Novel Functions of Smn Complex Members and Their

NOVEL FUNCTIONS OF SMN COMPLEX MEMBERS AND THEIR

IMPLICATIONS IN SPINAL MUSCULAR ATROPHY

MICHAEL PATRICK WALKER

Submitted in partial fulfillment of the requirements

for the degree of Doctor of Philosophy

Thesis Advisor: Dr. A. Gregory Matera

Department of Genetics

CASE WESTERN RESERVE UNIVERSITY

May, 2009

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the dissertation of

______candidate for the Ph.D. degree *.

(signed)______(chair of the committee)

______

(date) ______

*We also certify that written approval has been obtained for any proprietary material contained therein.

Table of Contents

List of tables...... 5

List of figures…………………………………………………………………….6

Acknowledgements……………………………………………………………...8

Abbreviations……………………………………………………………...... 9

Abstract……………………………………………………………………………10

Chapter I: Introduction and Research Objectives…………………………...12

Introduction…………………………………………………………13

Spinal Muscular Atrophy……………………………………13

snRNP Biogenesis……………………………………...... 21

The SMN Complex…………………………………………...26

SMN and Gemin Function in the Motor Unit……………...33

Research Objectives…………………………………………………39

Chapter II: Overexpression of Gemin4 relocalizes the SMN complex to the nucleoplasm and causes disassembly of Cajal Bodies…………………..41

Abstract…………………………………………………………….....42

Introduction…………………………………………………...... 43

Results…………………………………………………………………46

Discussion……………………………………………………………..59

Materials and Methods………………………………………………61

3 Chapter III: Characterization of Gemin4 loss-of-function in Mus musculus.63

Abstract……………………………………………………………...... 64

Introduction…………………………………………………...... 65

Results…………………………………………………………………...69

Discussion…………………………………………………………...... 75

Materials and Methods………………………………………………...77

Chapter IV: The SMN complex localizes to the sarcomeric Z-disc and is a proteolytic target of calpain………………………………………………………..79

Abstract……………………………………………………………...... 80

Introduction…………………………………………………...... 81

Results…………………………………………………………………...85

Discussion……………………………………………………………….104

Material and Methods…………………………………………………109

Chapter V: Discussion and Future Directions………………………...... 113

Implications of Gemin4 Mediated Import………………...... 114

Gemin4 Mice and SMA……………………………………...... 119

A Novel Function of the SMN Complex in Striated Muscle………123

Appendix Chapter: Reduced viability and fecundity in mice lacking the

Cajal body marker protein, coilin………………………………………………...131

Abstract…………………………………………………………………132

Introduction………………………………………………………...... 133

Results………………………………………………………...... 136

Discussion……………………………………………………………….144

Material and Methods…………………………………………………149

Bibliography…………………………………………………………………………150

4 List of Tables

Chapter III

Table 3-1: Gemin4 is essential in the mouse…………………………....71

Table 3-2: Genetic background contribution to the SMA phenotype..72

Table 3-3: Gemin4 heterozygotes do not modify the SMA early

lethality phenotype……………………………………...... 73

Appendex Chapter

Table A1-1: Coilin intercross mice……………………………………….137

Table A1-2: Contibution of the uterine environment to neonatal

viability………………………………………………………138

5 List of Figures

Chapter I

Figure 1-1: SMN2 exon 7 skipping………………………………………….15

Figure 1-2: SMN2 expression inversely correlates with the SMA

phenotype………………………………………………...... 16

Figure 1-3: A simplified overview of mRNA splicing……………...... 22

Figure 1-4: snRNP biogenesis overview………………………...... 25

Figure 1-5: The SMN complex………………………………………...... 27

Figure 1-6: Functions of SMN & Gemins in the motor unit…...... 34

Figure 1-7: The Sarcomere…………………………………………………..38

Chapter II

Figure 2-1: GFP:Gemin4 localizes to the nucleus…………………………47

Figure 2-2: GFP:Gemin4 deletion constructs……………………………...48

Figure 2-3: The amino terminal half of Gemin4 contains a nuclear

localization signal…………………………………….…………49

Figure 2-4: The Gemin4 NLS is sufficient to drive nuclear import……..50

Figure 2-5: Mouse and human Gemin4 localize to the nucleus

Regardless of the placement of GFP…………………………51

Figure 2-6: Gemin4 redirects Gemin3 into the nucleus……………...... 53

Figure 2-7: Gemin4 can redirect other members of the SMN complex

into the nucleus………………………………………………...56

Figure 2-8: Cajal Bodies are maintained in GFP:Gemin4 expressing

Cells……………………………………………………………….58

6 Chapter III

Figure 3-1: Characterization of Gemin4 gene trap………………………..70

Figure 3-2: Gemin4 expression profile…………………………………….74

Figure 3-3: Gemin4 heterozygous expression profile…………………...74

Chapter IV

Figure 4-1: Smn localizes to skeletal myofibrils…………………...... 86

Figure 4-2: Smn localizes to the Z-discs of striated muscle……………..87

Figure 4-3: The Smn complex is present at Z-discs………………………89

Figure 4-4: U snRNPs do not localize to myofibrils……………………..90

Figure 4-5: Calpain activity removes Smn from myofibrils…………….92

Figure 4-6: Calpain directly cleaves SMN in vitro………………………..94

Figure 4-7: Characterization of novel anti-SMN monoclonal antibody

9F2……………………………………………………………….95

Figure 4-8: Calpain inhibition, titration and endogenous activation…..97

Figure 4-9: Inhibition of calpain cleavage in human and mouse cell

lysates using a peptide inhibitor………………………………98

Figure 4-10: Calpain cleaves a subset of the Gemins within the SMN

complex in vitro and in vivo……………………………...…....100

Figure 4-11: SMA type 1 mice have aberrant myofibrils……………….103

Chapter V

Figure 5-1: The Gemin4 Import Receptor………………………...... 116

Figure 5-2: Gemin4 Mediated Import………………………………...... 121

Figure 5-3: Schematic of Gemin4 Embryo Analysis ………………...... 123

Figure 5-4: Is RNP biogenesis occurring at the Z-disc?.....……………...125

Figure 5-5: Possible functions of the SMN complex at the Z-disc……..127

7 Figure 5-6: mRNP transport for maintaining myofibrils……………….131

Appendix Chapter

Figure A1-1: Coil -/- mice are reproductively less fit…………………..140

Figure A1-2: Reciprocal mating crosses…………………………………142

Figure A1-4: Coil -/- mice have reduced testis size…………….………..144

Figure A1-5: Analysis of Coil -/- ovaries…………………………………145

8 Acknowledgements

I would like to take this opportunity to thank my mentor, Dr. Gregory

Matera. Greg is an extraordinarily bright scientist and over the years it has been a privilege to interact and learn from him. Greg has always been there for discussions of my project, science, and life in general. He has always been able to point out the “big picture”, when, at times I was discouraged about the way my research was heading. Greg really knew when to let me be independent and when to step in and get me back on the right track, for that I’ll always be truly grateful. I would also like to thank all the members of the Matera lab, past and present. Not only were they great colleagues whose knowledge and suggestions played an integral role in my development as a scientist, but I also consider all of them good friends for the rest of my life. Thank you to my committee for their advice and support over the years with regard to my project.

I would like to thank my parents, grandparents and siblings for their unwavering support throughout my graduate career and giving me the courage to follow my dreams. Most importantly, I would like to thank my wife, Heather.

She has been a constant source of inspiration, support and companionship through out all of this and I know her being in my life has given me the drive to succeed; for it was here in graduate school she made the happiest man alive and married me and gave me the proudest day in my life, the birth of our daughter,

Blair.

List of abbreviations

Aa amino acid ATP adenosine triphospate CBC cap binding complex GFP green fluorescent protein GIP1 Gemin3 interaction protein 1 GST glutathione S-transferase hnRNP heterogeneous nuclear RNP IP immunoprecipitation KO knock out mRNA messenger RNA NLS nuclear localization signal NMJ neuromuscular junction NPC nuclear pore complex PRMT5 protein arginine methyltranferase 5 PCR polymerase chain reaction RNP ribonucleoprotein RNA ribose nucleic acid SIP1,2,3 SMN interacting protein 1,2,3 SMA spinal muscular atrophy SMN survival of motor neuron snoRNP small nucleolar RNP snRNA small nuclear RNA snRNP small nuclear RNP SPN snurportin TMG 2,2,7-trimethylguanosine U snRNP uridine-rich snRNP UNRIP unr interacting protein

Novel Functions of SMN Complex Members and Their Implications

in Spinal Muscular Atrophy

Abstract

MICHAEL PATRICK WALKER

Spinal Muscular Atrophy (SMA) is one of the most widespread genetic disorders in children. Genetic research into the disorder has identified the survival motor neurons 1 (SMN1) gene as the causative agent. The gene product, SMN, is found in a multiprotein particle, the SMN complex, required for the biogenesis of essential splicing factors, the U snRNPs. While much is known about the function of SMN within this complex, other member’s roles remain enigmatic.

Recent investigations in muscle and motoneurons also point to additional functions for the SMN complex outside of snRNP biogenesis. These revelations have lead to a debate on whether or not SMA results from faulty snRNP production or from perturbation of another function(s). Clearly, a better understanding into all the members of the SMN complex would lead to a clearer view of snRNP biology and SMA etiology. The goal of my thesis was to determine the function of a little known member of the SMN complex, Gemin4, and investigate the role of the SMN complex in muscle function. Surprisingly, by utilizing a cell biological approach I discovered a putative role for Gemin4 with regard to import of the entire SMN complex. Gemin4 contains a functional

11 nuclear localization signal (NLS) and can drive other members of the complex into the nucleus. The creation of a Gemin4 gene-trap mouse revealed that

Gemin4 is essential. Finally, by using biochemical and genetic techniques, I discovered a novel role of the SMN complex in muscle function that is separate from snRNP biogenesis. At the molecular level the SMN complex is part of the contractile apparatus of both skeletal and cardiac muscle. Importantly, known muscle regulators, the calpains, directly process the core member of the complex,

SMN. Mouse models of SMA show defective muscle phenotypes at the molecular level that are indicative of a novel role of the SMN complex. Thus, I have identified a novel function for a member of the SMN complex, Gemin4, and shown that the SMN complex has a separate function in striated muscle. My research adds substantial knowledge to the study of SMN complex function and

SMA biology.

CHAPTER I

Introduction and Research Objectives

Introduction

Spinal Muscular Atrophy

Loss-of-function mutations in the human survival of motor neuron 1 (SMN1) gene results in autosomal recessive spinal muscular atrophy (SMA), a devastating neuromuscular disorder. SMA is the leading monogenic cause of infant morbidity and mortality (Oskoui and Kaufmann 2008). Relatively common, SMA occurs at a frequency of 1 in 6000 to 1 in 10,000 births with a carrier frequency as high as 1 in 50 individuals (Feldkotter et al. 2002; Smith et al.

2007). While SMN1 is currently the only gene known to cause autosomal recessive SMA, roughly 4% of the cases are unlinked to this locus with the late- onset form of the disease sometimes associated with dominant mutations in the

VAPB genes (Nishimura et al. 2004; Wirth et al. 2006).

The human SMN1 gene is located in an unstable genomic region of the long arm of chromosome 5, 5q13. This region is characterized by an inverted duplication, which houses several duplicated genes and pseudogenes including

SMN2 (Daniels et al. 1995; Rodrigues et al. 1995; Wirth et al. 1995). There is a telomeric copy, SMN1, and a centromeric copy, SMN2 (Wirth et al. 2006). Besides humans, great apes are the only other animals that have this duplication. With the exception of Saccharomyces cerevisiae, all other eukaryotes studied have only one copy of SMN (Bertrandy et al. 1999; DiDonato et al. 1997; Hannus et al. 2000;

Lorson et al. 2008b; Miguel-Aliaga et al. 2000; Miguel-Aliaga et al. 1999; Owen et al. 2000; Paushkin et al. 2000). The SMN genes consist of nine exons, of which exon 8 does not code for any amino acid residues. In humans, the two paralogs are nearly identical with only five nucleotide differences between the two, none

14 of which cause amino acid changes. However, a critical synonymous change, a C to T transition, in the upstream portion of exon 7 promotes preferential skipping of exon 7, which results in an unstable product that is turned over rapidly

(Figure 1-1) (Lorson et al. 1999; Monani et al. 1999). Much debate has centered on the nature of the alternative splicing. There are two schools of thought; one holds that the C-T transition obliterates an exonic splice enhancer within exon 7 which binds SF2/ASF while the other suggests the transition results in the creation of an exonic splicing inhibitor that binds hnRNP A1 (Cartegni and

Krainer 2002; Kashima and Manley 2003; Singh et al. 2004). Regardless of the mechanism that leads exon 7 exclusion, only about ten to twenty percent of full- length mRNA is produced from SMN2. In the absence of SMN1 or in the presence of null SMN1 mutations this residual amount of full-length SMN is sufficient for life and thus, SMN2 acts as a modifier of the SMA disease. In fact, there is an inverse correlation seen with SMN2 copy number and disease severity

(Lorson et al. 1999; Monani et al. 1999); the more copies an individual has the less severe the clinical phenotype observed, presumably from more full-length protein being produced (Figure 1-2). In fact, many therapeutic strategies for

SMA involve the promotion of an increased ratio of inclusion to exclusion of exon 7 from SMN2. Retention of exon 7 is facilitated by different classes of drugs such as hydroxyurea, valproic acid and butyrates; of which at this time clinical trials are either completed or ongoing (Brichta et al. 2006; Kinali et al. 2002; Liang et al. 2008; Mercuri et al. 2004; Russman et al. 2003).

Figure 1-1: SMN2 exon 7 skipping. Green and red bars represent the SMN1 and SMN2 genes, respectively. A carrier for SMA is depicted in this schematic.

Figure 1-2: SMN2 expression inversely correlates with the SMA phenotype. The X-axis represents the amount of full length SMN protein being produced from the SMN2 gene.

The Y-axis represents quality of life of SMA patients.

While many point mutations in SMN1 have been documented that cause

SMA (Wirth 2000; Zapletalova et al. 2007), the overwhelming majority of loss-of- function comes from the complete absence of the SMN1 gene. This can arise from the spontaneous loss of the telomeric copy from the unstable region and out-of-register recombination (misaligned homologous regions), which can result

17 in duplication and/or loss of SMN1 and SMN2 on either of the two chromosome

5 copies. Individuals who have had children with SMA or have a family history of the disorder often get genetic tests to determine who may be a carrier of SMA.

The genetic tests involve PCR based quantification of SMN1 copy number.

While this method has proved valuable for many individuals, for others this quantification analysis can be misleading. Certain individuals harbor both of their SMN1 copies on a single chromosome 5 and are in fact carriers of SMA as the other chromosome 5 lacks SMN1, which has just as likely of chance as of being inherited during fertilization as the other chromosome. Also, the combination of a point mutation in one individual and complete loss of SMN1 from another individual can introduce complications during analysis, via compound heterozygosity, an individual who has a deleterious point mutation within SMN1 on one chromosome and no SMN1 on the other chromosome

(Brahe and Bertini 1996; Spiegel et al. 1996).

SMA is characterized by the loss of cells in the anterior horn (motoneurons and interneurons), found in the lower lumbar spinal column in the ventral grey matter. In SMA patients, post mortem analysis reveals only 10-20% morphologically normal motoneurons present and many motoneurons appear to be chromatolytic, missing neuronal granules, and are slowly dying (necrotic) within this region (Chou and Wang 1997). There is an increase of apoptosis within motoneurons and abnormal migration of motoneurons that lack synapses within the anterior horn region (Simic et al. 2008; Simic et al. 2000). The amount of cell loss, type of cell death and amount of cell migratory aberration correlates with disease severity.

18 There are currently five clinical categories of SMA based on severity of the phenotype, the embryonic lethal form SMA type 0, the childhood SMA’s type I,

II and III and the adult form SMA type IV (Russman 2007). SMA type I, also known as acute SMA, severe infantile SMA or Werdnig-Hoffman disease is the most severe form of SMA characterized by muscle atrophy beginning during development, resulting in reduced fetal movement late in pregnancy. Physical manifestations of the disease occur early after birth, usually before 9 months of age (Simic et al. 2008). Type I patients are unable to walk, stand alone or sit unaided, have poor sucking and swallowing capabilities, are never able to lift their heads and cannot roll over on their own. These individuals are known to have congenital defects of bones and the heart (Cook et al. 2006; El-Matary et al.

2004; Felderhoff-Mueser et al. 2002; Kizilates et al. 2005; Menke et al. 2008; Moller et al. 1990; Mulleners et al. 1996; Vaidla et al. 2007). Respiratory failure and death generally occurs before two years of age. SMA type II, intermediate SMA, is characterized by onset of symptoms between the ages of six to 12 months.

While these individuals initially are able to sit upright and roll on their own, paralysis usually intensifies later in life, but then stabilizes. Type II patients are never able to walk and generally die before 18 years, but can live far beyond that age (Oskoui and Kaufmann 2008). SMA Type III, Kugelberg-Welander disease, is a chronic condition; the symptoms are greatly reduced and appear between 3-

15 years of age. While weaknesses in the legs are reported in SMA type III patients, they are generally able to walk and lead relatively normal lives (Simic et al. 2008). The rare SMA type IV, adult SMA, is reported to first show symptoms at 30 years of age and is mild in nature (Simic et al. 2008).

19 Several mouse models have been created for studying SMA. The first Smn knock out mice revealed that Smn is an essential gene as mouse embryos that lacked Smn died very early in development, at the pre-implantation stage

(Schrank et al. 1997). Later, two independent groups successfully knocked-out the mouse Smn gene and added the human SMN2 transgene to recapitulate the

SMA phenotype (Hsieh-Li et al. 2000; Monani et al. 2000b). Mice carrying one or two copies of the SMN2 transgene phenocopy SMA type I symptoms such as early lethality, reduction in motoneurons and atrophy of associated muscles

(Hsieh-Li et al. 2000; Monani et al. 2000b). Interestingly, only neuronal and skeletal muscle tissues were markedly affected in the mutant mice, indicative of the disease’s tissue specificity. In addition, when mice harbored more copies of the human transgene they displayed less severe SMA phenotypes, a situation observed in human SMA patients (see Figure 1-2). SMA type II mice carry an intermediate number of transgenes and have lower weight, partial paralysis of the hind limbs and significantly lessened life spans when compared to their wild type and heterozygous littermates (Hsieh-Li et al. 2000). SMA type III mice harbor increasing numbers of the transgene and live average adult life spans and are able to reproduce. However, these mice have significantly truncated tails, which are thought to be caused by necrosis of the muscle bundles in that region

(Monani et al. 2000b).

Although these animals represent the wide pathological spectrum of SMA, some variations within the sub-classes of SMA mice have made it necessary to create well-defined SMA type II and SMA type III mouse lines.

The SMA type II mouse line is a triple mutant consisting of the KO Smn allele, the human SMN2 transgene, and a SMN∆7 cDNA transgene. Originally

20 this line was developed in order to study the toxicity of the truncated SMN peptide, but surprisingly, it was found to ameliorate the severe SMA phenotype and extend mean life spans from 5 days to 13 days. It is hypothesized that the truncated form is able to bind the low amount of full length SMN and becomes more stable, which in turn becomes partially functional (Le et al. 2005). Thus, these mice partially mimic the intermediate SMA disease of humans. The SMA type III mice are also triple mutants consisting of the Smn KO allele, the human

SMN2 transgene and the human SMN A2G cDNA transgene. The A2G mutation is derived from patients with the mild form of SMA. These mice display motoneuron loss and muscle atrophy, but the symptoms are mild compared to types I and II mice and onset of these symptoms occurs much later in life. In fact, type III mice are able to survive long into adulthood (Monani et al. 2003).

Other SMA models are directed at knocking out Smn function in specific tissues. Neuronal, muscle and liver specific mouse lines have been established wherein Smn function has been ablated by Cre/Lox-P mediated excision of SMN exon 7 (Cifuentes-Diaz et al. 2001; Frugier et al. 2000; Vitte et al. 2004).

Importantly, homozygous deletion of exon 7 in all cell types leads to early embryonic lethality (Frugier et al. 2000). When directed at the liver these animals die late in embryonic development due to grossly malformed and atrophied livers and iron overload (Vitte et al. 2004). When Smn deletion is targeted to muscle the tissues become necrotic, and display a severe dystrophic phenotype.

These animals become severely paralyzed by three weeks of age and mean death occurs at 33 days (Cifuentes-Diaz et al. 2001). Finally, when deletion of exon 7 is localized only to neurons some SMA like phenotypes are observed. These phenotypes include muscle bundle atrophy due to denervation and reduction in

21 motoneuron numbers (Frugier et al. 2000). Motoneurons are malformed in these animals, which also display improper axon formation (Cifuentes-Diaz et al.

