Targeting of Intracellular TMEM16 Proteins to the Plasma Membrane and Activation by Purinergic Signaling

International Journal of Molecular Sciences

Article Targeting of Intracellular TMEM16 Proteins to the Plasma Membrane and Activation by Purinergic Signaling

Rainer Schreiber *, Jiraporn Ousingsawat and Karl Kunzelmann

Institut für Physiologie, Universität Regensburg, Universitätsstr. 31, 93053 Regensburg, Germany; [email protected] (J.O.); [email protected] (K.K.) * Correspondence: [email protected]; Tel.: +49 (0)941 943 2935

Received: 3 May 2020; Accepted: 2 June 2020; Published: 5 June 2020

2+ Abstract: Anoctamins such as TMEM16A and TMEM16B are Ca -dependent Cl− channels activated through purinergic receptor signaling. TMEM16A (ANO1), TMEM16B (ANO2) and TMEM16F (ANO6) are predominantly expressed at the plasma membrane and are therefore well accessible for functional studies. While TMEM16A and TMEM16B form halide-selective ion channels, TMEM16F and probably TMEM16E operate as phospholipid scramblases and nonselective ion channels. Other TMEM16 paralogs are expressed mainly in intracellular compartments and are therefore diﬃcult to study at the functional level. Here, we report that TMEM16E (ANO5), -H (ANO8), -J (ANO9) and K (ANO10) are targeted to the plasma membrane when fused to a C-terminal CAAX (cysteine, two aliphatic amino acids plus methionin, serine, alanin, cystein or glutamin) motif. These paralogs produce Ca2+-dependent ion channels. Surprisingly, expression of the TMEM16 paralogs in the plasma membrane did not produce additional scramblase activity. In contrast, endogenous scrambling induced by stimulation of purinergic P2X7 receptors was attenuated, in parallel with reduced plasma membrane blebbing. This could suggest that intracellular TMEM16 paralogs operate diﬀerently when compared to plasma membrane-localized TMEM16F, and may even stabilize intracellular membranes. Alternatively, CAAX tagging, which leads to expression in non-raft compartments of the plasma membrane, may antagonize phosphatidylserine exposure by endogenous raft-located TMEM16F. CAAX-containing constructs may be useful to further investigate the molecular properties of intracellular TMEM16 proteins.

Keywords: ANO5; ANO8; ANO9; ANO10; TMEM16E; TMEM16H; TMEM16J; TMEM16K; scramblase; membrane blebbing; P2X7R; purineric signaling

1. Introduction The TMEM16/Anoctamin family of proteins consists of ten transmembrane paralogs, ranging 2+ from TMEM16A/ANO1 to TMEM16K/ANO10. In addition to their function as Ca -activated Cl− channels, some members of this family, like TMEM16F, also operate as Ca2+-activated lipid scramblases. Lipid scramblases facilitate the passive transport of phospholipids, such as phosphatidylserine (PtdSer), from the inner to the outer leaﬂet of the plasma membrane [1–4]. TMEM16A works exclusively as a 2+ Ca -activated Cl− channel in secretory epithelial cells of the exocrine pancreas and salivary glands. TMEM16A is activated by extracellular ATP or UTP through stimulation of purinergic P2Y receptors 2+ and generation of inositol 1,4,5-trisphosphate (IP3) by phospholipase C, which leads to a Ca release from endoplasmic reticulum (ER) stores [5]. Expression of TMEM16A also promotes cell proliferation and migration of tumor cells, and cyst growth in autosomal recessive polycystic kidney disease [6–8]. TMEM16E is required for skeletomuscular repair; its mutations cause gnathodiaphyseal dysplasia [9]

Int. J. Mol. Sci. 2020, 21, 4065; doi:10.3390/ijms21114065 www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2020, 21, 4065 2 of 15 and different types of muscular dystrophies [10]. Regarding TMEM16H and TMEM16J, there is very limited information available on their properties and cellular functions. For TMEM16H, Jha et al. reported its function as a key tether that forms ER/PM membrane contact sites to control intracellular Ca2+ signaling [11]. TMEM16J has a role in the progression and metastasis of colorectal cancer [12]. It is associated with poor prognosis of pancreatic cancer [13]. For TMEM16K, we reported a central role in the innate immune defense against Borrelia infection [14]. Moreover, mutations in TMEM16K cause recessive cerebellar ataxia [15], epilepsy, cognitive impairment [16], and coenzyme Q10 deficiency [17]. In contrast to TMEM16A, which is well expressed at the plasma membrane, TMEM16E, -H, -J and -K are predominantly expressed in membranes of intracellular compartments, in particular in the endoplasmic reticulum (ER) [4,11,14,18,19]. This makes it difficult to study the biophysical properties and mechanisms of activation of these TMEM16 paralogs. Here, we reported that TMEM16E, -H, -J and -K can be targeted to the plasma membrane by fusion with a C-terminal CAAX motif. Plasma membrane-targeted TMEM16 paralogs produced ion currents but did not scramble phospholipids. The results confirm an earlier report suggesting anoctamins as a family of Ca2+ activated ion channels [4]. CAAX-mediated plasma membrane targeting may be helpful to further investigate the molecular properties of intracellular TMEM16 proteins.

2. Results

2.1. Targeting TMEM16E, TMEM16H, TMEM16J and TMEM16K to the Plasma Membrane In Fisher rat thyroid (FRT) cells, overexpressed His-tagged TMEM16E, TMEM16H, TMEM16J and TMEM16K, were located in membranes of intracellular compartments (Figure1). Two different strategies were used to target these TMEM16 paralogs to the plasma membrane. As a first strategy, we fused the cytosolic N- and C-terminal parts of TMEM16A to the transmembrane domains of TMEM16E and TMEM16K. To visualize expression of these chimeras in living human embryonic kidney (HEK293) cells, the constructs were tagged with green fluorescent protein (GFP). However, these chimeras were still expressed intracellularly (Figure2A,B). As a second strategy, we added the cyan fluorescent protein (CFP) to the CAAX motif sequence (KKKKSKTKCVIM) from Rho GTPase and fused both to the carboxyl terminus of TMEM16E, TMEM16H, TMEM16J and TMEM16K. It was shown by Agarwal et al. [20] that the CAAX motif targets the cAMP sensitive biosensor Epac2 specifically to non-lipid raft domains of the plasma membrane. At the C-terminus, CAAX proteins contain a specific recognition site (CAAX motif/box) for prenylation, a post-translational modification process. Due to prenylation, 15-carbon farnesyl groups or 20 carbon isoprenoids are added to the cysteine residues of the CAAX box [21]. Indeed, this translational modification guided TMEM16E-CFP-CAAX, TMEM16H-CFP-CAAX,

TMEM16J-CFP-CAAXInt. J. Mol. Sci. 2020, 21, 4065and TMEM16K-CFP-CAAX to the plasma membrane (Figure2C–G).3 of 16

FigureFigure 1.1. TMEM16E, -H, -H, -J, -J, and and -K -Kare are expressed expressed in in intracellular intracellular compartmen compartments.ts. Expression Expression of (A) of TMEM16E, (B) TMEM16H, (C) TMEM16J and (D) TMEM16K in FRT cells. His-tagged TMEM16E, - H, -J and -K proteins were detected with anti-His antibodies (green). β-catenin was visualized using an Alexa 568-labeled secondary antibody (red). Bar 20 µm.

Int. J. Mol. Sci. 2020, 21, 4065 3 of 15

(A) TMEM16E, (B) TMEM16H, (C) TMEM16J and (D) TMEM16K in FRT cells. His-tagged TMEM16E, -H, -J and -K proteins were detected with anti-His antibodies (green). β-catenin was visualized using an Alexa 568-labeled secondary antibody (red). Bar 20 µm. Int. J. Mol. Sci. 2020, 21, 4065 4 of 16

FigureFigure 2. Expression2. Expression of TMEM16of TMEM16 proteins. proteins. Chimeras Chimeras of TMEM16Aof TMEM16A/TMEM16E/TMEM16E and and TMEM16A / TMEM16A/TMEM16K were located in intracellular compartments (A,B), while TMEM16 paralogs TMEM16K were located in intracellular compartments (A,B), while TMEM16 paralogs were targeted were targeted by the CAAX motif to the plasma membrane (C-G). N-terminus (NT, amino acid (aa) by theM1-G351 CAAX or motifM1-I348) to and the C-terminus plasma membrane (CT, aa I911-L982) (C-G). of N-terminus TMEM16A (red (NT, lines) amino were acidcloned (aa) to the M1-G351 or M1-I348)transmembrane and C-terminus domains (CT, (blue aa columns) I911-L982) of of(A TMEM16A) TMEM16E (red(aa I302-D856) lines) were and cloned (B) TMEM16K to the transmembrane (aa domainsT207-D615). (blue columns)In living HEK293 of (A) cells, TMEM16E localization (aa of I302-D856) the chimeras and was (B visualized) TMEM16K by C-terminal-tagged (aa T207-D615). In living HEK293GFP cells,proteins localization (green). (C) of Cyan the chimerasfluorescentwas protein visualized (CFP) (blue) byC-terminal-tagged and the CAAX motif GFP (red) proteins were (green). (C) Cyancloned ﬂuorescent to the C-terminus protein (CT) (CFP) of TMEM16 (blue) andproteins. the CAAXIn living motifcells (D (red)) TMEM16E-CFP-CAAX, were cloned to the (E C-terminus) TMEM16H-CFP-CAAX, (F) TMEM16J-CFP-CAAX and (G) TMEM16K-CFP-CAAX were located at (CT) of TMEM16 proteins. In living cells (D) TMEM16E-CFP-CAAX, (E) TMEM16H-CFP-CAAX, the plasma membrane. N-terminus (NT), Bar 20 µm. (F) TMEM16J-CFP-CAAX and (G) TMEM16K-CFP-CAAX were located at the plasma membrane. N-terminus (NT), Bar 20 µm.

