DOCSLIB.ORG

Generated by SRI International Pathway Tools Version 25.0, Authors S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Generated by SRI International Pathway Tools Version 25.0, Authors S Authors: Pallavi Subhraveti Ron Caspi Peter Midford Peter D Karp An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Ingrid Keseler Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. Gcf_000299235Cyc: Leptospirillum ferriphilum ML-04 Cellular Overview Connections between pathways are omitted for legibility. Anamika Kothari phosphate phosphate phosphate phosphate ammonium ammonium ammonium predicted ABC transporter RS12230 RS11960 RS10935 RS01775 RS01785 RS04585 of phosphate phosphate phosphate phosphate ammonium ammonium ammonium phosphate Macromolecule Modification Inorganic Nutrient Metabolism tRNA-uridine 2-thiolation UDP-N-acetyl- undecaprenyl- a carboxy- a nascent a peptidoglycan an [amino-group β 34 a nucleoside cob(II)yrinate a,c- Cofactor, Carrier, and Vitamin Biosynthesis selenate reduction α-D-glucosamine diphospho-N- adenylated- peptidoglycan a uracil in DNA D-glycero- -D- a cytidine lys dimer (meso- met carrier protein]- [2Fe-2S] iron-sulfur thioredoxin flavin biosynthesis I (bacteria and plants) lipoate biosynthesis lipoate salvage I benzimidazolyl adenosylcobamide lipoate biosynthesis pyridoxal 5'-phosphate biosynthesis I folate transformations III (E. coli) Fatty Acid and Lipid Biosynthesis and selenation (bacteria) cys ATP triphosphate RNA diamide biosynthesis I acetylmuramoyl- [ThiS sulfur- (meso-DAP manno-heptose in tRNA Ile2 diaminopimelate C-terminal-γ- cluster biosynthesis pathway and incorporation I biosynthesis from and incorporation II amino-acid N- (early cobalt insertion) L-alanyl-γ-D- carrier protein] containing) 1-phosphate containing) (L-glutamate 5- adenosylcobinamide-GDP D-erythrose a tetrahydrofolate palmitate biosynthesis cys selenate uracil-DNA acetyltransferase: uroporphyrinogen-III an oxidized (R)-lipoate 4-phosphate gondoate biosynthesis sulfate glutamyl-L-lysyl- tRNA(Ile)-lysidine DNA- LFML04_RS10300 semialdehyde-2-N-acetyl- L-cysteine desulfurase GTP an octanoyl-[acp] lipoate-- benzimidazole octanoate (type II fatty acid synthase) glycosylase: uroporphyrinogen-III thioredoxin octanoyl-[acyl-carrier (anaerobic) adenylyltransferase: sat D-alanyl-D-alanine D-glycero-beta-D- synthetase: penicillin- directed RNA yl)-L-glutamategamma- protein ligase: nicotinate-nucleotide-- lipoate-- cysteine desulfurase: UDP-N- IscS subfamily lytic transglycosylase LFML04_RS00725 bifunctional C-methyltransferase: cysteine desulfurase: protein] biosynthesis adenosine 5'- manno-heptose LFML04_RS02125 binding polymerase glutamyl- bifunctional LFML04_RS01050 dimethylbenzimidazole protein ligase: an acetoacetyl-[acp] LFML04_RS03125 acetylglucosamine- cysteine desulfurase: domain-containing uracil-DNA glutamate N- cobA LFML04_RS03125 a [lipoyl-carrier [(R)- (mitochondria, yeast) a malonyl-[acp] an oleoyl-[acp] phosphoselenate 1-phosphate protein subunit phosphate 3,4-dihydroxy- phosphoribosyltransferase: a [lipoyl-carrier LFML04_RS01050protein] 4-phospho- IscS subfamily -N-acetylmuramyl- LFML04_RS02340 protein: glycosylase: tRNA acetyltransferase/ an [amino-group precorrin-1 thioredoxin- protein] N 6 - lipoyl]adenylate adenylyltransferase: 2: mrdA omega: rpoZ reductase: IscS subfamily 6 3-oxoacyl-[acyl- cysteine desulfurase: (pentapeptide) cysteine desulfurase: LFML04_RS04415 lysidine(34) amino-acid carrier protein]- 2-butanone- octanoyl-L-lysine cobT N -octanoyl-L-lysine D-erythronate an acetoacetyl-[acp] LFML04_RS05165 rfaE2 argC uroporphyrinogen-III cysteine desulfurase: disulfide lipoate-- benzimidazole carrier-protein] 3-oxoacyl-[acyl- LFML04_RS02340 sulfite