2002). Furthermore, these mice have an average life span of 25 days (Cifuentes-

Diaz et al. 2002; Frugier et al. 2000).

The various SMA mouse models are providing valuable information in the study of SMA pathology and etiology. With KO and conditional KO Smn mouse lines becoming increasingly available by commercial sources there continues to be an overabundance of experimental gains into basic, clinical and therapeutic research. These animals are helping answer perhaps one of the most fundamental questions in the SMA field: and that is “What is the molecular cause of SMA?” Is there a unique function of SMN in neurons and muscle or are these tissues particularly sensitive to perturbation in the all-important “housekeeping” function of SMN, U snRNP biogenesis?

snRNP biogenesis

During the process of mRNA splicing, intron sequences are recognized and subsequently removed from the precursor transcript and the flanking exons are joined. A multifactor complex, the spliceosome, carries out this complicated feat.

The spliceosome consists of five (U1, U2, U4, U5 and U6) uridine-rich small nuclear ribonucleoproteins (U snRNPs), which themselves consist of a small nuclear ribonucleic acid molecule (snRNA), a common heptameric Sm protein ring and U snRNP specific proteins. The RNA components of snRNPs act as guides to complement splicing signals within the mRNA intron/exon boundaries (Sperling et al. 2008). The spliceosomal U snRNPs and non-snRNP proteins then drive spliceosome function (Figure 1-3).

Figure 1-3: A simplified overview of mRNA splicing. Shown are the U snRNPs and the pre-mRNA transcript; non-snRNP factors are not depicted. U1 and U2 first recognize sequence elements of the pre-mRNA and form an early complex. The actions of U1 and

U2 bring the ends of the intron in close proximity and the tri-snRNP (U4-U6) displaces

U1 and U4 is removed. The catalytic U2, U5 andU6 snRNP is then involved in excision

23 of the intron. The end products of the splicing reaction are a joined exon-exon messenger RNP (mRNP) and the intron lariat by-product.

The biogenesis of the snRNPs is a rather complex pathway (Figure 1-4) that consists of three phases: snRNA transcription and export from the nucleus, primary maturation in the cytoplasm and import of the snRNP back into the nucleus and final maturation before storage or use in splicing (Matera 1998). U snRNP biogenesis begins in the nucleus with transcription of U1, U2, U4 and U5 snRNAs by RNA polymerase II or the U6 snRNA by RNA pol III (Bark et al.

1986; Kunkel et al. 1986; Mattaj and Zeller 1983; Murphy et al. 1982). The monomethyl caps of the snRNAs are then complexed with several proteins termed the CBC/PHAX complex, which is a prerequisite for cytoplasmic export

(Ohno et al. 2000; Segref et al. 2001). Once exported to the cytoplasm these factors are released and the snRNA interacts with a large protein particle, the SMN complex.

The SMN complex is essential for the ordered assembly of the Sm proteins

(B/B′, D1, D2, D3, E, F and G) in the form of a heptameric ring onto the Sm site of snRNAs (Meister et al. 2001a; Yong et al. 2004). A subset of these proteins (D1 and D3) are methylated by another complex, the PRMT5 complex, which acts in concert with the SMN complex in vivo during Sm core formation (Friesen et al.

2001b; Meister et al. 2001b; Meister and Fischer 2002; Pu et al. 1999). SMN preferentially binds to these methylated Sm proteins (Friesen et al. 2001a). The addition of the Sm ring serves as a catalyst for hypermethylation of the 5′ cap by the capping enzyme trimethylguanosine synthase 1 (TGS1) (Mattaj 1986;

24 Mouaikel et al. 2003; Mouaikel et al. 2002; Plessel et al. 1994) and 3′ end trimming by RNAse III (Seipelt et al. 1999). Once these modifications occur, the hypermethylated (TMG) cap directly interacts with the import adaptor, snurportin 1, SPN (Huber et al. 1998). SPN in turn interacts with the import receptor, importin β, which also binds the SMN complex; this then serves as the snRNP import signal into the nucleus (Huber et al. 2002; Narayanan et al. 2004;

Narayanan et al. 2002).

Within in the nucleus additional U specific proteins are added to the snRNP and the snRNAs undergo modifications within large nuclear structures, the Cajal bodies (Figure 1-4) (Jady et al. 2003; Kiss et al. 2002; Nesic et al. 2004; Richard et al. 2003). The Cajal body is a RNP modification and assembly factory responsible for not only snRNP modification, but also of snoRNPs, rRNPs, histone mRNAs, telomerase, and biogenesis of micro and small interfering RNAs in plants

(Matera and Shpargel 2006; Morris 2008); within this structure small cajal body- specific RNAs (scaRNAs) act as guide RNAs in the process of addition of pseudouridine (Ψ) and 2′-O-ribose methylation of snRNA (Jady et al. 2003).

Once these modifications occur the mature snRNPs leave the Cajal body and locate to areas of active splicing (perichromatin fibrils) or storage areas

(intrachromatin granule clusters) (Morris 2008).

Figure 1-4: snRNP biogenesis overview. Depicted here is the creation of a U1 snRNP.

26 First the U1 snRNA is transcribed in the nucleus. This RNA exits the nucleus, via CRM1 mediated export facilitated by PHAX and CBC. In the cytoplasm the export proteins are removed from U1 snRNA. Primarily the SMN complex with help of the PRMT5 complex mediates the addition of the Sm core or ring. Addition of the ring results in modifications of the 5’ and 3’ ends of the U1 snRNA. The hypermethylated cap interacts with the import factor SPN and the immature U1 snRNP along with the SMN complex are imported into the nucleus. The U1 snRNP first localizes to the Cajal body where further modifications occur. The now mature U1 snRNP is ready to locate to areas of splicing or storage.

The SMN complex

While many factors play a role in the U snRNP formation, the SMN complex is, by far, the pivotal member of the biogenesis machinery. Thus, it comes to no surprise that much effort has gone into the study of SMN and its interacting partners, the Gemins. Because of SMN’s involvement in SMA, Gemin function(s) needs to be deciphered to address the issue of snRNP formation and their role, if any, in the pathology of the disease. The SMN complex contains nine cytoplasmic members, Gemins 2-8, SMN and UNRIP (Kolb et al. 2007; Pellizzoni

2007) and although the SMN complex in its entirety is responsible for the assembly of the core and import of the snRNP, the complex is actually modular in nature (Battle et al. 2007). There are three separate sub-complexes that have important functions (disscused below), which come together to form the functional SMN complex (Figure 1-5). Like SMN, Gemin 2-8 all localize in Cajal bodies, often referred to as Gems (Baccon et al. 2002; Carissimi et al. 2006a;

Charroux et al. 1999; Charroux et al. 2000; Fischer et al. 1997; Grimmler et al.

27 2005b; Pellizzoni et al. 2002a). Experimental perturbations within the SMN complex and cells derived from SMA patients or model organisms often lead to an absence of Cajal bodies/Gems indicating this complex’s importance in proper snRNP biogenesis (Feng et al. 2005; Frugier et al. 2000; Shpargel and Matera

2005).

Figure 1-5: The SMN complex. The SMN complex is modular in nature comprised of three sub-complexes and two additional Gemins. Gemin2, which also helps stabilize the entire SMN complex, stabilizes SMN oligomers; these factors form the core of the SMN complex. The Gemin3/4 sub-complex houses the RNA helicase and its proposed co-

28 factor. Gemin5 is thought to target snRNAs to the SMN comlex. The Gemin6, 7 and

UNRIP sub-complex is targeted to the SMN complex by the action of Gemin8.

The most extensively studied member of the SMN complex is undoubtedly

SMN. As mentioned above, SMN is an essential gene (Schrank et al. 1997).

SMN/Gemin1 is a 294 aa protein that self associates to form oligomers of yet unknown proportions (Pellizzoni et al. 1999). What is known is that self- oligomerization of SMN is needed for proper SMN complex function. Point mutations found in the regions of self-oligomerization render the mutant protein unable to self-associate (Pellizzoni et al. 1999). SMN’s closely associated interacting partner, Gemin2, helps to stabilize the SMN oligomer (Ogawa et al.

2007). Knockdown of SMN levels significantly reduces Sm core assembly onto the snRNA in vitro (Feng et al. 2005; Shpargel and Matera 2005) and in vivo

(Gabanella et al. 2007; Wan et al. 2005). SMN acts as the central constituent that binds the rest of the Gemins to the complex. SMN directly interacts with Gemin

2, 3, 5, 7 and 8. Gemin 4, 6, and UNRIP are bound to other members

(Neuenkirchen et al. 2008; Otter et al. 2007). SMN also targets the SMN complex to the Cajal body via direct interaction by its tudor domain, involved in protein- protein interaction with methylated substrates, with the Cajal body structural protein Coilin. A methylated RG motif located in the Coilin peptide recruits

SMN; SMN’s tudor domain has a high affinity for symmetrically di-methylated arginines and these methylated arginines are located in the RG box (Hebert et al.

2002; Hebert et al. 2001).

Gemin2/SIP1 is another core member of the SMN complex; in fact, it is now assumed that Gemin2 and SMN form the primordial snRNP assembly complex

29 in that they form the minimal core required for U snRNP biogenesis, except in the case of Sachromymyces cerivisiae where only the distantly related ortholog of

Gemin2 is known (Kroiss et al. 2008). Gemin2, originally described as SMN

Interacting Protein 1 (SIP1), was initially identified in a yeast two-hybrid cDNA screen using SMN as the bait protein. Indeed, Gemin2 and SMN co-localize in

Cajal bodies (Liu et al. 1997). Early on it was revealed that Gemin2 and SMN were in a complex that associated with snRNAs (Liu et al. 1997). Gemin2 is an essential gene. Gemin2 mutant embryos die shortly after implantation of the blastocyst and heterozygous mice produce only 50% protein levels (Jablonka et al. 2002). Low levels of Gemin2 significantly affect the U snRNP assembly pathway. RNA interference of Gemin2 severely reduces the SMN complex’s ability to assemble the Sm core onto snRNAs (Feng et al. 2005; Shpargel and

Matera 2005). Gemin2 interacts with SMN via a domain located in the amino terminus of SMN and the levels of Gemin2 are dependent on their avid association. Surprisingly, low levels of SMN result in lower levels of Gemin2 protein (Wang and Dreyfuss 2001). Biochemically, Gemin2 functions to stabilize

SMN oligomerization via an amino-terminal self-associating domain in SMN, which lies relatively close to the Gemin2 binding site. When Gemin2 is deleted the amino-based self-oligomerization activity of SMN is severely reduced and the stabilization of other components of the SMN complex are also significantly affected (Ogawa et al. 2007).

Gemin3/DP103/Ddx20 was the third member of the SMN complex reported. Gemin3 was originally identified by mass spectrometry of an unknown peptide, revealing Gemin3 is in a complex with SMN, Gemin2 and the

Sm proteins (Charroux et al. 1999). Gemin3 interacts directly with SMN and a

30 sub-set of the Sm core proteins. Gemin3 and SMN localize in Cajal bodies

(Charroux et al. 2000). Gemin3 also directly interacts with Gemin4, tethering the protein to the SMN complex (Charroux et al. 2000). Gemin3 is a DEAD box ATP- dependent RNA helicase; its amino terminus houses helicase motifs that share a high degree of identity and similarity to members of the SFII superfamily of helicases (Charroux et al. 1999; Grundhoff et al. 1999). RNA helicase activity is reportedly needed for proper RNP metabolism and Gemin3 has been demonstrated in vitro to possess both ATPase activity and dsRNA unwinding ability (Yan et al. 2003). Interestingly, both the amino terminus, which houses the helicase domain, and the carboxy terminus are required for helicase activity

(Yan et al. 2003). Gemin3’s carboxy half shows no known homology to any other proteins and is important for protein-protein interactions including, but not limited to, SMN, SF-1, EBNA2 and Egr2 (Charroux et al. 1999; Gillian and Svaren

2004; Grundhoff et al. 1999; Ou et al. 2001; Yan et al. 2003). Gemin3 is important for Sm core assembly within the SMN complex. In vitro knockdown experiments by RNAi against Gemin3 result in significantly reduced core assembly onto radiolabelled U1 snRNA (Shpargel and Matera 2005). Like SMN and Gemin2,

Gemin3 is an essential gene. Mice lacking Gemin3 die very early in embryonic development and mutant flies die at the larval stage (Mouillet et al. 2008;

Shpargel et al. 2008).

Gemin4/GIP1 is a 1058 aa protein first discovered by biochemical analysis of the SMN complex in HeLa cells (Charroux et al. 2000), like the rest of the

Gemin’s, Gemin4 does not share significant homology to any other known proteins. However, there are three characterized functional domains within

Gemin4. There is a leucine zipper found in the carboxy terminus. This stretch of

31 leucines is important for interactions with certain zinc finger proteins, especially nuclear dot protein 52, NDP52 (Di et al. 2003). The last 50 aa residues of Gemin4 are important for interactions with two splicing factors, Galectin 1 and 3. Over expression of this carboxy domain halts in vitro splicing (Park et al. 2001). More recently a functional nuclear localization signal (NLS) has been characterized in the amino terminus of the human peptide (Lorson et al. 2008a). Within the SMN complex Gemin4 interacts directly with its binding partner Gemin3 and several members of the Sm core (Charroux et al. 2000). Gemin4 is thought to act as a co- factor for the Gemin3 helicase, but its direct function in this regard is yet to be determined (Charroux et al. 2000). Surprisingly, Gemin 4 also interacts with its self, possibly self-oligermerizing like the SMN protein, and Gemin 8 (Otter et al.

2007).

Gemin5 is the largest member of the SMN complex at ~ 170 kD. Gemin5 colocalizes with SMN in the nucleus within Gems/Cajal bodies, although it is less frequently observed in theses structure than other members of the complex

(Gubitz et al. 2002; Hao le et al. 2007). Gemin5 interacts directly with SMN and several of the Sm core proteins. Interestingly, Gemin5 contains 13 WD repeats suggesting it forms multiple protein-protein interactions (Gubitz et al. 2002).

Gemin5 plays a key role in snRNP assembly in that it’s the protein that directly interacts with the snRNA and targets it to the rest of the complex in an ATP- dependent fashion (Battle et al. 2007). Outside of snRNP biogenesis Gemin5 functions in mRNA translation. Interestingly, Gemin5 is found to interact directly with several members of the translational machinery and knock down experiments reveal Gemin5’s role in control of both cap-dependent and IRES specific translation by down regulating the initiation steps (Pacheco et al. 2008).

32 Gemin6/SIP2 and Gemin7/SIP3 are the smallest members of the complex at

16 and 15 kD, respectively (Baccon et al. 2002; Pellizzoni et al. 2002a). These members both colocalize with SMN in Gems/Cajal bodies. While Both Gemins 6 and 7 interact with several of the Sm proteins, Gemin7 interacts directly with

SMN and tethers Gemin6 to the complex (Baccon et al. 2002; Pellizzoni et al.

2002a). Gemins 6 and 7 contain domains that are similar to the “Sm fold” and are thought to function as scaffolding intermediates during Sm core formation

(Ma et al. 2005). In fact, Gemins 6 and 7 are referred to as a heterodimer and, along with another factor, form one of the sub-complexes that come together to form the fully functional SMN complex (Battle et al. 2007; Ma et al. 2005).

Gemins 6 & 7 also interact with the solely cytoplasmic member of the SMN complex, Unr (upstream of N-Ras) interacting protein, UNRIP (Carissimi et al.

2005; Grimmler et al. 2005b). UNRIP is largely absent from the nucleus and is not found in Gems/Cajal bodies (Carissimi et al. 2005). Interestingly, UNRIP regulates the cellular distribution of the SMN complex. Reduction in UNRIP levels by RNAi results in higher abundance of SMN positive Cajal bodies

(Grimmler et al. 2005b). While its direct function is yet not known, UNRIP is essential for efficient Sm core assembly (Carissimi et al. 2005). Finally, while

UNRIP, Gemins 6 and 7 form a heteromeric subunit the last member identified,

Gemin8, targets this group of factors to the SMN complex. Gemin8 is required for SMN interaction with the Gemin6, 7 heterodimer (Carissimi et al. 2006b).

Gemin8 is a ~32 kD protein similar in size to Gemin2. This protein colocalizes with SMN in nuclear Gems in HeLa PV cells indicating that it is indeed a member of the SMN complex (Carissimi et al. 2006a). Moreover, Gemin8 directly interacts with SMN (Carissimi et al. 2006a; Carissimi et al. 2006b). RNAi induced

33 reduction of Gemin8 levels results in significantly reduced snRNP assembly activity in vitro, but does not effect snRNA delivery to the SMN complex, reflecting the importance of Gemin8 to deliver the Gemin6, 7 complex to function in core assembly (Carissimi et al. 2006a; Carissimi et al. 2006b).

The wealth of knowledge being produced from the various studies of SMN and the Gemins has undoubtedly contributed to our basic knowledge of snRNP biology and given us clearer insights into the root cause(s) of SMA. However, through these studies it has become abundantly clear that members of the SMN complex are also involved in functions that are not involved in U snRNP biogenesis. In the case of SMN this has confounded the SMA field and as a result there is not a clear consensus on which function of the SMN complex or which tissues are directly affected in SMA.

SMN and Gemin function in the motor unit

In SMA two tissues are profoundly affected, skeletal muscle and motoneurons. In the case of snRNP biogenesis low levels of SMN have been shown to reduce snRNP assembly, but the SMA phenotype only manifests itself in muscle and neurons leading to one school of thought that these tissues are particularly susceptible to aberrant snRNP biogenesis. However, recent studies have indicated SMN and other members of the complex have separate functions within these tissues (see Figure 1-6) and lend credence to the idea that a novel function in one or both of these tissues is ablated, exposing the true reason for the tissue specific phenotypes observed.

Figure 1-6: Functions of SMN & Gemins in the motor unit. Besides SMN’s function in snRNP biogenesis it has been implicated in mRNA transport, axonal growth cones, neurite outgrowth, maintenance of NMJs, and a member of the sarcomere. Gemins 2, 3,

5, 7 and unrip also localize to axonal processes.

One theory of SMA is that motoneurons are the primary targets of the disease and that the atrophy and paralysis of muscle seen in the disease is a secondary consequence of denervation. In motorneurons, the SMN complex is thought not only to actively assemble and transport snRNPs, but also there is evidence that it has a role in mRNA. Several knockdown and rescue studies in animals reveal a role for SMN in axon integrity including axon length, outgrowth and synapses (Gavrilina et al. 2008; Jablonka et al. 2007; McGovern et al. 2008;

McWhorter et al. 2008; McWhorter et al. 2003). Axonal truncations and branching defects are observed in developing zebrafish embryos when morpholinos are used to reduce SMN levels. Injection of human SMN1 mRNA

35 partially rescues these defects (McWhorter et al. 2003). Surprisingly, a conserved

QNQKE motif found in exon 7 of human SMN is essential for rescue of the axonal defects seen in zebrafish and this motif is not involved in aspects of Sm core assembly (Carrel et al. 2006). Consistent with importance of this motif in exon 7 RNAi of endogenous SMN levels in neurons results in diminished neurite outgrowth, but this phenotype is rescued by exogenous expression of the C- terminus of SMN (van Bergeijk et al. 2007; Zhang et al. 2003). Moreover, over expression of SMN promotes neurite outgrowth in cultured neuron cells (Rossoll et al. 2003; van Bergeijk et al. 2007). SMN directly interacts with the mRNA interacting hnRNPs R and Q (Rossoll et al. 2002). These two RNPs are involved in mRNA editing, splicing and transport. Interestingly, hnRNP-R is found in high abundance in axonal processes and SMN colocalizes in this region (Rossoll et al. 2002). Furthermore, SMN’s binding partner, hnRNP-R, binds to ß-actin mRNA, which, is highly enriched in axonal processes and at the growth cones

(Rossoll et al. 2003). In fact, SMN also interacts with profilin, which is an actin binding protein (Rossoll et al. 2003; Sharma et al. 2005). Not only is SMN found in axons and growth cones, but several of the Gemins including Gemin2, 3, 5, 7 and UNRIP are also present, indicating that the SMN complex in its entirety is present in axons and growth cones transporting actin mRNA (Sharma et al. 2005;

Zhang et al. 2006). These studies have led to an emerging hypothesis of the SMN complex being involved in the trafficking of actin mRNPs in neurons and that this may be the function that is perturbed in SMA pathology. Consistent with this view, is the fact that over expression of the C-terminus of SMN increases filamentous actin in cultured neurons and increased expression of the SMA- protective modifier, Plastin 3, up regulates filamentous actin levels rescuing

36 axonal defects associated with the disease (Oprea et al. 2008; van Bergeijk et al.