Int. J. Mol. Sci. 2020, 21, 4065 4 of 15

2.2. Purinergic Stimulation and Increase in Intracellular Ca2+ Concentration Induces Anion Permeability in Plasma Membrane Targeted TMEM16E, TMEM16H, TMEM16J or TMEM16K Int. J. Mol. Sci. 2020, 21, 4065 5 of 16 Anion permeability of TMEM16 proteins was determined in yellow fluorescence protein 2+ (YFP)-quenching2.2. Purinergic Stimulation assays using and Increase HEK293 in Intracellular cells stably Ca expressing Concentration the iodideInduces sensitiveAnion Permeability yellow fluorescentin Plasma Membrane Targeted TMEM16E, TMEM16H, TMEM16J or TMEM16K protein I152L (YFP) [22]. Validation of the YFP assay by the C-terminal CFP-tagged Ca2+-activated chlorideAnion channel permeability TMEM16A of TMEM16 (TMEM16A-CFP) proteins was showeddetermined fluorescence in yellow fluorescence quenching protein after application (YFP)- of quenching assays using HEK293 cells stably expressing the iodide sensitive yellow2+ fluorescent iodide (I−), upon stimulation with 100 µM ATP and in the presence of the Ca ionophore ionomycin 2+ (Iono,protein 1 µ M)I152L (Figure (YFP)3 [22].A). TheValidation initial of decrease the YFP ofassay the by YFP the fluorescence C-terminal CFP-tagged by iodide Ca (initial-activated slope, ∆F/s) chloride channel TMEM16A (TMEM16A-CFP) showed fluorescence quenching after application of correlated to the iodide permeability (IP) and is summarized in Figure3D. Compared to CFP-transfected iodide (I−), upon stimulation with 100 µM ATP and in the presence of the Ca2+ ionophore ionomycin cells (Figure3C, mock), the basal iodide quenching was increased in TMEM16A-CFP-expressing (Iono, 1 µM) (Figure 3A). The initial decrease of the YFP fluorescence by iodide (initial slope, ΔF/s) cells, and was increased by ATP or ionomycin (Figure3D). Pre-incubation of the cells for 30 min correlated to the iodide permeability (IP) and is summarized in Figure 3D. Compared to CFP- 2+ withtransfected the Ca cells-chelator (Figure BAPTA3C, mock), significantly the basal iodide decreased quenching basal was IP increasedand slightly in TMEM16A-CFP- increased the effect ofexpressing ionomycin, cells, due and to was increased increased sensitivity by ATP or ofionomy unstimulatedcin (Figure TMEM16A3D). Pre-incubation (Figure of3 A,D).the cells Expression for 2+ of30 the min TMEM16-CFP-CAAX with the Ca -chelator BAPTA proteins significantly in HEK-YFP decreased cells basal had IP and no slightly effect onincreased basal the IP. effect However, ATPof ionomycin, or ionomycin due inducedto increased in allsensitivity TMEM16-CFP-CAAX of unstimulated TMEM16A proteins an(Figure increase 3A,D). of Expression IP (Figure 3ofB,E–H). the TMEM16-CFP-CAAX proteins in HEK-YFP cells had no effect on basal IP. However, ATP or For TMEM16E-CFP-CAAX and TMEM16H-CFP-CAAX, the ATP-induced increase of IP was enhanced whenionomycin compared induced to the in CFPall TMEM16-CFP-CAAX control (Figure3C) butproteins could an not increase be further of IP augmented(Figure 3B,E–H). by ionomycinFor TMEM16E-CFP-CAAX and TMEM16H-CFP-CAAX, the ATP-induced increase of IP was enhanced (Figure3E,F), whereas only ionomycin, but not ATP, increased I in TMEM16J-CFP-CAAX-expressing when compared to the CFP control (Figure 3C) but could not be furtherP augmented by ionomycin cells. This increase of IP was not significantly different from the CFP control (Figure3G). (Figure 3E,F), whereas only ionomycin, but not ATP, increased IP in TMEM16J-CFP-CAAX- TMEM16K-CFP-CAAX-dependent I was only significantly activated by ATP when compared to CFP expressing cells. This increase of IP wasP not significantly different from the CFP control (Figure 3G). controlTMEM16K-CFP-CAAX-dependent (Figure3B,H). Tannic acid I (TA,P was 20onlyµ significantlyM), a TMEM16 activated blocker by ATP [23 when], was compared used to to confirm CFP the activationcontrol (Figure of TMEM16 3B,H). proteins.Tannic acid Indeed, (TA, 20 ionomycin- µM), a TMEM16 or ATP-induced blocker [23], increases was used of to I Pconfirmwere sensitive the to tannicactivation acid (Figureof TMEM164A,B). proteins. Indeed, ionomycin- or ATP-induced increases of IP were sensitive to tannic acid (Figure 4A,B).

Figure 3. Cont.

Int. J. Mol. Sci. 2020, 21, 4065 6 of 16

Int. J. Mol. Sci. 2020, 21, 4065 5 of 15 Int. J. Mol. Sci. 2020, 21, 4065 6 of 16

Figure 3. Purinergic stimulation and increase of intracellular Ca2+ concentration by ionomycin 2+ Figure 3. Purinergic stimulation and increase of intracellular Ca2+ concentration by ionomycin inducedFigure iodide 3. Purinergic permeability stimulation in HEK293-YFP and increase cells of intracellularexpressing Caplasma concentration membrane-targeted by ionomycin TMEM16 inducedinduced iodide iodide permeability permeability in HEK293-YFPin HEK293-YFP cells cellsexpressing expressing plasma plasma membrane-targeted membrane-targeted TMEM16 TMEM16 proteins. (A) Original recording of TMEM16A-CFP-expressing HEK293-YFP cells. Application of 20 proteins.proteins. (A) (A Original) Original recording recording of TMEM16A-CFP-expre TMEM16A-CFP-expressingssing HEK293-YFP HEK293-YFP cells. Application cells. Application of 20 mM iodide under control (con) in the presence of 100 µM ATP (ATP) or in the presence of 1 µM of 20mM mM iodide iodide under under control control (con) (con) in the in presence the presence of 100 µM of 100ATP µ(ATP)M ATP or in (ATP) the presence or in the of 1 presence µM ionomycin (Iono) caused in TMEM16A-CFP-expressing HEK293-YFP cells (red, T16A) a strong but in of 1 µionomycinM ionomycin (Iono) (Iono) caused causedin TMEM16A-CFP-expressing in TMEM16A-CFP-expressing HEK293-YFP HEK293-YFP cells (red, T16A) cells a strong (red, but T16A) in a TMEM16A-CFP-non-expressing HEK293-YFP cells (black, mock) only a weak transient quenching of strongTMEM16A-CFP-non-expressing but in TMEM16A-CFP-non-expressing HEK293-YFP HEK293-YFP cells (black, mock cells) only (black, a weak mock) transient only aquenching weak transient of the theYFP YFP signal, signal, indicating indicating enhancedenhanced iodideiodide permeability permeability through through TMEM16A-CFP TMEM16A-CFP expression. expression. The The quenching of the YFP signal, indicating enhanced iodide permeability through TMEM16A-CFP Ca2+Ca-chelator2+-chelator BAPTA BAPTA reducedreduced iodide quenchingquenching under under control control conditions conditions in TMEM16A-CFP- in TMEM16A-CFP- expression. The Ca2+-chelator BAPTA reduced iodide quenching under control conditions in expressingexpressing HEK293-YFP HEK293-YFP cellscells (blue, T16AT16A + +BAPTA). BAPTA). (B )( BOriginal) Original recording recording of TMEM16K-CFP- of TMEM16K-CFP- TMEM16A-CFP-expressing HEK293-YFP cells (blue, T16A + BAPTA). (B) Original recording of CAAX-expressingCAAX-expressing HEK293-YFP HEK293-YFP cells (r(red,ed, T16K). T16K). Twenty Twenty mM mM iodide iodide induced induced a slight a slight increase increase of the of the TMEM16K-CFP-CAAX-expressing HEK293-YFP cells (red, T16K). Twenty mM iodide induced a slight YFP-quenchingYFP-quenching under under control control (con) andand in in the the presen presence ceof 1of µM 1 µM ionomycin ionomycin (Iono), (Iono), like in like TMEM16K- in TMEM16K- increaseCFP-CAAX-non-expressing of the YFP-quenching underHEK293-YFP control (con)cells and(black, in themock) presence but significantly of 1 µM ionomycin increased (Iono), YFP- like CFP-CAAX-non-expressing HEK293-YFP cells (black, mock) but significantly increased YFP- in TMEM16K-CFP-CAAX-non-expressingquenching in the presence of 100 µM ATP HEK293-YFP when compared cells (black,to control mock) cells but (mock). signiﬁcantly Summaries increased of quenching in the presence of 100 µM ATP when compared to control cells (mock). Summaries of YFP-quenchingiodide permeability in the presence (IP) measured of 100 µ byM ATPinitial when slope compared of fluorescence to control decrease cells ( (mock).ΔF/s) of Summaries(C) CFP- of iodide permeability (IP) measured by initial slope of fluorescence decrease (ΔF/s) of (C) CFP- iodideexpressing permeability cells (IunderP) measured basal condition by initial (basal), slope in ofthe ﬂuorescence presence of 100 decrease µM ATP (∆ (ATP)F/s) of or (C in) the CFP-expressing presence expressing cells under basal condition (basal), in the presence of 100 µM ATP (ATP) or in the presence cells underof 1 µM basal ionomycin condition (Iono); (basal), (D) of TMEM16A-CFP in the presence (T16A)-expressing of 100 µM ATP HEK293-YFP (ATP) or cells in the under presence control of 1 of 1 µM ionomycin (Iono); (D) of TMEM16A-CFP (T16A)-expressing HEK293-YFP cells under control µM ionomycincondition or (Iono); pre-incubated (D) of with TMEM16A-CFP 50 µM BAPTA (T16A)-expressing for 30 min at RT; (E) HEK293-YFP TMEM16E-CFP-CAAX cells under (T16E)-, control condition(F) TMEM16H-CFP-CAAX or pre-incubated with(T16H)-, 50 µM(G) TMEM16J-CFP-CAAXBAPTA for 30 min at (T16J)-, RT; (E or) TMEM16E-CFP-CAAX(H) TMEM16K-CFP-CAAX (T16E)-, condition or pre-incubated with 50 µM BAPTA for 30 min at RT; (E) TMEM16E-CFP-CAAX (T16E)-, (T16K)-expressing HEK293-YFP cells. (Number of cells measured), # paired t-test, α < 0.05, § unpaired (F)(F TMEM16H-CFP-CAAX) TMEM16H-CFP-CAAX (T16H)-, (T16H)-, (G ()G TMEM16J-CFP-CAAX) TMEM16J-CFP-CAAX (T16J)-, (T16J)-, or or (H ()H TMEM16K-CFP-CAAX) TMEM16K-CFP-CAAX t-test to control and CFP, resepectively, α < 0.05, and analysis of variance (ANOVA) to CFP, α < 0.05. (T16K)-expressing(T16K)-expressing HEK293-YFP HEK293-YFP cells. cells. (Number (Number of cellsof cells measured), measured), # paired # paired t-test, t-test,α < α0.05, < 0.05, §unpaired § unpaired t-testt-test to to control control and and CFP, CFP, resepectively, resepectively,α < α0.05, < 0.05, and and analysis analysis of varianceof variance (ANOVA) (ANOVA) toCFP, to CFP,α < α0.05. < 0.05.

