Oncogenic Activation of FOXR1 by 11Q23 Intrachromosomal Deletion-Fusions in Neuroblastoma

Home , Blastoma, PAFAH1B2

Oncogene (2012) 31, 1571–1581 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc ORIGINAL ARTICLE Oncogenic activation of FOXR1 by 11q23 intrachromosomal deletion-fusions in neuroblastoma

EE Santo1, ME Ebus1, J Koster1, JH Schulte2, A Lakeman1, P van Sluis1, J Vermeulen3, D Gisselsson4, I Øra4, S Lindner2, PG Buckley5, RL Stallings5, J Vandesompele3, A Eggert2, HN Caron6, R Versteeg1 and JJ Molenaar1

1Department of Oncogenomics, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands; 2Department of Pediatric Oncology, University Children’s Hospital Essen, Essen, Germany; 3Center for Medical Genetics, Ghent University Hospital, Ghent, Belgium; 4Department of Clinical Genetics, Lund University, Lund, Sweden; 5Department of Cancer Genetics, Royal College of Surgeons in Ireland and the National Children’s Research Centre, Dnublin, Ireland and 6Department of Pediatric Oncology, Emma Kinderziekenhuis, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

Neuroblastoma tumors frequently show loss of hetero- Oncogene (2012) 31, 1571–1581; doi:10.1038/onc.2011.344; zygosity of chromosome 11q with a shortest region of published online 22 August 2011 overlap in the 11q23 region. These deletions are thought to cause inactivation of tumor suppressor genes leading Keywords: FOXR1; FOXO; forkhead-box; neuroblas- to haploinsufficiency. Alternatively, micro-deletions could toma; MLL; 11q23 lead to gene fusion products that are tumor driving. To identify such events we analyzed a series of neuroblastomas by comparative genomic hybridization and single-nucleotide polymorphism arrays and integrated these data with Affymetrix mRNA profiling data with Introduction the bioinformatic tool R2 (http://r2.amc.nl). We identified three neuroblastoma samples with small interstitial Forkhead-box transcription factors are a large evolu- deletions at 11q23, upstream of the forkhead-box R1 tionarily conserved family of transcriptional regulators transcription factor (FOXR1). Genes at the proximal that share a highly conserved winged helix DNA- side of the deletion were fused to FOXR1, resulting in binding domain. Outside of this domain, forkheads fusion transcripts of MLL–FOXR1 and PAFAH1B2– have diverged into sub-families and incorporated a FOXR1. FOXR1 expression has only been detected in variety of other domains conferring on them a plethora early embryogenesis. Affymetrix microarray analysis of functions (Myatt and Lam, 2007). This divergence is showed high FOXR1 mRNA expression exclusively in especially relevant within the context of cancer where the neuroblastomas with micro-deletions and rare cases of forkhead-box genes have been found operating as other tumor types, including osteosarcoma cell line HOS. both oncogenes and tumor suppressors via a variety RNAi silencing of FOXR1 strongly inhibited proliferation of mechanisms. Among the tumor suppressors, the of HOS cells and triggered apoptosis. Expression FOXO family is the most intensely studied. Chromo- profiling of these cells and reporter assays suggested that somal translocations involving FOXO1/3/4 have FOXR1 is a negative regulator of fork-head box factor- been implicated in the genesis of pediatric malignancies. mediated transcription. The neural crest stem cell line In alveolar rhabdomyosarcoma FOXO1 is commonly JoMa1 proliferates in culture conditional to activity of a fused to the PAX3 and PAX7 (Galili et al., 1993; Davis MYC-ER transgene. Over-expression of the wild-type et al., 1994). In mixed lineage leukemia FOXO3 and FOXR1 could functionally replace MYC and drive FOXO4 are fused to the MLL gene and these fusion proliferation of JoMa1. We conclude that FOXR1 is products are sufficient for transformation of murine recurrently activated in neuroblastoma by intrachromoso- myeloid progenitors (So and Cleary, 2002, 2003). mal deletion/fusion events, resulting in overexpression Recently, triple knockout of FOXO1/3/4 in mice has of fusion transcripts. Forkhead-box transcription factors demonstrated that FOXOs are bona fide tumor sup- have not been previously implicated in neuroblastoma pressors (Paik et al., 2007). Additionally, FOXOs are pathogenesis. Furthermore, this is the first identification commonly post-translationally inactivated in a wide of intrachromosomal fusion genes in neuroblastoma. range of cancers by the activation of the PI3K/Akt pathway, which generally results from loss of the tumor suppressor phosphatase and tensin homolog or consti- Correspondence: Dr JJ Molenaar, Department of Oncogenomics, tutive activation of receptor tyrosine kinase signaling M1-132, Academic Medical Center, University of Amsterdam, (Brunet et al., 1999; Yuan and Cantley, 2008). Fork- Meibergdreef 15, Amsterdam 1105 AZ, The Netherlands. E-mail: [email protected] heads are not always tumor suppressive as FOXM1 and Received 7 March 2011; revised 2 June 2011; accepted 5 July 2011; FOXP1 demonstrate. FOXM1 is crucial for cell-cycle published online 22 August 2011 progression and mitotic spindle integrity and has been FOXR1 fusion genes in neuroblastoma EE Santo et al 1572 found in various cancers to act oncogenically (Schu¨ ller the inhibition of the transcription of forkhead-box et al., 2007; Wierstra and Alves, 2007). FOXP1 has been family target genes. identified in diffuse large B-cell lymphoma to be over- expressed as the result of intrachromosomal translocations and high expression has been linked to poor Results prognosis (Wlodarska et al., 2005; Hoeller et al., 2010). This raises the possibility that other forkheads may be of Intrachromosomal deletions create FOXR1 fusion genes comparable importance in oncogenesis. Forkhead-box in neuroblastoma R1 (FOXR1, previously named FOXN5) located on In an ongoing effort to characterize genomic aberra- 11q23.3, is another recently described member of the tions and corresponding gene expression patterns in forkhead family (Katoh and Katoh, 2004c). On the basis neuroblastoma tumors we combine mRNA expression of sequence alignment, FOXR1 is most similar to the profiling by Affymetrix microarrays and DNA copy FOXP sub-family (Myatt and Lam, 2007). FOXR1 number analysis by comparative genomic hybridization expression is restricted to the early stages of embryo- (CGH) and single-nucleotide polymorphism array genesis as is its ortholog FOXR2 (FOXN6), which is profiling for a series of 225 tumor samples. These data located on the X chromosome (Katoh and Katoh, were analyzed using the R2 web application (http:// 2004a, b; Schuff et al., 2006). r2.amc.nl). aCGH and single-nucleotide polymorphism Chromosomal deletions within the 11q23 region are a profiling identified three neuroblastomas with micro- common abnormality found in a wide range of cancers deletions in the 11q23 region. Large deletions of the (Hampton et al., 1994; Lee et al., 2000; Pulido et al., q arm of chromosome 11 are frequently found in 2000). In addition to deletions, translocations have neuroblastoma and are reasoned to lead to inactiva- also been identified. The most frequent translocations tion or haploinsufficiency of tumor suppressor genes. occur within leukemia’s, which exhibit a multitude Alternatively, intrachromosomal aberrations could of MLL gene fusion products generated by a variety lead to the formation and over-expression of fusion of chromosomal translocations (Liu et al., 2009). genes. The CGH and single-nucleotide polymorphism Neuroblastomas are pediatric tumors that arise from array profiles of tumor sample NRC0041 revealed neuroblasts of the sympathetic nervous system. Despite that NRC0041 only contains an intrachromosomal intense multi-modal therapy neuroblastoma remains deletion within one copy of 11q23 of B0.5 Mb and the second most common cause of cancer deaths among was otherwise free of genomic copy number alterations children (van Noesel and Versteeg, 2004). Previously, (Figure 1a). This micro-deletion has a distal break- deletion of the 11q23 region has been described in point in front of the FOXR1 locus and a proximal neuroblastoma with the smallest region of overlap breakpoint within the MLL gene, which creates a mapping to 11q23.3. LOH of 11q23 is associated with potential MLL–FOXR1 fusion gene. Overlaying the poor prognosis in neuroblastoma and characteristics Z-scores of Affymetrix expression data on the genomic such as advanced stage disease and unfavorable map shows that the FOXR1 gene is highly expressed in histopathology (Guo et al., 1999). Despite the clear this sample (Figure 1a). In the second tumor with an link to prognosis in neuroblastoma tumors only two 11q23 deletion, NRC0129, the micro-deletion also candidate tumor suppressors at 11q23 have been created a potential MLL–FOXR1 fusion from a proposed to date. These are cell adhesion molecule 1 B0.5 Mb deletion with breakpoints highly similar to (TSLC1) and the microRNA mir34c (Cole et al., 2008; NRC0041 as shown by single-nucleotide polymorphism Nowacki et al., 2008). array (Supplementary Figure S1). Surprisingly, the third Here we describe that a subset of neuroblastomas tumor with 11q23 deletion (NRC0051) also exhibited have intrachromosomal 11q23 deletions that create a FOXR1 fusion resulting from a B1.8 Mb deletion. PAFAH1B2–FOXR1 or MLL–FOXR1 fusion genes. However, the proximal breakpoint was located within FOXR1 is silent in all normal tissues studied, but the PAFAH1B2 gene (Supplementary Figure S1). the fusion gene is highly expressed in these neuro- We hypothesized that the FOXR1 expression resulted blastoma samples. Re-expression of FOXR1 is sufficient from the formation of a fusion gene with MLL or to drive the proliferation of non-malignant mouse PAFAH1B2. As a consequence the expression of neural crest stem cells, whereas silencing of FOXR1 FOXR1 would no longer be regulated by the FOXR1 expression in the osteosarcoma cell line, HOS, results promoter but by the promoters of MLL or PAFAH1B2. in growth inhibition and increased cell death. Analysis Support for this idea was found by using the Mega- of Affymetrix profiling data from this knockdown Sampler program of R2 (http://r2.amc.nl). R2 is a web- experiment demonstrates significant de-repression based collection of bioinformatic applications designed of genes containing the canonical forkhead-box DNA- for the analysis of gene expression and genomic data binding element (DBE) within their proximal promoter derived from various microarray platforms. R2 also regions, such as the cell-cycle inhibitor and validated contains an extensive database of publicly available gene FOXO target gene p27Kip1. Suppression of DBE-driven expression data sets. Using the MegaSampler applica- expression by FOXR1 was confirmed in luciferase tion of R2 it is possible to view the expression of a gene reporter assays with synthetic DBE-driven reporter across a user-defined panel of data sets. This showed constructs. These data strongly suggest that FOXR1 that MLL and PAFAH1B2 are relatively highly expression has an oncogenic role in neuroblastoma via expressed in neuroblastoma cell lines and tumors