oxidation II pyrophosphoryl- LFML04_RS03125 endolytic synthetase [+ 2 isozymes] acetyltransferase C-terminal-γ- 4-phosphate lipoyl lipoyl beta-ketoacyl- C-methyltransferase: LFML04_RS02340 reductase: protein ligase: ribotide phosphate reductase: fabG carrier-protein] an [L-cysteine undecaprenol N- transglycosylase TilS: tilS a peptidoglycan ArgJ: argJ (5-phospho- synthase/GTP synthase: ACP synthase β trxB LFML04_RS01050 synthase: lipA desulfurase]-S- selenite acetylglucosamine MltG: mltG an apyrimidinic uracil ADP-D-glycero- - with D,D cross- D-ala N-acetyl-L- L-glutamyl)- cobA an S-sulfanyl-[L- cyclohydrolase II: lipA cobalamin 5 serine a (3R)-3- reductase: fabG II: fabF sulfite a thiocarboxylated- a [lipoyl-carrier superpathway of thiamine diphosphate biosynthesis II a [lipoyl-carrier (3R)-3-hydroxy-2-oxo- a (3R)-3- sulfanyl-L-cysteine transferase: site in DNA D-manno-heptose links (meso- RNA methionine L-glutamate cysteine desulfurase] LFML04_RS06305 a [lipoyl-carrier phosphate 6 a 7,8-dihydrofolate hydroxymethyltransferase:a 5-methyltetrahydrofolate hydroxybutanoyl-[acp] adenylyl-sulfate ala [ThiS sulfur- 34 precorrin-2 protein]-N 6 -[(R protein]-N -[(R)- 4 phosphooxybutanoate hydroxybutanoyl-[acp] LFML04_RS12585 AMP a lysidine 2,5-diamino-6- 6 glycine cleavage system reductase Ile2 diaminopimelate sulfite RS09035 sulfite scaffold protein]-N -[(R) synthase CobS: dihydrolipoyl]-L-lysine LFML04_RS11350 3-hydroxyacyl- ditrans,octacis- UDP carrier protein] a mature a nascent in tRNA a reduced (5-phospho-D- )-lipoyl]-L-lysine D-glyceraldehyde aminomethyltransferase 3-hydroxyacyl- an (11Z)-3-oxo- subunit alpha: containing) bifunctional precorrin- protein for -dihydrolipoyl]- cys LFML04_RS05805 pyruvate ACP dehydratase undecaprenyldiphospho- peptidoglycan peptidoglycan thioredoxin ribosylamino) Coα-[α-(benzimidazolyl) 3-phosphate GcvT: gcvT ACP dehydratase icos-11-enoyl-[acp] LFML04_RS02365 β 2 dehydrogenase/ iron-sulfur L-lysine a [ThiS sulfur- FabZ: fabZ a [TusA sulfur- selenodiglutathione N-acetyl-(N-acetyl- -D- with (L-alanyl- (meso-DAP pyrimidin- ]-Coβ-adenosylcobamide a (6S)-5-formyltetrahydrofolate FabZ: fabZ 3-oxoacyl-[acyl- APS sirohydrochlorin cluster cysteine desulfurase: carrier protein] 4-phosphooxy- glycine cleavage system bifunctional carrier protein]-S- glucosaminyl)muramoyl- γ-D-glutamyl- containing) with sulfate RS11860 sulfate 4(3H)-one 5'-phosphate 1-deoxy-D- γ ferrochelatase: LFML04_RS03125 protein GcvH: gcvH a (2E)-but-2-enoyl-[acp] carrier-protein] sulfanyl-L-cysteine L-alanyl- -D-glutamyl-L- meso-2,6- GlcNAc terminus assembly: iscU bifunctional L-threonine xylulose-5- methylenetetrahydrofolate5-formyltetrahydrofolate a (2E)-but-2-enoyl-[acp] LFML04_RS12350 an S-sulfanyl-[cysteine reductase: fabG lysyl-D-alanyl-D-alanine diaminopimeloyl- diaminohydroxyphosphoribosylaminopyrimidine IscS subfamily 4-hydroxythreonine- phosphate dehydrogenase/ cyclo-ligase: desulfurase]-[disordered- cysteine desulfurase: methenyltetrahydrofolateLFML04_RS07080 enoyl-ACP enoyl-ACP a (3R,11Z)-3-hydroxy- D-alanine) a reduced sirohydrochlorin deaminase/5-amino-6-(5-phosphoribosylamino) 4-phosphate synthase: glutathioselenol form scaffold LFML04_RS02340 a carboxy- Coα-[α-(benzimidazolyl) cyclohydrolase FolD: folD reductase: reductase: icos-11-enoyl-[acp] a [TusD sulfur- tetrapeptide H O c-type uracil reductase RibD: ribD dehydrogenase dxs sulfate 2 an [L-cysteine adenylated- β a 5,10-methylenetetrahydrofolate a 5,10-methenyltetrahydrofolate LFML04_RS05190 protein] complex 5-amino-6-(5- ]-Co -adenosylcobamide PdxA: pdxA LFML04_RS05190 3-hydroxyacyl- carrier protein]-S- RS08985 cytochrome [cysteine desulfurase]-S- desulfurase]-S- [ThiS sulfur- sulfanyl-L-cysteine an oxidized phospho-D- 3-amino-1- 