Figure 4. Increased iodide permeability induced by TMEM16 proteins was sensitive to tannic acid. (A) Ionomycin-induced iodide permeability (Ipionomycin) from TMEM16E-CFP-CAAX (T16E)-, TMEM16H-CFP-CAAX (T16H)- or TMEM16J-CFP-CAAX (T16J)-expressing HEK293 cells was Figure 4. Increased iodide permeability induced by TMEM16 proteins was sensitive to tannic Figure 4. Increased iodide permeability induced by TMEM16 proteins was sensitive to tannic acid. acid. (A) Ionomycin-induced iodide permeability (Ipionomycin) from TMEM16E-CFP-CAAX (T16E)-, TMEM16H-CFP-CAAX(A) Ionomycin-induced (T16H)- iodi orde TMEM16J-CFP-CAAX permeability (Ipionomycin (T16J)-expressing) from TMEM16E-CFP-CAAX HEK293 cells was measured (T16E)-, TMEM16H-CFP-CAAX (T16H)- or TMEM16J-CFP-CAAX (T16J)-expressing HEK293 cells was

Int. J. Mol. Sci. 2020, 21, 4065 6 of 15 Int. J. Mol. Sci. 2020, 21, 4065 7 of 16

measuredunder under control control (con) (con) or after or after pre-incubation pre-incubation with with tannic tannic acid acid (TA, (TA, 20 20µM) µM) for for 3 3 min. min. ((BB)) ATP-inducedATP- inducediodide iodide permeability permeability (IpATP (IpATP) of) of TMEM16K-CFP-CAAX TMEM16K-CFP-CAAX waswas measured measured under under control control (con) (con) or or after afterpre-incubation pre-incubation with with tannic tannic acidacid (TA,(TA, 2020 µµM)M) for 3 min. (Numbe (Numberr of of cells cells measured), measured), § unpaired § unpaired t-test, t-test,α < α 0.05.< 0.05.

TheseThese results results were wereconfirmed confirmed in additional in additional whole-cell whole-cell patch-clamp patch-clamp experiments experiments (Figure 5). CFP- (Figure5). CFP-positive HEK293 cells were patched under whole-cell configuration with 145 mM CsCl and 10 nM positive HEK293 cells were patched under whole-cell configuration with 145 mM CsCl2 and 102 nM 2+ 2+ Ca2+Ca as theas pipette the pipette solution. solution. Increase Increase in intracellular in intracellular Ca2+ concentration Ca concentration by 1 µM by ionomycin 1 µM ionomycin induced induced in TMEM16E-,in TMEM16E-, TMEM16J- TMEM16J- and andTMEM16K-CFP-CAAX-ex TMEM16K-CFP-CAAX-expressingpressing HEK293 HEK293 cells a rapid cells aand rapid transient and transient whole-cellwhole-cell current current which which was sensitive was sensitive to 20 µM to tannic 20 µM acid tannic (Figure acid 5B,D,E). (Figure In5B,D,E). mock-transfected In mock-transfected and TMEM16H-CFP-CAAX-expressingand TMEM16H-CFP-CAAX-expressing HEK293 HEK293cells, iono cells,mycin ionomycin had no effect had no on e ffwhole-cellect on whole-cell currents currents (Figure(Figure 5A,C).5A,C).

2+ 2+ − FigureFigure 5. Increase 5. Increase of intracellular of intracellular Ca Caby ionomycinby ionomycin activated activated whole-cell whole-cell Cl currents Cl− currents in TMEM16E-, in TMEM16E-, J- J- andand K-CFP-CAAX-expressing K-CFP-CAAX-expressing HEK293 HEK293 cells. (A) CurrentCurrent/voltage/voltage relationshipsrelationships obtained obtained in in non-stimulated non- stimulated mock-transfected HEK293 cells (con), 1 µM ionomycin-treated cells (Iono) and ionomycin-