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1573 aCGH overview of patient NRC0041 3.0 44369 2.5 2.0 1.5 1.0 0.5

log fold 0.0 -0.5 -1.0 -1.5 -2.0

1.0 itcc0041 SNP 56 1087 376 0.9 0.8 0.7 0.6 0.5 0.4

B Allele Freq 0.3 0.2 0.1 0.0 2.0 itcc0041 CGH 1.5 1.0 0.5 0.0 -0.5 -1.0 -1.5 -2.0 8 itcc0041 Affymetrix 6 4 2 0

zscore-2 log fold -4 -6 -8

Cyloband RefSeq

MLL FOXR1

1200 NBAF29 1000

800

600 NRC0041

400 NRC0051 HOS 200 NRC0129 0 ALL (92) Glioma (153) Breast (351) Cervix (36) Colon (315) Renal (47) Endometrium (209) Lung (121) Other (296):exocrine pancreas Other (296):liver Rectum (38) Thyroid (34) Prostate (72) Sigmoid (39) Neuroblastoma (287) Ped. cancer cell lines (86) Other (296):peritoneum Other (296):stomach Other (296):urinary bladder Normal (504) :brain Normal (504) :digestive_tract Normal (504) :muscle_heart Normal (504) :nervous_tissue Normal (504) :organ_tissue Normal (504) :others Normal (504) :reproductivge_female Normal (504) :reproductivge_male

Other cancers Normal tissues Figure 1 The MLL–FOXR1 fusion results in re-expression of FOXR1. (a) The top panel of this ﬁgure shows the aCGH overview of all chromosomes of patient NRC0041. The aberration on chromosome 6p is a known copy number variation in the control donor DNA. The second panel is a focus of the 11q23 region showing a combination of single-nucleotide polymorphism array b allele frequencies (top), aCGH log-fold copy number changes (middle) and Affymetrix mRNA Z-score data (bottom) for NRC0041. The MLL and FOXR1 genes are indicated by arrowheads. The vertical dashed lines indicate the boundaries of the 11q23 interstitial deletion. The red circle indicates the FOXR1 probe that detects the mRNA expression that results from the MLL–FOXR1 fusion. Z-scores are based on our core panel of 88 NB tumors. (b) mRNA expression of FOXR1 across a large panel of neuroblastomas (red), pediatric cancer-derived cell lines (pink) as well as other tumor types (blue) and normal tissues (green) visualized with the R2 MegaSampler program. relative to other cancers and normal tissues (Supple- FOXR1 expression. We used MegaSampler to analyze mentary Figure S2). This indicated that the promoters the expression of FOXR1 in 287 neuroblastomas and in of these genes may indeed be driving the observed a broad panel of 504 normal tissues, 1803 other cancers