1-deoxy-D- bifunctional ACP dehydratase a mature peptidoglycan a [bis(guanylyl L-alanyl-γ-D- a peptidoglycan (E)-4-hydroxy-3- O c-type sulfanylcysteine:[acceptor sulfanyl-L-cysteine carrier protein] a butanoyl-[acp] a butanoyl-[acp] [EntB aryl- 2 ribosylamino)uracil hydroxyacetone coenzyme A H O sec D-ribulose D-glyceraldehyde xylulose 5- methylenetetrahydrofolate FabZ: fabZ (meso-diaminopimelate molybdopterin) cys glutamyl-meso-2,6- 2 ile dimer (E. faeciums) methylbut-2-en- ser a tRNA cytochromea reduced cobalt- protein]-cysteine bifunctional hypoxanthine carrier protein] GTP 5-phosphate 3-phosphate 1-phosphate phosphate dehydrogenase/ beta-ketoacyl- hydrogen selenide containing) PRPP cofactor diaminopimeloyl- 1-yl diphosphate H O c-type sirohydrochlorin sulfurtransferase: diaminohydroxyphosphoribosylaminopyrimidine superpathway of coenzyme A biosynthesis I (bacteria) cysteine desulfurase: beta-ketoacyl- a (2E,11Z)-icosa- branched chain flavodoxin- 2 bifunctional methenyltetrahydrofolate ACP synthase a [TusE sulfur chaperone]- D-alanine RS09540 cytochrome LFML04_RS02340 deaminase/5-amino-6-(5-phosphoribosylamino) LFML04_RS03125 1-deoxy-D- pyridoxine 5'- bis(guanylyl molybdopterin) ACP synthase 2,11-dienoyl-[acp] amino acid penicillin- dependent an oxidized a [cysteine desulfurase]- gly 34 carrier protein]-S L-cysteine holo-[acyl- 3,4-dihydroxy- 3-methyl-2- a 5,10- IscS subfamily xylulose-5- cofactor sulfurylation cyclohydrolase FolD: folD II: fabF II: fabF a uridine in tRNA lytic transglycosylase GTPase aminotransferase: binding (E)-4-hydroxy- serine- O c-type S-sulfanyl-[disordered- uracil reductase RibD: ribD phosphate synthase: enoyl-ACP -sulfanylcysteine carrier- 2 2-butanone- 5-amino-6-(5- oxobutanoate methylenetetrahydrofolate cysteine desulfurase: phosphate superpathway of tetrahydrofolate biosynthesis domain-containing hypoxanthine HflX: hflX LFML04_RS02085 protein 3-methylbut- -tRNA cytochromea reduced form
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • {Replace with the Title of Your Dissertation}
    Characterization and evolution of artificial RNA ligases A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Aleardo Morelli IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Adviser: Burckhard Seelig June 2015 © Aleardo Morelli, 2015 Abstract Enzymes enable biocatalysis with minimal by-products, high regio- and enantioselectivity, and can operate under mild conditions. These properties facilitate numerous applications of enzymes in both industry and research. Great progress has been made in protein engineering to modify properties such as stability and catalytic activity of an enzyme to suit specific processes. On the contrary, the generation of artificial enzymes de novo is still challenging, and only few examples have been reported. The study and characterization of artificial enzymes will not only expand our knowledge of protein chemistry and catalysis, but ultimately improve our ability to generate novel biocatalysts and engineer those found in nature. My thesis focused on the characterization of an artificial RNA ligase previously selected from a library of polypeptide variants based on a non-catalytic protein scaffold. The selection employed mRNA display, a technique to isolate de novo enzymes in vitro from large libraries of 1013 protein variants. The artificial RNA ligase catalyzes the formation of a phosphodiester bond between two RNA substrates by joining a 5'- triphospate to a 3'-hydroxyl, with the release of pyrophosphate. This activity has not been observed in nature. An initial selection carried out at 23°C yielded variants that were poorly suitable for biochemical and biophysical characterization due do their low solubility and poor folding.