2007). Thus, the SMN complex is implicated in actin-dynamics of the cytoskeleton in motoneurons.

There have been many studies on the role of SMN in motoneurons because of the obvious neurodegenerative nature of the disease, but less attention has been focused on the role of SMN and the SMN complex within muscle cells.

However, many aspects of SMA pathology resemble other myopathic disorders and studies into the involvement of skeletal muscle in SMA pathology are now beginning to shed light on the crucial role(s) SMN plays (Sumner 2007). During muscle formation individual muscle cells (myoblasts) fuse to form elongated multi-nucleated myotubes. As the myotubes mature they become innervated by motorneurons forming the motor unit. SMN is required for proper myotube formation (Shafey et al. 2005); Mouse skeletal muscle cell lines that are hypomorphic for Smn expression show reductions in myotube formation and malformations of the myotubes (Shafey et al. 2005). These defects observed during early myogenesis underscore the importance of SMN function in muscle.

It is known that myoblasts and satellite cells derived from the more severe types of SMA patients are not able to maintain stable innervations of wild-type motoneurons (Braun et al. 1995; Guettier-Sigrist et al. 2002). In co-cultures, motoneurons are able to innervate SMA muscle satellite cells as efficiently as wild-type satellite cells, but after 1-3 weeks the SMA muscle cells lose their ability to maintain their connection of the motor unit and denervation leads to motoneuron death (Braun et al. 1995). Just prior to myoblast fusion and innervation there are peaks of SMN mRNA expression. However, in cells derived from SMA types I and II the second peak of expression is absent. Thus,

37 SMN1 gene expression is required to maintain newly innervated myotubes and this explains why in co-cultures SMA muscle cells are able to form motor units, but unable to maintain them (Braun et al. 1995; Guettier-Sigrist et al. 2001;

Guettier-Sigrist et al. 2002). The importance of proper expression of SMN levels in muscle is a key event in neuromuscular junction (NMJ) maintenance as demonstrated in the Drosophila SMA model (Chang et al. 2008). These transgenic insects have targeted reduction of dSmn by RNAi drivers directed in either muscle or motoneurons and muscle driven reduction has a more severe NMJ phenotype. Moreover, dSmn is highly enriched in the postsynaptic region of the

NMJ further demonstrating the importance of SMN in muscle (Chang et al.

2008).

Muscle is organized in hierarchal levels beginning with the large muscle itself made up of varying amounts of muscle bundles (fascicles). These in turn are comprised of the myofibers, which are multi-nucleated myotubes with hundreds to thousands of contractile filament networks called myofibrils (Clark et al. 2002). At the molecular level myofibrils consist of tandem repeats of contractile units termed sarcomeres (Figure1-7). Two major and two minor filamentous networks that are stacked many times upon each other comprise the sarcomere. Myosin heavy chains make up the bulk of the thick filament region known as the A-band. A protein dense region called the M-line, which houses proteins involved in stability of the heavy chains, bisects the A-band. The A- band is flanked on either side by a region of thin filaments. The actin-rich thin filaments comprise the I-Band. Each I-band is bisected by the Z-disc or Z-line.

The Z-disc marks the boundary of the sarcomere (Clark et al. 2002). The Z-disc functions as the anchor for adjoining sarcomeres, transducer of contractile force,

38 houses proteins involved in signal tranduction and anchors the myofibril to the muscle plasma membrane (sarcolemma) (Frank et al. 2006). Titin is the largest known protein to date and it forms another filament network within the sarcomere. Its elastic property allows it to stretch from the end of sarcomere at the Z-disc to the center of the contractile unit at the M-line giving the sarcomere as a whole more stability and flexibility (Fukuda et al. 2008). Nebulin forms the last of the filament networks. Its proposed function is to act as a guide, or ruler, to specify exact lengths of the actin thin filaments and contracile regulation

(McElhinny et al. 2003). Therefore, a sarcomere consists of a Z-line beginning boundary, one half of an I-band, an A-band, another half of an I-band, and a Z- line ending boundary, all stabilized by titin and nebulin filaments.

Figure 1-7: The Sarcomere. Depicted here are two full sarcomeres bounded by Z-discs.

The Titin and Nebulin filament networks are only depicted in the left hand of the schematic.

39 Amazingly, the Drosophila ortholog of SMN was recently found to be a constituent of the Z-disc in indirect flight muscles (Rajendra et al. 2007). dSmn was observed to be enriched at regular intervals along the entire length of the myofibril and colocalized with the Z-disc marker protein α-actinin (an actin cross-linking protein). Importantly, dSmn hypomorphs lost this localization and their muscle organization was severely perturbed (Rajendra et al. 2007). The establishment of SMN as an integral member of the Z-disc has profound implications for SMA pathology and muscle function in general. Further research into SMN’s role in muscle function is clearly needed.

Research Objectives

SMN and the Gemins form the SMN complex, a key component in the ubiquitous function of snRNP biogenesis. Perturbations in snRNP biogenesis are thought to play a role in the SMA disease. To this end, much focus on research has been directed at SMN, the disease gene product. However, recently great strides have been made in not only ascertaining SMNs role in snRNP formation but also deciphering the molecular function of several of the Gemins within the complex and how they contribute to snRNP biogenesis. The role of Gemin4 in the SMN complex remains unknown. By using a genetic and cell biological approach I proposed to decipher a function for Gemin4. Previous unpublished observations from our laboratory had established that exogenous expression of

GFP tagged full length Gemin4 localizes almost exclusively in the nucleus. By creating a panel of deletion constructs of Gemin4 tagged with GFP and transfecting cells I determined which sequences within Gemin4 are required for nuclear localization. Furthermore, co-localization experiments with GFP tagged

Gemin4 constructs and immunostaining with various other Gemins will help

40 determine Gemin4’s role in SMN complex localization throughout the cell.

One dilemma in understanding the etiology of SMA is the question of whether or not the pathology, which is restricted to neuromuscular tissue, is due to a novel function of SMN or that these tissues are particularly sensitive to snRNP biogenesis. Previous reports have shown that reductions in individual members of the SMN complex can significantly affect snRNP biology. Thus, the ideal model system to study would be an organism that has one of the Gemin functions altered and ascertain the consequences to SMA phenotypes. I proposed the creation and characterization of a Gemin4 mouse to determine not only a function for Gemin4, but also to determine what, if any, modification of

SMA symptoms would occur in Gemin4 mice brought onto a genetic background where SMN expression mimicked that of SMA patients.

Finally, another conundrum in SMA biology is what tissue is the primary target of the disease; is the tissue muscle or motoneurons? Much research into this question has focused on SMN function in motoneurons, while a small amount of research has delved into the muscle aspect of the disorder.

Previously, our lab verified that SMN localizes to a distinct region of the sarcomere, the Z-disc, in the fruit fly. I intended to further investigate this phenomenon and determine if not only SMN, but also other members of the complex localize within the sarcomere of mammalian striated muscle. By utilizing mouse muscle tissues I planed to use immuno-localization techniques and biochemical analysis to determine the contribution of the SMN complex to sarcomere function. Furthermore, I assessed the consequence of the SMA phenotype on myofibril integrity.

CHAPTER II

Overexpression of Gemin4 relocalizes the SMN complex to the nucleoplasm

and causes disassembly of

Cajal Bodies.

Michael P. Walker1,2, Karl Shpargel1 and A. Gregory Matera1,2

1Department of Genetics, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4955

2Department of Biology, Program in Molecular Biology & Biotechnology, Lineberger Comprehensive Cancer Center University of North Carolina, Chapel Hill, NC 27599-3280

* This chapter is a manuscript currently in preparation.

42 Abstract

Gemin4 is a member of the macromolecular SMN complex, largely responsible for the primary assembly and maturation of the Sm-class of uridine rich small nuclear ribonucleorproteins (U snRNPs). Newly formed snRNPs are subsequently imported into the nucleus from the cytoplasm. We have previously reported that the SMN complex is required in the import of newly formed snRNPs. However, it is not clear which components of the SMN complex drive import into the nucleus. Here we report that Gemin4 over expressed in HeLa cells localizes primarily to the nucleus. The Gemin4 amino acid sequence contains three putative NLS motifs. Interestingly, only one of these motifs was found to be necessary and sufficient for nuclear import. Surprisingly, exogenous

Gemin4 expression also drives its close interacting partner, Gemin3, into the nucleus. Moreover, this phenomenon was observed for other members of the

SMN complex. These data indicate that Gemin4 serves as an import signal for the SMN complex.

43 Introduction

The SMN complex consists of nine proteins (SMN, Gemins 2-8 and unrip) and is responsible for the ordered assembly of a common heptomeric Sm ring onto snRNA during snRNP biogenesis (Kolb et al. 2007; Meister et al. 2001a;

Pellizzoni 2007). Upon completion of Sm assembly, the SMN complex remains associated with the snRNP Sm core (Narayanan et al. 2002). The import adaptor, snurportin, is required for nuclear import of snRNPs via an interaction with the tri-methyl cap of the 5’ end (Huber et al. 1998; Narayanan et al. 2004; Narayanan et al. 2002). However, the SMN complex can also drive nuclear import in the absence of snurportin, but as of yet the adaptor protein(s) has not been identified within the complex (Narayanan et al. 2004).

Upon nuclear import, the SMN complex is thought to transport the newly formed snRNP to a RNP factory, the Cajal body, where further maturation processes occur (Matera and Shpargel 2006). At this point, the SMN complex now becomes a sub-domain within the Cajal body and this domain is sometimes referred to as the Gem, when separated from the Cajal body (Young et al. 2001;

Young et al. 2000). The complex is able to anchor itself into the Cajal body via

SMN’s tudor domain directly contacting the Cajal body structural protein coilin

(Hebert et al. 2001). This interaction is achievable because the tudor domain of

SMN preferentially binds symmetrically dimethylated arginines within the coilin peptide (Hebert et al. 2002). Within the nucleus, the SMN complex is thought to recycle snRNPs for multiple rounds of splicing in the splicesome.

There has been much emphasis on research of SMN, because of its role in the devastating childhood disorder spinal muscular atrophy (SMA). In fact, 95% of SMA cases are due to mutations of SMN. Importantly, not only do SMA

44 patients and SMA-like mice display numerous debilitating phenotypes, but they also have serious defects in the snRNP pathway (Feng et al. 2005; Frugier et al.

2000; Le et al. 2000; Pellizzoni et al. 1999; Shpargel and Matera 2005).

Knockdown studies of SMN and the Gemins reveal their importance in core assembly (Feng et al. 2005; Shpargel and Matera 2005). SMN and Gemin2 form the core of the complex and are thought to be the primordial proteins in the evolution of the complex. Higher metazoans have acquired more Gemin proteins over time and details into their roles in snRNP assembly are only now beginning to be ascertained (Kroiss et al. 2008). Gemin4 was first discovered by biochemical analysis of the SMN complex in HeLa cells (Charroux et al. 2000).

There are currently three known functional motifs within Gemin4, a leucine zipper and a galectin interacting domain located in the carboxy terminus, and a nuclear localization signal found in the amino terminus (Di et al. 2003; Lorson et al. 2008a; Park et al. 2001). The leucine zipper is required for interactions with five zinc finger proteins one of which, NDP52 (nuclear dot protein 52), interacts strongly (Di et al. 2003). The last 50 aa residues are important for interactions with two galectins (Galectin 1 and 3) involved in splicing (Park et al. 2001).

Within the SMN complex Gemin4 interacts directly with its binding partner

Gemin3 and SmB of the heptomeric ring (Charroux et al. 2000). Gemin3 directly interacts with SMN within the core and tethers Gemin4 to the complex

(Charroux et al. 1999; Charroux et al. 2000). More recently it has been determined that Gemin4 can interact with itself and Gemin8 (Otter et al. 2007).

Gemins 3, 4 and the argonaut protein eIF2C2 are also found in a separate complex, the microRNP complex, which has demonstrated RNA induced silencing (RISC) activity in vitro (Dostie et al. 2003; Hutvagner and Zamore 2002;

45 Nelson et al. 2004). Gemin4, like most of the Gemins, does not share significant homology with other known proteins, which has made determining its function(s) challenging.

In this study we identify a bona fide NLS within the amino half of mouse

Gemin4. This NLS is both necessary and sufficient for robust nuclear import.

Surprisingly, when GFP:Gemin4 is over expressed not only does the fusion protein localize to the nucleus, but Gemin3 is also driven into the nucleoplasm, and the carboxy half of Gemin4 appears responsible for this ability. Moreover, we document Gemin4’s apparent ability to transport other complex members into the nucleoplasm as well. These data indicate that Gemin4 can act as the nuclear signal in the SMN complex to get itself and other members of the complex into the nucleus.

Results

GFP:Gemin4 localizes primarily to the nucleus

To better understand the overall function(s) of Gemin4 we set out to determine the localization of mouse Gemin4 utilizing a HeLa cell line. Human and mouse Gemin4 are greater than 84% identical and more than 90% similar in their peptide sequence and as such would be expected to localize similarly in different cell cultures. Recently, it has been reported that tagged versions of human Gemin4 localize almost exclusively to the nucleus. Endogenous Gemin4, like other Gemins, typically localizes diffusely throughout the cytoplasm and sparsely within the nucleus in scattered structures termed Cajal bodies (reference and Figure 2-1). We tagged GFP to the amino terminus of mouse Gemin4,

GFP:Gemin4 (Figure 2-2A), and transiently transfected HeLa cells with this construct then observed the localization pattern (GFP was used to visualize localization because reliable antibodies for mouse Gemin4 are not readily available). As seen in Figure 2-1, GFP:Gemin4 localizes to the nucleus and this localization is not the result of a nuclear localization signal (NLS) from the GFP peptide as tagged versions of Gemin3 and SMN did not give the same localization pattern (Figure 2-1). Thus, the Gemin4 protein most likely houses a an NLS, or a trans acting factor facilitates Gemin4 import into the nucleus.

Figure 2-1: GFP:Gemin4 localizes to the nucleus. HeLa cells were transfected with

GFP:Gemin3, GFP:Gemin4 or GFP:SMN and their localization was compared to the endogenous Gemin4 IF signal in cells that were not transfected (compare first panel to the transfected panels). GFP:Gemin4 lacks any appreciable signal in the cytoplasm compared to the rest of the panels. Note: Alexa 594 goat anti-mouse secondary antibody was used against the Gemin4 primary antibody and the image was false- colored to maintain uniformity. Scale bar is 5 µm.

Gemin4 contains three putative NLSs

We analyzed the Gemin4 amino acid sequence for potential NLS motifs and three simple SV40-like NLSs were discovered (Figure 2-2B). Two of the NLSs were in the amino terminal half of Gemin4 and the third was embedded in a leucine zipper motif located in the carboxy terminal half. Various deletion constructs were made including gross truncations of the amino and carboxy ends as well as precise excisions of the two putative amino NLSs and excision of the leucine zipper motif which houses the other putative NLS (Figure 2-2A,B). The leucine zipper motif is important for protein-protein interactions. The GFP signal remains exclusively nuclear when either the GFP:Gemin4 or GFP:∆CT construct is transfected into cells, but when GFP:∆NT is expressed the signal is cytoplasmic (Figure 2-3A). Next, constructs where the putative NLS1, NLS2, and

48 the leucine zipper were removed were expressed in HeLa cells and GFP:∆NLS1 and GFP∆ZIP both have nuclear localization patterns (Figure 2-3B). In stark contrast, the GFP signal is entirely cytoplasmic when the GFP:∆NLS2 construct is expressed (Figure 2-3B). These data clearly show there is a NLS at the amino end of Gemin4 located at aa 199-206.

Figure 2-2: GFP:Gemin4 deletion constructs. (A) GFP was fused to the amino terminus of mouse Gemin4 and this construct was used to subsequently make gross truncations

49 and precise excisions throughout the peptide sequence. (B) The entire 1058 aa sequence was analyzed for NLS motifs using web-based PSORT software. Three putative NLS motifs as well as a leucine zipper motif were predicted.

Figure 2-3: The amino terminal half of Gemin4 contains a nuclear localization signal. (A)

The fusion constructs were expressed with the full length, the amino half (aa 1-440) or the carboxy half (aa 440-1058) of Gemin4. The carboxy half, GFP:∆NT, does not localize to the nucleus: compare the far right panel to the other two panels. (B) Both

NLS motifs in the amino half, GFP:∆NLS1 and GFP:∆NLS2 (aa 62-69 and aa 199-206, respectively), and the leucine zipper, GFP:∆LZIP (aa 714-736), containing the third NLS were excised. The only construct that was not able to localize to the nucleus was

GFP:∆NLS2. Scale bar is 5 µm.

50 The NLS is necessary and sufficient for Gemin4 import

The above data demonstrate that the NLS at aa 199-206 is necessary for nuclear import of Gemin4 (Figure 2-3B, middle panel), but does not address whether or not the NLS is sufficient to drive nuclear import, because other amino acid sequences may be required. To address this we fused the NLS amino acid sequence to the carboxy terminus of GFP. One construct consisted of only the

NLS sequence, NLS-min. The other construct had 5 additional amino acids flanking the NLS in both directions, NLS-ext. We expressed these constructs and compared the localization of the GFP signal compared to a native GFP control.

While native GFP has an overall pan-cellular localization (Figure 2-4, left panel)

GFP:NLS-min is much more concentrated in the nucleus ,albeit with some signal retained in the cytoplasm (Figure 2-4, middle panel). However, when GFP:NLS- ext is expressed the GFP signal is almost entirely nuclear (Figure 2-4, right panel). These observations verify Gemin4 as having a bona fide NLS that is both necessary and sufficient for nuclear import.

Figure 2-4: The Gemin4 NLS is sufficient to drive nuclear import. The NLS at aa 199-

206 was fused to the carboxy half of GFP directly, GFP:NLS-min, or flanked by 5 residues at aa 194-211, GFP:NLS-ext, and their localization was compared to GFP alone. The GFP:NLS-ext signal is almost exclusively nuclear. Scale bar is 5µm.

51 Nuclear localization is not species dependent or dependent on location of GFP

As stated above, an NLS has been characterized for human Gemin4.

However, at the time of this study we also independently fused GFP to the amino terminus of human Gemin4 in order to rule out the possibility that the localization pattern seen in our study is unique to the mouse (Figure 2-5, compare A to B). Also, we found the location of GFP, either fused to the amino or carboxy terminus of Gemin4, had no effect on the localization pattern observed (Figure 2-5, compare A to C); the same localization pattern is seen when GFP is fused to the carboxy terminus of human Gemin4 (data not shown).

Figure 2-5: Mouse and human Gemin4 localize to the nucleus regardless of the placement of GFP. (A) GFP fused to the amino terminus of mouse Gemin4 was expressed in HeLa cells and localized to the nucleus. (B) GFP fused to the amino terminus of human Gmin4 was expressed and localized to the nucleus. (C) GFP fused to the carboxy terminus of mouse Gemin4 was expressed and found to localized to the nucleus. Scale bar is 5 µm.

52 Gemin4 nuclear localization alters Gemin3 distribution throughout the cell

Gemin4 is tethered to the SMN complex due to a strong interaction with

Gemin3 and, because of this strong interaction we tested whether or not Gemin4 over expression would alter the distribution of endogenous Gemin3. Gemin3 localizes diffusely throughout the cytoplasm in addition to concentration in nuclear Cajal bodies. As expected when GFP:Gemin4 is expressed the GFP signal is nuclear (Figure 2-6). Surprisingly, endogenous Gemin3 is also predominantly nuclear in transfected cells (Figure 2-6A). Furthermore, not only is Gemin3 more pronounced in the nucleus, but also less cytoplasmic Gemin3 is observed in transfected cells compared to cells that are not transfected (Figure 2-6A, arrows).

As indicated above GFP:∆CT localizes primarily to the nucleus (Figure 2-3A, 2-

6B). However, in this case endogenous Gemin3 has a wild type distribution signal seen diffusely throughout the cytoplasm and in Cajal bodies within the nucleus (Figure 2-6B, arrow; compare 2-6A to 2-6B). This suggests that Gemin4 may no longer interact with Gemin3 and that the region within Gemin4 responsible for this interaction is located in the carboxy half of the protein. Since the leucine zipper is known to be important for protein-protein contact we tested whether Gemin3 localization is altered by expressing GFP∆ZIP. As seen in

Figure 2-6C, cells transfected with this construct display typical endogenous

Gemin3 localization as compared to non-transfected cells (Figure 2-6C, arrow).