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1574 and a collection of 86 pediatric cancer cell lines. FOXR1 (Table 1). A total of 7 neuroblastomas with strong is highly expressed in only four neuroblastoma tumors FOXR1 over-expression were, therefore, identified in 649 (three tumors with the confirmed 11q23 micro-deletions neuroblastomas, which in all three analyzable cases were and one additional tumor sample), one endometrial caused by micro-deletion and potential fusion events. tumor and the osteosarcoma cell line HOS. For the To confirm the existence of FOXR1 fusion genes, additional neuroblastoma with high FOXR1 expression, cDNA was generated and PCR performed to sequence NBAF29, no genomic DNA was available to analyze for the products using forward primers within the first micro-deletions. Expression of FOXR1 is essentially exons of MLL and PAFAH1B2 and reverse primers silent in all other samples, including those of normal within the FOXR1 coding sequence. In all, three tumors tissue (Figure 1b). This is consistent with previous with intrachromosomal 11q23 micro-deletions and findings that FOXR1 expression is only detectable in high expression of FOXR1 we could sequence verify the early stages of embryogenesis (Katoh and Katoh, cDNA fusion products (Figures 2a, b and c). The MLL- 2004a, b; Schuff et al., 2006). To further explore the FOXR1 cDNA of NRC0129 contained the complete extent of FOXR1 expression in neuroblastoma, we exon 1 of MLL (422 bp) in addition to 87 bp of performed quantitative (qPCR) on an additional 362 the FOXR1 promoter and 226 bp of the FOXR1 neuroblastoma tumor samples and identified three 50 untranslated region. The cDNA of NRC0041 also more tumors exhibiting very high FOXR1 expression contained exon 1 of MLL (422 bp), 15 bp of intron 1 of

Table 1 Summary of neuroblastoma tumor samples that exhibit FOXR1 expression as measured by either microarray or qPCR Tumor no. Tumor series mRNA 11q23 Tumor Age Sex State Follow-up Histology MYCN platform deletion stage (months)

NRC0041 Amsterdam Affymetrix Confirmed 3 o1year Female CR 60 NB SC 133plus2 NRC00129 Amsterdam Affymetrix Confirmed 4 1–2 years Male Death — NB SC 133plus2 NRC0051 Dublin Affymetrix Confirmed 3 3 years Female CR 24 NB SC 133plus2 NBAF29 Paris Affymetrix No DNA 3 — — — — NB SC 133plus2 1894 SIOPEN FOXR1 qPCR No DNA 2 o1year Female CR 64.3 NB SC 1761 SIOPEN FOXR1 qPCR No DNA 3 o1year Male CR 80.9 NB SC 1890 SIOPEN FOXR1 qPCR No DNA 3 o1year Male CR 52.5 NB SC

Abbreviations: FOXR1, forkhead-box R1; QPCR, quantitative PCR.

MLL FOXR1 FOXR1 FOXR1 MLL Exon1 promoter 5'UTR CDS FOXR1 5'UTR (422bp) (87bp) (226 bp) (755 bp) 3'UTR NRC0129

MLL FOXR1 FOXR1 MLL Intron1 promoter 5'UTR FOXR1 MLL Exon1 (15bp) (30bp) (226 bp) CDS FOXR1 5'UTR (422bp) (755 bp) 3'UTR NRC0041

PAFAH1B2 FOXR1 FOXR1 FOXR1 Exon1+2 promoter 5'UTR CDS PAFAH1B2 FOXR1 (177bp) (87bp) (226 bp) (755 bp) 5'UTR 3'UTR NRC0051

con NRC 0051

600 600 400 400

Figure 2 Veriﬁcation of the MLL–FOXR1 and PAFAH1B2–FOXR1 fusion transcripts. (a) Schematic diagrams of the sequence results of the FOXR1 fusion transcripts identiﬁed in three tumors. Arrowheads indicate locations of primers used for real-time (RT)–PCR and sequencing. (b) RT–PCR products generated from MLL–FOXR1 fusions. (c) RT–PCR product generated from PAFAH1B2–FOXR1 fusion.

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1575 MLL, 30 bp of the FOXR1 promoter and 226 bp of the various parts of MLL or PAFAH1B2 while all included FOXR1 50 untranslated region. The cDNA of NRC0051 full-length FOXR1. This suggests that the tumor driving contained exons 1 and 2 of PAFAH1B2 (177 bp), 87 bp event is the over-expression of the FOXR1 gene product. of the FOXR1 promoter and 226 bp of the FOXR1 Therefore, we sub-cloned the full-length FOXR1 open 50 untranslated region. For all fusion genes the FOXR1 reading frame (ORF) from the NRC0129 cDNA into coding sequence was in-frame with the coding sequences the pMSCVpuro expression vector for further charac- of MLL or PAFAH1B2. Fusion cDNAs contained terization. To evaluate the oncogenic potential of the full-length FOXR1 coding sequence. In addition to FOXR1 over-expression we used mouse JoMa1 neuro- the fusion genes containing full-length FOXR1 we could blasts stably expressing a 4-hydroxytamoxifen (4-OHT) identify splice variants missing exon 5 or exon 4 and 5 inducible ER-c-myc fusion gene (Maurer et al., 2007). of FOXR1. Both FOXR1 splice variants have been Normally, cultured mouse neuroblasts undergo apopto- reported in the Genbank database as expressed sequence sis or differentiate if cultured in vitro but JoMa1 cells tags. The supplemental contains the actual cDNA maintain a MYC-dependent proliferative phenotype sequences for these fusion products. when treated with 4-OHT. Withdrawal of 4-OHT results in MYC exclusion from the nucleus and cell cycle arrest. FOXR1 can substitute for MYC-driven proliferation In order to explore the role of FOXR1 in neuroblast in mouse neuroblasts proliferation we over-expressed either FOXR1 or green It is known that most oncogenic MLL fusion genes ﬂuorescent protein in JoMa1 cells. After withdrawal of involve large and functionally deﬁned regions of MLL. 4-OHT FOXR1 was able to fully compensate for MYC- The MLL–FOXR1 fusion gene does not include such a driven proliferation in these neuroblasts (Figures 3a and region. The three different fusion genes all contained b). High FOXR1 expression, therefore, maintains the

JoMa1JoMa1-FOXR1 JoMa1-GFP

+4OHT

-4OHT

0.09 +4OHT 0.08 -4OHT

0.07

0.06

0.05

0.04

0.03 Absorbance at 570 nM 0.02

0.01

0 JoMa1JoMa1-FOXR1 JoMa1 GFP Figure 3 Constitutive over-expression of FOXR1 maintains the proliferation of JoMa1 cells following withdrawal of 4-OHT. (a) Light microscopy images of JoMa1 mother line, JoMa1-FOXR1 and JoMa1-green ﬂuorescent protein (GFP) lines with and without 4-OHT. (b) MTT assay quantiﬁcation of cell viability with and without 4-OHT addition. Cells were seeded at 1000 cells per well in 96-well plates and 4-OHT was withdrawn. After 72 h, cell viability was measured by MTT assay.