Int. J. Mol. Sci. 2020, 21, 4065 7 of 15

Int. J. Mol. Sci. 2020, 21, 4065 8 of 16 mock-transfected HEK293 cells (con), 1 µM ionomycin-treated cells (Iono) and ionomycin-treated treatedcells pre-incubatedcells pre-incubated with with 20 µ20M µM tannic tannic acid acid (TA). (TA). Summary Summary of corresponding corresponding current current densities densities obtainedobtained at atVc Vc = =+100 +100 mV. mV. (B ()B Current/voltage) Current/voltage relationships relationships obtained obtained inin TMEM16E-CFP-CAAX TMEM16E-CFP-CAAX (T16E)-transfected(T16E)-transfected HEK293 HEK293 cells. cells. Summary Summary of of correspon correspondingding currentcurrent densitiesdensities obtained obtained at at Vc Vc= +=100 +100 mV. mV.(C ) Current(C) Current/voltage/voltage relationships relationships obtained obtained in TMEM16H-CFP-CAAX in TMEM16H-CFP-CAAX (T16H)-transfected (T16H)-transfected HEK293 cells. HEK293Summary cells. of corresponding Summary of current corresponding densities obtainedcurrent atdensities Vc = +100 obtained mV.(D) Current at Vc/ voltage= +100 relationships mV. (D) Current/voltageobtained in TMEM16J-CFP-CAAX relationships obtained (T16J)-transfected in TMEM16J-CFP-CAAX HEK293 cells. (T16J)-transfected Summary of corresponding HEK293 currentcells. Summarydensities obtainedof corresponding at Vc = +100 current mV.(E )dens Currentities/ voltageobtained relationships at Vc = obtained+100 mV. in TMEM16K-CFP-CAAX(E) Current/voltage relationships(T16K)-transfected obtained HEK293 in TMEM16K-CFP-CAAX cells. Summary of corresponding (T16K)-transfected current densitiesHEK293 obtainedcells. Summary at Vc = +of100 correspondingmV. (Number current of cells densities measured), obtained # paired att-test, Vc = α+100< 0.05. mV. (Number of cells measured), # paired t- test, α < 0.05. 2.3. Plasma Membrane-Targeted Expression of TMEM16E, TMEM16H, TMEM16J and TMEM16K Did Not 2.3.Correlate Plasma toMembrane-Targeted Phopholipid Scrambling Expression Activity of TMEM16E, and Reduced TMEM16H, P2X7R-Dependent TMEM16J Membrane and TMEM16K Blebbing Did Not Correlate to Phopholipid Scrambling Activity and Reduced P2X7R-Dependent Membrane Blebbing TMEM16E-CFP-CAAX proteins were only expressed in 6.4 0.5 % of transfected HEK293 cells; ± TMEM16H-CFP-CAAXTMEM16E-CFP-CAAX in 20 proteins4.8 %, were TMEM16J-CFP-CAAX only expressed in in6.4 21.8 ± 0.5 6.6% of % transfected and TMEM16K-CFP-CAAX HEK293 cells; ± ± TMEM16H-CFP-CAAXin 2.7 0.5% (Figure6 E).in Scrambling20 ± 4.8 %, TMEM16J-CFP-CAAX activity of living HEK293 in 21.8 cells ± was 6.6 measured% and TMEM16K-CFP- by detection of ± CAAXphosphatidylserine in 2.7 ± 0.5% in(Figure the outer 6E). leaﬂetScrambling of the plasmaactivity membraneof living HEK293 by Annexin cells Vwas staining measured (Figure by6 ). detectionIncubation of phosphatidylserine of mock-transfected in cells the withouter 5 leafleµM ionomycint of the plasma for 10 membrane min at RT by resulted Annexin in anV staining increased (Figurecell number 6). Incubation positive of for mock-transfected Annexin V from cells 2.2 with0.5% 5 (conµM ionomycin AnV) to 62.2 for 104.4% min (ionoat RT AnV,resulted Figure in an6E). ± ± increasedIn general, cell thenumber ionomycin-induced positive for Annexin scrambling V from was 2.2 signiﬁcantly ± 0.5% (con AnV) reduced to 62.2 in cells ± 4.4% transfected (iono AnV, with FigureTMEM16-CFP-CAAX 6E). In general, paralogs the ionomycin-induced (Figure6E). In addition, scrambling ionomycin-induced was significantly scrambling reduced activity in was cells not transfectedcorrelated towith the expressionTMEM16-CFP-CAAX of TMEM16-CFP-CAAX paralogs (Figure paralogs. 6E). Only In aaddition, fraction of ionomycin-induced TMEM16-CFP-CAAX scramblingparalogs-expressing activity was cells not showed correlated scrambling to the ex activitypression under of TMEM16-CFP control conditions,-CAAX which paralogs. was not Only further a fractionenhanced of TMEM16-CFP-CAAX by ionomycin (Figure paralogs-expressing6). cells showed scrambling activity under control conditions, which was not further enhanced by ionomycin (Figure 6). Ionomycin Ionomycin A control x20 x63

TMEM16E Annexin V

TMEM16H Annexin V

TMEM16J Annexin V

TMEM16K Annexin V

Figure 6. Cont.

Int. J. Mol. Sci. 2020, 21, 4065 9 of 16

Int. J. Mol. Sci. 2020, 21, 4065 8 of 15 Int. J. Mol. Sci. 2020, 21, 4065 9 of 16

Figure 6. Plasma membrane expression of TMEM16E, -H, -J or -K was not correlated to phospholipid scrambling activity. (A) CFP fluorescence (green) of living HEK293 cells transfected with TMEM16E- CFP-CAAX, (B) TMEM16H-CFP-CAAX, (C) TMEM16J-CFP-CAAX or (D) TMEM16K-CFP-CAAX was mostly not localized with the annexin V signal (red), indicating absence of phosphatidylserine scrambling to the outer leaflet of the plasma membrane under control and after stimulation with ionomycin. Bar 20 µm. (E) Summary of positive cells for TMEM16 paralogs and annexin V staining under control (con) and stimulated (iono) conditions. (Number of experiments), # unpaired t-test, and analysis of variance (ANOVA), α < 0.05.

Activation of P2X7 receptors (P2X7R) with 5 mM ATP for 15 min induced in P2X7R and CFP- transfected HEK293 cells 0.58 ± 0.08 blebbing events per min, but not in cells expressing CFP only (FigureFigureFigure 7A,B). 6. 6. Plasma Surprisingly,Plasma membrane membrane expressionP2X7R-dependent expression of TMEM16E, of me TMEM16E,mbrane -H, -J or -Kblebbing -H, was -J not or correlatedwas -K si wasgnificantly to not phospholipid correlated reduced in TMEM16E-,toscrambling phospholipid TMEM16J- activity. scrambling (A ) CFPand fluorescenceTMEM16K-CFP-CAAX-e activity. (green) (A) CFP of living fluorescencexpressing HEK293 (green)cells cells, transfected of whereas living with HEK293 TMEM16H-CFP- TMEM16E- cells transfected with TMEM16E-CFP-CAAX, (B) TMEM16H-CFP-CAAX, (C) TMEM16J-CFP-CAAX or CAAXCFP-CAAX, had no effect (B) TMEM16H-CFP-CAAX, (Figure 7). (C) TMEM16J-CFP-CAAX or (D) TMEM16K-CFP-CAAX (D) TMEM16K-CFP-CAAX was mostly not localized with the annexin V signal (red), indicating absence wasIn summary, mostly not TMEM16E,localized with TMEM16H, the annexin TMEM16J V signal (red), and indicatingTMEM16K absence proteins of phosphatidylserineare typically located in of phosphatidylserine scrambling to the outer leaflet of the plasma membrane under control and after intracellularscrambling compartments to the outer leaflet but canof the be plasmatargeted me tombrane the plasma under controlmembrane and afterby addition stimulation of thewith CAAX stimulation with ionomycin. Bar 20 µm. (E) Summary of positive cells for TMEM16 paralogs and motifionomycin. to their Bar C-terminus. 20 µm. (E) SummaryAt the plasmaof positive memb cells rane,for TMEM increased16 paralogs ion andcurrents annexin after V staining purinergic annexin V staining under control (con) and stimulated (iono) conditions. (Number of experiments), under control (con) and stimulated (iono) conditions2+ . (Number of experiments), # unpaired t-test, and stimulation or by increase in intracellular Ca uponα stimulation with ionomycin were inducible and #analysis unpaired of t-test,variance and (ANOVA), analysis of α variance < 0.05. (ANOVA), < 0.05. were more pronounced in TMEM16E- and TMEM16K-CFP-CAAX and less distinct for TMEM16H- andActivation TMEM16J-CFP-CAAX-expressing of P2X7 receptors (P2X7R) HEK with cells. 5 mMSurp ATPrisingly, for 15expression min induced of the in TMEM16E, P2X7R and -J CFP-and - Activation of P2X7 receptors (P2X7R) with 5 mM ATP for 15 min induced in P2X7R and CFP- transfectedK paralogs HEK293 at the plasma cells 0.58 membrane0.08 blebbing did not events induce per phosphatidylserine min, but not in cells scrambling expressing and CFP reduced only transfected HEK293 cells 0.58 ±± 0.08 blebbing events per min, but not in cells expressing CFP only (FigureP2X7R-dependent7A,B). Surprisingly, membrane P2X7R-dependent blebbing. These membraneresults suggest blebbing that intracellular was significantly TMEM16 reduced paralogs in (Figure 7A,B). Surprisingly, P2X7R-dependent membrane blebbing was significantly reduced in TMEM16E-,may have no TMEM16J- impact on and the TMEM16K-CFP-CAAX-expressing lipid composition of intracellular membranes. cells, whereas Further TMEM16H-CFP-CAAX experiments have TMEM16E-, TMEM16J- and TMEM16K-CFP-CAAX-expressing cells, whereas TMEM16H-CFP- hadto be no performed effect (Figure to clarify7). the functional role of intracellular TMEM16 paralogs. CAAX had no effect (Figure 7). In summary, TMEM16E, TMEM16H, TMEM16J and TMEM16K proteins are typically located in intracellular compartments but can be targeted to the plasma membrane by addition of the CAAX motif to their C-terminus. At the plasma membrane, increased ion currents after purinergic stimulation or by increase in intracellular Ca2+ upon stimulation with ionomycin were inducible and were more pronounced in TMEM16E- and TMEM16K-CFP-CAAX and less distinct for TMEM16H- and TMEM16J-CFP-CAAX-expressing HEK cells. Surprisingly, expression of the TMEM16E, -J and - K paralogs at the plasma membrane did not induce phosphatidylserine scrambling and reduced P2X7R-dependent membrane blebbing. These results suggest that intracellular TMEM16 paralogs may have no impact on the lipid composition of intracellular membranes. Further experiments have to be performed to clarify the functional role of intracellular TMEM16 paralogs.

Figure 7. Cont.

