTGA Restriction Sites: SgfI-MluI ACCN: NM_080389 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_080389.2, NP_525128.2 RefSeq Size: 281 bp RefSeq ORF: 219 bp Locus ID: 140596 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 BD4 (DEFB104A) (NM_080389) Human Untagged Clone – SC305782 UniProt ID: Q8WTQ1 Protein Families: Secreted Protein Gene Summary: Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 104, DEFB104A and DEFB104B, in head-to-head orientation. This gene, DEFB104A, represents the more centromeric copy. [provided by RefSeq, Oct 2014] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

Copy Link

Recommended publications

Manual Annotation and Analysis of the Defensin Gene Cluster in the C57BL
BMC Genomics BioMed Central Research article Open Access Manual annotation and analysis of the defensin gene cluster in the C57BL/6J mouse reference genome Clara Amid*†1, Linda M Rehaume*†2, Kelly L Brown2,3, James GR Gilbert1, Gordon Dougan1, Robert EW Hancock2 and Jennifer L Harrow1 Address: 1Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire CB10 1SA, UK, 2University of British Columbia, Centre for Microbial Disease & Immunity Research, 2259 Lower Mall, Vancouver, BC, V6T 1Z4, Canada and 3Department of Rheumatology and Inflammation Research, Göteborg University, Guldhedsgatan 10, S-413 46 Göteborg, Sweden Email: Clara Amid* - [email protected]; Linda M Rehaume* - [email protected]; Kelly L Brown - [email protected]; James GR Gilbert - [email protected]; Gordon Dougan - [email protected]; Robert EW Hancock - [email protected]; Jennifer L Harrow - [email protected] * Corresponding authors †Equal contributors Published: 15 December 2009 Received: 15 May 2009 Accepted: 15 December 2009 BMC Genomics 2009, 10:606 doi:10.1186/1471-2164-10-606 This article is available from: http://www.biomedcentral.com/1471-2164/10/606 © 2009 Amid et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Host defense peptides are a critical component of the innate immune system. Human alpha- and beta-defensin genes are subject to copy number variation (CNV) and historically the organization of mouse alpha-defensin genes has been poorly defined.
[Show full text]
Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
[Show full text]
High-Resolution Analysis of Chromosomal Alterations in Adult Acute Lymphoblastic Leukemia
Elmer Press Original Article J Hematol. 2014;3(3):65-71 High-Resolution Analysis of Chromosomal Alterations in Adult Acute Lymphoblastic Leukemia Lam Kah Yuena, c, Zakaria Zubaidaha, Ivyna Bong Pau Nia, Megat Baharuddin Puteri Jamilatul Noora, Esa Ezaliaa, Chin Yuet Menga, Ong Tee Chuanb, Vegappan Subramanianb, Chang Kiang Mengb Abstract Introduction Background: Chromosomal alterations occur frequently in acute Acute lymphoblastic leukemia (ALL) is a heterogeneous lymphoblastic leukemia (ALL), affecting either the chromosome disease, resulting from the accumulation of chromosomal al- number or structural changes. These alterations can lead to inacti- terations either in the form of numerical or structural chang- vation of tumor suppressor genes and/or activation of oncogenes. es such as amplification, deletion, inversion or translocation. The objective of this study was to identify recurrent and/or novel The frequency of chromosomal alterations in adult ALL is chromosomal alterations in adult ALL using single nucleotide poly- 64-85% [1], compared to 60-69% in childhood ALL. Trans- morphism (SNP) array analysis. location t(9.22), one of the most common recurring chromo- Methods: We studied 41 cases of adult ALL compared with healthy somal alterations, is found in 20-40% adult ALL patients [2], normal controls using SNP array. and its incidence increases with age. Some of the chromo- somal alterations are significantly associated with remission Results: Our analysis revealed 43 copy number variant regions, duration, complete remission rate and disease-free survival of which 44% were amplifications and 56% were deletions. The [1]. Increasing age is also associated with lower remission most common amplifications were on chromosome regions 8p23.1 rates, shorter remissions and poor outcomes in adult ALL (71%), 1q44 (66%), 1q23.3 (54%), 11q23.3 (54%), 12p13.33 [1].