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1576 proliferative capacity of primary neuroblasts. This and analyzed by fluorescence-activated cell sorter. finding strongly supports the genomic evidence and Silencing of FOXR1 resulted in a dramatic increase of implicates aberrant FOXR1 expression in neuroblasto- the sub-G1 fraction, suggesting that the reduced HOS ma oncogenesis. growth was at least in part because of an increase in apoptosis (Figure 4d). Silencing of FOXR1 in osteosarcoma HOS cells results in cell cycle arrest and cell death FOXR1 suppresses forkhead-box family target genes Because the JoMa1 results demonstrate that FOXR1 To further delve into FOXR1 function, we performed can drive proliferation we next asked if knockdown Affymetrix profiling of the FOXR1 knockdown in HOS. of endogenously expressed FOXR1 could inhibit it. We isolated a time series of RNAs at 0, 16, 24, 48 and From the previous use of MegaSampler we had 72 h after lentiviral-mediated silencing of FOXR1 or identified the osteosarcoma cell line HOS as expressing transduction with the SHC002 control virus. A data FOXR1 (Figure 1c). We transduced HOS cells with five set was generated and analyzed using the built-in R2 lentiviral shRNAs targeting FOXR1 from the Sigma time series module as well as identifying the strongly lentiviral TRC library and a scrambled control shRNA regulated genes by analysis of variance analysis. (SHC002) at equal multiplicity of infection for all This analysis provided further confirmation of our shRNAs. The knockdown of FOXR1 was confirmed FOXR1 knockdown by both shRNAs (Figure 5a). by qPCR, which identified the best shRNAs as B4 and Additionally, we identified 180 genes upregulated and B8 (Figure 4a). As expected, FOXR1 knockdown with 148 genes downregulated following FOXR1 silencing both shRNAs resulted in a very large reduction in (see Materials and methods for analytic method). growth as assessed in a 3T3 assay (Figures 4b and c). Among the strongly activated genes were the cell-cycle At 144 h post-transduction, HOS nuclei were isolated inhibitors p21Cip1, p27Kip1 and the mTORC2 compo-

FOXR1 QPCR -10 0 16 24 48 72 No virus -11 SHC control FOXR1 shRNA B4 SHC FOXR1 shRNA B4 FOXR1 shRNA B8 -12 FOXR1 shRNA B8

-dCt -13

-14

-15 FACS 100 100

Cell growth (3T3 assay) 80 80 8E+09 60 60 7E+09 40 40 % of Max 6E+09 % of Max 5E+09 20 20

4E+09 0 0 0 200 400 600 800 1000 0 200 400 600 800 1000

Cell count 3E+09 NV SHC 2E+09 100 100 1E+09 80 80 0 0 3 6 10 13 60 60 days

SHC control 40 % of Max 40 FOXR1 shRNA B8 % of Max FOXR1 shRNA B4 20 20 0 0 0 200 400 600 800 1000 0 200 400 600 800 1000 FOXR1 shRNAB4 FOXR1 shRNAB8 Figure 4 Knockdown of FOXR1 expression by lentiviral shRNA reduces HOS cell proliferation and induces apoptosis. (a) Time- course qPCR analysis of FOXR1 knockdown in HOS cells. HOS cells were transduced with control shRNA SHC002, FOXR1 shRNA B4 or B8. We also included a non-transfected control sample. Total RNA was harvested at the indicated time points (time point 0 being untransduced cells). qPCR was performed to measure FOXR1 expression and the inverse dCT is plotted in the ﬁgure. (b) Images of control and FOXR1 shRNA-transduced HOS cells at 72 h post-transduction. (c) 3T3 assay of SHC002 and FOXR1 shRNA transduced HOS cells. Cells were transduced at an multiplicity of infection (M.O.I.) of 3 with the indicated shRNAs. After 24 h infection, 1 mg/ml puromycin was added. After 24 h,the medium was refreshed again without puromycin. Cells were then counted and re-seeded at 3-day interval over the course of 13 days. All assays were performed in triplicate with the individual results plotted in matching colors for each shRNA. (d) Fluorescence-activated cell sorter (FACS) analysis of SHC002 and FOXR1 shRNA transduced HOS cells. Cells were transduced or not with control and FOXR1 shRNAs at an M.O.I. of 3. Transduced cells were selected on puromycin for 24 h and then the medium was changed. At 72 h nuclei were harvested and stained with propidium iodide. The assay was carried out in triplicate for each shRNA. A total of 30 000 nuclei were counted per sample. All assays were performed in triplicate.

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1577 nent Rictor (Figure 5a). Interestingly, these three genes showed no enrichment for forkhead motifs. This is are well-characterized FOXO family target genes probably because both FOXO and FOXJ2 are known normally upregulated by FOXO activity (Stahl et al., transcriptional activators and generally not associated 2002; Gomis et al., 2006; Chen et al., 2010). with direct transcriptional repression of their target This finding raised the possibility that forkhead-box genes (Furuyama et al., 2000; Go´ mez-Ferrerı´ a and transcription factors and particularly the FOXO family Rey-Campos, 2003). These findings suggest that of transcription factors were inactivated by FOXR1 and FOXR1 may function as a repressor of forkhead-box- re-activated upon FOXR1 silencing. To assess the extent mediated transcription by either directly or indirectly of this finding, we carried out a statistical analysis to blocking the activity of other forkheads that are identify, which transcription factor binding motifs were transcriptional activators. enriched in the genes activated and repressed by FOXR1 To test the idea that forkhead-box transcription knockdown. This analysis was carried out using the factors can be modulated by FOXR1, we generated a proximal promoters (2500 bp upstream and 500 bp pair of synthetic luciferase reporter vectors each downstream of the TSS) of the regulated genes and a containing one copy of either a functional FOXO- randomly chosen set of promoters as background. binding element (1 Â DBEwt–‘TTGTTTAC’) or a mu- We found the set of upregulated genes to be highly tant element (1 Â DBEmut—‘TGTTCTAT’; Furuyama enriched for forkhead motifs, prevalent among these et al., 2000). We then transduced HOS cells with being FOXO1/FOXO and FOXJ2 motifs (Figure 5b). FOXR1 shRNA B4 or SHC002 control virus The genes downregulated following FOXR1 silencing and subsequently co-transfected the cells with the

Enrichment of Forkhead-Box Transcription Factor Binding Sites Within Promters of Genes Up-Regulated After FOXR1 KD 1.83E-05 0.004 FOXR1 CDKN1B 100 95 BG 237613_at 209112_at FG 0.00012 1200 1200 90 85 1000 1000 80 75 800 800 70 600 600 65 60