Int. J. Mol. Sci. 2020, 21, 4065 9 of 15 Int. J. Mol. Sci. 2020, 21, 4065 10 of 16

Figure 7. Reduced P2X7R-dependent membrane blebbing in cells expressing TMEM16 paralogs. Figure 7. Reduced P2X7R-dependent membrane blebbing in cells expressing TMEM16 paralogs. (A) (A) HEK293 cells were transfected with CFP (control), P2X7 receptor (P2X7R) and CFP or P2X7R and HEK293 cells were transfected with CFP (control), P2X7 receptor (P2X7R) and CFP or P2X7R and TMEM16 paralogs in a ratio of 4:1. Membrane blebbing was stimulated by 5 mM ATP. Blebbing events TMEM16 paralogs in a ratio of 4:1. Membrane blebbing was stimulated by 5 mM ATP. Blebbing events were counted in a time frame of 15 min after addition of ATP. Bar 20 µm. White arrows indicate blebbing were counted in a time frame of 15 min after addition of ATP. Bar 20 µm. White arrows indicate events. (B) Summary of membrane blebbing rate (blebbing/min) of HEK293 cells expressing CFP blebbing events. (B) Summary of membrane blebbing rate (blebbing/min) of HEK293 cells expressing (control), P2X7R and CFP or P2X7R and TMEM16 paralogs. Mean SEM (Number of experiments). CFP (control), P2X7R and CFP or P2X7R and TMEM16 paralogs.± Mean ± SEM (Number of For each experiment 10 CFP positive cells were measured), # significant difference when compared to experiments). For each experiment 10 CFP positive cells were measured), # significant difference when control (ANOVA), α < 0.05. compared to control (ANOVA), α < 0.05. In summary, TMEM16E, TMEM16H, TMEM16J and TMEM16K proteins are typically located in intracellular3. Discussion compartments but can be targeted to the plasma membrane by addition of the CAAX motifA wide to theirvariety C-terminus. of molecules At the including plasma membrane,nuclear lamins increased (intermediate ion currents filaments), after purinergic Ras, GTP- 2+ stimulationbinding proteins, or by increase several in protein intracellular kinases Ca andupon phosphatases stimulation contain with ionomycin specific amino were acid inducible sequences and at weretheir more C-terminus. pronounced The in so-called TMEM16E- CAAX and motif/box TMEM16K-CFP-CAAX directs protein andto the less plasma distinct membrane. for TMEM16H- C stands andfor TMEM16J-CFP-CAAX-expressing cysteine residue, AA are two aliphatic HEK cells. residu Surprisingly,es and X represents expression any of the C-terminal TMEM16E, amino -J and acid, -K paralogsdepending at on the different plasma membranesubstrate specificities. did not induce These phosphatidylserine proteins always undergo scrambling a prenylation and reduced process P2X7R-dependentbefore they are membrane sent to plasma blebbing. membrane These results [21,24]. suggest Here, that we intracellular showed that TMEM16 intracellular paralogs TMEM16 may haveproteins no impact containing on the lipida C-terminal composition CAAX of intracellular box can be membranes.targeted to the Further plasma experiments membrane have (Figure to be 2C). performedThis technique to clarify was the also functional used to roletarget of the intracellular cAMP sensitive TMEM16 biosensor paralogs. Epac2 to the plasma membrane. It was shown that Epac2 was targeted specifically to non-lipid raft domains of the plasma membrane 3. Discussion [20]. A wideWe measured variety of moleculesthe anion includingconductance nuclear of the lamins plasma (intermediate membrane-targeted filaments), Ras, channels GTP-binding with two proteins,different several methods: protein first, kinases by YFP-quenching and phosphatases using contain ATP specificand the aminoCa2+ ionophore acid sequences ionomycin, at their and C-terminus.second, by The patch-clamp so-called CAAXin whole-cell motif/ boxconfiguration directs protein after toionomycin the plasma application. membrane. To Cverify stands the for YFP- cysteinequenching residue, assay, AA arewe two overexpressed aliphatic residues TMEM16A-CF and X representsP as control any C-terminal and found amino increased acid, depending basal iodide on dipermeability,fferent substrate as reported specificities. earlier These[4] (Figure proteins 3A,D). always Reducing undergo the aintracellular prenylation Ca process2+ concentration before they with arethe sent Ca to2+ plasma-chelator membrane BAPTA [21attenuated,24]. Here, basal we showed activity that of intracellular TMEM16A TMEM16 (Figure proteins3A,D). TMEM16A containing is a C-terminalactivated CAAXthrough box purinergic can be targeted stimulation to the plasma via P2Y membrane receptors. (Figure It was2C). shown This technique that TMEM16A was also is usedorganized to target thein a cAMP functional sensitive compartment biosensor Epac2 together to the with plasma purinergic membrane. receptors It was and shown IP3that receptors Epac2 of wasintracellular targeted specifically Ca2+ stores. to non-lipidCompartmentalization raft domains of allo thewed plasma for efficient membrane purinergic [20]. Ca2+ signaling and activationWe measured of TMEM16A the anion [5]. conductance Such functional of the comp plasmaartments membrane-targeted were found in Xenopus channels oocytes with twoand in diffdorsalerent methods: root ganglia first, by and YFP-quenching were essential using ATPfor andefficient the Ca 2TMEM16A+ ionophore ionomycin,activation and[25–27]. second, This by patch-clampcompartmentalization in whole-cell by configurationtethering the afterER to ionomycin the plasma application. membrane To might verify theallow YFP-quenching for a restricted assay,regulation we overexpressed of local Ca2+ TMEM16A-CFP concentrations. as ER-tethering control and has found also increased been described basal iodide for the permeability, yeast TMEM16A- as reportedhomolog earlier Ist2 [4 [28]] (Figure and 3TMEM16HA,D). Reducing [11]. theThe intracellular increase in Cabasal2+ concentration activity of TMEM16A with the Ca (Figure2+-chelator 3A,3D) BAPTAcould attenuated be explained basal activityby dislocation of TMEM16A of overexpr (Figure3essedA,D). TMEM16A isto activated non-lipid through raft purinergicdomains and stimulationactivation via by P2Y cytosolic receptors. Ca2+, It which was shown could thatbe chelated TMEM16A by BAPTA is organized (Figure in a3A,3D). functional compartment 2+ togetherATP with induced purinergic iodide receptors permeability and IP3 receptors (Ip) in HEK of intracellular293 cells expressing Ca stores. TMEM16E-, Compartmentalization TMEM16H- and allowedTMEM16K-CAAX for efficient purinergiccompared Cato2 +CFP-expressingsignaling and activationcells, which of could TMEM16A not be [5 ].further Such functionalenhanced by ionomycin (Figure 3E–H). Similar results for TMEM16E-, TMEM16J- and TMEM16K-CAAX were obtained from the patch-clamp study (Figure 5). In contrast, activation of TMEM16H-CAAX could

Int. J. Mol. Sci. 2020, 21, 4065 10 of 15 compartments were found in Xenopus oocytes and in dorsal root ganglia and were essential for efficient TMEM16A activation [25–27]. This compartmentalization by tethering the ER to the plasma membrane might allow for a restricted regulation of local Ca2+ concentrations. ER-tethering has also been described for the yeast TMEM16A-homolog Ist2 [28] and TMEM16H [11]. The increase in basal activity of TMEM16A (Figure3A,D) could be explained by dislocation of overexpressed TMEM16A to non-lipid raft domains and activation by cytosolic Ca2+, which could be chelated by BAPTA (Figure3A,D). ATP induced iodide permeability (Ip) in HEK293 cells expressing TMEM16E-, TMEM16H- and TMEM16K-CAAX compared to CFP-expressing cells, which could not be further enhanced by ionomycin (Figure3E–H). Similar results for TMEM16E-, TMEM16J- and TMEM16K-CAAX were obtained from the patch-clamp study (Figure5). In contrast, activation of TMEM16H-CAAX could not be induced by ionomycin under whole-cell condition (Figure5C). Tannic acid (20 µM), a non-specific blocker of TMEM16 paralogs, inhibited the ionomycin- or ATP-induced iodide permeability (Ip) as well as the ionomycin-induced whole-cell conductance, confirming activation of intracellular TMEM16 paralogs at the plasma membrane (Figures4 and5). TMEM16F is located at the plasma membrane and is an inducible Ca2+-activated lipid scramblase mediating passive transport of phospholipids, in particular phosphatidylserine (PtdSer), between both membrane leaflets [1–3]. The crystal structure of the fungal nhTMEM16 lipid scramblase indicated a lateral hydrophilic groove facing the plasma membrane, allowing for translocation of the hydrophilic head groups of phospholipids across the plasma membrane. This pathway is thought also to provide a nonspecific pathway for the anion permeability [29]. Other TMEM16 proteins, like TMEM16E, -H, -J and -K, are expressed mainly at the membranes of intracellular compartments [4,11,14,18,19] and are therefore difficult to study at the functional level. The first evidence that intracellular TMEM16 proteins operate as scramblases came from a chimeric approach in which a 35-aa-long stretch connecting transmembrane domains 4 and 5, designated “scrambling domains” in the TMEM16F protein [29], was introduced in the corresponding site of TMEM16A [30]. This study identified TMEM16E as a scramblase with a strong activity and TMEM16J and TMEM16K as scramblases with lower activities when compared to TMEM16F. For TMEM16H, no scramblase activity was found [30]. In our study, we could not confirm scrambling activity for TMEM16E, TMEM16J and TMEM16K (Figure6). Moreover, the main parts of the cells which express the TMEM16-CAAX paralogs showed no annexin V staining after application of ionomycin (Figure6A–D). To follow these surprising findings, we investigated P2X7 receptors (P2X7R)-dependent membrane blebbing, which is associated with PtdSer exposure [31,32]. P2X7R are ligand-gated, non-selective cation channels that are activated by high concentrations of extracellular nucleotides, released during inflammation, tissue injury and T-cell activation [33,34]. Activation of P2X7R by high extracellular ATP concentrations induced not only an instantaneous inward cationic current but also pore formation. This pore is non-selective and permeable to molecules up to 900 Da [31,32]. By the work of Ousingsawat et al., it was shown that activation of P2X7R caused Ca2+ influx, which activated—with a delay of seconds up to 2 min—a large whole-cell current and permeation of the fluorescent molecules YO-PRO-1, fluorescein and calcein [35–38]. Increase in intracellular Ca2+ by the P2X7R activated TMEM16F. TMEM16F was in part responsible for the delayed pore conductance and dye uptake [35]. TMEM16F also participated in many of the essential cellular responses downstream of P2X7R like initial cell shrinkage, membrane phospholipid scrambling, membrane blebbing and apoptosis [35]. Membrane blebbing was defined as a phenomenon in response to elevated intracellular Ca2+, where large membrane-bound vesicles (about 0.5 µm in diameter) protruded rapidly from the cell surface [39,40]. These vesicles were characterized by phosphatidylserines externalized to the outer membrane leaflet [31,32]. Blebbing has been observed during such processes as mitosis, cytokinesis, differentiation and apoptosis [40,41]. Targeting intracellular TMEM16 paralogs to the plasma membrane resulted in a reduction of P2X7R-dependent membrane blebbing induced by 5 mM ATP (Figure7). Int. J. Mol. Sci. 2020, 21, 4065 11 of 15