[Show full text]
[Inserm-00719917, V1] Integrated Analysis of Somatic Mutations and Focal Copy-Number Changes Identifies Key Genes and Pathways I
a Final target bases 46.2 Mb Target bases covered 43.3 Mb Percent target bases covered 93.81% Average depth 73.3 Median depth 70 Coverage at 25x 75.9% Coverage at 10x 87.0% Coverage at 4x 92.3% Coverage at 1x 96.0% b 100 75 50 25 Reads depth (X) depth Reads 0 1 2 3 4 5 6 7 8 9 5 6 2 10 11 12 13 14 1 1 17 18 19 20 21 2 X # Chromosome c 1.0 Author manuscript, published in "Nature Genetics 2012;44(6):694-8" 0.8 0.6 0.4 Coverage in target regions target in 0.2 Coveragex1 Coveragex4 Coveragex10 Coveragex25 0.0 1 2 3 4 5 6 7 8 9 5 8 1 4 7 8 1 4 10 11 12 13 14 1 16 17 1 19 20 2 22 23 2 25 26 2 28 29 30 31 32 33 34 35 36 37 3 39 40 4 42 43 4 45 46 47 48 # Exomes DOI : Supplementary Figure 1. Statistics of mapping of sequencing reads 10.1038/ng.2256 inserm-00719917, version 1 - 22 Jul 2012 a, summary statistics for whole-exome sequence reads of 24 HCC with their non tumor liver tissues. b, mean depth (with 95% IC) of reads on each chromosome, c, cumulative fraction of coding bases covered in captured regions. A 1-fold, 4-fold, 10-fold and 25- fold coverage were considered (mean with 95% IC) per exome (numbered #1-48). $ Bioinforma5cs$workﬂow$ Variant$calling$Tumor$ ! Variant$calling$Normal$ 1,775,892$variants$ $ Database$extrac5on$ ! dbSNP$ 1,577,724$$ 198,168$ $ background$known$polymorphisms$ $ Coding$SNPs/Indels$ (targeted$sequencing$of$exons)$ ! Intronic,$ 16,498$ UTR$ synonymous$$ 65,947$ variants$ non$coding$variants$ 44,172$nonsynonymous$ $coding$SNPs/Indels$ $ $ Quality$check$of$reads$ (Mean$size$±3SD,$Paired$end,$Phred$>=10,$$N>=$6)$
[Show full text]
Effects of Sphingosine-1-Phosphate on Cell Viability, Differentiation, And
International Journal of Molecular Sciences Article Effects of Sphingosine-1-Phosphate on Cell Viability, Differentiation, and Gene Expression of Adipocytes Xiyuan Wu 1, Meena Kishore Sakharkar 1, Martin Wabitsch 2 and Jian Yang 1,* 1 Drug Discovery and Development Research Group, College of Pharmacy and Nutrition, University of Saskatchewan, 107 Wiggins Road, Saskatoon, SK S7N 5E5, Canada; [email protected] (X.W.); [email protected] (M.K.S.) 2 Department of Pediatrics and Adolescent Medicine, Ulm University Medical Center, Eythstr. 24, 89075 Ulm, Germany; [email protected] * Correspondence: [email protected] Received: 29 October 2020; Accepted: 4 December 2020; Published: 5 December 2020 Abstract: Sphingosine-1-phosphate (S1P) is a highly potent sphingolipid metabolite, which controls numerous physiological and pathological process via its extracellular and intracellular functions. The breast is mainly composed of epithelial cells (mammary gland) and adipocytes (stroma). Adipocytes play an important role in regulating the normal functions of the breast. Compared to the vast amount studies on breast epithelial cells, the functions of S1P in breast adipocytes are much less known. Thus, in the current study, we used human preadipocyte cell lines SGBS and mouse preadipocyte cell line 3T3-L1 as in vitro models to evaluate the effects of S1P on cell viability, differentiation, and gene expression in adipocytes. Our results showed that S1P increased cell viability in SGBS and 3T3-L1 preadipocytes but moderately reduced cell viability in differentiated SGBS and 3T3-L1 adipocytes. S1P was also shown to inhibit adipogenic differentiation of SGBS and 3T3-L1 at concentration higher than 1000 nM.