Expression 400 Expression 400 55

% Of Genes Containing Motif 50 200 200 V$FOXO1_01 V$FOXJ2_02 V$FOXO1_02 0 0 Transfac Matrix ID 0 12 24 36 48 60 72 0 12 24 36 48 60 72 2 2 Time in hours Time in hours 2 1 1 1 bits bits bits 0 0 0 2 1 3 4 5 6 7 8 9 3 4 9 1 2 5 6 7 8 1 2 3 4 5 7 8 9 6

CDKN1A RICTOR 10 13 14 10 11 12 202284_at 226312_at 10 11 12 13 14 200 900 180 800 Induction of Forkhead-Box Transcriptional 160 700 Activity By FOXR1 Knoxkdown 140 600 0.65 120 500 100 0.6 80 400 0.55 Expression Expression 60 300 40 200 0.5 20 100 0.45 0 0 0 12 24 36 48 60 72 0 12 24 36 48 60 72 0.4 Time in hours Time in hours SHC control 0.35

FOXR1 shRNA B4 Fold-Change Relative 0.3 FOXR1 shRNA B8 To DBE Mutant Reporter 0.25 0.2 SHC002 FOXR1 shRNA B4 Figure 5 Forkhead-box transcription factors are activated following shRNA knockdown of FOXR1 in HOS cells. (a) R2 time series module plots of genes regulated by FOXR1 silencing. HOS cells were transduced at an multiplicity of infection (M.O.I.) of 3 with control SHC002 and FOXR1 shRNAs. Post-transduction total RNA was harvested at 16, 24, 48 and 72 h time points. Time point 0 was without transduction. (b) Analysis of transcription factor binding site (TFBS) content of the promoters of regulated time series genes. From the genes defined as differentially regulated in the time series experiment 167 promoters were evaluated for the 180 genes (only 1 promoter per gene, some genes having no reliable TSS information) upregulated by FOXR1 silencing. These promoters were compared to 463 randomly chosen promoters from a set of HOS cell line expressed genes (background, BG), excluding genes from among the 167 (foreground, FG) set (see Materials and methods for microarray and TFBS analysis). (c) Luciferase reporter assay after FOXR1 knockdown in HOS cells. Cells were first transduced at an M.O.I. of 3 with the control and FOXR1 shRNA B4. The following day, they were selected on puromycin for 24 h then counted and re-seeded at equal density in 24-well plates. The cells were then co- transfected in triplicate with the following combinations of vectors: (1) CMV-Renilla/pGL3-1 Â DBEmut and (2) CMV-Renilla/pGL3- 1 Â DBEwt. After 24 h, the cells were harvested and luciferase and renilla signals quantified. For analysis, the luciferase/renilla ratio was calculated for each well and the resultant values averaged within each triplicate. For each shRNA transduction, the pGL3-1 Â DBEwt reporter activity was then divided by the pGL3-1 Â DBEmut reporter activity to calculate the fold change of the 1 Â -DBEwt relative to the 1 Â -DBEmut reporter.

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1578 luciferase reporters and a renilla expression plasmid as hypothesis that this is an oncogenic event in neuroblas- an internal control. After 24 h transfection, lysates toma we provide evidence in primary mouse neuroblasts were harvested and luciferase/renilla signals quantified. that over-expression of FOXR1 is sufficient to maintain After normalization of luciferase to renilla values, neuroblast proliferation after sustaining MYC activa- the values of the 1 Â DBEwt reporter were normalized tion is withdrawn. In order to further elucidate the to the 1 Â DBEmut reporter values. Relative to the function of FOXR1 in a tumorigenic background we SHC002 control virus, we observed a twofold increase identified the HOS osteosarcoma cell line as having in forkhead-box-mediated transcriptional activity after high FOXR1 expression by R2-facilitated microarray FOXR1 silencing (Figure 5c). These data strongly analysis. Using lentiviral shRNAs that target FOXR1 suggest that FOXR1 either directly or indirectly inhibits we performed stable knockdowns in the HOS cell the transcriptional activation of forkhead-box target line. Two different shRNAs caused acute downregula- genes, some of which are well proven FOXO target tion of FOXR1 as shown by both qPCR and micro- genes. This finding implies that FOXR1 may impair the array analysis. This FOXR1 knockdown resulted in transcriptional activity of FOXO family members. an increase in the sub-G1 population as shown by fluorescence-activated cell sorter analysis as well as a Clinical characteristics of FOXR1 over-expressing tumors dramatic decrease in proliferation as measured by 3T3 growth assays. Neuroblastoma tumors with large deletions involving 11q23 are known to have a poor prognosis (Guo et al., Subsequent Affymetrix profiling of a time series of FOXR1 knockdown combined with transcription factor 1999). This is thought to be functionally related to binding site enrichment analysis revealed that many reduced expression of tumor suppressor genes that are located on the 11q deleted region and which result in putative and known forkhead-box target genes were upregulated following FOXR1 knockdown. Among increased aggressiveness of the tumor and therapy them were the well-known FOXO target genes resistance. The group of 11q-deleted tumors consists of p27Kip1, p21Cip1 and Rictor (Stahl et al., 2002; Gomis a subset of tumors with terminal 11q deletions and a et al., 2006; Chen et al., 2010). This strongly indicated subset with interstitial deletions. We now hypothesize that FOXO transcription factors may have been that in a subset of the tumors with interstitial deletions activated following FOXR1 knockdown. This suggests of 11q, the tumor driving event is not deletion of the potential for FOXR1 to either directly or indirectly a tumor suppressor but over-expression of a fusion blocks FOXO target gene expression. To test this gene. As a consequence the clinical behavior of these possibility we cloned a FOXO reporter system contain- tumors could be different. Therefore, we correlated over-expression of FOXR1 to clinical characteristics. ing one copy of the canonical forkhead-box/FOXO target sequence DBE or a mutated element. The We have a series of 287 neuroblastoma tumors for which reporter assays revealed that FOXR1 knockdown was we have mRNA profiling data and a series of 352 for indeed capable of activating forkhead-box/FOXO trans- which we have performed FOXR1 qPCR. We selected criptional activity in HOS cells. Given the identity of the samples with an increased expression of FOXR1 target genes involved FOXO appears to be the most (Affymetrix: MAS 5.0 corrected present calls above likely sub-family of forkhead-box transcription factors 100/qPCR qbasePLUS determined CNRQ above 5). Surprisingly 6 out of 7 are low-stage tumors, and 5 are that were activated although other members such as younger than 18 months. For six tumors we have follow- FOXJ2 cannot be definitively excluded. Given the up information. Five patients were in complete remis- similarity of FOXR1 to the FOXP sub-family by sion for over 50 months and only one patient died from sequence alignment it seems reasonable that FOXR1 his disease (Table 1). These findings are in contrast with may also be a transcriptional repressor such as FOXP reports on 11q-deleted tumors, which are known to be (Myatt and Lam, 2007). This suggests that FOXR1 high stage tumors and have a very poor prognosis. may have the ability to directly repress genes usually activated by other forkhead-box transcription factors. Within the context of these aberrant over-expressions in neuroblastoma and the osteosarcoma cell line HOS this Discussion repression appears to be an oncogenic event. 11q23 deletion has long been considered a prognostic Using an integrated array CGH and mRNA expression and tumor-driving event in neuroblastoma (Guo et al., analysis approach of neuroblastoma tumors we have 1999; Buckley et al., 2010). Usually interstitial deletions discovered the oncogenic activation of a forkhead-box lead to the loss of tumor suppressors, which potentiate transcription factor, FOXR1. The over-expression of oncogenesis. Here we describe the re-expression of a FOXR1 is achieved by 11q23.3 intrachromosomal forkhead-box oncogene capable of inhibiting the activity deletion and subsequent fusion of either MLL or of tumor suppressive forkhead-box transcription factors PAFAH1B2 first exons to the proximal promoter region such as FOXO in a subset of 11q23-deleted tumors. of FOXR1. This shows that combining aCGH and Notably, these tumors with 11q23 micro-deletions do mRNA expression data is a powerful method to identify not contain any other 11q aberrations. This observation DNA aberrations that lead to over-expression of tumor classifies a small subgroup of neuroblastoma with driving genes. Notably, this is the first ever fusion gene intrachromosomal 11q deletions that lead to activation event identified in neuroblastoma. In support of the of an oncogene, which is distinct from the majority of