During apoptosis, platelet activation or formation of extracellular vesicles, a rapid externalization of PtdSer is occurring. It was found that the PtdSer concentration is 2- to 3-fold higher in lipid rafts as compared to the non-raft membrane [42–45]. Externalization of PtdSer to the outer leaflet in lipid rafts is dependent on TMEM16F activity [46–49]. Ionomycin or activation of P2X7R induces a strong increase in the intracellular calcium concentration, which activates endogenous TMEM16F [35]. Therefore, activation of TMEM16F caused PtdSer exposure and membrane blebbing in our experiments (Figures6 and7). Overexpression of TMEM16-CAAX paralogs in the plasma membrane outside lipid rafts appears to counteract TMEM16F activity, possibly by scrambling PtdSer back to the inner leaflet and thus reducing PtdSer exposure. Such a scenario could explain the surprising finding that plasma membrane expression of intracellular TMEM16 paralogs inhibits ionomycin-induced scrambling and membrane blebbing. In summary, the fusion of the C-terminal CAAX box moves intracellular TMEM16 proteins to the plasma membrane, which may be then assessable through functional studies. We showed that TMEM16E, -H, -J and -K produced Ca2+-activated anion currents, a result that corresponds well to our earlier findings [4]. Moreover, TMEM16E, -H, -J and -K reduced scrambling activity and P2X7R-dependent membrane blebbing. These results suggest that intracellular TMEM16 paralogs stabilize intracellular membranes by preventing scrambling activity and subsequent membrane blebbing. Further investigation is necessary to clarify the function of intracellular TMEM16 paralogs and to elucidate the mechanism of how these TMEM16 paralogs regulate membrane properties.

4. Materials and Methods

4.1. Cell Culture, cDNAs and Transfection Human embryonic kidney HEK293T cells (ATCC, CRL-3216, LGC Standards GmbH, Wesel, Germany) and HEK293T stably expressing hsYFP-I152L (HEK-YFP,Amgen GmbH, München, Germany) were grown in DMEM low-glucose medium supplemented with 10% (v/v) FBS, 1% (v/v) l-glutamine and 10 mM HEPES (all from Capricorn Scientific, Ebsdorfergrund, Germany). HEK-YFP cells were cultured in the presence of selection antibiotic puromycin (0.5 µg/mL); Sigma-Aldrich, Missouri, USA). Fisher rat thyroid (FRT) cells were cultured in Invitrogen’s DMEM/F-12 GlutaMAXTM-I medium, supplemented with 5% fetal calf serum and 1% penicillin (100,000 units/L)/streptomycin (100 mg/L). TMEM16A (NM_001378095.1), TMEM16E (NM_213599), TMEM16H (NM_020959), TMEM16J (NM_001012302) and TMEM16K (NM_001346468.1) cDNAs were cloned into the pcDNA3.1 plasmid. Cyan fluorescent protein (CFP) and the CAAX motif (KKKKSKTKCVIM) were cloned on the 3’-end of TMEM16 cDNA by standard cloning technique. CAAX motif was inserted by using the Primer 5´- ATATATTTAAATCTAGAAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTA ATTATGTAAGGGCCCATATATTTAA-3´. T16A/T16E and T16A/T16K chimeras were generated by using the BEBuilder HiFi DNA Assembly cloning method (New England BioLabs, Frankfurt, Germany). All the primers were from Eurofins Genomics (Ebersberg, Germany). All constructs were verified by sequencing (SeqLab, Göttingen, Germany). HEK293T cells were seeded in fibronectin- and collagen-coated 18 mm coverslips and transfected with plasmid vectors using standard protocols for Lipofectamine 3000 (Thermo Fisher Scientific, Germany). For cell blebbing experiments, HEK293T cells were transfected with human P2X7R (gift from Prof. Schmalzing, Institut für Pharmakologie & Toxikologie, Universitätsklinikum der RWTH Aachen) and CFP plasmids in the ratio of 4:1. All experiments were performed 48–72 h after transfection.

4.2. Immunocytochemistry Transfected FRT cells were ﬁxed for 10 min with 4%(w/v) paraformaldehyde as described previously [18]. In brief, cells were permeabilized and blocked with 2% (w/v, PBS) bovine serum albumin and 0.04% (v/v, PBS) Triton X-100. After 1 h incubation with primary antibody mouse Int. J. Mol. Sci. 2020, 21, 4065 12 of 15

anti-His tag (1:500, Qiagen, Hilden, Germany) at 37 ◦C, cells were incubated with a secondary donkey anti-mouse antibody conjugated with AlexaFluor 488 (1:1.000, Molecular Probes, Invitrogen). Nuclei were stained with Hoe33342 (0.1 µg/mL PBS, Aplichem, Darmstadt, Germany). β-Catenin (primary rabbit antibody from Sigma-Aldrich (C2206, Deisenhofen, Germany) was visualized using an Alexa 568-labeled secondary antibody. Cells were mounted on glass slides with ﬂuorescence mounting medium (DAKOCytomation, Hamburg, Germany) and examined with an ApoTome Axiovert 200 M ﬂuorescence microscope (Zeiss, Göttingen, Germany).

4.3. Annexin V Live Staining TMEM16-CFP-CAAX transfected cells grown on glass coverslips were incubated with Annexin V Alexa Fluor 555 (0.9 µg/mL, Life Technologies, Germany) and Hoe33342 for 10 min at RT in Ringer 2+ solution (mmol/L: NaCl 145; KH2PO4 0.4; K2HPO4 1.6; Glucose 5; MgCl2 1; Ca -Gluconate 1.3). To chelate intracellular Ca2+, cells were pre-incubated with 50 µM BAPTA-AM (Calbiochem; Merck, Germany) and 0.02% pluronic F-127 (Invitrogen, Thermo Fisher Scientific, Germany) for 30 min at RT. Live fluorescence images were obtained from a ApoTome 2 Axio Observer fluorescence microscope with ZEN software (Zeiss, Göttingen, Germany). CFP-fluorescence was monitored using the filter set #37 (excitation: 450/50 nm; emission: 510/50 nm), and for Annexin V Alexa Fluor 555 fluorescence the filter set #43 HE DS Red (excitation: 545/25 nm; emission: 605/70 nm) was used (Zeiss, Göttingen, Germany).

4.4. Iodide Quenching Assay The iodide-sensitive enhanced yellow fluorescent protein (EYFP-I152L) was used to measure anion conductance as described previously [18]. Cells grown on coverslips were continuously perfused at 4–5 mL/min with Ringer solution (37 ◦C). YFP-I152L-fluorescence was excited at 485 nm and CFP-fluorescence at 440 nm to identify TMEM16-CFP-CAAX-positive cells (Figure S1) using a high-speed polychromatic illumination system for microscopic fluorescence measurements (Visitron Systems, Puchheim, Germany). The emitted light at 535 25 nm was detected with a Coolsnap HQ ± CCD camera (Roper Scientific). Quenching of YFP-I152L-fluorescence by iodide influx was induced by replacing 20 mM extracellular chloride by iodide. Images were analyzed with Metafluor software (Universal Imaging). Changes in fluorescence induced by iodide were expressed as initial rates of fluorescence decrease (∆F/∆t).

