
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC305782 BD4 (DEFB104A) (NM_080389) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: BD4 (DEFB104A) (NM_080389) Human Untagged Clone Tag: Tag Free Symbol: DEFB104A Synonyms: BD-4; DEFB-4; DEFB4; DEFB104; hBD-4 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_080389, the custom clone sequence may differ by one or more nucleotides ATGCAGAGACTTGTGCTGCTATTAGCCATTTCTCTTCTACTCTATCAAGATCTTCCAGTGAGAAGCGAAT TTGAATTGGACAGAATATGTGGTTATGGGACTGCCCGTTGCCGGAAGAAATGTCGCAGCCAAGAATACAG AATTGGAAGATGTCCCAACACCTATGCATGCTGTTTGAGAAAATGGGATGAGAGCTTACTGAATCGTACA AAACCCTGA Restriction Sites: SgfI-MluI ACCN: NM_080389 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. RefSeq: NM_080389.2, NP_525128.2 RefSeq Size: 281 bp RefSeq ORF: 219 bp Locus ID: 140596 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 BD4 (DEFB104A) (NM_080389) Human Untagged Clone – SC305782 UniProt ID: Q8WTQ1 Protein Families: Secreted Protein Gene Summary: Defensins form a family of antimicrobial and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 104, DEFB104A and DEFB104B, in head-to-head orientation. This gene, DEFB104A, represents the more centromeric copy. [provided by RefSeq, Oct 2014] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages2 Page
-
File Size-