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1579 neuroblastoma where the 11q deletions most likely lead Expression and luciferase reporter constructs to inactivation of a tumor suppressor or several tumor For over-expression studies, the full-length FOXR1 ORF suppressors. This is of importance when determining the was sub-cloned into a Clonase (Invitrogen) compatible pENTR/D-TOPO vector (Invitrogen) modified to contain smallest region of overlap of 11q deletions in search of 0 important tumor suppressors. In addition, analysis of the MCS 5 -AAGCTTGGTACCGAGCTCGGATCCACTA GTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACA clinical characteristics shows that these patients have a GTGGCGGCCGCTCGAGTCTAGA-30 (creating pENTR- remarkable good prognosis compared with other neuro- MCS). After FOXR1 ORF amplification with the following blastoma patients with 11q deletions. primers: 50-TATATAAAGCTTGCTCCAACACCTCGACT This is the first report on the involvement of fork- TCT-30 (fwd) and 50-TATATAGAATTCGCATTAGCTGG head-box transcription factors in neuroblastoma CTGTTGCTTC-30 (rev) from NRC0129 cDNA, the product tumors. which highlights the central importance of was digested with HindIII (50 end) and EcoRI (30 end) and forkhead-box-mediated transcriptional activity in the ligated into similarly digested pENTR-MCS. Using the LR determination of cell fate and regulation of tumorigen- Clonase II enzyme (Invitrogen), the FOXR1 ORF was then esis. It is also the first to describe a bona fide fusion gene introduced into the vector pMSCVpuro (Clonetech, Mountain in neuroblastoma. These mechanisms may be especially view, CA, USA) by recombination. Previously, a gateway cassette was introduced into the pMSCVpuro vector using the relevant in pediatric cancers given the various mutations Gateway Conversion Kit (Invitrogen), to make it compatible identified to date involving this class of transcrip- with the Invitrogen Gateway system and Clonase-mediated tion factors, especially within the FOXO family, which recombination. is replete with gene fusion events. Therefore, further elucidation of the mechanisms underlying FOXR1- JoMa1 cell experiments mediated tumorigenesis is warranted and may uncover JoMa1 cells were cultured in a modified neural crest culture additional nodes of importance in the forkhead-box medium (NCC medium; Maurer et al., 2007). Dulbecco’s transcriptional networks. modified Eagle’s medium (4,5 mg/ml glucose, L-glutamine, Pyruvate) and Ham’s F12 medium were mixed 1:1 and supplemented with 1% N2-Supplement (Invitrogen), 2% Materials and methods B27-Supplement (Invitrogen), 10 ng/ml epidermal growth factor (PromoKine, Heidelberg, Germany), 1 ng/ml FGF Patient material and cell lines (Millipore, Billerica, MA, USA), 100 U/ml Penicillin–Strepto- All samples were derived from primary tumors of untreated mycin (Invitrogen) and 10% chick embryo extract (Pajtler T patients. Material was obtained during surgery and immedi- et al., 2010). To ensure nuclear localization of c-MycER and ately frozen in liquid nitrogen. The mRNA expression and concomitant proliferation in JoMa1 cells, 200 nM 4-OHT DNA copy number analysis were performed using several (Sigma, Deisenhofen, Germany) was added to NCC medium. different platforms on samples derived through various JoMa1 cells were transfected by electroporation and subse- collaborations as given in the Supplementary Materials and quent puromycin selection. Cells were seeded at a density of Methods Table 1. The Affymetrix expression data from adult 1000 cells per well for MTT cultured in standard NCC tumors and normal tissues were derived from the Expression medium. MTT assays were performed as described previously Project for Oncology database from the International Geno- (Schulte et al., 2009). Cell viability was assessed 72 h after mics Consortium (http://www.intgen.org/expo/). The HOS cell withdrawal of 4-OHT. line was a kind gift from Prof M Serra. The cell line was cultured in Dulbecco’s modified Eagle’s medium supplemented Lentiviral shRNA silencing with 10% fetal bovine serum, 20 mML-glutamine, 10 U/ml The lentiviral shRNA expression vectors were obtained from penicillin and 10 mg/ml streptomycin. Cells were maintained at Sigma (MISSION shRNA Lentiviral library). Lentiviral 37 1C under 5% CO2. particles were produced in HEK293T cells by co-transfection of lentiviral vector containing the short hairpin RNA (shRNA) PCR analysis fusion genes with lentiviral packaging plasmids pMD2G, pRRE and pRSV/ cDNA from the tumors and cell line samples was isolated REV using FuGene HD. Supernatant of the HEK293T cells using Trizol (Invitrogen, Carlsbad, CA, USA). Real-time– was harvested at 48 and 72 h after transfection, which was PCR was performed using 1 mg total RNA, 125pM oligodT12 purified by filtration and ultracentrifugation. The concentra- tion was determined by a p24 enzyme-linked immunosorbent primers, 0.5 mM deoxyribonucleotide triphosphates, 2 mM assay. HOS cells were counted and 12 500 cells were plated MgCl2, RT-buffer (Invitrogen) and 100U Superscript II (Invitrogen) in a total volume of 25 ml. cDNA of 1 ml volume in 6-well plates in 2 ml of culture medium. The culture was used for PCR analysis of the breakpoints. The primers medium was changed after 16 h and the cells were infected used for PCR amplification and sequencing of the MLL- with either the shFOXR1-lentivirus (Sigma TRC FOXR1B4 FOXR1 breakpoints were 50-CTCGTCTTCGTCTTCGTC and FOXR1B8) or the control lentivirus (non-target shRNA ATC-30 (fwd) and 50-CTTTCCAGGGGGATACACAAT-30 control SHC002). An multiplicity of infection of 3 was used for (rev). The PAFAH1B2-FOXR1 breakpoint was amplified with the experiments. Medium was refreshed 24 hours post- 50-CGCACGGACCCTCTACTTC-30 (fwd) and 50-TAAGGG infection. GAGGTGAGATGTGG-30 (rev). For exons 1–5 of FOXR1 from NRC0051 50-AGCTCCAACACCTCGACTTCT-30 Fluorescence-activated cell sorter analysis and 3T3 assays (fwd) and 50-GGCACTTTCTCAAAGCTGTCTC-30 (rev) For fluorescence-activated cell sorter analysis HOS cells were were used. To capture the full-length ORF of the MLL grown for 24 h in 6-well plates and transduced with shRNA as fusion from NRC0129 cDNA 50-CTTCACGGGGCGAAC described above. After 24 h transduction, the medium was ATG-30 (fwd) and 50-GCATTAGCTGGCTGTTGCTTC-30 refreshed. At 144 h after infection nuclei were isolated and (rev) were used. stained with propidium iodide by incubation in a hypotonic