4.5. Whole-Cell Patch Clamp Patch-clamp experiments in the fast whole-cell configuration were performed as described earlier [35]. In brief, cells were grown on coated glass coverslips, and these were mounted in a perfused bath chamber (37 ◦C) on the stage of an inverted microscope (IM35, Zeiss, Oberkochen, Germany). Patch pipettes were filled with a solution containing, in mM, CsCl 145, NaH2PO4 1.2, Na2HPO4 4.8, EGTA 1, Ca2+-Gluconate 0.209, d-Glucose 5, ATP 3; Ca2+ activity was 0.01 µM, pH 7.2. Patch pipettes had an input resistance of 2–4 MΩ. The access conductance was monitored continuously and was 60–140 nS. Currents and voltages were recorded using a patch-clamp amplifier (EPC 9, List Medical Electronics, Darmstadt, Germany). Data were analyzed using PULSE software (HEKA, Lambrecht, Germany). In regular intervals, membrane voltage (Vc) was clamped in steps of 20 mV from 100 to − +100 mV from a holding voltage of 100 mV. Current density was calculated by dividing whole-cell − currents by cell capacitance.

4.6. Materials and Statistic All compounds used were of the highest available grade of purity. Data are reported as mean SEM. ± Student’s t-test was used for unpaired or paired samples comparison, and diﬀerences between more than two means were tested by using one-way analysis of variance (ANOVA) with a Bonferroni–Holm multiple comparisons test (post-hoc test), with signiﬁcance assumed when p < 0.05. Int. J. Mol. Sci. 2020, 21, 4065 13 of 15

5. Conclusions Intracellular TMEM16 proteins can be targeted to the plasma membrane by adding a CAAX motif to their C-terminus and there they are assessable through functional studies. We could show that TMEM16E, -H, -J and K have inducible anion conductance and stabilize intracellular membranes by preventing scrambling activity and subsequent membrane blebbing. Further investigation is necessary to elucidate the mechanism of how these TMEM16 paralogs regulate membrane properties.

Supplementary Materials: Supplementary materials can be found at http://www.mdpi.com/1422-0067/21/11/ 4065/s1, Figure S1: HEK293-YFP cells were transfected with (A) TMEM16A-CFP, (B) TMEM16E-CFP-CAAX, (C) TMEM16H-CFP-CAAX, (D) TMEM16J-CFP-CAAX and (E) TMEM16K-CFP-CAAX. An excitation wavelength of 485 nm was used to measure YFP-fluorescence, whereas an excitation wavelength of 440 nm was used to identify plasma membrane-targeted TMEM16E/-H/-J/-K-expressing cells by CFP-fluorescence. Fluorescence emission was measured at 520–540 nm. Bar 10 µm. Author Contributions: Conceptualization, R.S. and K.K.; methodology, R.S. and J.O; validation, R.S. and J.O; formal analysis, R.S. and J.O.; investigation, R.S. and J.O.; writing—original draft preparation, R.S. writing—review and editing, K.K. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by Deutsche Forschungsgemeinschaft (DFG)—project number A3, 387509280— SFB 1350. Conflicts of Interest: The authors declare no conflict of interest.

Abbreviations

ANO Anoctamin ANO1 TMEM16A ANO5 TMEM16E ANO6 TMEM16F ANO8 TMEM16H ANO9 TMEM16J ANO10 TMEM16K P2X7R P2X7 receptor TMEM16 Transmembrane protein 16

References

1. Kunzelmann, K.; Tian, Y.; Martins, J.R.; Faria, D.; Kongsuphol, P.; Ousingsawat, J.; Thevenod, F.; Roussa, E.; Rock, J.; Schreiber, R. Anoctamins. Pflug. Arch. Eur. J. Physiol. 2011, 462, 195–208. [CrossRef] 2. Kunzelmann, K.; Nilius, B.; Owsianik, G.; Schreiber, R.; Ousingsawat, J.; Sirianant, L.; Wanitchakool, P.; Bevers, E.M.; Heemskerk, J.W. Molecular functions of anoctamin 6 (TMEM16F): A chloride channel, cation channel, or phospholipid scramblase? Pflug. Arch. Eur. J. Physiol. 2014, 466, 407–414. [CrossRef][PubMed] 3. Falzone, M.E.; Malvezzi, M.; Lee, B.C.; Accardi, A. Known structures and unknown mechanisms of TMEM16 scramblases and channels. J. Gen. Physiol. 2018, 150, 933–947. [CrossRef][PubMed] 4. Tian, Y.; Schreiber, R.; Kunzelmann, K. Anoctamins are a family of Ca2+-activated Cl- channels. J. Cell Sci. 2012, 125, 4991–4998. [CrossRef] 5. Cabrita, I.; Benedetto, R.; Fonseca, A.; Wanitchakool, P.; Sirianant, L.; Skryabin, B.V.; Schenk, L.K.; Pavenstadt, H.; Schreiber, R.; Kunzelmann, K. Differential effects of anoctamins on intracellular calcium signals. FASEB J. 2017, 31, 2123–2134. [CrossRef] 6. Buchholz, B.; Faria, D.; Schley, G.; Schreiber, R.; Eckardt, K.U.; Kunzelmann, K. Anoctamin 1 induces calcium-activated chloride secretion and proliferation of renal cyst-forming epithelial cells. Kidney Int. 2014, 85, 1058–1067. [CrossRef][PubMed] 7. Wanitchakool, P.; Wolf, L.; Koehl, G.E.; Sirianant, L.; Schreiber, R.; Kulkarni, S.; Duvvuri, U.; Kunzelmann, K. Role of anoctamins in cancer and apoptosis. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 2014, 369, 20130096. [CrossRef] 8. Kunzelmann, K.; Ousingsawat, J.; Benedetto, R.; Cabrita, I.; Schreiber, R. Contribution of Anoctamins to Cell Survival and Cell Death. Cancers 2019, 11, 382. [CrossRef] Int. J. Mol. Sci. 2020, 21, 4065 14 of 15

9. Tsutsumi, S.; Kamata, N.; Vokes, T.J.; Maruoka, Y.; Nakakuki, K.; Enomoto, S.; Omura, K.; Amagasa, T.; Nagayama, M.; Saito-Ohara, F.; et al. The novel gene encoding a putative transmembrane protein is mutated in gnathodiaphyseal dysplasia (GDD). Am. J. Hum. Genet. 2004, 74, 1255–1261. [CrossRef] 10. Bolduc, V.; Marlow, G.; Boycott, K.M.; Saleki, K.; Inoue, H.; Kroon, J.; Itakura, M.; Robitaille, Y.; Parent, L.; Baas, F.; et al. Recessive mutations in the putative calcium-activated chloride channel Anoctamin 5 cause proximal LGMD2L and distal MMD3 muscular dystrophies. Am. J. Hum. Genet. 2010, 86, 213–221. [CrossRef] 11. Jha, A.; Chung, W.Y.; Vachel, L.; Maleth, J.; Lake, S.; Zhang, G.; Ahuja, M.; Muallem, S. Anoctamin 8 tethers endoplasmic reticulum and plasma membrane for assembly of Ca2+ signaling complexes at the ER/PM compartment. EMBO J. 2019, 38.[CrossRef][PubMed] 12. Li, C.; Cai, S.; Wang, X.; Jiang, Z. Identification and characterization of ANO9 in stage II and III colorectal carcinoma. Oncotarget 2015, 6, 29324–29334. [CrossRef][PubMed] 13. Jun, I.; Park, H.S.; Piao, H.; Han, J.W.; An, M.J.; Yun, B.G.; Zhang, X.; Cha, Y.H.; Shin, Y.K.; Yook, J.I.; et al. ANO9/TMEM16J promotes tumourigenesis via EGFR and is a novel therapeutic target for pancreatic cancer. Br. J. Cancer 2017, 117, 1798–1809. [CrossRef][PubMed] 14. Hammer, C.; Wanitchakool, P.; Sirianant, L.; Papiol, S.; Monnheimer, M.; Faria, D.; Ousingsawat, J.; Schramek, N.; Schmitt, C.; Margos, G.; et al. A Coding Variant of ANO10, Affecting Volume Regulation of Macrophages, Is Associated with Borrelia Seropositivity. Mol. Med. 2015, 21, 26–37. [CrossRef][PubMed] 15. Vermeer, S.; Hoischen, A.; Meijer, R.P.; Gilissen, C.; Neveling, K.; Wieskamp, N.; de Brouwer, A.; Koenig, M.; Anheim, M.; Assoum, M.; et al. Targeted next-generation sequencing of a 12.5 Mb homozygous region reveals ANO10 mutations in patients with autosomal-recessive cerebellar ataxia. Am. J. Hum. Genet. 2010, 87, 813–819. [CrossRef][PubMed] 16. Chamard, L.; Sylvestre, G.; Koenig, M.; Magnin, E. Executive and Attentional Disorders, Epilepsy and Porencephalic Cyst in Autosomal Recessive Cerebellar Ataxia Type 3 Due to ANO10 Mutation. Eur. Neurol. 2016, 75, 186–190. [CrossRef] 17. Balreira, A.; Boczonadi, V.; Barca, E.; Pyle, A.; Bansagi, B.; Appleton, M.; Graham, C.; Hargreaves, I.P.; Rasic, V.M.; Lochmuller, H.; et al. ANO10 mutations cause ataxia and coenzyme Q(1)(0) deficiency. J. Neurol. 2014, 261, 2192–2198. [CrossRef] 18. Schreiber, R.; Uliyakina, I.; Kongsuphol, P.; Warth, R.; Mirza, M.; Martins, J.R.; Kunzelmann, K. Expression and function of epithelial anoctamins. J. Biol. Chem. 2010, 285, 7838–7845. [CrossRef] 19. Di Zanni, E.; Gradogna, A.; Scholz-Starke, J.; Boccaccio, A. Gain of function of TMEM16E/ANO5 scrambling activity caused by a mutation associated with gnathodiaphyseal dysplasia. Cell. Mol. Life Sci. 2018, 75, 1657–1670. [CrossRef] 20. Agarwal, S.R.; Yang, P.C.; Rice, M.; Singer, C.A.; Nikolaev, V.O.; Lohse, M.J.; Clancy, C.E.; Harvey, R.D. Role of membrane microdomains in compartmentation of cAMP signaling. PLoS ONE 2014, 9, e95835. [CrossRef] 21. Gao, J.; Liao, J.; Yang, G.Y. CAAX-box protein, prenylation process and carcinogenesis. Am. J. Transl. Res. 2009, 1, 312–325. [PubMed] 22. Galietta, L.J.; Haggie, P.M.; Verkman, A.S. Green fluorescent protein-based halide indicators with improved chloride and iodide affinities. FEBS Lett. 2001, 499, 220–224. [CrossRef] 2+ 23. Namkung, W.; Thiagarajah, J.R.; Phuan, P.W.; Verkman, A.S. Inhibition of Ca -activated Cl− channels by gallotannins as a possible molecular basis for health benefits of red wine and green tea. FASEB J. 2010, 24, 4178–4186. [CrossRef][PubMed] 24. Appels, N.M.; Beijnen, J.H.; Schellens, J.H. Development of farnesyl transferase inhibitors: A review. Oncology 2005, 10, 565–578. [CrossRef][PubMed] 25. Kunzelmann, K.; Schreiber, R.; Kmit, A.; Jantarajit, W.; Martins, J.R.; Faria, D.; Kongsuphol, P.; Ousingsawat, J.; Tian, Y. Expression and function of epithelial anoctamins. Exp. Physiol. 2012, 97, 184–192. [CrossRef] 26. Jin, X.; Shah, S.; Du, X.; Zhang, H.; Gamper, N. Activation of Ca2+ -activated Cl(-) channel ANO1 by localized Ca2+ signals. J. Physiol. 2016, 594, 19–30. [CrossRef] 27. Courjaret, R.; Machaca, K. Mid-range Ca2+ signalling mediated by functional coupling between store-operated Ca2+ entry and IP3-dependent Ca2+ release. Nat. Commun. 2014, 5, 3916. [CrossRef] 28. Maass, K.; Fischer, M.A.; Seiler, M.; Temmerman, K.; Nickel, W.; Seedorf, M. A signal comprising a basic cluster and an amphipathic alpha-helix interacts with lipids and is required for the transport of Ist2 to the yeast cortical ER. J. Cell Sci. 2009, 122, 625–635. [CrossRef] Int. J. Mol. Sci. 2020, 21, 4065 15 of 15