    [Show full text]
  • University of Birmingham Synthesis of -Glucan in Mycobacteria Involves A
    University of Birmingham Synthesis of -glucan in mycobacteria involves a hetero-octameric complex of trehalose synthase TreS and Maltokinase Pep2 Roy, Rana; Veeraraghavan, Usha; Kermani, Ali; Scott, David J; Hyde, Eva I; Besra, Gurdyal S; Alderwick, Luke J; Fütterer, Klaus DOI: 10.1021/cb400508k License: Creative Commons: Attribution (CC BY) Document Version Publisher's PDF, also known as Version of record Citation for published version (Harvard): Roy, R, Veeraraghavan, U, Kermani, A, Scott, DJ, Hyde, EI, Besra, GS, Alderwick, LJ & Fütterer, K 2013, 'Synthesis of -glucan in mycobacteria involves a hetero-octameric complex of trehalose synthase TreS and Maltokinase Pep2', ACS chemical biology, vol. 8, no. 10, pp. 2245-2255. https://doi.org/10.1021/cb400508k Link to publication on Research at Birmingham portal Publisher Rights Statement: Eligibility for repository : checked 30/06/2014 General rights Unless a licence is specified above, all rights (including copyright and moral rights) in this document are retained by the authors and/or the copyright holders. The express permission of the copyright holder must be obtained for any use of this material other than for purposes permitted by law. •Users may freely distribute the URL that is used to identify this publication. •Users may download and/or print one copy of the publication from the University of Birmingham research portal for the purpose of private study or non-commercial research. •User may use extracts from the document in line with the concept of ‘fair dealing’ under the Copyright, Designs and Patents Act 1988 (?) •Users may not further distribute the material nor use it for the purposes of commercial gain.
    [Show full text]
  • Supplementary Table S1. Table 1. List of Bacterial Strains Used in This Study Suppl
    Supplementary Material Supplementary Tables: Supplementary Table S1. Table 1. List of bacterial strains used in this study Supplementary Table S2. List of plasmids used in this study Supplementary Table 3. List of primers used for mutagenesis of P. intermedia Supplementary Table 4. List of primers used for qRT-PCR analysis in P. intermedia Supplementary Table 5. List of the most highly upregulated genes in P. intermedia OxyR mutant Supplementary Table 6. List of the most highly downregulated genes in P. intermedia OxyR mutant Supplementary Table 7. List of the most highly upregulated genes in P. intermedia grown in iron-deplete conditions Supplementary Table 8. List of the most highly downregulated genes in P. intermedia grown in iron-deplete conditions Supplementary Figures: Supplementary Figure 1. Comparison of the genomic loci encoding OxyR in Prevotella species. Supplementary Figure 2. Distribution of SOD and glutathione peroxidase genes within the genus Prevotella. Supplementary Table S1. Bacterial strains Strain Description Source or reference P. intermedia V3147 Wild type OMA14 isolated from the (1) periodontal pocket of a Japanese patient with periodontitis V3203 OMA14 PIOMA14_I_0073(oxyR)::ermF This study E. coli XL-1 Blue Host strain for cloning Stratagene S17-1 RP-4-2-Tc::Mu aph::Tn7 recA, Smr (2) 1 Supplementary Table S2. Plasmids Plasmid Relevant property Source or reference pUC118 Takara pBSSK pNDR-Dual Clonetech pTCB Apr Tcr, E. coli-Bacteroides shuttle vector (3) plasmid pKD954 Contains the Porpyromonas gulae catalase (4)
    [Show full text]
  • 770.Full-Text.Pdf