These data demonstrate Gemin4’s ability to bind Gemin3 via the carboxy end, and affect its localization throughout the cell.

54 Figure 2-6: Gemin4 redirects Gemin3 into the nucleus. (A) GFP:Gemin4 was expressed in HeLa cells and then the cells were stained with an antibody against

Gemin3. GFP:Gemin4 appears in green and Gemin3 in red. The Gemin3 nuclear signal is much more intense in transfected cells compared to non-transfected cells and is also less abundant in the cytoplasm. Arrows indicate cytoplasmic regions of the cell. (B,C)

Cells were transfected with GFP:∆CT or GFP:∆LZIP and then stained with a Gemin3 antibody. In either case the Gemin3 localization appeared the same as in non- transfected cells. Arrows point at Cajal bodies. Scale bar is 5 µm.

Gemin4 drives other members of the SMN complex into the nucleus

The effect of exogenous Gemin4 on endogenous Gemin3 localization suggests that Gemin4 may drive other complex members into the nucleus. We transiently transfected HeLa cells with GFP:Gemin4 and looked at the endogenous location of other complex members and compared their pattern to non-transfected cells. When GFP:Gemin4 is expressed there are three distinct localization patterns observed for endogenous SMN. In some transfected cells endogenous SMN is more pronounced in the nucleus with less cytoplasmic signal while Cajal bodies are maintained (Figure 2-7A, arrows). In other cells the endogenous SMN signal is mainly nuclear spread diffusely throughout when compared to non-transfected cells (Figure 2-7B). Finally, some transfected cells appeared no different from non-transfected cells (Figure 2-7C). While this nuclear pattern is more pronounced when compared to non-transfected cells, the

SMN localization pattern is intermediate when compared to Gemin3 localization

(Figure 2-6A, 2-7A). We also tested for the localization of other members of the

SMN complex. Gemin2/SIP1 is SMN’s close interacting partner. We tested if

55 over expression would also drive Gemin2 into the nucleus. In non-transfected cells, Gemin2 gave the typical Gemin localization profile. However, in a large proportion of GFP:Gemin4 transfected cells the localization of Gemin2 was predominately nuclear (Figure 2-7D). Unrip is a cytoplasmic member of the

SMN complex and in non-transfected cells is localized relatively uniform throughout the cell, but in cells transfected with GFP:Gemin4 the Unrip signal is mostly nuclear with less cytoplasmic signal (Figure 2-7E, arrows). Together, these data show that Gemin4 is able to bring other members of the complex into the nucleus when over expressed. Thus, Gemin4 may play an important role in the import of at least a sub-set if not the entire SMN complex.

Figure 2-7: Gemin4 can redirects other members of the SMN complex into the nucleus.

(A-C) HeLa cells were transfected with GFP:Gemin4 and then stained with an antibody against SMN. In transfected cells SMN tends to localizes less in the cytoplasm and more in the nucleus. Arrows indicate cytoplasmic regions. (D) Cells were tranfected with

GFP:Gemin4 and stained with an Unrip antibody. The cytoplasmic signal for Unrip diminishes greatly compared to non-transfected cells; see arrow. Scale bar represents

5µm.

Gemin4 over expression does not perturb Cajal body integrity

The nuclear SMN complex normally localizes to areas of enriched foci, the

Cajal bodies. However exogenous Gemin4 drives cytoplasmic Gemin3 into the nucleoplasm, but fails to concentrate into Cajal bodies. This phenomenon was also seen with SMN in a fraction of the transfected GFP:Gemin4 cells (Figures 2-

6, 2-7). To gauge the effect of Gemin4 over expression on Cajal body structure we transfected cells with GFP:Gemin4 and used an antibody against coilin, the marker protein for Cajal bodies. As seen in Figure 2-8, Cajal body intergrity is maintained in both transfected and non transfected cells alike. These data show that Cajal bodies are not affected by the nuclear localization of GFP:Gemin4.

Figure 2-8: Cajal Bodies are maintained in GFP:Gemin4 expressing Cells. HeLa cells were transfected with GFP:Gemin4 and stained with an antibody directed against the

Cajal body marker, Coilin. Cajal bodies remain in GFP:Gemin4 expressing cells as with non-transfected cells. Scale bar is 5 µm.

59 Discussion

Gemin4 contains a functional NLS in the amino terminus which is essential for the nuclear localization of GFP:Gemin4 observed in transfected HeLa cells.

This NLS was both necessary and sufficient to drive nuclear import of GFP as well. Interestingly, Gemin4’s nuclear localization drastically changed the cellular distribution of its interacting partner, Gemin3, to match that of its own.

Surprisingly, SMN as well as other members of the complex were redirected into the complex when Gemin4 was expressed. These findings suggest a novel

Gemin4 function involved in the nuclear import of the SMN complex.

The SMN complex enters the nucleus during import of newly formed snRNPs and is part of a bipartite nuclear import signal (Narayanan et al. 2004;

Narayanan et al. 2002). Gemin4 may serve as the alternative NLS located in the

SMN complex. Since the NLS describe in Gemin4 is a SV-40 like signal, this would lend to a more convenetional import receptor (importin α) molecule to attach. Thus, Gemin4 may link TMG/Snurportin driven nuclear import with a more common nuclear import pathway. This could be advantageous in two ways. First, Gemin4 truly is part of a bipartite nuclear signal and acts to enhance import of newly formed cytoplasmic snRNPs into the nucleus. Secondly, in the absence of Snurportin driven import, Gemin4 may serve as an alternative nuclear import pathway.

Finally, Gemin4 may only function to drive other members of the complex into the nucleus. In this regard Gemin4 may act as a shuttling factor bringing in needed Gemins into the nucleus from the abundant cytoplasmic pool. However there is the possibility that the nuclear localization of Gemin4 and its interacting partners maybe an artifact of over expression. Endogenous Gemin4 typically

60 localized diffusely through out the cytoplasm and localizes to Cajal bodies within the nucleus (Charroux et al. 2000). So, Gemin4 may only localize to the nucleus when found in a free state as when exogenously expressed. However, over expression of Gemin3 or SMN does not result in the same nuclear pattern as seen with Gemin4. Further investigation into this question will reveal if the NLS found in Gemin4 is of biological relevance.

61 Materials and Methods

Plasmids constructs

A commercially available cDNA library was used to PCR amplify mouse Gemin4 cDNA. The template DNA was later placed into the pEGFP.C2 (Clonetech, accession # U57606) vector. Human and mouse cDNA templates were also cloned into the Gateway pDONR221 (Invitrogen) vector and later transferred to the mammalian expression GFP destination vectors pDEST53 and pDEST47

(Invitrogen). The QuickChange site-directed mutagenesis kit (Stratagene) was used to create the deletion constructs following the manufacturers protocol.

Transfection, microscopy and antibody protocols

Transient transfection of HeLa cells was carried out using the Effectene transfection kit (Qiagen) following the recommended protocol of the manufacturer. Cells were seeded on two-well glass slides and grown in an incubator at 37° C with 5% CO2 in DMEM supplemented with 10% BSA and 1%

Penicillin/Streptomycin. Cells were fixed in 4% PFA, 1% Triton-X 100 in 1X PBS solution for 20 minutes at RT followed by 3 consecutive washes in 1X PBS for 5 minutes at RT. Standard IF protocols were used to stain HeLa cells. Antibodies used are as follows: anti-SMN mAb (clone 8, BD biosciences, 1:200), anti- dp103/Gemin3 mAb (clone 2, BD biosciences, 1:200), anti-Coilin pAb (R124,

1:400), anti-Gemin5 mAb (4G7, 1:10), anti-Gemin7 mAb (1:10), anti-Unrip mAb

(3G6, 1:10), Alexa 594 goat anti-mouse 2° antibody was used. All images were taken on a Leica TCS SP5 high speed and high resolution spectral confocal

62 microscope. Images were taken within a single plane with an objective of 63X with 3X zoom factor.

63 CHAPTER III

Characterization of Gemin4 loss-of-function in Mus musculus*

Michael P. Walker1,2 and A. Gregory Matera1,2

1Department of Genetics, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4955

2Department of Biology, Program in Molecular Biology & Biotechnology, Lineberger Comprehensive Cancer Center University of North Carolina, Chapel Hill, NC 27599-3280

* This chapter is a manuscript currently in preparation.

64 Abstract

Gemin4 is an integral member of the Survival motor neurons (SMN) complex. The most well characterized function of the SMN complex is its essential role in U snRNP biogenesis. Importantly, mutations in SMN, a core member of the complex, leads to spinal muscular atrophy (SMA), which is a significant genetic cause of infant mortality. While much attention has been placed on the disease gene product, SMN, specific roles for other members of the

SMN complex, the Gemins, are only now beginning to be investigated. We set out to create a loss-of-function for Gemin4 in the mouse to delineate its function and to assess its role, if any, in the SMA phenotype. We obtained an ES cell line with a gene-trap cassette that rendered Gemin4 functionally null. A mouse line was created from these cells and the viability of Gemin4 mice as well as a genetic interaction between Smn and Gemin4 was analyzed. Here we report that Gemin4 null mice die early in embryonic development. Also, Gemin4 heterozygous mice are phenotypically indistinguishable from wild type mice. These mice fail to modify the early infant mortality phenotype when crossed onto a SMA type 1 genetic background, which has the mouse Smn gene removed and replaced with the human SMN2 gene. Surprisingly, we found that different inbred genetic backgrounds had drastic effects on the viability of Smn mutant mice, indicating an unknown modifier(s) that is important in SMA pathology. These findings demonstrate that Gemin4 is an essential gene and indicates that Gemin4 plays a pivotal role in SMN complex function.

65 Introduction

Spinal muscular atrophy (SMA) is a devastating childhood disorder that afflicts 1 in 10,000 children born. It is characterized by loss of motor neurons in the lower anterior horn, which leads to atrophy of the associated muscles and eventual paralysis of the proximal limbs (Wirth et al. 2006). There are four clinical forms, types I, II, III and IV with type I being the most severe (Zerres et al. 1997). Currently there is no known cure for SMA, but studies into the disease gene survival of motor neurons 1(SMN1) and it’s paralog SMN2 has lead to a better understanding of the molecular mechanisms involved (Daniels et al. 1995;

Lorson et al. 1999; Monani et al. 1999; Rodrigues et al. 1995; Wirth et al. 1995).

It is not understood how a protein involved in a “house-keeping” function such as U snRNP biogenesis afflicts only a small subset of tissues, muscle and motor neurons. This problem has manifested itself into two competing hypotheses to explain the phenomenon. Either SMN has a separate function within these tissues or these tissues themselves are highly sensitive to perturbations in U snRNP assembly. While reduction of functional SMN is the root cause of SMA the protein itself is known to reside in a multi-subunit particle, the SMN complex, with eight other known proteins, Gemins2-8 and

Unrip (Briese et al. 2005; Eggert et al. 2006; Kolb et al. 2007; Monani 2005;

Pellizzoni 2007; Sumner 2007). To this end, knockout mice of Smn and other members of the Smn complex have been created to study SMA pathology.

Smn knockouts are early embryonic lethal, because mice, like most other vertebrates contain only a single copy of Smn gene (Bertrandy et al. 1999;

DiDonato et al. 1997; Hannus et al. 2000; Hsieh-Li et al. 2000; Lorson et al. 2008b;

Miguel-Aliaga et al. 2000; Monani et al. 2000b; Owen et al. 2000; Paushkin et al.

66 2000). However, addition of the human SMN2 transgene is sufficient to rescue the embryonic lethality and recapitulate the SMA phenotype (Hsieh-Li et al.

2000; Monani et al. 2000b). Unlike SMN, the Gemins all occur as a single copy and knock out mice of these genes reveal that they’re essential. Gemin2 -/- embryos die shortly after implantation of the blastocyst (Jablonka et al. 2002).

The heterozygous mice express 50% of Gemin2 and 35% when double heterozygous for Smn and Gemin2; these mice exacerbate the SMA type III phenotype (Jablonka et al. 2002). In contrast, both Smn and Gemin3 knockouts die pre-implantation. Smn heterozygotes phenocopy SMA type III while Gemin3 heterozygotes appear phenotypically normal, but females display a mild ovarian morphology phenotype (Monani et al. 2000b; Mouillet et al. 2008). While these studies address SMA pathology and/or unique organismal phenotypes biochemical analysis of the SMN complex as a whole has delineated some functions of the individual components.

The SMN complex is responsible for the ordered assembly of a common heptomeric Sm ring onto the snRNA during snRNP biogenesis and involved in nuclear import of newly formed snRNPs (Meister et al. 2001a; Narayanan et al.

2004; Pellizzoni et al. 2002b). Much emphasis has been placed on the research of

SMN, which has revealed many aspects of its role in this process, as well as other functions, but less in known about the function(s) of the Gemins. Knock down studies of SMN and the Gemins reveal their importance in core assembly (Feng et al. 2005; Shpargel et al. 2008; Wan et al. 2005). SMN and Gemin2 form the core of the complex and are thought to be the primordial proteins in the evolution of the complex (Kroiss et al. 2008). Higher metazoans have acquired more Gemin proteins over time and details into their roles in snRNP assembly are only now

67 beginning to be ascertained. Gemin 3/dp103/Ddx20 is a DEAD box RNA helicase of which helicase activity has been verified in vitro (Yan et al. 2003).

Gemin5 plays a more peripheral role in the complex by delivering the snRNA into the SMN complex (Battle et al. 2007; Battle et al. 2006). Gemins 6 and 7 are thought to act as scaffolding intermediates in the assembly of the Sm ring (Battle et al. 2007; Leung and Nagai 2005; Ma et al. 2005). Gemin8 acts as a bridge for the Gemin6 and 7 heterodimer complex with unrip, bringing this module to the rest of the SMN complex via interacting directly with SMN (Carissimi et al.

2006b). More studies into the function(s) of Gemins 2-8 and unrip will surely expand the current knowledge of snRNP biology and SMA etiology.

Gemin4 was first discovered by biochemical analysis of the SMN complex in

HeLa cells (Charroux et al. 2000). There are currently three known functional motifs within Gemin4, a leucine zipper found in the carboxy terminal half, the galectin interacting domain also located in the carboxy terminus, and a nuclear localization signal found in the amino terminus (Di et al. 2003; Lorson et al.

2008a; Park et al. 2001). The leucine zipper is important for interactions with five zinc finger proteins one of which, NDP52 (nuclear dot protein 52), interacts strongly with Gemin4 (Di et al. 2003). The last 50 aa residues are important for interactions with two galectins (Galectin 1 and 3) involved in splicing (Park et al.

2001). Within the SMN complex Gemin4 interacts directly with its binding partner Gemin3 and SmB of the heptomeric ring (Charroux et al. 2000). Gemin3 directly interacts with SMN within the core and tethers Gemin4 to the complex.

More recently it has been determined that Gemin4 also interacts with itself, and

Gemin8 (Otter et al. 2007). Gemins3, 4 and the argonaut protein eIF2C2 are also found in a separate complex, the microRNP complex, which has demonstrated

68 RISC activity in vitro (Dostie et al. 2003; Hutvagner and Zamore 2002; Nelson et al. 2004). The majority of the Gemin4 protein, like most of the Gemins, shows no known homology in the proteosome, which has made determining its function(s) challenging.

Here we report the creation and characterization of a loss-of-function

Gemin4 mouse and its genetic interaction on a SMA type-1 background. Gemin4 -

/- mice are embryonic lethal as none were observed at birth or mid to late gestation periods. However, Gemin4 +/- mice are phenotypically wild type and do not modify the SMA phenotype. The Gemin4 +/- genotype was brought onto three separate genetic strains of Smn -/-;SMN2 +/+ mice. Mating pairs of these different genetic backgrounds were first tested to see if they were capable of producing live SMA type-1 mice. Interestingly, Smn -/-;SMN2 +/+ mice on the

C57BL/6J or mixed C57BL/67;129X1/SvJ genetic backgrounds were unable to escape embryonic lethality, but the same mice on the FVB/NJ background were observed at birth and displayed typical SMA type-1 like phenotypes (Monani et al. 2000a). We conclude that Gemin4 is an essential gene needed for life.

Results

69 Gemin4 gene trap insertion.

We obtained mouse ES cells (Lexicon Genetics) that have a retroviral gene trap insertion in the single Gemin4 intron. This gene trap is derived from an engineered retroviral cassette that preferentially inserts itself into upstream introns within the mouse genome. The genomic organization of Gemin4 is ideal for this gene-trapping scheme because there is only one intron within the gene.

The upstream exon (exon 1) is relatively short while exon 2 contains the vast majority of the coding sequence. The gene-trap contains an upstream element consisting of a 5’ splice acceptor site fused to a neo cassette with a termination sequence downstream, this element hijacks the upstream exon 1 of Gemin4 that encodes only three residues of the polypeptide. The downstream element hijacks the remaining exon 2. The downstream element contains its own PGK promoter and puromycin cassette that has stop codons introduced in all three reading frames downstream of the cassette. There is a splice donor site that fuses this transcript with exon 2 (Figure 3-1A). Blastocysts that harbor the mutant ES cells were injected into a pseudopregnant female resulting in four chimera males of which two mice displayed germ line transmission of the gene-trap as ascertained by PCR genotyping of the founder progeny (Figure 3-1A,B). Founder mice were backcrossed three generations onto the C57BL/6J genetic background.

Figure 3-1: Characterization of Gemin4 gene trap. Retroviral insertion of the gene trap into the single intron of murine Gemin4 creates an up stream transcript that incorporates exon 1, which only encodes three residues, with a neo cassette and exon 2 becomes trapped with a puromyicin cassette upstream that has stop codons introduced in all three reading frames just upstream of the exonic sequence (A). Verification of germ-line transmission was observed from two of four chimeric males mated with a wild-type female (B).

Gemin4 is essential for life

Heterozygous males and heterozygous females were intercrossed to each other and the resulting offspring were PCR genotyped (Figure 3-1A). While heterozygous and wild type progeny were readily detected in the P1, E13, E8 and

E6 mice no Gemin4 -/- mutants were detected at any of these time points (Table 3-

71 1 and data not shown). This finding was not surprising in that other snRNP biogenesis knock out models as well as SMN mice display an early embryonic lethality (Gangwani et al. 2005; Hsieh-Li et al. 2000; Jablonka et al. 2002; Monani et al. 2000b). Thus, Gemin4 -/- mice are dying early in embryonic development indicating that Gemin4 is essential for life.

Table 3-1: Gemin4 is essential in the mouse. Gemin4 heterozygotes were intercrossed and the genotypes of F1 progeny (from heterozygous parents that were back crossed 3 generations) at P1, E13 and E8 were analyzed by PCR genotyping (refer to Figure 3-1A for primer design).

Heterozygous mice are unable to modify the SMA phenotype

We sought to bring the Gemin4 gene trap mouse onto the SMA type1 genetic background, Smn -/-;SMN2+/+. However, we initially were surprised by the observation that Smn -/-;SMN2 +/+ mice were obtainable only in a specicific inbred strain. Smn -/-;SMN2 +/+ mice were never observed on the C57BL/6J or a mixed C57BL/6J;129X1/SvJ genetic background, but were found in expected numbers on the FVB/NJ background (Table 3-2).

Table 3-2: Genetic background contribution to the SMA phenotype. Mice that were on pure C57BL/6J and FVB/NJ inbred strain (backcrossed more than 10 generations) or mixed C57BL/6J;129X1/SvJ background were PCR genotyped to determine the number of SMA type 1-like mice produced.

Gemin4 heterozygotes were initially crossed with Smn -/+;SMN2 +/+ mice in order to obtain Gemin4 -/+;Smn -/+;SMN2 + progeny, these mice are hemizygous for the human SMN2 transgene . These mice were then intercrossed to obtain

Gemin4 -/+; Smn -/+;SMN2 +/+ (from here out the SMN2+/+ is omitted) mice.

This was done to ensure SMA type 1 mice will survive the gestation period since mice hemizygous for SMN2 fail to rescue embryonic lethality (personal communication and data not shown). As seen in Table 3-3 SMA type1 mice are found in expected numbers regardless if wild type or heterozygous for Gemin4.

This failure to exacerbate or ameliorate the early lethality phenotype was puzzling considering the fact that both Gemin2 and Gemin3 mice produce half the protein levels as their wild type littermates and have associated phenotypes as a result (Jablonka et al. 2002; Mouillet et al. 2008).

Table 3-3: Gemin4 heterozygotes do not modify the SMA early lethality phenotype.

Parental mice with the genotype of Gemin4 +/-;Smn+/-;SMN2+/+ were intercrossed and the resulting progeny were PCR genotyped to look for SMA type 1-like mice that were either wild type or heterozygous for Gemin4.