29. Yu, K.; Whitlock, J.M.; Lee, K.; Ortlund, E.A.; Cui, Y.Y.; Hartzell, H.C. Identification of a lipid scrambling domain in ANO6/TMEM16F. eLife 2015, 4, e06901. [CrossRef] 30. Gyobu, S.; Ishihara, K.; Suzuki, J.; Segawa, K.; Nagata, S. Characterization of the scrambling domain of the TMEM16 family. Proc. Natl. Acad. Sci. USA 2017.[CrossRef] 31. MacKenzie, A.; Wilson, H.L.; Kiss-Toth, E.; Dower, S.K.; North, R.A.; Surprenant, A. Rapid secretion of interleukin-1beta by microvesicle shedding. Immunity 2001, 15, 825–835. [CrossRef] 32. Zwaal, R.F.; Schroit, A.J. Pathophysiologic implications of membrane phospholipid asymmetry in blood cells. Blood 1997, 89, 1121–1132. [CrossRef][PubMed] 33. Wiley, J.S.; Sluyter, R.; Gu, B.J.; Stokes, L.; Fuller, S.J. The human P2X7 receptor and its role in innate immunity. Tissue Antigens 2011, 78, 321–332. [CrossRef][PubMed] 34. Elliott, J.I.; Surprenant, A.; Marelli-Berg, F.M.; Cooper, J.C.; Cassady-Cain, R.L.; Wooding, C.; Linton, K.; Alexander, D.R.; Higgins, C.F. Membrane phosphatidylserine distribution as a non-apoptotic signalling mechanism in lymphocytes. Nat. Cell Biol. 2005, 7, 808–816. [CrossRef] 35. Ousingsawat, J.; Wanitchakool, P.; Kmit, A.; Romao, A.M.; Jantarajit, W.; Schreiber, R.; Kunzelmann, K. Anoctamin 6 mediates effects essential for innate immunity downstream of P2X7 receptors in macrophages. Nat. Commun. 2015, 6, 6245. [CrossRef] 36. Surprenant, A.; Rassendren, F.; Kawashima, E.; North, R.A.; Buell, G. The cytolytic P2Z receptor for extracellular ATP identified as a P2X receptor (P2X7). Science 1996, 272, 735–738. [CrossRef] 37. Faria, R.X.; Defarias, F.P.; Alves, L.A. Are second messengers crucial for opening the pore associated with P2X7 receptor? Am. J. Physiol. Cell Physiol. 2005, 288, C260–C271. [CrossRef] 38. Faria, R.X.; Reis, R.A.; Casabulho, C.M.; Alberto, A.V.; de Farias, F.P.; Henriques-Pons, A.; Alves, L.A. Pharmacological properties of a pore induced by raising intracellular Ca2+. Am. J. Physiol. Cell Physiol. 2009, 297, C28–C42. [CrossRef] 39. Keller, H.; Rentsch, P.; Hagmann, J. Differences in cortical actin structure and dynamics document that different types of blebs are formed by distinct mechanisms. Exp. Cell Res. 2002, 277, 161–172. [CrossRef] 40. Hagmann, J.; Burger, M.M.; Dagan, D. Regulation of plasma membrane blebbing by the cytoskeleton. J. Cell. Biochem. 1999, 73, 488–499. [CrossRef] 41. Cohen, J.J.; Duke, R.C.; Fadok, V.A.; Sellins, K.S. Apoptosis and programmed cell death in immunity. Annu. Rev. Immunol. 1992, 10, 267–293. [CrossRef][PubMed] 42. Pike, L.J. The challenge of lipid rafts. J. Lipid Res. 2009, 50, S323–S328. [CrossRef][PubMed] 43. Pike, L.J.; Han, X.; Chung, K.N.; Gross, R.W. Lipid rafts are enriched in arachidonic acid and plasmenylethanolamine and their composition is independent of caveolin-1 expression: A quantitative electrospray ionization/mass spectrometric analysis. Biochemistry 2002, 41, 2075–2088. [CrossRef][PubMed] 44. Dillon, S.R.; Mancini, M.; Rosen, A.; Schlissel, M.S. Annexin V binds to viable B cells and colocalizes with a marker of lipid rafts upon B cell receptor activation. J. Immunol. 2000, 164, 1322–1332. [CrossRef][PubMed] 45. Ishii, H.; Mori, T.; Shiratsuchi, A.; Nakai, Y.; Shimada, Y.; Ohno-Iwashita, Y.; Nakanishi, Y. Distinct localization of lipid rafts and externalized phosphatidylserine at the surface of apoptotic cells. Biochem. Biophys. Res. Commun. 2005, 327, 94–99. [CrossRef][PubMed] 46. Wei, H.; Malcor, J.M.; Harper, M.T. Lipid rafts are essential for release of phosphatidylserine-exposing extracellular vesicles from platelets. Sci. Rep. 2018, 8, 9987. [CrossRef] 47. Mattheij, N.J.; Braun, A.; van Kruchten, R.; Castoldi, E.; Pircher, J.; Baaten, C.C.; Wülling, M.; Kuijpers, M.J.; Köhler, R.; Poole, A.W.; et al. Survival protein anoctamin-6 controls multiple platelet responses including phospholipid scrambling, swelling, and protein cleavage. FASEB J. 2016, 30, 727–737. [CrossRef] 48. Veit, M.; Koyro, K.I.; Ahrens, B.; Bleibaum, F.; Munz, M.; Rövekamp, H.; Andrä, J.; Schreiber, R.; Kunzelmann, K.; Sommer, A.; et al. Anoctamin-6 regulates ADAM sheddase function. Biochim. Biophys. Acta. Mol. Cell Res. 2018, 1865, 1598–1610. [CrossRef] 49. Ousingsawat, J.; Schreiber, R.; Kunzelmann, K. TMEM16F/Anoctamin 6 in Ferroptotic Cell Death. Cancers 2019, 11, 625. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).