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1580 solution of phosphate buffered saline, dH2O, propidium iodide Luciferase reporter assays and RNAse. A total of 10 000 nuclei per sample were counted. Single-copy luciferase reporter constructs were generated by For 3T3 assays all cell counting experiments were performed in cloning the forkhead-box DBEwt ‘TTGTTTAC’ or a mutated triplo using a Beckman Coulter counter. HOS cells were version (DBEmut) ‘TGTTCTAT’ into the pGL3-SV40 vector seeded at a density of 50 000 cells per 6 cm dish. After 24 h, (Promega, Madison, WI, USA) double digested with SmaI(50 cells were transduced with the shRNAs as above. The next day end) and BglII (30 end) to create pGL3-1xDBEwt and pGL3- 1 mg/ml puromycin was added with medium refresh. At time 1 Â DBEmut. The DBEwt oligos were as follows: 50-CTGG points 3, 6, 10 and 13 days cells were counted and re-seeded. ATTTGTTTACGTCCCGGGTGCA-30 (fwd) and 50-GATC TGCACCCGGGACGTAAACAAATCCAG-30 (rev). The DBEmut oligos were as follows: 50-CTGGATTGTTCTA qPCR analysis TGTCCCGGGTGCA-30 (fwd) and 50-GATCTGCACCCGG 1 mg of Trizol isolated RNA was used for cDNA synthesis as GACATAGAACAATCCAG-30 (rev). The reporter assays described above. A volume of 1 ml of this cDNA was used for were performed using the Dual-Luciferase Reporter Assay QPCR. A fluorescence-based kinetic real-time PCR was System (Promega cat. #E1980). Lysates were harvested in performed using the real-time iCycler PCR platform (Biorad, 100 ml1Â passive lysis buffer from 24-well plates. A volume of Hercules, CA, USA) in combination with the intercalating 50 ml of each lysate was loaded into 96-well opaque plates for fluorescent dye SYBR Green I. The IQ SYBR Green I injection with 50 ml of each substrate; signal detection was Supermix (BioRad) was used in accordance with the manu- performed on a Synergy HT Multi-Mode Microplate Reader facturer’s instructions. The primers used for the qPCR to (Biotek, Winooski, VT, USA). measure FOXR1 knockdown were as follows: 50-CCAC ATCTCACCTCCCCTTA-30 (fwd) and 50-CTTTCCAGGG GGATACACAA-30 (rev). The control primers to b-actin were Conflict of interest as follows 50-ACATCTGCTGGAAGGTGGAC-30 (fwd) and 50-GCAAAGACCTGTACGCCAAC-30 (rev). FOXR1 gene expression in 362 neuroblastoma tumor The authors declare no conflict of interest. samples was performed according to a procedure described elsewhere (Vermeulen et al., 2009). In brief, a qPCR assay was designed for FOXR1 and five reference sequences (HMBS, Acknowledgements HPRT1, SDHA, UBC and Alu) and validated using our in silico analysis pipeline (Lefever et al., 2009). Real-time This work was supported by the Stichting Koningin qPCR was performed in a 384-well plate instrument (LC480, Wilhelmina Fonds (KWF), Stichting Kindergeneeskundig Roche, Germany) and data analyzed using qbasePLUS 1.4 Kankeronderzoek (SKK) and the Stichting Kinderen (http://www.qbaseplus.com; Hellemans et al., 2007). Kankervrij (KiKa).