We next examined the protein expression profile of Gemin4 in various tissues.

Gemin4 is found at various levels in all the tissues we examined, with high abundance in liver, kidney and skeletal muscle tissues (Figure 3-2 and data not shown). We then looked at the transcriptional and translation levels of Gemin4 heterozygous and wild type mice to determine if there was difference in overall

Gemin4 levels. Wild type adult and neonatal mice expressed approximately two fold more Gemin4 mRNA than their heterozygous litter mates (Figure 3-3A).

However, protein levels from these animals were consistently the same (Figure 3-

3B). Thus, Gemin4 heterozygous mice appear phenotypically identical to wild type mice and as a result are unable to modify any SMA phenotypes.

Figure 3-2: Gemin4 expression in organ tissues: Protein lysates from various tissues were used for western blot analysis of Gemin4 expression. Detection of α-tubulin was used as a loading control.

Figure 3-3: Gemin4 heterozygous expression profile. RNA was isolated from liver tissue of P4 Gemin4 -/+ and Gemin4 +/+ mice and semi-quantitative RT-PCR analysis was performed; 40 cycles was used as this was the optimal cycle number for analysis of

Gemin4 transcripts (A). Western analysis of lysates from liver was used to determined protein levels of Gemin4 in wild type and heterozygous animals. Detection of α-tubulin was used as a loading control (B).

75 Discussion

Our data clearly demonstrate that Gemin4 is an essential gene. Importantly, null mutations in Smn, Gemins 2 and 3 are all embryonic lethal demonstrating that these genes are also essential (Hsieh-Li et al. 2000; Jablonka et al. 2002;

Monani et al. 2000b; Mouillet et al. 2008). Gemin 4 is known to reside in two important macromolecular structures, the SMN and microRNP complexes

(Charroux et al. 2000; Hutvagner and Zamore 2002; Mourelatos et al. 2002). U snRNP biogenesis is an essential process that ensures required splicing factors are available for pre-mRNA splicing. Previous knock down experiments revealed that greater than 50% reduction in levels of Gemin4 causes an intermediate yet significant loss of U snRNP assembly in a HeLa cell culture system (Shpargel and

Matera 2005). Also, Gemin4’s close interacting partner in the SMN complex,

Gemin3, when knocked down has a moderate yet significant effect on U snRNP assembly (Shpargel and Matera 2005). This moderate effect is not detrimental to the cell as cell death was not reported as a phenotype in the knock down experiments. These observations suggest that levels of Gemin4 and Gemin3 may be dispensable when it comes to basal levels of U snRNPs needed for cells in culture. However, during mammalian development U snRNA and snRNP levels increase dramatically from the 2-16 cell stage to the blastocyst stage (Dean et al.

1989; Lobo et al. 1988). The SMN complex would most likely need to operate at peak efficiency for the high increase in U snRNP production during these critical stages of development and the full compliment of Gemin4 may be required to stabilize the complex or directly aid in assembly of snRNPs. This idea is bolstered by the fact that we see no Gemin4 null embryos in mid or late pregnancy and for the fact that Smn, Gemin2 and Gemin3 null embryos do not

76 survive past the blastocyst stage (Hsieh-Li et al. 2000; Jablonka et al. 2002;

Monani et al. 2000b; Mouillet et al. 2008).

Gemin4 is also found in the proposed mammalian miRNP complex. miRNPs house miRNAs which are thought to involved in a wide range of gene regulatory roles, including developmental stages by post-transcriptional mRNA cleavage or translational repression (Singh et al. 2008). The miRNAs target certain mRNAs in ES cells to precisely control mammalian development. The miRNP is a small 15S particle only known to consist of Gemins 3, 4, eIF2C2 and miRNA (Hutvagner and Zamore 2002; Mourelatos et al. 2002; Nelson et al. 2004).

Since so relatively few proteins make up the miRNP it is likely that removal of any the its members would render the complex non-functional and since Gemin4 is not known to have a paralog or redundant equivalent it is reasonable to assume loss of its function would be detrimental to miRNP function.

In summary we have shown that Gemin4 is required for life. No such mice were observed throughout gestation or at birth. Also, SMA type-1 embryos can only survive to birth on the FVB-NJ genetic background, suggesting a modifier gene(s) is important in this inbred strain. Finally, we show that heterozygous

Gemin4 mice produce phenotypically normal levels of the protein levels.

77 Materials and Methods

Mouse lines and crosses

Transgenic mice were created on FVB/NJ, C57BL/6J and 129 genetic backgrounds; these mice were used throughout the study. FVB.Cg-

Tg(SMN2)89Ahmb Smntm1Msd/J mice carrying the SMA allele were obtained from the Jackson Laboratory. Gemin4 mice were created by purchasing ES cells with the Gemin4 gene-trap cassette from Lexicon genetics and these cells were injected into a donor blastocyst, this was subsequently injected into a pseudopregnant female mouse by the Case transgenenic facility. All strains were maintained on a standard diet of 50/10 food pellets and sterile water. These mice were housed in micro-isolation chambers. Breeding pairs for SMA type 1 mice consisted of mice that were homozygous for the transgene and heterozygous for the knockout allele, which resulted in pups that display the

SMA phenotype and control littermates. Breeding pairs for Gemin4 mice were heterozygous for the gene trap cassette. All mice were humanely euthanized according to protocols set forth by the Institutional Animal Care and Use

Committee (IACUC), CWRU Animal Resource Center (ARC) and UNC Division of Laboratory Animal Medicine (DLAM) standards.

Genotyping and RT-PCR

Tail clippings from the tip of approximately 3 mm were collected from mice and used for DNA extraction (Roche, High Pure PCR Template Preparation Kit) according to manufacturers protocols. The genotyping primers for Gemin4 genetrap (G4GT) are as follows; LTR:F-

AAATGGCGTTACTTAAGCTAGCTTGC, G4GT:F-

GGAGCGAATATAGCCTTGATTCTCTGGAAATG, G4GT:R-

78 CTTCCCAGGACGGCCTCCTAGTCTTACCCTCTA. The genotyping primers for the murine Smn Neo cassette are as follows; neostop:F-

TCGCCTTCTTGACGAGTTCTTCTG, Smn:F-

AGGATCTCTGTGTTCGTGCGTGGTG, Smn:R-

CCTTAAAGGAAGCCACAGCTTTATC. Dr. Cathleen Lutz of the Jackson

Laboratory graciously supplied the primer sequences for the SMN2 transgene.

PCR amplification was performed using standard protocols. Total RNA was isolated from mouse tissues using Trizol reagent (Invitrogen) following the manufactures protocol. RT-PCR analysis was performed using the OneStep RT-

PCR kit (Qiagen) according to the manufacture’s protocols. Primers used were as follows Gemin4exon1:F-CAGACTACAGCACGGAAGCGGAG,

Gemin4exon2:R-CTAAGCAGTTGGTGGTGCAGGATG.

Western Analysis

Protein lysates were prepared by flash freezing mouse tissues in liquid nitrogen then crushing the tissue into a fine powder. This powder was then transferred to a gentle binding buffer, homogenized and centrifuged at max speed at 4° C for 10 min. Supernatants were quantified using a standard Bradford assay protocol.

The MOPs/NuPage gel system (Invitrogen) was used to run the protein samples following the recommended protocol of the manufacturer. Lanes were transferred to nitrocellulose membranes and incubated with appropriate antibodies using standard protocols. Detection of the protein bands was achieved using standard chemiluminescence substrates.

CHAPTER IV

The SMN complex localizes to the sarcomeric Z-disc and is a proteolytic target of calpain

Michael P. Walker1,2, T.K. Rajendra2 , Luciano Saieva3, Jennifer L.

Fuentes2, Livio Pellizzoni3, and A. Gregory Matera1,2

1Department of Genetics, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4955

2Department of Biology, Program in Molecular Biology & Biotechnology, Lineberger Comprehensive Cancer Center University of North Carolina, Chapel Hill, NC 27599-3280

3Center for Motor Neuron Biology and Disease, Department of Pathology and Cell Biology, Columbia University Medical Center, New York, NY 10032, USA

*Address correspondence to: A. Gregory Matera Department of Biology University of North Carolina 415 Fordham Hall, CB#3280 Chapel Hill, NC 27599-3280 Tel: (919) 962-2770 e-mail: [email protected]

*This chapter has been published: Hum Mol Genet. 2008 Nov 1;17(21):3399-410

80 Abstract

Spinal Muscular Atrophy (SMA) is a recessive neuromuscular disease caused by mutations in the human Survival Motor Neurons 1 (SMN1) gene. The human

SMN protein is part of a large macromolecular complex involved in the biogenesis of small ribonucleoproteins. Previously, we showed that SMN is a sarcomeric protein in flies and mice. In this report, we show that the entire mouse Smn complex localizes to the sarcomeric Z-disc. Smn colocalizes with α- actinin, a Z-disc marker protein, in both skeletal and cardiac myofibrils.

Furthermore, this localization is both calcium- and calpain-dependent. Calpains are known to release proteins from various regions of the sarcomere as part of the normal functioning of the muscle, however, this removal can be either direct or indirect. Using mammalian cell lysates, purified native SMN complexes, as well as recombinant SMN protein, we show that SMN is a direct target of calpain cleavage. Finally, myofibers from a mouse model of severe SMA, but not controls, display morphological defects that are consistent with a Z-disc deficiency. These results support the view that the SMN complex performs a muscle-specific function at the Z-discs.

81 Introduction

Loss-of-function mutations in the human survival motor neurons 1 (SMN1) gene result in spinal muscular atrophy (SMA), a devastating neuromuscular disorder. SMN1 is currently the only gene known to cause SMA, however, roughly 4% of the cases are unlinked to this locus (Wirth et al. 2006). SMN protein is predominantly found as part of a large macromolecular complex, consisting of nine different proteins: SMN, Gemins2-8 and UNRIP/STRAP (Kolb et al. 2007; Pellizzoni 2007). SMN is involved in essential housekeeping functions as well as tissue-specific ones (Briese et al. 2005; Eggert et al. 2006; Monani 2005;

Sumner 2007). These include biogenesis of small nuclear ribonucleoproteins

(snRNPs), transcription, pre-mRNA splicing, axonal mRNA transport, neurite outgrowth, neuromuscular junction formation, myoblast fusion and myofibrillogenesis (Arnold et al. 2004; Carrel et al. 2006; Chan et al. 2003; Dundr et al. 2004; Fan and Simard 2002; McWhorter et al. 2003; Meister et al. 2001a;

Mourelatos et al. 2002; Pellizzoni et al. 2002b; Rajendra et al. 2007; Rossoll et al.

2003; Shafey et al. 2005; Sharma et al. 2005; Shpargel and Matera 2005; van

Bergeijk et al. 2007; Yong et al. 2004; Zhang et al. 2006). A common theme among many of these processes is the actin cytoskeleton, however, the molecular details by which loss of SMN function results in SMA are not known.

Although a majority of studies have focused on roles for SMN in motoneurons, SMA patients display a pattern of muscle weakness that is more reminiscent of a myopathic disorder than a neurogenic one (Sumner 2007). SMN- depleted myoblasts from humans and mice show marked defects in fusion and proliferation (Arnold et al. 2004; Shafey et al. 2005). Moreover, co-cultures of

SMA patient-derived muscle cells with wild-type motoneurons revealed that

82 SMN is required for maintaining stable innervation (Braun et al. 1995; Guettier-

Sigrist et al. 2002). Tissue-specific knockouts of Smn in mouse muscles caused pronouced dystrophic phenotypes (Cifuentes-Diaz et al. 2001; Nicole et al. 2003).

Thus SMA might not be a cell-autonomous disease; the observed motor defects in SMA patients could be caused by primary abnormalities in both muscles and motoneurons, or perhaps due to a failure of communication between these two tissues. Indeed, SMA has recently been described as a neuromuscular junction synaptopathy (Kariya et al. 2008). Clearly, a better understanding of SMN’s role(s) in muscle cell function will help to distinguish among these possibilities.

Muscle fibers (myofibers) are composed of bundles of contractile filaments, termed myofibrils. At the ultrastructural level, each myofibril consists of hundreds of individual contractile units, called sarcomeres. Sarcomeres work in tandem to produce the mechanical force of muscle contraction. Within each sarcomere is an actin-rich I-band that is bisected by the Z-disc (or Z-line) and a myosin-rich A-band that is bisected by the M-line (Clark et al. 2002). The boundaries of each sarcomere are defined by the Z-discs, which function to interlock adjacent sarcomeres and to anchor the actin-rich thin filaments.

Myofibrillar dynamics at the Z-discs and overall muscle maintenance are regulated by two distinct proteolytic pathways, the calcium-dependent calpain system and the ubiquitin proteasome system (Bartoli and Richard 2005; Nury et al. 2007). Disruptions within both of these proteolytic pathways have been linked to a number of muscular disorders (Abu-Baker et al. 2003; Richard et al.

1995; Tagawa et al. 2000; Wang and Maldonado 2006).

83 The ubiquitin proteasome is the principal pathway involved in muscle growth, remodeling and atrophy (Jagoe and Goldberg 2001; Taillandier et al.

1996). Although the proteasome is the final degradative mechanism utilized by muscle during wasting, it is clear that additional proteolytic systems operate upstream to disassemble the sarcomere, as proteasomes are not able to degrade intact myofibrils (Solomon and Goldberg 1996). Calpain-mediated proteolysis is important in this regard, and this pathway also contributes to muscle protein breakdown and remodeling under catabolic conditions (Gissel 2005; Hasselgren and Fischer 2001; Taillandier et al. 1996). Thus calpains are calcium-dependent proteases that act upstream of the proteasome to release proteins from the myofibrillar Z-disc (Goll et al. 2008; Hasselgren and Fischer 2001; Kramerova et al. 2005).

We recently reported that reduced expression of dSMN within the adult

Drosophila thorax results in severe neuromuscular dysfunction, with prominent myofibrillogenesis defects (Rajendra et al. 2007). Surprisingly, we found that

SMN is a sarcomeric protein that forms a complex with α-actinin and colocalizes at the Z-discs of both Drosophila and mouse myofibrils. Here, we show that the entire Smn complex localizes to the Z-discs of wild-type mouse myofibrils.

Furthermore, Smn is present at the Z-disc in both skeletal and cardiac muscles and, interestingly, this localization is both calcium- and calpain-dependent. In accordance with the view that calpains regulate Z-disc protein turnover (Bartoli and Richard 2005), we also demonstrate that Smn is a direct target of calpain cleavage in vitro and in vivo. Importantly, myofibers from a mouse model of

SMA, but not controls, display morphological defects that are consistent with a

Z-disc deficiency. Taken together with the fact that calpains are regulatory

84 proteases with functions in diverse cell types, the results have direct implications not only for muscle-specific functions of SMN but also for neuronal ones as well.

85 Results

Smn localization in striated muscle

Previously, we showed that Smn localizes to the sarcomeres of native Drosophila and purified mouse striated muscle myofibrils (Rajendra et al. 2007). Although there was some variability in the anti-dSMN staining patterns of the native

Drosophila myofibrils (i.e. those that are mechanically teased apart), the more highly purified mouse myofibrils (see Methods) showed exclusive Z-disc anti-

Smn staining (Rajendra et al. 2007). We therefore investigated the distribution of

Smn in native myofibers and purified myofibrils from wildtype mice (Figure 4-

1). Similar to the situation in Drosophila, we observed two different patterns of

Smn staining in the native mouse fibers: granular and striated (Figure 4-1A,B). In the majority of muscle fibers, the granular staining pattern was predominant

(Figure 4-1A), whereas in a subset of fibers, a more striated pattern was revealed

(Fig 4-1B). A significant amount of diffuse Smn signal was overlaid upon both of the patterns (Figure 4-1A,B). We hypothesized that the diffuse and granular staining was primarily due to sarcoplasmic signal and that removal of this material would allow better visualization of the sarcomeric Smn protein.

Consistent with this interpretation, Smn was found to localize in a distinctly striated pattern throughout the length of the myofibrils following the purification procedure (Figure 4-1C). Importantly, western blot analysis (Figure.

4-1D) demonstrated the presence of Smn in purified myofibrils and confirmed the specificity of the Smn signal observed by immunostaining. Thus, Smn localizes in a sarcomeric pattern on mouse skeletal muscle myofibrils.

Figure 4-1: Smn localizes to skeletal myofibrils. Mouse muscle fiber preps and purified myofibrils were subjected to immunofluorescence imaging (average projection with a z- stack of 13 at 0.5 µm per section) or western analysis. Antibodies against Smn were used to stain muscle fibers (A,B) and purified myofibrils (C); scale bar represents 10 µm.

The presence of Smn was verified by western blot of whole muscle lysate and purified myofibrils (D).

87 The Z-disc, which marks the boundary of each sarcomere, is composed of many different components, several of which localize to multiple subsarcomeric compartments (Lange et al. 2006). Thus we wanted to determine whether Smn colocalized with other known Z-disc proteins. α-actinin plays an important role in the sarcomere as an actin filament cross-linker and is often used as a Z-disc marker. Because we previously observed that Smn colocalizes with α-actinin in mouse skeletal muscle myofibrils (Rajendra et al. 2007), we tested whether this colocalization also occurs in cardiac myofibrils, especially given the fact that both acute and chronic SMA patients are reported to have cardiac problems (see

Discussion). As shown in Figure 4-2, Smn colocalizes with α-actinin in purified myofibrils from both skeletal and cardiac muscles. We conclude that Smn localization to the Z-disc of striated muscles is a conserved feature among metazoans.

Figure 4-2: Smn localizes to the Z-disks of striated muscle. Purified myofibrils from skeletal and cardiac muscle were co-stained with antibodies against Smn and the Z-disk

88 protein α-actinin; the scale bar for skeletal myofibrils is 10 µm and 5 µm for cardiac myofibrils.

The Smn complex is a component of the Z-disc

Smn forms a large, oligomeric complex with at least eight other binding partners, collectively known as Gemins (Gabanella et al. 2007; Kolb et al. 2007). In order to determine whether Smn was present in the sarcomere as part of a larger complex, we investigated the sarcomeric localization of Gemins 2, 3, 4, 5, 6 and 8, as well as that of Unrip, another integral member of the Smn complex (Baccon et al. 2002; Carissimi et al. 2005; Carissimi et al. 2006a; Charroux et al. 1999;

Charroux et al. 2000; Grimmler et al. 2005b; Gubitz et al. 2002; Liu et al. 1997;

Pellizzoni et al. 2002a). Each of the Gemins we tested, with the possible exception of Gemin5, colocalized precisely with Smn in skeletal muscle myofibrils (Figure 4-3 and data not shown). Although it was certainly detectable, the Gemin5 staining was weaker than that of the other Gemins (data not shown).

Furthermore, consistent with the cytoplasmic origin of the myofibril, we found that Unrip, a protein that copurifies with the Smn complex preferentially in the cytoplasm of other cell types (Carissimi et al. 2005; Grimmler et al. 2005a) also colocalized with Smn at the Z-disc (Figure 3). Thus the entire cytoplasmic Smn complex is part of the sarcomeric Z-disc ensemble.

Figure 4-3: The Smn complex is present at Z-Disks. Purified mouse hindlimb skeletal myofibrils were co-stained with antibodies against Smn and Gemins 2,3,4,6 and 8.

Because the anti-human Gemin3 antibody does not cross-react with mouse, but does cross-react with the hamster protein

(http://www.abcam.com/index.html?datasheet=10305 ), purified myofibrils from hamster hindlimb were used for the Gemin 3 panel. Scale bar represents 5 µm.

U snRNPs do not localize to sarcomeres

The function of the Smn complex in cytoplasmic assembly and nuclear import of

Sm-class snRNPs is well documented (Grimmler et al. 2005a; Meister et al. 2001a;

Narayanan et al. 2004; Pellizzoni et al. 2002b; Shpargel and Matera 2005).

However, Sm-class snRNPs are not thought to be part of the muscle myofibril.

To confirm the absence of splicing snRNPs from the myofibril preparations, we used three markers: U2B′′, a protein specific to the U2 snRNP, SmB, a member of

90 the spliceosomal Sm core, and the trimethylguanosine (TMG) cap, a structure common to all mature Sm-class snRNPs. Antibodies targeting a non-muscle protein, neurofilament-L, were used as a negative control; actin (visualized by phalloidin) was used as a positve control. When purified skeletal muscle myofibrils were probed using antibodies targeting these markers, no specific signals were detected (Figure 4-4A-D). These findings are therefore most consistent with a function for sarcomeric Smn that is muscle-specific and not related to its role in spliceosomal snRNP biogenesis.