[Show full text]
IL17A Antibody Rabbit Polyclonal Antibody Catalog # ALS14963
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 IL17A Antibody Rabbit Polyclonal Antibody Catalog # ALS14963 Specification IL17A Antibody - Product Information Application WB Primary Accession Q16552 Reactivity Human Host Rabbit Clonality Polyclonal Calculated MW 18kDa KDa IL17A Antibody - Additional Information Gene ID 3605 Other Names Interleukin-17A, IL-17, IL-17A, Cytotoxic Western Blot (non-reducing) of IL-17 T-lymphocyte-associated antigen 8, CTLA-8, antibody ALS14963 IL17A, CTLA8, IL17 Target/Specificity Human IL-17A Reconstitution & Storage Store Lyophilized at room temperature up to 1 month; Reconstituted for up to two weeks at 2-8°C. Aliquot and freeze at -20°C for long term storage. Avoid freeze/thaw cycles. Precautions IL17A Antibody is for research use only and not for use in diagnostic or therapeutic procedures. Western Blot (reducing) of IL-17 antibody ALS14963 IL17A Antibody - Protein Information Name IL17A IL17A Antibody - Background Synonyms CTLA8, IL17 Induces stromal cells to produce proinflammatory and hematopoietic cytokines. Function Enhances the surface expression of Effector cytokine of innate and adaptive ICAM1/intracellular adhesion molecule 1 in immune system involved in antimicrobial fibroblasts. host defense and maintenance of tissue integrity (PubMed:<a href="http://www.uni IL17A Antibody - References prot.org/citations/24120361" Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 target="_blank">24120361</a>). Signals Fossiez F.,et al.J. Exp. Med. via IL17RA-IL17RC heterodimeric receptor 183:2593-2603(1996). complex, triggering homotypic interaction Yao Z.,et al.J.
[Show full text]
Identification of a Genetic Signature of Response to Fulvestrant in Advanced Hormone Receptor Positive Breast Cancer
Author Manuscript Published OnlineFirst on May 16, 2016; DOI: 10.1158/1078-0432.CCR-16-0148 MolecularAuthor predictors manuscripts of response have been to peerfulvestrant reviewed and accepted for publication but have not yet been edited. TransCONFIRM: Identification of a genetic signature of response to fulvestrant in advanced hormone receptor positive breast cancer. Rinath Jeselsohn1,2 , William T. Barry1,3, Ilenia Migliaccio4, Chiara Biagioni4 ,5, Jin Zhao2, Jonas De Tribolet-Hardy2, Cristina Guarducci4, Martina Bonechi4, Naomi Laing 6, Eric P. Winer1, Myles Brown1,2 , Angelo Di Leo4,5, Luca Malorni4,5. 1. Susan F. Smith Center for Women’s Cancers, Dana Farber Cancer Institute, Boston, MA 2. Center for Functional Caner Epigenetics, Dana Farber Cancer Institute, Boston, MA 3. Department of Biostatistics and Computational Biology, Dana Farber Cancer Institute 4. Translational Research Unit, Hospital of Prato, Istituto Toscano Tumori, Prato, Italy 5. "Sandro Pitigliani" Medica Oncology Unit, Istituto Toscano Tumori, Prato, Italy 6. Astra Zeneca Pharmaceuticals, Macclesfield, United Kingdom Rinath Jeselsohn, email: [email protected] William T. Barry, email: [email protected] Ilenia Migliaccio, email: [email protected] Chiara Biagioni, email: [email protected] Jin Zhao, email: [email protected] Jonas De Tribolet-Hardy, email: [email protected] Christina Guarducci, email: [email protected] Martina Bonechi, email: [email protected] Naomi Laing, email: [email protected] Eric P. Winer, email: [email protected] Myles Brown, email: [email protected] Angelo Di Leo, email: [email protected] Luca Malorni, email: [email protected] 1 Downloaded from clincancerres.aacrjournals.org on October 1, 2021.