References

Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS et al. (1999). Guo C, White PS, Weiss MJ, Hogarty MD, Thompson PM, Stram DO Akt promotes cell survival by phosphorylating and inhibiting a et al. (1999). Allelic deletion at 11q23 is common in MYCN single Forkhead transcription factor. Cell 96: 857–868. copy neuroblastomas. Oncogene 18: 4948–4957. Buckley PG, Alcock L, Bryan K, Bray I, Schulte JH, Schramm A et al. Hampton GM, Mannermaa A, Winqvist R, Alavaikko M, Blanco G, (2010). Chromosomal and microRNA expression patterns reveal Taskinen PJ et al. (1994). Loss of heterozygosity in sporadic human biologically distinct subgroups of 11q- neuroblastoma. Clin Cancer breast carcinoma: a common region between 11q22 and 11q23.3. Res 16: 2971–2978. Cancer Res 54: 4586–4589. Chen CC, Jeon SM, Bhaskar PT, Nogueira V, Sundararajan D, Tonic I Hellemans J, Mortier G, De PA, Speleman F, Vandesompele J. (2007). et al. (2010). FoxOs inhibit mTORC1 and activate Akt by inducing qBase relative quantification framework and software for manage- the expression of Sestrin3 and Rictor. Dev Cell 18: 592–604. ment and automated analysis of real-time quantitative PCR data. Cole KA, Attiyeh EF, Mosse YP, Laquaglia MJ, Diskin SJ, Genome Biol 8: R19. Brodeur GM et al. (2008). A functional screen identifies miR-34a Hoeller S, Schneider A, Haralambieva E, Dirnhofer S, Tzankov A. as a candidate neuroblastoma tumor suppressor gene. Mol Cancer (2010). FOXP1 protein overexpression is associated with inferior Res 6: 735–742. outcome in nodal diffuse large B-cell lymphomas with non-germinal Davis RJ, D’Cruz CM, Lovell MA, Biegel JA, Barr FG. (1994). Fusion centre phenotype, independent of gains and structural aberrations at of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in 3p14.1. Histopathology 57: 73–80. alveolar rhabdomyosarcoma. Cancer Res 54: 2869–2872. Katoh M, Katoh M. (2004a). Germ-line mutation of Foxn5 gene in Furuyama T, Nakazawa T, Nakano I, Mori N. (2000). Identification mouse lineage. Int J Mol Med 14: 463–467. of the differential distribution patterns of mRNAs and consensus Katoh M, Katoh M. (2004b). Identification and characterization of binding sequences for mouse DAF-16 homologues. Biochem J 349: human FOXN6, mouse Foxn6, and rat Foxn6 genes in silico. Int J 629–634. Oncol 25: 219–223. Galili N, Davis RJ, Fredericks WJ, Mukhopadhyay S, Rauscher III Katoh M, Katoh M. (2004c). Identification and characterization FJ, Emanuel BS et al. (1993). Fusion of a fork head domain gene to of human FOXN5 and rat Foxn5 genes in silico. Int J Oncol 24: PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet 1339–1344. 5: 230–235. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM Go´ mez-Ferrerı´ a MA, Rey-Campos J. (2003). Functional domains of et al. (2002). The human genome browser at UCSC. Genome Res 12: FOXJ2. J Mol Biol 329: 631–644. 996–1006. Gomis RR, Alarcon C, He W, Wang Q, Seoane J, Lash A et al. (2006). Lee AS, Seo YC, Chang A, Tohari S, Eu KW, Seow-Choen F et al. A FoxO-Smad synexpression group in human keratinocytes. Proc (2000). Detailed deletion mapping at chromosome 11q23 in color- Natl Acad Sci USA 103: 12747–12752. ectal carcinoma. Br J Cancer 83: 750–755.

Oncogene FOXR1 fusion genes in neuroblastoma EE Santo et al 1581 Lefever S, Vandesompele J, Speleman F, Pattyn F. (2009). RTPri- Schu¨ ller U, Zhao Q, Godinho SA, Heine VM, Medema RH, Pellman merDB: the portal for real-time PCR primers and probes. Nucleic D et al. (2007). Forkhead transcription factor FoxM1 regulates Acids Res 37: D942–D945. mitotic entry and prevents spindle defects in cerebellar granule Liu H, Cheng EH, Hsieh JJ. (2009). MLL fusions: pathways to neuron precursors. Mol Cell Biol 27: 8259–8270. leukemia. Cancer Biol Ther 8: 1204–1211. Schulte JH, Lim S, Schramm A, Friedrichs N, Koster J, Versteeg R Mahony S, Benos PV. (2007). STAMP: a web tool for exploring et al. (2009). Lysine-specific demethylase 1 is strongly expressed in DNA-binding motif similarities. Nucleic Acids Res 35: W253–W258. poorly differentiated neuroblastoma: implications for therapy. Martinez MJ, Smith AD, Li B, Zhang MQ, Harrod KS. (2007). Cancer Res 69: 2065–2071. Computational prediction of novel components of lung transcrip- So CW, Cleary ML. (2002). MLL-AFX requires the transcriptional tional networks. Bioinformatics 23: 21–29. effector domains of AFX to transform myeloid progenitors and Matys V, Kel-Margoulis OV, Fricke E, Liebich I, Land S, Barre-Dirrie transdominantly interfere with forkhead protein function. Mol Cell A et al. (2006). TRANSFAC and its module TRANSCompel: Biol 22: 6542–6552. transcriptional gene regulation in eukaryotes. Nucleic Acids Res 34: So CW, Cleary ML. (2003). Common mechanism for oncogenic D108–D110. activation of MLL by forkhead family proteins. Blood 101: 633–639. Maurer J, Fuchs S, Jager R, Kurz B, Sommer L, Schorle H. (2007). Stahl M, Dijkers PF, Kops GJ, Lens SM, Coffer PJ, Burgering BM Establishment and controlled differentiation of neural crest stem cell et al. (2002). The forkhead transcription factor FoxO regulates lines using conditional transgenesis. Differentiation 75: 580–591. transcription of p27Kip1 and Bim in response to IL-2. J Immunol Myatt SS, Lam EW. (2007). The emerging roles of forkhead box (Fox) 168: 5024–5031. proteins in cancer. Nat Rev Cancer 7: 847–859. van Noesel MM, Versteeg R. (2004). Pediatric neuroblastomas: genetic Nowacki S, Skowron M, Oberthuer A, Fagin A, Voth H, Brors B et al. and epigenetic 0danse macabre0. Gene 325: 1–15. (2008). Expression of the tumour suppressor gene CADM1 is Vermeulen J, De PK, Naranjo A, Vercruysse L, Van RN, Hellemans J associated with favourable outcome and inhibits cell survival in et al. (2009). Predicting outcomes for children with neuroblastoma neuroblastoma. Oncogene 27: 3329–3338. using a multigene-expression signature: a retrospective SIOPEN/ Paik JH, Kollipara R, Chu G, Ji H, Xiao Y, Ding Z et al. (2007). COG/GPOH study. Lancet Oncol 10: 663–671. FoxOs are lineage-restricted redundant tumor suppressors and Wakaguri H, Yamashita R, Suzuki Y, Sugano S, Nakai K. (2008). regulate endothelial cell homeostasis. Cell 128: 309–323. DBTSS: database of transcription start sites, progress report 2008. Pulido HA, Fakruddin MJ, Chatterjee A, Esplin ED, Beleno N, Nucleic Acids Res 36: D97–101. Martinez G et al. (2000). Identification of a 6-cM minimal deletion Wierstra I, Alves J. (2007). FOXM1, a typical proliferation-associated at 11q23.1-23.2 and exclusion of PPP2R1B gene as a deletion target transcription factor. Biol Chem 388: 1257–1274. in cervical cancer. Cancer Res 60: 6677–6682. Wlodarska I, Veyt E, De PP, Vandenberghe P, Nooijen P, Theate I Schones DE, Smith AD, Zhang MQ. (2007). Statistical significance of et al. (2005). FOXP1, a gene highly expressed in a subset of diffuse cis-regulatory modules. BMC Bioinformatics 8: 19. large B-cell lymphoma, is recurrently targeted by genomic aberra- Schuff M, Rossner A, Donow C, Knochel W. (2006). Temporal and tions. Leukemia 19: 1299–1305. spatial expression patterns of FoxN genes in Xenopus laevis Yuan TL, Cantley LC. (2008). PI3K pathway alterations in cancer: embryos. Int J Dev Biol 50: 429–434. variations on a theme. Oncogene 27: 5497–5510.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc)

Oncogene