Figure 4-4: U snRNPs do not localize to myofibrils. Purified skeletal myofibrils were co- stained with an antibody against the U2 specific protein, U2B′′, an antibody specific to a member of the Sm core ring, SmB, and an antibody specific to the U snRNPs trimethyl cap, TMG (A-C). The myofibrils were counter stained with phaloidin conjugated with

FITC. A negative control antibody (Neurofilament-L) was also used on purified myofibrils

( D); scale bars represent 10 µm.

91 Smn is removed from myofibrils by calcium or calpain treatment

Calpains are thought to be regulatory proteases (as opposed to degradative ones) and are essential for numerous cellular processes in virtually every tissue in the body, including muscle (Goll et al. 2003; Stockholm et al. 2005; Wu and Lynch

2006). The ubiquitous calpains 1 and 2, as well as the muscle-specific isoform, calpain 3, are involved in aspects of muscle maintenance, including myofibril degeneration and sarcomeric remodeling (Bartoli and Richard 2005; Duguez et al. 2006; Goll et al. 2008). Increasing the endogenous calpain activity with calcium is known to trigger disassemby of the sarcomere, including removal of Z-disc proteins such as α-actinin (Busch et al. 1972; Dayton et al. 1976a; Dayton et al.

1976b; Goll et al. 1991). To test whether Smn could be removed by these procedures, muscle tissue was incubated overnight in Ringer’s buffer that contained either 10 mM Ca++ or 1 mM EGTA (control). Myofibrils were then purified by standard procedures and analyzed by fluorescence microscopy. As shown in Figure 4-5A (upper panels), the control myofibrils remained intact, as visualized by Z-disc staining with Smn or α-actinin. The calcium-treated preparations showed loss of the signals for both Smn and α-actinin (Figure 4-5A, lower panels).

Although suggestive of calpain activity, the above results demonstrate that endogenous proteases are responsible for the removal of Smn and α-actinin from the Z-disc. In order to test whether calpain activity is required, we purified myofibrils under standard conditions and then treated them with or without exogenous calpain for 20 minutes at room temperature. Figure 4-5B clearly

92 shows that calpain treatment removed Smn from the Z-discs, leaving the myofibrils intact (as evidenced by the actin counterstain).

Figure 4-5: Calpain activity removes Smn from myofibrils. Increased endogenous calpain activity was indirectly assessed by incubating skeletal muscle tissue either in a buffer with calcium, which activates calpain, or lacking calcium; purified myofibrils were either stained with antibodies against Smn or α-actinin as a positive control (A).

Exogenous calpain 1 was either added or not added to purified skeletal myofibrils and co-stained with antibodies against Smn and conjugated phaloidin (B); the scale bars are set at 10 µm.

Smn is a direct target of calpain-mediated proteolytic cleavage

Calpains can remove Z-disc proteins from myofibrils either by direct cleavage of the target protein or indirectly by cleavage of an interacting partner. For example, calpain treatment of myofibrils is known to remove α-actinin from the

Z-disc, but calpains do not directly target skeletal muscle α-actinin for cleavage

(Goll et al. 1991). We therefore assayed whether SMN was a direct target of

93 calpain. We incubated purified native human SMN complexes or recombinant

SMN/Gemin2 heterodimers in the presence or absence of calpain and analyzed the cleavage products by western blotting with N- and C-terminal specific anti-

SMN monoclonal antibodies. As shown in Figure 4-6, a ~28 kD N-terminal SMN cleavage product and a ~10 kD C-terminal product were detected only upon addition of calpain. The N-terminal fragments were visualized using a commercial anti-SMN monoclonal antibody (Clone 8, BD Biosciences) that recognizes residues mapping within human exon 2B, whereas the C-terminal fragments were detected using a monoclonal antibody (mAb 9F2) that recognizes residues near the polyproline motif in exon 5 (Figure 4-7 and L. Pellizzoni, unpublished results). Notably, GST-Gemin2, which was co-expressed in the bacteria expressing His-SMN, was unaffected by the calpain treatment (Fig. 6).

Similarly, native Gemin2 was also uncleaved when purified SMN complexes were treated with calpain (Figure 4-6). We conclude that calpain is necessary and sufficient for cleavage of SMN in vitro.

Figure 6: Calpain directly cleaves SMN in vitro. To verify that calpain cleaves SMN and does not work upstream of other potential proteases, purified SMN complexes and recombinant His:SMN/GST:Gemin2 heterodimers were incubated with either 0.06 U and

0.15 U of calpain, respectively. Antibodies recognizing the N and C-terminus of SMN were used to grossly map the area of cleavage within the SMN peptide.

Figure 4-7: Characterization of a novel anti-SMN monoclonal antibody 9F2. Hela lysate was run on a polyacrylamide gel under denaturing conditions and the resulting blot was probed with the 9F2 antibody and detected using a HRP conjugated secondary antibody.

Hela cells were fixed and permeablized then probed with 9F2 and the immunofluorescent signal was detected using a FITC conjugated secondary antibody.

Cleavage of SMN was inhibited by addition of N-acetyl-leucyl-leucyl-norleucinal

(ALLN), a synthetic inhibitor of calpain and other neutral cysteine proteases.

Purified native SMN complexes (Figure 4-8A ) and cellular lysates (Figure 4-9) were treated with calpain in the presence or absence of the ALLN peptide. In the presence of ALLN, no cleavage product was detected. Titration of the reaction

96 showed that the appearance of the 28 kD cleavage product and disappearance of the full-length protein was dependent upon the amount of added calpain (Figure

4-8B). At very high concentrations of calpain, the full-length SMN protein was fully cleaved and shorter, secondary SMN cleavage products were also detected

(Figure 4-8B). Thus calpain targets SMN in the context of the native complex.

To examine whether SMN cleavage could be detected in vivo, we incubated total HeLa cell lysates with or without added calcium and/or calpain.

Importantly, we found that addition of 1mM Ca++ to the lysate was sufficient to induce SMN cleavage, presumably by endogenous calpains (Figure 4-8C, lane 2).

Incubation of control lysates with exogenous calpain but without added Ca++ also showed no cleavage (Figure 4-8C, lane 3). When lysates were incubated in 1mM

Ca++ along with exogenous calpain, SMN cleavage was nearly complete (Figure

4-8C, lane 4). Note that ~10-fold higher concentrations of exogenous calpain were used in the reactions performed on total cellular lysates than on those using purified SMN proteins (recombinant or native). The fact that the same-sized cleavage products were detected in the presence or absence of added calpain

(Figure 4-8C) suggests that SMN is a target of calpain cleavage in vivo.

98 Figure 4-8: Calpain inhibition, titration and endogenous activation. Purified native complexes were treated with calpain (0.05 U) or with calpain and ALLN inhibitor and the cleavage of SMN was compared to a control lane (A). Increasing amounts of calpain

0.003 U to 3.0 U were incubated with purified SMN complexes and the cleavage profile of SMN was analyzed (B). Exogenous calcium (1 mM) was added to HeLa lysate to activate endogenous calpains and the SMN cleavage profile was compared to lanes where no calcium was added and where calpain plus calcium was added (C).

Figure 4-9: Inhibition of calpain cleavage in human and mouse cell lysates using a peptide inhibitor. Lysates from human and mouse cells (HeLa and C2C12, respectively) were incubated with exogenous calpain and 1 mM added Ca++ in the presence or absence of the calpain inhibitor ALLN. The SMN cleavage profile was analyzed.

We also assayed for cleavage of other members of the SMN complex by calpain.

99 Western blotting for SMN, Gemins 2-8 and Unrip following treatment of either

HeLa lysate or purified native SMN complexes with calpain showed that Gemin5 was cleaved in both HeLa lysate and the purified SMN complex. In contrast,

Gemin3 cleavage was only detected when the purified complex was used as the substrate (Figure 4-10). Other members of the SMN complex were relatively unaffected. Unfortunately, we were unable to detect the ~10 kD C-terminal cleavage products in total HeLa lysate using mAb 9F2 (data not shown). While we have not measured the stability of the SMN cleavage products in HeLa lysate, it is likely that these products are ultimately degraded. We were similarly unable to detect endogenous SMN cleavage products in wildtype mouse muscle tissues (data not shown). Thus, the steady-state level of these proteolytic isoforms of SMN is likely to be quite low.

100

101 Figure 4-10: Calpain cleaves a subset of the Gemins within the SMN complex in vitro and in vivo. HeLa lysate and purified SMN complexes were treated with exogenous calpain, 1.4 and 0.06 U, respectively. Western blotting was performed with antibodies to each member of the SMN complex. Note control and calpain lanes in the Gemin 5 and

Gemin 3 panels

Myofibrillar defects in a mouse model of severe SMA

To determine whether reduced Smn expression leads to sarcomeric defects, we investigated the integrity of skeletal muscle myofibrils in the severe hypomorphic background of SMA type I mice (Smn-/-;SMN2+/+). These animals recapitulate much of the human SMA pathology and are characterized by reduced size, proximal muscle paralysis and a general failure to thrive (Hsieh-Li et al. 2000; Monani et al. 2000b). As shown in Figure 4-11A, the mutant pups were significantly smaller than their wild-type littermates at postnatal day 5 (P5) and the amount of Smn protein in skeletal muscle lysates of the SMA mice was dramatically reduced (Figure 4-11B). Myofiber preparations from wild-type and

SMA mutant mice were stained with antibodies targeting the Z-disc marker protein, α-actinin, and imaged in 3D by laser-scanning confocal microscopy.

Two-dimensional views of 3D datasets (average intensity projections) are shown in Figure 4-11C. The images reveal that wild-type myofibrils contain the expected ordered sarcomeric staining pattern throughout their lengths, whereas the SMA mutant muscles exhibit numerous morphological defects, including vacuoles (Figure 4-11C, arrows), wave-like lobulations (Figure 4-11C, stars) and altered Z-disc spacing (Figure 4-11C, arrowheads). The ‘wavy’ myofibers and associated α-actinin negative vacuolar areas in the SMA type I muscles are

102 reminiscent of the phenotype seen in the Drosophila model of SMA (Rajendra et al. 2007). The vacuolar areas lacking α-actinin may represent focal dissolution of the myofibrils, one of the key features found in myofibrillar myopathies (De

Bleecker et al. 1992; Nakano et al. 1996; Selcen and Engel 2004). Whereas the vacuoles are invariably associated with convolutions of the myofiber, the Z-disc malformations include occasional streaming and variations in spacing that indicate an overall loss of sarcomeric uniformity (Figure 4-11C). Consequently, many sarcomeres are out of alignment with their neighbours and appear to be either overstretched or reduced in length. Whether this phenotype is primarily myopathic or if it is a secondary consequence of denervation is not known and remains to be determined. However, these results establish that myofibrils from

SMA type I mice display defects that are consistent with those observed in other myopathies (Chae et al. 2001; Fanin et al. 2007; Haldar et al. 2007; Kramerova et al. 2004; Kvist et al. 2001; Nakano et al. 1996; Selcen and Engel 2004; Sussman et al. 1998).

103

Figure 4-11: SMA type 1 mice have aberrant myofibrils. SMA type 1 mice have aberrant myofibrils. Muscle fibers from SMA and wild-type littermates (A, B) were fixed and then stained with an antibody against -actinin (average projection of a Z-stack of 18 focal planes at 0.5 µm per section) and compared (C). See text for details.

104 Discussion

Role of the SMN complex in the sarcomere

We have shown that the entire cytoplasmic Smn complex localizes to the sarcomeric Z-disc in both cardiac and skeletal myofibrils of the mouse.

Numerous case reports have suggested congenital heart defects in SMA patients

(Cook et al. 2006; El-Matary et al. 2004; Jong et al. 1998; Menke et al. 2008; Moller et al. 1990; Mulleners et al. 1996; Vaidla et al. 2007). Our discovery that SMN is a sarcomeric protein provides a plausible explanation for the observed cardiac involvement in SMA. We speculate that SMN performs a tissue-specific function in striated muscles because spliceosomal snRNPs and related protein factors do not localize to the myofibril. Thus it is unlikely that the sarcomeric SMN complex participates in snRNP biogenesis. Instead, we suggest three non- mutually exclusive possibilities for SMN function in the sarcomere: maintenance of Z-disc integrity, signaling to nucleus, and mRNP transport.

The alignment of sarcomeres between adjacent myofibrils provides a means to coordinate contractions between individual myofibrils. This precise alignment is accomplished by a complex network of protein-protein interactions within and physically linked to the Z-disc (Clark et al. 2002). The Z-discs also link peripheral myofibrils to the nuclear membrane, to the sarcolemmal costameres and to the mitochondria. These lateral associations are mediated by intermediate filaments and associated cytoskeletal proteins such as desmin, vinculin, plectin and alpha-B crystallin (Clark et al. 2002). It is interesting to note that two members of the SMN complex, SMN and Gemin3, have been shown to interact with α-actinin (Rajendra et al. 2007) and alpha-B crystallin (den Engelsman J

2005), respectively. Given the sarcomeric malformations observed in the muscles

105 of SMA type I mice (Figure 4-11), it is possible that the sarcomeric SMN complex is involved in Z-disc homeostasis.

In addition to its canonical roles in anchoring actin filaments and transmitting the contractile force, the Z-disc has recently emerged as a platform for intracellular signaling (Frank et al. 2006; Pyle and Solaro 2004). The SMN complex localizes to both the nucleus and cytoplasm of many cell types, including muscles. SMN is known to interact with components of the EGF receptor signaling pathway (Doran et al. 2006; Gangwani et al. 2005; Mishra et al.

2007) and is, therefore, a candidate Z-disc signaling factor.

Cell types with vast cytoplasmic extensions, such as muscles and neurons, face tremendous challenges in maintaining the asymmetric protein distributions required for proper functioning of these highly specialized cells. Localized translation is thought to be important for setting up these cellular asymmetries.

Previous work has shown that the Smn complex colocalizes with β-actin mRNP granules in axons and growth cones of motoneurons and that reduced Smn expression correlates with a reduction in β-actin protein and mRNA staining at these distal sites (Rossoll et al. 2003; Zhang et al. 2006). Thus SMN is thought to play a role in the assembly, transport and/or localization of β-actin mRNP complexes. We hypothesize that Smn plays a similar role in the transport and localized translation of mRNPs in muscle cells (model fig?). In support of this model, Morris and Fulton (1994) showed that three different Z-disc associated proteins (desmin, vinculin and vimentin) colocalize with their respective mRNAs in a striated pattern in primary cultures of embryonic chicken skeletal muscle.

Similar to β-actin (Condeelis and Singer 2005), vimentin mRNA is also thought to

106 contain an mRNA “zipcode” that targets the mRNP to a specific subcellular locale (Al-Maghrebi et al. 2002; Chabanon et al. 2004). Interestingly, a protein that binds to the vimentin mRNA zipcode (EF-1γ) is known to copurify with Z- disc proteins MuRF1 and MuRF2 (Witt et al. 2008). Thus it is plausible that localized translation takes place within the sarcomeric Z-disc. In light of the putative role for the SMN complex in mRNP transport (Zhang et al. 2006) and its demonstrated localization to the Z-disc (Rajendra et al. 2007), SMN’s sarcomeric function may be regulated by calcium and/or calpain.

Calpain cleavage of SMN: functional implications

We have shown that SMN is a direct target of calpain cleavage in vitro and in vivo. As mentioned above, calpain is a regulatory protease, whose action typically activates or inactivates a given protein target; calpain activity is compartmentalized and works in microenvironments where the Ca++ flux can be controlled. Calpains 1 and 2 are ubiquitously expressed and share a common subunit, Calpain 4. The genes encoding Calpains 2 and 4, Capn2 and Capn4, are essential (Arthur et al. 2000; Dutt et al. 2006; Zimmerman et al. 2000). In contrast,

Calpain 1 knockout mice are viable and fertile (Azam et al. 2001). Calpain 3 is a muscle-specific isoform, but is not essential (Tagawa et al. 2000). However, mutations in human Calpain 3 (CAPN3) are known to cause Limb Girdle

Muscular Dystrophy, type 2A LGMD2A; (Duguez et al. 2006). Notably, patients with mutations in CAPN3 have been misdiagnosed with SMA type III (Starling et al. 2003), illustrating the degree of phenotypic overlap between the two diseases.

Although Calpain 3 is a sarcomeric protein, it is not thought to localize to the Z- disc (Keira et al. 2003; Sorimachi et al. 1995). Thus, while we do not anticipate

107 that SMN is a target of calpain 3, additional experiments will be required in order to address the question of which calpains cleave SMN in vivo.

The structural cues for cleavage by calpain are incompletely understood, as the protease does not have a clear target site preference. Instead, three- dimensional features within the substrate (Sakai et al. 1987; Stabach et al. 1997) as well as the sequence context (Cuerrier et al. 2005; Tompa et al. 2004) appear to be more important than the actual scissile peptide linkage. Although we have not mapped the precise cleavage site on SMN, the epitope for the monoclonal antibody used to identify the ~10 kD C-terminal cleavage product lies within the region encoded by exon 5 of the human gene (L. Pellizzoni, unpublished results).

We therefore place the cleavage site of the human protein somewhere between amino acids 190 and 230, separating the N-terminal Tudor domain of SMN from its C-terminal Y-G box motif.

Importantly, the C-terminal domain of SMN (residues 235-294) has been implicated in regulating the G- to F-actin ratio, and expression of this C-terminal fragment can rescue neurite outgrowth defects in PC-12 cells that have been depleted of endogenous Smn (van Bergeijk et al. 2007). Moreover, SMN was shown to modulate the inhibitory effect of profilin IIa on spontaneous actin polymerization in vitro (Sharma et al. 2005). SMN was also shown to associate with the actin cytoskeleton in fibroblasts (Zhang et al. 2003) and to colocalize with F-actin in neuronal growth cones (Fan and Simard 2002). Finally, regulation of the actin cytoskeleton was recently shown to be a key factor in SMA type III pathology, as overexpression of an F-actin stabilizing protein rescued the disease phenotype in humans (Oprea et al. 2008). These results firmly establish the importance of actin cytoskeletal dynamics in SMN function and SMA pathology.

108 Calpains are ubiquitously expressed and are important for the function of many cell types, including neurons. Thus the identification of SMN as a target of calpain cleavage is of general interest. In the future, it will be interesting to test whether proteolytic isoforms of SMN play a role in actin cytoskeletal dynamics.

109 Materials and Methods

Mouse lines and crosses

Wild-type strains of FVB/NJ, C57BL/6J and 129 genetic backgrounds were used throughout the study. FVB.Cg-Tg(SMN2)89Ahmb Smntm1Msd/J mice carrying the

SMA allele were obtained from the Jackson Laboratory. All strains were maintained on a standard diet of 50/10 food pellets and sterile water. These mice were housed in micro-isolation chambers. Breeding pairs consisted of mice that were homozygous for the transgene and heterozygous for the knockout allele, which resulted in pups that display the SMA phenotype and control littermates. All mice were humanely euthanized according to protocols set forth by IACUC standards.

Antibodies

The antibodies used are as follows: anti-α-actinin (Abcam), anti-Gemin2 (2E17,

Abcam), anti-Gemin3 (12H12), anti-Gemin4 (30-H3), anti-Gemin6 (20H8-E5), anti-Gemin8 (1F8-B6), anti-neurofilament-L (DA2, Cell Signaling), anti-SmB

(125F), anti-SMN (clone 8, BD bioscience), anti-SMN (9F2), anti-unrip (3G6).

Western blotting

Muscle, myofibril and cell lystates were prepared, electrophoresed, and blotted using standard protocols. Antibodies directed against Smn (anti-mouse, 1:2500;

BD biosciences) and GST (anti-mouse, 1:3000) were used. Goat anti-mouse secondary conjugated to HRP was used for detection at a dilution of 1:10,000.

110 Detection of His-SMN was carried out by use of Ni conjugated to HRP (Peirce) at a dilution of 1:5000.

Immunofluourescence

Muscle fiber preps were prepared primarily from excision of the gastrocnemius of P5 pups. Muscle fiber preps were fixed in 4% paraformaldehyde/1X Triton X-

100. Myofibril preps were prepared from striated muscle taken from adult mice, which were subsequently fixed in 4% formaldehyde. Immunostaining was performed following established protocols. Certain preparations were also stained for filamentous actin by adding 1µM FITC-conjugated phalloidin (Sigma-

Aldrich) 20 min before the secondary antibody incubation was complete. Images were taken using either a TCS SP2 laser scanning confocal microscope or a

DM6000 microscope (both Leica), and assembled using Photoshop (Adobe). The

Leica Confocal Scanner is interfaced with Leica Confocal Software, and the

DM6000 microscope is interfaced with Volocity software.