    Published OnlineFirst January 14, 2019; DOI: 10.1158/1055-9965.EPI-18-0936 Research Article Cancer Epidemiology, Biomarkers Serum Metabolic Profiling Identified a Distinct & Prevention Metabolic Signature in Bladder Cancer Smokers: A Key Metabolic Enzyme Associated with Patient Survival Chandra Sekhar Amara1, Chandrashekar R. Ambati2, Venkatrao Vantaku1, Danthasinghe Waduge Badrajee Piyarathna1, Sri Ramya Donepudi2, Shiva Shankar Ravi1, James M. Arnold3, Vasanta Putluri2, Gurkamal Chatta4, Khurshid A. Guru5, Hoda Badr6, Martha K. Terris7, Roni J. Bollag7, Arun Sreekumar1,3, Andrea B. Apolo8, and Nagireddy Putluri1 Abstract Background: The current system to predict the outcome of nylalanine, proline, serine, valine, isoleucine, glycine, and smokers with bladder cancer is insufficient due to complex asparagine) and taurine were observed in bladder cancer genomic and transcriptomic heterogeneities. This study aims smokers. Integration of differential metabolomic gene signa- to identify serum metabolite-associated genes related to sur- ture and transcriptomics data from TCGA cohort revealed an vival in this population. intersection of 17 genes that showed significant correlation Methods: We performed LC/MS-based targeted metabo- with patient survival in bladder cancer smokers. Importantly, lomic analysis for >300 metabolites in serum obtained catechol-O-methyltransferase, iodotyrosine deiodinase, and from two independent cohorts of bladder cancer never tubulin tyrosine ligase showed a significant association with smokers, smokers, healthy smokers, and healthy never patient survival in publicly available bladder cancer smoker smokers. A subset of differential metabolites was validated datasets and did not have any clinical association in never using Biocrates absoluteIDQ p180 Kit. Genes associated smokers. with differential metabolites were integrated with a publicly Conclusions: Serum metabolic profiling of bladder cancer available cohort of The Cancer Genome Atlas (TCGA) to smokers revealed dysregulated amino acid metabolism.
    [Show full text]
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
    [Show full text]
  • Cultural Soil
    Structural and functional metage- nomic analyses of a tropical agri- cultural soil Análisis metagenómicos estructurales y funcionales de un suelo agrícola tropical Análises metagenómicas estruturais e funcionais de um solo agrícola tropical AUTHORS Received: 04.07.2018 Revised: 09.12.2018 Accepted: 21.01.2019 Lateef Babatunde 1 Salam@, 1 ABSTRACT babssalaam@yahoo. com Understanding the intricate link between the soil microbiota and their metabolic functions is important for agricultural and ecological processes and could be used as a biomarker of soil health. Oluwafemi Sunday To understand the relationship between soil microbial community structure and functions, a soil 2 Obayori microcosm designated 2S (agricultural soil) was set up. Metagenomic DNA was extracted from the soil microcosm and sequenced using Miseq Illumina next generation sequencing and analysed for their structural and functional properties. Structural analysis of the soil microcosm by MG-RAST @ Corresponding Author revealed 40 phyla, 78 classes, 157 orders, 273 families and 750 genera. Actinobacteria (54.0%) and 1Department of Biological Proteobacteria (17.5%) are the dominant phyla while Conexibacter (8.38%), Thermoleophilum (7.40%), Sciences, Al-Hikmah and Streptomyces (4.14%) are the dominant genera. Further assignment of the metagenomics using University, Ilorin, Kwara State, Nigeria. Cluster of Orthologous Groups (COG), Kyoto Encyclopedia of Genes and Genomes (KEGG), GhostKOALA, and NCBI’s CDD revealed diverse metabolic pathways utilized by the microbial 2Department of Microbiology, Lagos State community for the metabolism of carbohydrates, amino acids, lipids, biosynthesis of secondary University, Ojo, Lagos metabolites and resistance to antibiotics. Taxonomic analysis of the annotated genes also revealed State, Nigeria. the preponderance of members of Actinobacteria and Proteobacteria.