[Show full text]
WO 2018/136559 Al 26 July 2018 (26.07.2018) W !P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/136559 Al 26 July 2018 (26.07.2018) W !P O PCT (51) International Patent Classification: A61K 31/70 (2006.01) A61K 38/00 (2006.01) A61K 31/47 (2006.01) (21) International Application Number: PCT/US2018/014108 (22) International Filing Date: 17 January 2018 (17.01.2018) (25) Filing Language: English (26) Publication Language: English (30) Priority Data: 62/447,290 17 January 2017 (17.01.2017) US (71) Applicant: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA [US/US]; 1111Franklin Street, 12th Floor, Oakland, CA 94607-5200 (US). (72) Inventor: RANA, Tariq, M.; 10610 Briarlake Woods Dri ve, San Diego, CA 92130 (US). (74) Agent: JENKINS, Kenneth, E. et al; Mintz Levin Cohn Ferris Glovsky And Popeo, P.C., 3580 Carmel Mountain Road, Suite 300, San Diego, CA 92130-6768 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
[Show full text]
Β-Defensin Expression in the Canine Nasal Cavity by Michelle Satomi
β-defensin expression in the canine nasal cavity by Michelle Satomi Aono A thesis submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Masters of Science Auburn, Alabama May 6th, 2013 Keywords: defensin, innate immunity, canine nasal cavity Copyright 2013 by Michelle S. Aono Approved by Edward E. Morrison, Professor and Head of Anatomy, Physiology and Pharmacology Robert Kemppainen, Associate Professor of Anatomy, Physiology and Pharmacology John C. Dennis, Research Fellow IV of Anatomy, Physiology and Pharmacology Abstract Defensins are a family of endogenous antibiotics that are important in mucosal innate immunity, but little is currently known about defensin expression in the nasal cavity. Herein expression of canine β-defensin (cBD)1, cBD103, cBD108 and cBD123 RNA in the respiratory epithelium (RE), cBD1 and 108 RNA in the olfactory epithelium (OE), and cBD1, cBD108, cBD119 and cBD123 RNA in the olfactory bulb (OB) is reported. cBD1 and 103 were also expressed in the canine nares and tongue. cBD102, cBD120, and cBD122 RNA expression was undetectable in the tissues examined. cBD103 transcript abundance in canine nares showed a 90 fold range of inter-individual variation. Murine β-defensin 14 expression mirrors that of cBD103 in the dog, with high expression in the nares and tongue, but has little to no expression in the RE, OE or OB. High expression of cBD103 in the nares may provide indirect protection to the OE by eliminating pathogens in the rostral portion of the nasal cavity, whereas cBD1 and 108 may provide direct protection to the RE and OE.
[Show full text]
Us 2018 / 0305689 A1
US 20180305689A1 ( 19 ) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2018 /0305689 A1 Sætrom et al. ( 43 ) Pub . Date: Oct. 25 , 2018 ( 54 ) SARNA COMPOSITIONS AND METHODS OF plication No . 62 /150 , 895 , filed on Apr. 22 , 2015 , USE provisional application No . 62/ 150 ,904 , filed on Apr. 22 , 2015 , provisional application No. 62 / 150 , 908 , (71 ) Applicant: MINA THERAPEUTICS LIMITED , filed on Apr. 22 , 2015 , provisional application No. LONDON (GB ) 62 / 150 , 900 , filed on Apr. 22 , 2015 . (72 ) Inventors : Pål Sætrom , Trondheim (NO ) ; Endre Publication Classification Bakken Stovner , Trondheim (NO ) (51 ) Int . CI. C12N 15 / 113 (2006 .01 ) (21 ) Appl. No. : 15 /568 , 046 (52 ) U . S . CI. (22 ) PCT Filed : Apr. 21 , 2016 CPC .. .. .. C12N 15 / 113 ( 2013 .01 ) ; C12N 2310 / 34 ( 2013. 01 ) ; C12N 2310 /14 (2013 . 01 ) ; C12N ( 86 ) PCT No .: PCT/ GB2016 /051116 2310 / 11 (2013 .01 ) $ 371 ( c ) ( 1 ) , ( 2 ) Date : Oct . 20 , 2017 (57 ) ABSTRACT The invention relates to oligonucleotides , e . g . , saRNAS Related U . S . Application Data useful in upregulating the expression of a target gene and (60 ) Provisional application No . 62 / 150 ,892 , filed on Apr. therapeutic compositions comprising such oligonucleotides . 22 , 2015 , provisional application No . 62 / 150 ,893 , Methods of using the oligonucleotides and the therapeutic filed on Apr. 22 , 2015 , provisional application No . compositions are also provided . 62 / 150 ,897 , filed on Apr. 22 , 2015 , provisional ap Specification includes a Sequence Listing . SARNA sense strand (Fessenger 3 ' SARNA antisense strand (Guide ) Mathew, Si Target antisense RNA transcript, e . g . NAT Target Coding strand Gene Transcription start site ( T55 ) TY{ { ? ? Targeted Target transcript , e .