Myofibril preparations and staining

Mouse skeletal and cardiac myofibrils were prepared by following the protocols of Knight and Trinick (1982). Striated muscle was depleted of calcium by incubating over night in EGTA-Ringer’s solution (100 mM NaCl, 2 mM KCl, 2 mM MgCl2, 6 mM KH2PO4, 1 mM EGTA, 0.1% glucose, pH 7.0 at 0°C) at 4°C.

The samples were then transferred to rigor buffer (0.1 M KCl, 2 mM MgCl2, 1 mM EDTA, 0.5 mM DTT added fresh each time, 10 mM KH2PO4, pH 7.0 at 0°C) and homogenized using a glass Dounce tissue grinder. The homogenate was

111 cleared of cell membrane and other debris when spun at 200 g for 5 minutes. The resulting supernatant was then spun at 2000 g for 5 minutes and washed by repeated cycles until a pure preparation of myofibrils (as monitored by phase- contrast microscopy) was obtained. Purified myofibrils were used for western blotting or were fixed to gelatin coated slides (0.05%) and subjected to immunofluorescence analysis using standard protocols. Note that for dual staining of Smn and α-actinin or Gemins, mouse monoclonal antibodies were incubated with purified myofibrils, followed by incubation with secondary antibodies conjugated to Alexa Fluor 594. Following extensive washing, the preparations were incubated with FITC-conjugated monoclonal anti-SMN antibodies.

Calpain treatments

Cell lysates prepared in a gentle binding buffer (50 mM Tris pH 7.5, 200 mM

NaCl, 0.2 mM EDTA, 0.05% NP40) were incubated with either calpain1 or

Calpain 2 (Calbiochem) at 1.4 units for 10 minutes at 30°C. Note for each reaction 1mM CaCl2 is used to activate the calpain protease. The resulting lysates were then electrophoresed and analyzed by standard western blot procedures.

Purifiied SMN complexes and his-SMN/GST-Gemin2 heterodimers were treated with calpain as described above with the following exception: 0.003 – 0.3 units of calpain 1 were used. Myofibril preps were incubated in 1 ml of calcium activating buffer (100 mM KCl, 20mM Tis-acetate pH 7.0, 10 mM CaCl2, 1 mM

NaN3) with Calpain 1 (<40 units), for 30 min at RT on a nutator. After incubation the myofibrils were spun down and washed 3X in rigor buffer at 2000 g at 4°C

112 and fixed to slides. When activation of endogenous calpains was analyzed fresh skeletal muscle was incubated in calcium activating buffer over night at RT on a nutator. The muscle tissue was then prepared for myofibril extraction as described above. Standard immunostaining protocols were used for analysis.

113

CHAPTER V

Discussion and future directions

114 Recently, there have been significant advances in the research of snRNP biogenesis and spinal muscular atrophy. Current gains of knowledge can be attributed to the well-defined molecular assays used to measure snRNP formation and to a multitude of animal models created to study various aspects of SMA. It has been exciting for me to not only witness this explosion of newly found information, but to also contribute to these burgeoning paradigms.

During the course of my graduate studies I addressed fundamental questions with regard to Gemin4 and SMN complex function, as well as the roles that these factors may play in spinal muscular atrophy. Specifically, using imunnofluorescence microscopy I discovered that the Gemin4 protein contains a functional nuclear localization signal and that Gemin4 is able to redirect members of the SMN complex to the nucleus. Also, by creating a Gemin4 mouse model I demonstrated that Gemin4 is an essential gene. Finally, utilizing immunofluorescence microscopy and biochemical analysis I demonstrated a novel function in muscle tissue for SMN and the Gemins. These studies have not only addressed fundamental issues of snRNP biogenesis and SMA pathology, but have opened the door to a new line of tantalizing questions within these fields.

Implications of Gemin4 Mediated Import

Nuclear import typically involves the interaction of the heterodimeric αβ karyopherin complex with a cargo protein that contains an NLS followed by transport through the nuclear pore complex, NPC. Typically, the alpha subunit, importin-α, binds to the NLS sequence of the cargo molecule; the bound

115 importin-α then acts as the receptor molecule while the importin-β molecule facilitates the import of the cargo protein through the NPC (Schlenstedt 1996).

Recently our laboratory showed the importance of SPN (the import adaptor for snRNPs) interaction with SMN (Narayanan et al. 2004; Narayanan et al. 2002;

Ospina et al. 2005). Notably, the SMN complex, and not SMN alone, is able to drive nuclear import of snRNPs in the absence of SPN mediated import

(Narayanan et al. 2004). These findings suggest the SMN complex serves as an alternative NLS during RNP import. However, to date, this “alternative” NLS has not been identified within the complex.

I have shown in Chapter II that Gemin4 contains a bona fide NLS in the amino terminal half of the protein. Notably, this observation has also been independently verified (Lorson et al. 2008a). Removal of the NLS renders

Gemin4 unable to localize to the nucleus and when intact, the full-length protein exclusively targets to the nucleus. Surprisingly, Gemin4 over expression leads to nuclear accumulation of SMN and a number of the Gemins, which leads to a loss of Gems and a reduction in Cajal body number. These results indicate Gemin4 may play a role in SMN complex import and/or an alternative snRNP import pathway.

snRNP import is bipartite in nature, with one part of SPN binding the TMG cap of the snRNP and the other part binding importin-β. Additionally, importin

β also binds a factor(s) not yet known in the SMN complex and both these signals are required for efficient nuclear import (refer to Figure 1-3) (Fischer et al. 1993;

Huber et al. 1998; Marshallsay and Luhrmann 1994). However, in vitro experiments show that with an excess of importin-β and SPN one can drive

116 nuclear import or alternatively, nuclear import of snRNPs can be carried out with excess importin β and purified SMN complexes in the absence of SNP1

(Huber et al. 2002; Narayanan et al. 2004). So, does SPN bind to Gemin4 and bridge the bi-partite signal with importin-β bound to additional SPN molecules that are in turn bound to the TMG cap or does Gemin4 bind importin-α and form an αβ heterokaryopherin complex that is also bound to SPN, via importin β (see

Figure 5-1)?

Figure 5-1: The Gemin4 Import Receptor. Depicted here are two possible scenarios: where in Gemin4 utilizes SPN as the import receptor, left, or Gemin4 uses importin α as the receptor molecule. The smaller question mark juxtaposed to SPN bound to the TMG cap indicates that it’s not clear if Gemin4, is in fact, part of the bipartite signal of Sm- class snRNP import.

The first issue is: What is the karyopherin utilized by Gemin4? The NLS characterized in Chapter II is a simple SV-40 like sequence; these simple NLSs are known to bind importin α during nuclear import (Jans and Hubner 1996;

Lange et al. 2007). So, one way to address this question is to perform binding experiments, such as, GST-pulldowns and Co-IPs. Utilizing an antibody against

117 Gemin4 one could immunoprecipitate (IP) Gemin4 and see if importin-α or SPN interacts with Gemin4 and the reciprocal tests would also lend more credence to these binding experiments. However, since Gemin4 is part of large macromolecular structure, performing co-IP experiments could lead one to erroneous conclusions. For example, SPN binds to not only snRNPs and SMN but also Gemin3 (Narayanan et al. 2002). Gemin3 and Gemin4 have a robust affinity for one another as seen by their ability to stay bound even under high salt conditions (Charroux et al. 2000). For these reasons, it is better to perform direct binding experiments with recombinant proteins. GST-Gemin4 could be used in combination with recombinant importin-α or SPN to assess their binding capabilities and affinities. It should be noted that full-length Gemin4 and

Gemin3 are notoriously difficulty to purify (data not shown and personal communication). However, as I demonstrated in Chapter II the Gemin4 NLS was transferred to GFP and directed robust nuclear targeting. So a construct could be used where either the Gemin4 NLS is fused to a GST tag or the amino terminal half of Gemin4, which houses the NLS, could be fused to GST. This would undoubtedly make purification more manageable and determination of binding partners to the NLS region clearer.

To determine if Gemin4 is the alternative NLS used in snRNP import an in vitro permeablized cell nuclear import assay can be used. In this assay HeLa cells are permeablized by the detergent digitonin and the cytoplasm is washed out and replaced with lysate, import buffer, purified SMN complexes and labeled snRNPs (Adam et al. 1992; Dingwall and Palacios 1998; Narayanan et al. 2004).

In this experiment importin-β and purified whole SMN complexes (without SPN)

118 would be used as the positive control for complex-mediated snRNP import.

Next, recombinant importin-β and purified SMN complexes (with Gemin4 absent) would be used to assay snRNP import; these Gemin4 null complexes are stable and can be purified (Otter et al. 2007). Then one could determine if labeled snRNPs are able to enter the nucleus in absence of Gemin4. If, in the absence of

Gemin4, snRNPs are unable to accumulate in the nucleus, then that would be strong evidence for Gemin4 containing the “alternative” NLS that targets snRNPs to the nucleus.

The reason for an alternative NLS in snRNP import is not clearly understood. Perhaps, in some cell types, SPN expression is diminished or absent and in this case an alternative import pathway would be necessary to carry out normal snRNP function in these cells (Figure 5-2A). Alternatively, the Gemin4

NLS could act in concert with SPN/TMG/importin-β mediated snRNP import, making import more efficient (Figure 5-2B). In contrast, it is possible that

Gemin4’s NLS has nothing to do with snRNP import, but directs itself and other

SMN complex members into the nucleus only (Figure 5-2C). Clearly, addressing which import receptors are mediating Gemin4’s entry into the nucleus and if

Gemin4 can mediate snRNP import will determine if the phenomenon observed in Chapter II is merely an artifact of over expression or if it has biological significance.

119

Figure 5-2: Gemin4-mediated Import. Depicted here are three possible ways Gemin4 could influence import of factors other than itself. In the absence of SPN, Gemin4 acts as the nuclear import signal (A). As suggested in earlier studies, Gemin4 could be part of the bipartite signal in Sm-class of snRNP nuclear import and work in concert with SPN

(B). Gemin4 may only recruit other members of the SMN complex and have no involvement in snRNP nuclear import (C). In this case the NLS within the SMN complex is not known, red question mark.

Gemin4 mice and SMA

In Chapter III, I showed that Gemin4 is an essential gene, as no Gemin4 null mice are obtained at birth or mid- to late-gestation. While most knock out mice of snRNP biogenesis genes are embryonic lethal (Gangwani et al. 2005; Hsieh-Li et al. 2000; Jablonka et al. 2002; Monani et al. 2000b; Mouillet et al. 2008) an important exception are the coilin KO mice (Tucker et al. 2001). These mice, generated in our lab, contributed to important discoveries of coilin function.

These findings were obtained by using imunnofluorescent staining techniques on coilin null cells acquired from the KO mice to study the snRNP pathway in Cajal bodies. So, an apparent problem with early embryonic mutants is that, by the

120 time of lethality, there is not much in the way of cellular accumulation and, thus, less material for experimental manipulation. For example, Smn KO embryos arrest fairly early in development, in the early morula stage (Hsieh-Li et al. 2000;

Monani et al. 2000b). Furthermore, Gemin3 mice arrest even earlier at the 2 cell- stage (Mouillet et al. 2008); while Gemin2 mice survive to the blastocyst stage and die shortly after implantation on the uterine wall (Jablonka et al. 2002). The zinc finger protein ZPR1 is an auxiliary factor of the SMN complex and directly interacts with SMN, which is required for proper SMN localization to Cajal bodies (Gangwani et al. 2005; Gangwani et al. 2001). ZPR1 mutant embryos, like

Gemin2 mutants, arrest at the blastocyst stage. Interestingly, Gangwani et al.

(2005) imunnostained trophoblastic cells of the blastocyst to obtain the findings described above. However, with Gemin4 mutants, I was unable to determine the time period in which mutant mouse embryos arrest, because of an inability to genotype early embryos (E2.5 – E4.5) covering the 2-cell to blastocyst stages.

Ideally, one would be able to determine the time of lethality by PCR genotyping or other methods and perform imunnofluorecence microscopy on mutant and control embryos. This would be invaluable, in that you could determine the localization of snRNPs from the cytoplasm and the nucleus among mutant and control littermates. If Gemin4 does indeed have an import function, this technique would allow one to determine if there is an abnormal accumulation of snRNPs or SMN complex proteins in the cytoplasm, and ascertain whether

Gem/Cajal body integrity is perturbed (see Figure 5-3). Interestingly, our lab has previously shown that RNAi knockdown of Gemin4 protein levels to 10% does not perturb Gem/Cajal body formation or numbers (Shpargel and Matera 2005).

However, these data were acquired in HeLa cells, a cancerous cell line that can

121 be quite different from normal cells, and there is a small amount of Gemin4 still present in these cells, which may be all that is required for efficient function.

Thus, studying cells from embryos that are devoid of Gemin4 could certainly address fundamental questions of its role in snRNP biogenesis.

Figure 5-3: Schematic of Gemin4 Embryo Analysis. Depicted here is a hypothetical

Gemin4 null morula embryo. Seen within the insets are possible observations obtained from imunnostaining these cells.

One benefit of Gemin mouse models is the potential to shed light on SMA pathology. For example, since SMN and Gemin4 are known to associate in the

SMN complex and their function is required for proper snRNP formation, mutations in Gemin4 that lead to similar aberrant snRNP phenotypes could be used to create transgenic animals and determine if they also display similar SMA phenotypes as do SMA model organisms. Also, these transgenic animals can be crossed onto an SMA genetic background to see if they modify preexisting phenotypes of SMA animals. In Chapter III, I crossed the Gemin4 genetrap onto

122 the SMA type 1 genetic background. When this was done, no modification of the post-natal lethality phenotype was seen. Upon of further investigation of

Gemin4 heterozygotes, this result was not surprising since these animals express wild type levels of Gemin4 protein. In fact, both Gemin3 and Gemin2 mice only produce protein levels of 50%, but have no obvious SMA phenotypes, respectively (Jablonka et al. 2002; Mouillet et al. 2008). These phenotypes include neo-natal lethality, motoneuron numbers, and atrophy of muscles. Since Gemin4 null mice never develop beyond the earliest of stages, these animals are not practical in studying SMA phenotypes, which occur relatively late, and as seen in

Chapter III, heterozygous mice appear the same as wild type mice and are of no use in studying SMA phenotypes. So, one would ideally want to use a transgenic or mutant mouse that has reduced levels of Gemin4 function but is able to survive to birth and beyond.

To create such a mouse, two approaches could be undertaken. A hypomorphic Gemin4 mouse line could be created where only 10 to 30% of normal protein levels are expressed; hypothetically this would be enough protein to survive long enough to study the desired phenotypes. A full length Gemin4 cDNA could be placed under the control of a ubiquitous, but low expressing promoter. This transgene can then be put onto the Gemin4 gene trap background. Alternatively, one might wish to create mutations within Gemin4 that wouldn’t lower expression, but would make Gemin4 function less efficiently. Using random mutagenesis techniques mutations could be introduced through out the Gemin4 gene and using, for example, snRNP assembly assays in vitro one could determine good candidates for transgene targeting.

123 These mouse lines could be assayed for various SMA phenotypes.

Importantly, would muscle and motoneurons be the tissues that are affected, such as in the case of SMA mice? These mice could also be crossed onto SMA backgrounds to determine if pathological symptoms are ameliorated or exacerbated. By creating Gemin4 mice that are hypomorphic or less efficient in function, one has a strong genetic tool to determine if SMA is truly a result of altered SMN complex function in snRNP biogenesis or does it point to SMN having a novel function in motoneurons and muscle.

A Novel Function of the SMN Complex in Striated Muscle

In SMA, one of the two major tissues afflicted by the disease is muscle.

However, many people who study SMA believe that the skeletal muscle phenotypes observed in SMA patients are a secondary effect of motoneuron degeneration. Conversely, there are some studies that point to muscle, as the target tissue in SMA and degeneration of motoneurons is a secondary phenotype caused by the diseased state of the muscle. Recently, the importance of motoneurons and muscle in SMA was brought to the forefront by the observations that neuronal stem cells transplanted into the spinal cords of P1

SMA mice (Corti et al. 2008). Moreover, expression of wild type Smn in neuronal tissues in SMA mice ameliorates early neo-natal lethality, albeit a small, but significant increase in lifespan. However, an important fact to take away from this study is that only when wild type Smn is expressed in both motoneurons and muscle is full rescue of the SMA severe phenotypes observed (Gavrilina et al. 2008). Furthermore, SMA type-2 mice are able to significantly extend their life through forced exercise, which provides protection from motoneuron loss and

124 atrophy of muscles (Biondi et al. 2008; Grondard et al. 2005). These studies suggest that both tissues are important for the SMA phenotype and although continued studies into the role of motoneurons in SMA pathology are vital, more research is needed to decipher the role of muscle plays in SMA pathology. To this end, in Chapter IV I show the importance of the SMN complex in muscle function.

We had previously shown that dSmn localizes to the sarcomeric Z-disc in fruit flies and that Smn also localizes to the Z-disc of skeletal muscle in mice

(Rajendra et al. 2007). Since SMN is found to localize to the Z-discs of skeletal muscle in both invertebrates and mammals, there is an implication of a conserved function. These surprising findings, along with other previous studies, necessitated a comprehensive examination of SMN and the SMN complex in striated muscle. As seen in Chapter IV, the Gemins, along with Smn, localize to the Z-disc in skeletal muscle. Thus, the SMN complex is an intergral member of the Z-disc group of proteins. Therefore, a critical question to be resolved is whether or not the SMN complex is involved in the snRNP biogenesis pathway at the Z-disc or is serving another purpose at this locale (see Figure 5-4).

125

Figure 5-4: Is RNP biogenesis occurring at the Z-disc? In this schematic the SMN complex is either functioning in the assembly of the U1 snRNP (depicted on the left) or the SMN complex is providing a novel function at the Z-disc (right hand side of diagram).

The zigzag line bisecting the I band is the Z-disc and the dashed line bisecting the A band is the M-line.

In Chapter IV, I show the absence of snRNPs at the Z-disc measured by the lack of snRNP markers at the Z-disc, but the the SMN complex is present at the

Z-line suggesting that Smn and the Gemins are performing a separate role other than snRNP biogenesis. A fundamental biochemical question to address is, how does the SMN complex anchor itself to the Z-disc? Does one member of the complex tether the entire complex to the myofibril, or are there multiple interactions with the complex and Z-disc proteins? Previously in our lab we showed that SMN interacts directly with the Z-disc marker protein, α-actinin

126 (Rajendra et al. 2007). α-actinin is an anti-parallel rod-shaped dimer that binds adjoining filaments of F-actin in the Z-disc and associates with a number of cytoskeletal signaling factors (Sjoblom et al. 2008). So, because SMN binds to a protein that that is in abndance at the Z-disc, it is reasonable to assume that SMN could be the anchoring protein that attaches the rest of the complex to this region. Therefore, it will be important to determine the binding site of α-actinin within SMN. Using a recombinant binding approach one could make various deletion constructs of GST-tagged SMN with His-tagged α-actinin to determine the specific region responsible for their interaction. Once the α-actinin binding motif is identified then one could create a transgenic animal with mutations in this region and determine if SMN and the SMN complex fail to localized to Z- discs, assuming muations in this region do not interfere with SMN’s other functions. Also, to determine if SMN or other members of the complex are binding Z-disc or sarcomeric proteins a general binding screen should be performed. The yeast two-hybrid screen could be used wherein SMN complex members would act as bait and Z-disc proteins as the prey utilizing a sarcomere specific library. Determining the binding partners of the SMN complex within the Z-disc could be very beneficial in deciphering the function(s) with which it performs in muscle.

As mentioned in Chapter IV, three proposed functions of the SMN complex in striated muscle are: providing integrity to the Z-disc, being part of the intracellular signaling apparatus and performing localized mRNP transport.

SMN is known to interact with intermediate filaments of the Z-dics such as α- actinin and alpha-B crystallin implying that the SMN complex may bestow

127 additional mechanical or structural support to the Z-disc by providing protein- protein interactions to the scaffolding of filaments within the region (see Figure

5-5A) (den Engelsman J 2005; Rajendra et al. 2007). Also, The SMN complex localizes to both the nucleus and cytoplasm and is also known to interact with members of the epidermal signaling pathway and α-actinin, which in addition to actin cross-linking, is known to be involved in cytoskeletal signaling pathways

(Sjoblom et al. 2008). Since the Z-disc contains signaling factors that shuttle between the sarcoplasm and the nucleus it is entirely possible that the SMN complex is involved in Z-disc signaling (Figure 5-5B). However the most intriguing candidate function proposed thus far is a role for SMN in mRNP transport.