    [Show full text]
  • UC Berkeley UC Berkeley Electronic Theses and Dissertations
    UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Analyzing Microbial Physiology and Nutrient Transformation in a Model, Acidophilic Microbial Community using Integrated `Omics' Technologies Permalink https://escholarship.org/uc/item/259113st Author Justice, Nicholas Bruce Publication Date 2013 Supplemental Material https://escholarship.org/uc/item/259113st#supplemental Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Analyzing Microbial Physiology and Nutrient Transformation in a Model, Acidophilic Microbial Community using Integrated ‘Omics’ Technologies By Nicholas Bruce Justice A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Microbiology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Jillian Banfield, Chair Professor Mary Firestone Professor Mary Power Professor John Coates Fall 2013 Abstract Analyzing Microbial Physiology and Nutrient Transformation in a Model, Acidophilic Microbial Community using Integrated ‘Omics’ Technologies by Nicholas Bruce Justice Doctor of Philosophy in Microbiology University of California, Berkeley Professor Jillian F. Banfield, Chair Understanding how microorganisms contribute to nutrient transformations within their community is critical to prediction of overall ecosystem function, and thus is a major goal of microbial ecology. Communities of relatively tractable complexity provide a unique opportunity to study the distribution of metabolic characteristics amongst microorganisms and how those characteristics subscribe diverse ecological functions to co-occurring, and often closely related, species. The microbial communities present in the low-pH, metal-rich environment of the acid mine drainage (AMD) system in Richmond Mine at Iron Mountain, CA constitute a model microbial community due to their relatively low diversity and extensive characterization over the preceding fifteen years.
    [Show full text]
  • Enzyme-Catalyzed C–F Bond Formation and Cleavage
    Tong et al. Bioresour. Bioprocess. (2019) 6:46 https://doi.org/10.1186/s40643-019-0280-6 REVIEW Open Access Enzyme-catalyzed C–F bond formation and cleavage Wei Tong1,2 , Qun Huang1,2, Min Li1,2 and Jian‑bo Wang1,2* Abstract Organofuorines are widely used in a variety of applications, ranging from pharmaceuticals to pesticides and advanced materials. The widespread use of organofuorines also leads to its accumulation in the environment, and two major questions arise: how to synthesize and how to degrade this type of compound efectively? In contrast to a considerable number of easy‑access chemical methods, milder and more efective enzymatic methods remain to be developed. In this review, we present recent progress on enzyme‑catalyzed C–F bond formation and cleav‑ age, focused on describing C–F bond formation enabled by fuorinase and C–F bond cleavage catalyzed by oxidase, reductase, deaminase, and dehalogenase. Keywords: Organofuorines, C–F bonds, Enzyme‑catalyzed, Degradation, Formation Introduction usually require harsh conditions and are not environ- Incorporation of fuorine into organic compounds usu- ment friendly (Dillert et al. 2007; Lin et al. 2012; Sulbaek ally endows organofuorines with unique chemical and Andersen et al. 2005). To solve these problems, devel- physical properties, a strategy that has been successfully opment of mild and green methods is urgently needed. applied in agrochemicals, materials science, and pharma- Biocatalysis has been playing an increasingly more ceutical chemistry (Phelps 2004; Müller et al. 2007; Shah important role in modern chemistry due to its high ef- and Westwell 2007; Hagmann 2008; Nenajdenko et al.