[Show full text]
Chromosomal Breakpoints in Primary Colon Cancer Cluster at Sites of Structural Variants in the Genome
Research Article Chromosomal Breakpoints in Primary Colon Cancer Cluster at Sites of Structural Variants in the Genome Jordi Camps,1 Marian Grade,1,3 Quang Tri Nguyen,1 Patrick Ho¨rmann,1 Sandra Becker,1 Amanda B. Hummon,1 Virginia Rodriguez,2 Settara Chandrasekharappa,2 Yidong Chen,1 Michael J. Difilippantonio,1 Heinz Becker,3 B. Michael Ghadimi,3 and Thomas Ried1 1Genetics Branch, Center for Cancer Research, National Cancer Institute/NIH; 2Genome Technology Branch, National Human Genome Research Institute/NIH, Bethesda, Maryland; and 3Department of General and Visceral Surgery, University Medicine Go¨ttingen, Go¨ttingen, Germany Abstract 8q, 13, and 20q as well as losses of chromosomes 4q, 8p, 17p, and 18q (2). Genomic aberrations on chromosome 8 are common in colon cancer, and are associated with lymph node and distant Within the last decade, microarray technology has been metastases as well as with disease susceptibility. This extensively applied to survey the cellular transcriptome of common prompted us to generate a high-resolution map of genomic solid tumors, including colorectal cancer, and for colon cancers, imbalances of chromosome 8 in 51 primary colon carcinomas gene expression signatures were subsequently correlated with using a custom-designed genomic array consisting of a tiling clinical outcome (for reviews, see refs. 3–5). However, high- path of BAC clones. This analysis confirmed the dominant role resolution mapping of chromosomal copy number changes has of this chromosome. Unexpectedly, the position of the break- only recently been achieved using BAC or cDNA clone-based arrays points suggested colocalization with structural variants in the (6–10).
[Show full text]
Transconfirm: Identification of a Genetic Signature of Response to Fulvestrant in Advanced Hormone Receptor–Positive Breast Ca
Published OnlineFirst May 16, 2016; DOI: 10.1158/1078-0432.CCR-16-0148 Personalized Medicine and Imaging Clinical Cancer Research TransCONFIRM: Identification of a Genetic Signature of Response to Fulvestrant in Advanced Hormone Receptor–Positive Breast Cancer Rinath Jeselsohn1,2, William T. Barry1,3, Ilenia Migliaccio4, Chiara Biagioni4,5, Jin Zhao2, Jonas De Tribolet-Hardy2, Cristina Guarducci4, Martina Bonechi4, Naomi Laing6, Eric P. Winer1, Myles Brown1,2, Angelo Di Leo4,5, and Luca Malorni4,5 Abstract Purpose: Fulvestrant is an estrogen receptor (ER) antago- Results: Pathway analysis demonstrated that increased EGF nist and an approved treatment for metastatic estrogen pathway and FOXA1 transcriptional signaling is associated with þ receptor–positive (ER ) breast cancer. With the exception of decreased response to fulvestrant. Using a multivariate Cox mod- ER levels, there are no established predictive biomarkers of el, we identified a novel set of 37 genes with an expression that is response to single-agent fulvestrant. We attempted to identify independently associated with progression-free survival (PFS). a gene signature of response to fulvestrant in advanced breast TFAP2C, a known regulator of ER activity, was ranked second in cancer. this gene set, and high expression was associated with a decreased Experimental Design: Primary tumor samples from 134 response to fulvestrant. The negative predictive value of TFAP2C patients enrolled in the phase III CONFIRM study of patients expression at the protein level was confirmed by IHC. þ with metastatic ER breast cancer comparing treatment with Conclusions: We identified biologic pathways and a novel gene þ either 250 mg or 500 mg fulvestrant were collected for signature in primary ER breast cancers that predicts for response genome-wide transcriptomic analysis.
[Show full text]