    [Show full text]
  • Supplementary Information Genomice and Transcriptomic Analysis
    Supplementary Information Genomice and Transcriptomic Analysis for Identification of Genes and Interlinked Pathways Mediating Artemisinin Resistance in Leishmania donovani Sushmita Ghosh1,2, Aditya Verma1, Vinay Kumar1, Dibyabhaba Pradhan3, Angamuthu Selvapandiyan 2, Poonam Salotra1, Ruchi Singh1* 1. ICMR- National Institute of Pathology, Safdarjung Hospital Campus, New Delhi-110029, India 2. Jamia Hamdard University-Institute of Molecular Medicine, New Delhi-110062, India 3. ICMR-AIIMS Computational Genomics Centre, Indian Council of Medical Research, New Delhi- 110029 *Correspondence: [email protected] Supplementary Figures and Tables: Figure S1. Figure S1: Comparative transcriptional responses following ART adaptation in L. donovani. Overlap of log2 transformed K133 AS-R and K133 WT expression ratio plotted as a function of chromosomal location of probes representing the full genome microarray. The plot represents the average values of three independent hybridizations for each isolate. Table S1: List of genes validated for their modulated expression by Quantitative real time- PCR S.N Primer Gene Name/ Function/relevance Primer Sequence o. Name Gene ID 1 AQP1 Aquaglyceropor Metal ion F- in (LinJ.31.0030) transmembrane 5’CAGGGACAGCTCGAGGGTAA transporter activity, AA3’ integral to membrane; transmembrane R- transport; transporter 5’GTTACCGGCGTGAAAGACAG activity; water TG3’ transport. 2 A2 A2 protein Cellular response to F- (LinJ.22.0670) stress 5’GTTGGCCCGCTTTCTGTTGG3’ R- 5’ACCAACGTCAACAGAGAGA GGG3’ 3 ABCG1 ATP-binding ATP binding, ATPase
    [Show full text]
  • T4 RNA Ligase Catalyzes the Synthesis of Dinucleoside Polyphosphates
    Eur. J. Biochem. 261, 802±811 (1999) q FEBS 1999 T4 RNA ligase catalyzes the synthesis of dinucleoside polyphosphates Eva Ana Atencia, Olga Madrid, MarõÂaA.GuÈnther Sillero and Antonio Sillero Instituto de Investigaciones BiomeÂdicas Alberto Sols, UAM/CSIC, Departamento de BioquõÂmica, Facultad de Medicina, Madrid, Spain T4 RNA ligase has been shown to synthesize nucleoside and dinucleoside 50-polyphosphates by displacement of the AMP from the E-AMP complex with polyphosphates and nucleoside diphosphates and triphosphates. Displacement of the AMP by tripolyphosphate (P3) was concentration dependent, as measured by SDS/PAGE. When the enzyme 32 was incubated in the presence of 0.02 mm [a- P] ATP, synthesis of labeled Ap4A was observed: ATP was acting as both donor (Km, mm) and acceptor (Km,mm) of AMP from the enzyme. Whereas, as previously known, ATP or dATP (but not other nucleotides) were able to form the E-AMP complex, the specificity of a compound to be acceptor of AMP from the E-AMP complex was very broad, and with Km values between 1 and 2 mm. In the presence of a low concentration (0.02 mm)of[a-32P] ATP (enough to form the E-AMP complex, but only marginally enough to form Ap4A) and 4 mm of the indicated nucleotides or P3, the relative rate of synthesis of the following radioactive (di)nucleotides was observed: Ap4X (from XTP, 100); Ap4dG (from dGTP, 74); Ap4G (from GTP, 49); Ap4dC (from dCTP, 23); Ap4C (from CTP, 9); Ap3A (from ADP, 5); Ap4ddA, (from ddATP, 1); p4A (from P3, 200). The enzyme also synthesized efficiently Ap3A in the presence of 1 mm ATP and 2 mm ADP.
    [Show full text]
  • Nouchali Bandaranayaka Phd Thesis
    Studies of enzymes relevant to the biotransformation of fluorinated natural products Nouchali Bandaranayaka Supervisor: Prof. David O’Hagan This thesis is submitted in partial fulfilment for the degree of PhD at the University of St Andrews NOVEMBER 2016 ii Declarations 1. Candidate’s declarations: I, Nouchali Bandaranayaka hereby certify that this thesis, which is approximately 50,000 words in length, has been written by me, and that it is the record of work carried out by me, or principally by myself in collaboration with others as acknowledged, and that it has not been submitted in any previous application for a higher degree. I was admitted as a research student in November 2009 and as a candidate for the degree of Doctor of Philosophy in November 2011; the higher study for which this is a record was carried out in the University of St Andrews between 2009 and 2016. Date Signature of candidate 2. Supervisor’s declaration: I hereby certify that the candidate has fulfilled the conditions of the Resolution and Regulations appropriate for the degree of Doctor of Philosophy in the University of St Andrews and that the candidate is qualified to submit this thesis in application for that degree. Date Signature of supervisor 3. Permission for publication: In submitting this thesis to the University of St Andrews I understand that I am giving permission for it to be made available for use in accordance with the regulations of the University Library for the time being in force, subject to any copyright vested in the work not being affected thereby.
    [Show full text]