Figure 5-5: Possible functions of the SMN complex at the Z-disc. (A) In this scenario the SMN complex acts to stabilize the lattice structure formed by intermediate filaments in the Z-disc. (B) Here the SMN complex is involved in the Z-disc signaling pathway by interacting with factors that shuttle between the sarcoplasm and the nucleus.

128 The vast majority of studies of SMN and its role in actin mRNA transport have been focused in motoneurons. The hypothesis is that the SMN complex transports beta-actin mRNA in growth cones, axons and dendrites and in general is an mRNP remodeling complex; thus, areas of active actin polymerization require actin mRNPs localized for translation. Perplexingly, striated muscle, which is mostly filamentous actin, has been overlooked in this regard. However, as our lab has previously demonstrated, and I addressed in Chapter IV, the SMN complex functions within the Z-disc in an snRNP biogenesis independent manner and it is known that mRNAs of certain sarcomeric proteins co-localize at the Z-disc (Morris and Fulton 1994). Since the SMN complex is implicated in mRNP transport in neurons, an exciting prospect is that the SMN complex functions in a similar way to transport mRNPs of various sarcomeric proteins. A series of simple, yet elegant, experiments could be employed to demonstrate this proposed function. First, co-localization experiments with SMN and Gemins at the Z-disc with in situ hybridization of known mRNAs would establish if these factors could interact at the Z-line. One could label mRNAs for α-actinin, alpha actins and various other Z-disc proteins to determine if there is indeed co- localization with the SMN complex. Once it has been determined if the SMN complex localizes with mRNAs of Z-disc factors one could then perform co-IP experiments using lysates of purified myofibrils and antibodies of SMN complex members to determine if these factors interact with known mRNP markers. If so, this would suggest that the SMN complexes located at the Z-discs are complexed with mRNAs. Finally, one could perform an IP pulling out the SMN complex and isolating any associated RNA from a myofibril lysate. Once these RNAs are purified one could perform northern blot and/or RT-PCR analysis to show what

129 specific mRNPs the SMN complex is housing at the Z-disc. Thus, in this model the SMN complex is localizing mRNPs at the Z-disc needed for myofibril homeostasis (Figure 5-6)

Figure 5-6: mRNP transport for maintaining myofibrils. Depicted here are SMN complexes integrated with mRNPs to be delivered to sites of active translation of sarcomeric proteins. In this scheme the complex is directly involved in the maintenance of disturbed regions of the myofibrils (dashed lines) by supplying the mRNAs of various factors of the filamentous network.

Chapter IV reveals that, not only is Smn found at the Z-disc of skeletal muscle, but it is also localized to cardiac muscle. While the Gemins are also found in skeletal myofibrils, the presence of the Gemins at the cardiac Z-disc

130 warrants further investigation. This could be achieved utilizing the same techniques seen in Chapter IV. One would look for Gemin localization by immunofluorescence labeling. However, the presence of the complex at the Z- disc within heart muscle is likely, due to the fact that Smn localizes to the cardiac

Z-line and the fact that the cardiac Z-disc is very similar to the skeletal Z-disc

(Pyle and Solaro 2004).

Finally, in Chapter IV, I demonstrated that the proteolytic enzyme, calpain, directly cleaves SMN. Calpains play a crucial role in muscle maintenance and the fact that calpain specifically cleaves SMN lends more credence to the idea that the SMN complex has a novel function in muscle. While I was able to show that the ubiquitous calpains target SMN at a specific site as seen by the same size fragment after cleavage, the specific calapain cleavage site remains a mystery.

However, I was able to determine that the cleavage site resides in the carboxy terminus of SMN by using SMN specific whose epitopes reside in either the N- or C-terminus. Currently, we are investigating the specific cleavage site within recombinant SMN by using various deletion constructs at the carboxy terminus.

Once the cleavage site has been delineated various experiments can be planned to investigate the SMN complex’s role in muscle tissue.

131 APPENDIX CHAPTER

Reduced viability and fecundity in mice lacking the Cajal body marker

protein, coilin

Michael P. Walker1,2, Liping Tian1, and A. Gregory Matera1,2

1Department of Genetics, School of Medicine, Case Western Reserve University,

Cleveland, OH 44106-4955

2Department of Biology, Program in Molecular Biology & Biotechnology,

Lineberger Comprehensive Cancer Center

University of North Carolina, Chapel Hill, NC 27599-3280

* This chapter is a manuscript currently in preparation.

132 Abstract

The biogenesis of uridine-rich small nuclear riobonucleoproteins (U snRNPs) is a rather peculiar pathway that begins in the nucleus, enters the cytoplasm to begin assembly and then imported back into the nucleus for final maturation. This nuclear maturation step takes place in proteinaceous dense structures, the Cajal bodies. The Cajal body is an assembly and storage factory made up of many different protein and RNP factors. In particular, the marker protein, Coilin is important for Cajal body homeostasis. Recent evidence shows that removal of Coilin from the Cajal body breaks down this structure into three separate nuclear structures (Gems, the scaRNA body and the Nopp140 body) termed residual Cajal bodies. Thus, Coilin acts as a structural protein that holds the Cajal body together. Intriguingly, mice that are null for Coilin are not embryonic lethal and can reproduce. Here we investigate the consequences of removal of Coilin on overall viability and reproductive success. In this study we report that Coilin null mice (Coil -/-) have reduced viability starting at birth and that these mice have significantly reduced fecundity. Interestingly, the reduced reproductive output does not seem to be due to any gross abnormalities of germ line structures.

133 Introduction

Small nuclear ribonucleoproteins (snRNPs) are essential factors of the spliceosome, required for proper pre-mRNA splicing (Kiss 2004). snRNP biogenesis is a complex pathway that begins in the nucleus wih the transcription of small nuclear RNA (snRNA) and subsequent exportation to the cytoplasm

(Izaurralde and Mattaj 1995; Masuyama et al. 2004; Ohno et al. 2000; Segref et al.

2001). Once in the cytoplasm the snRNAs form complexes with a core set of seven Sm proteins. The assembly of the heptameric Sm core is facilitated by the survival of motor neurons (SMN) complex. This complex contains eight Gemin proteins along with the spinal muscular atrophy disease gene product, SMN

(Baccon et al. 2002; Carissimi et al. 2006a; Charroux et al. 1999; Charroux et al.

2000; Fischer et al. 1997; Gubitz et al. 2002; Liu et al. 1997; Pellizzoni et al. 2002a).

The addition of the Sm core serves as a catalyst for 5′ and 3′ end processing which, upon completion of these steps, the snRNP is imported back into the nucleus. When newly formed snRNPs enter the nucleus they first accumulate within nuclear structures called Cajal bodies, where additional RNP maturation steps take place (Darzacq et al. 2002; Jady et al. 2003; Kiss et al. 2002; Mattaj and

Zeller 1983; Richard et al. 2003).

The Cajal body was first characterized over one hundred years ago by the

Spanish neurocytologist Santiago Ramón y Cajal using silver staining. A large argyophilic nuclear body was located in close proximity to the nucleolus and termed the “accessory body.” These structures were later termed Cajal bodies in honor of their discoverer (Gall et al. 1999). The Cajal body is a relatively large

(0.2-1.0 µm in diameter) macro-molecular structure comprised of many different proteins and RNAs, most of which are also concentrated in other sub-nuclear

134 domains. For example, Nopp140, fibrillarin and snoRNAs are found in Cajal bodies, but also accumulate in the nucleolus. The SMN complex accumulates in

Cajal bodies, but is also present in the cytoplasm and in Gemini bodies or gems

(Carmo-Fonseca et al. 1991a; Carmo-Fonseca et al. 1991b; Fakan and Bernhard

1971; Matera 1998; Matera et al. 1995; Matera and Ward 1993). In contrast, coilin, which was first characterized through the use of autoimmune patient sera, is highly concentrated in the Cajal body and is diffusely localized throughout the nucleoplasm (Andrade et al. 1991; Raska et al. 1991). Coilin has thus become the primary molecular marker used to identify Cajal bodies in vertebrate cells.

Functional studies in several species have shown that coilin is required for the formation of proper Cajal bodies (Bauer and Gall 1997; Collier et al. 2006;

Tucker et al. 2001). Notably, recruitment of the SMN complex to Cajal bodies is mediated by RG-rich residues within the coilin C-terminal domain (Hebert et al.

2002; Hebert et al. 2001). Murine Coilin is located on chromosome 11 and encodes a 61.8 kDa protein comprised of 568 amino acids; the protein is expressed in all tissues examined with a rather high concentration in brain and especially the testis (Tucker et al. 2000). Deletion of 85% of the coilin coding region, encompassing the C-terminal 486 aa had a profound effect on Cajal body formation in both adult tissues and embryonic fibroblasts (MEFs) derived from

Coil -/- mice. Coilin knockout cells display at least three distinct types of

“residual” structures (Matera and Shpargel 2006). Normally each of these entities are located together with coilin in the Cajal body. Importantly, when exogenous coilin was expressed in Coil -/- cells, the residual structures disappeared and Cajal bodies were re-formed (Tucker et al. 2001). Thus the cellular phenotypes described in the previous work on coilin knockout cells

135 (Dundr et al. 2004; Hebert et al. 2002; Hebert et al. 2001; Sun et al. 2005; Tucker et al. 2001) reveal that coilin is required for Cajal body formation and for recruitment of splicing snRNPs and the SMN complex to these structures.

Despite these advances, characterization of the organismal phenotypes has lagged behind.

Somewhat surprisingly, we found that loss of coilin was homozygous viable when the mutation was generated on an outbred CD-1 background, whereas roughly half of the F1 homozygotes died when crossed to 129Sv/J or

C57BL6/J inbred strains (Tucker et al. 2001). Because the heterozygous animals used for the intercrosses described above had only been backcrossed for a single generation onto their respective inbred strains, it was possible that the homozygous lethality we observed was due to a second site mutation in the ES cell line used in creation of the chimeric mice. We therefore backcrossed the animals for ten generations onto the C57BL6/J background and then analyzed the progeny of heterozygote intercrosses. Furthermore, because the animals were genotyped at weaning (post-natal day 21, P21), the phenocritical phase was not established (Tucker et al. 2001). Genotyping at embryonic day 13.5 (E13.5), P1 and P21 allowed us to restrict the time period of lethality to between E13.5 and

P1. Finally, we show that Coil -/- mice display significant fertility and fecundity defects as compared to controls.

136

Results

Coilin knockout mice are partially viable

Previous observations showed that Coil -/- mice were significantly under- represented at weaning (P21) when first generation founder mice were crossed to two different inbred strains (Tucker et al. 2001). However, these mice were analyzed after only one generation of backcrossing. Thus the progeny contained

50% C57BL6/J and 50% 129Sv/J (from the ES cells used to create the mutation).

Hence, the reduced number of Coil -/- mice observed at weaning could, in principle, be due to a second site mutation contained within the ES cell line used to create the knockout. In order to address this caveat, we backcrossed animals heterozygous at the Coil locus with wildtype C57BL6 mice (obtained from

Jackson Laboratories) for ten generations, each time selecting for the Coilin deletion allele. Therefore, any remaining 129Sv/J alleles must be tightly linked to the Coilin gene. We then intercrossed heterozygotes and genotyped the progeny at four different developmental time points. As shown in Table 1, we found that

Coil -/- mice were significantly under-represented when genotyped at weaning

(P21). In order to determine if the animals were dying early in development or later on, we genotyped mid-gestation embryos (E13.5) and found that the number of homozygous mutants did not significantly differ from the expected number (Table A1-1). Thus the animals must have died between E13.5 and P21.

To narrow down this lethal window, we genotyped neonatal (P1) mice and found that their numbers were significantly reduced. Similar results were obtained for P10 animals (Table A1-1). Importantly, the ratios of Coil +/+ and

137 +/- mice remained a relatively constant 1:2. Thus, we conclude that roughly half of the coilin knockout mice died late in gestation (i.e. between E13.5 and birth), whereas the other half survived. The Coil -/- mice that survived to weaning showed no gross morphological or behavioral defects. However, the majority of the runts genotyped at weaning were Coil -/- mice, but these animals were indistinguishable in size from their littermates after they reached sexual maturity

(data not shown). These findings were somewhat surprising, given that analysis of mutations in other genes involved in snRNP biogenesis, such as Smn, Zpr1 and

Gemin2, each displayed early embryonic lethality (Gangwani et al. 2005; Hsieh-Li et al. 2000; Jablonka et al. 2002; Schrank et al. 1997).

Table A1-1: Coilin intercross mice. These data are tabulated from litter derived from

Coilin heterozygous mating pairs at E13.5, P1, P10 and P21 (from left to right). Colors alternant to distinguish data sets. P values were calculated from chi-square analysis of each litter time point.

138

Maternal contribution of coilin is not important for viability

The decreased viability of Coil -/- mice can be explained as a purely developmental defect wherein the knockout mice are less fit than their littermates and consequently are more susceptible to late gestation arrest.

Alternatively, the reduced viability of Coil -/- embryos might be due to a suboptimal uterine environment in the mother. To address this question, we compared the number of Coil -/- neonates born to heterozygous versus homozygous mutant females. Coil -/- females were mated with Coil -/+ males or

Coil -/+ females were mated with Coil -/- males, ensuring that only homozygous mutant and heterozygous littermates were produced. Consistent with the reduced viability of the knockout animals, there were fewer homozygous mutant pups than heterozygotes (Table A1-2), but the difference in number was not as pronounced as that observed for the heterozygous intercrosses. Importantly, a

Student’s T-test comparing the results of the two groups in Table A1-2 found no significant differences. We therefore conclude that the absence of a maternal contribution of coilin in the oocyte has no significant effect on the viability of the progeny.

139

Table A1-2: Contribution of the uterine environment to neonatal viability. The two mating pairs (top of Table) progeny were PCR genotyped at P1. P values were calculated from chi-square analysis of the two data sets.

Coil -/- mice display significant fecundity defects

Anecdotal observations indicated that Coil -/- mouse mating pairs were fertile, but that the litter sizes from these matings were smaller. To test whether

Coil -/- mice display fecundity defects, we compared litter size and litter number over a six month time period. Mating pairs were established from intercrosses of heterozygous mice. Wildtype and homozygous animals derived from these crosses were age-matched and the number of pups per litter was measured during the first six months after the females had reached sexual maturity (P42).

We found that the mean litter size, 3.3±1.4, of Coil -/- mating pairs was significantly smaller than that of wildtype mating pairs ,6.9±2.2 (Figure A1-1A).

140 Importantly, the average litter size of the wildtype mating pairs is in good agreement with published data for C57BL6/J mice (Green and Seyfried 1991).

Thus, coilin knockout mice have fewer pups per litter than do their wildtype counterparts.

In addition to the nearly two-fold reduction in litter size, homozygous mutant mating pairs also appeared to produce fewer litters overall. An analysis of litter number revealed that wildtype mating pairs produced significantly more litters over a 6 month period than did the Coil -/- mating pairs. On average, Coil

+/+ females gave birth to 5.3±1.1 litters over the first 6 months of breeding, whereas Coil -/- females gave birth to only 3.0±0.7 litters over the same time period (Figure A1-1B). Thus the reproductive output of Coil -/- mice is significantly less than that of wildtype C57BL6/J mice.

Figure A1-1: Coil -/- mice are reproductively less fit. The mean litter size (A), and the mean number of litters (B) were analyzed following 6 months of breeding. Coil -/- mice display reduced litter size and litter number compared to Coil +/+ controls, p = 2 x 10-8 and p = 3 x 10-7, respectively. P values were calculated by Student’s T-test analysis.

141

Male and female Coil -/- mice contribute equally to their reduced fecundity

Reciprocal mating pairs (i.e. Coil -/- females and wildtype males as well as wildtype females with Coil -/- males) were set up to determine whether gender contributed to the reduced fecundity observed in Figure A1-1A,B. Again, we measured litter size and litter number over time. As a control, heterozygous mating pairs were also analyzed. The mean litter size was not significantly different between the reciprocal mating pairs (Figure A1-2A). However, each produced significantly smaller litters (4.9±0.8 and 4.6±0.9, respectively) than did the control heterozygous mating pairs (7.2±0.8; Fig. 2A). Males and females therefore have the same influence on reduced litter size observed in homozygous intercrosses (Figure A1-1A).

Finally, we measured the number of litters derived from these reciprocal matings, as compared to the heterozygous intercrosses over a period of four months and found no significant difference in litter number among the three mating schemes (3.88±0.5, 3.22±0.7 and 3.88±1.3 Figure A1-2B). These results show that while litter size is affected, the reciprocal mating pairs are able to produce normal amounts of litters during this shorter time period.

Because the progeny from the reciprocal matings described in Figure A1-

2A were genotypically identical (heterozygous), the smaller litter sizes we observed must be due to significantly reduced fecundity and not from reduced viability of the neonates. Moreover, these experiments represent a better test of the reproductive fitness of the Coil -/- females than are the results described in

Table A1-2 because all of the progeny in these crosses are heterozygotes. Thus we

142 conclude that the uterine environment of the Coil -/- female does not contribute sigificantly to the fitness of the progeny. Rather, the genotype of the progeny is the determining factor. Taken together, these data show that male and female

Coil -/- mice contribute equally to the reduced fecundity phenotype.

Figure A1-2: Reciprocal mating crosses. Both male and female Coil -/- mice contribute to reduced reproductive output. The mean litter size (A), and the mean number of litters at 4 months were analyzed (B). (Coil -/- female)/(Coil +/+ male) and (Coil

+/+female)/(Coil -/- male) mating pairs were compared to control heterozygous mating pairs. Mating pairs that contain a male or female Coil -/- mouse have smaller litter sizes compared the control mating pair; p = 4 x 10-5. P values were calculated by ANOVA testing.

143 Coil -/- mice testes are significantly smaller then their male litter mates

Finally, we wanted to determine if obvious germ-line defects were the culprits for the reduced fecundity observed above. Male mice were sacrificed at sexually maturity, P56, and their testes were excised for examination. We first examined cross sections of Coil +/+, +/- and -/- mice and observed no major differences with regards to seminiferous tubules or to whole testis tissue sections

(Figure A1-4A). However, we did observe a highly significant difference in mean testis weight. Coil +/- and +/+ mice had fairly normal sized testes at

0.0905±0.009 and 0.0949±0.008 grams, respectively. By contrast, Coil -/- litter mates smaller testes compared to their wildtype and heterozygous littermates weighing significantly less at 0.0683±0.008 grams (Figure A1-4B). We also examined ovaries from P42 mutant females and compared them to their control littermates. No obvious differences were detected in Coil -/-, in fact, ovaries from

Coil -/- mice were observed to have mature oocyte follicles just the same as their

Coil +/+ and +/- siblings (Figure A1-5). Thus, other than in males where they have slightly smaller testes removal of coilin does not significantly alter reproductive tissues.

144

145 Figure A1-4: Coil -/- mice have reduced testis size. Testis sections were made and H &

E stained from young adult male mice (56 days old; A). In the top panels individual seminiferous tubules were analyzed for any gross abnormalities; scale bar = 100µm.

Excised testes of Coil -/-, +/- and +/+ mice were individually weighed (B). Male Coil -/- mean testis weight is significantly lower then control littermates; p << 0.0001.

Figure A1-5: Analysis of Coil -/- ovaries. Ovaries were removed from P42, sexually mature, females and cross sections were H & E stained. No obvious morphological abnormalities were detected among the genotypes. The parallel lines observed are artifacts from preparation of the tissue samples. The scale bar in the center panel is 2 mm.

146 Discussion

We have shown Coil -/- mice have reduced viability and fecundity by using different mating schemes on a pure inbred strain. These simple mating experiments have allowed us to narrow the period of lethality to sometime between E13 and P1 (Table 1). Intriguingly, a proportion of Coil -/- mice are viable showing that coilin is not essential for life. In fact, cells derived from these mice have restructured the nuclear body makeup to compensate for the loss of the Cajal body by the formation of residual Cajal bodies and UsnRNP biogenesis and/or recycling appears adequate. However, there is the caveat that UsnRNP biogenesis or the Cajal body function in general is not optimal. We also show that a reduction or complete absence of coilin in the pregnant female does not contribute to this phenotype. Perhaps during gestation the Cajal body function needs to be optimized to ensure robust development and lack of coilin protein diminishes this function. This scenario could help to explain the observed 50% reduction of Coil -/- mice being born. One could imagine that sub-optimal embyos have a difficult time receiving nourishment from the mother and as a result fail to flourish in late gestation. This could arise from improper placental formation from trophectoderm cells compromised by loss of coilin or other developmental abnormalities and/or delays of Coil -/- mice.

The Coil -/- mating pair’s litter size and litter number is significantly reduced compared to wild type controls. This lowered fecundity observed may be due to defects in the germ lines of males and females or to behavioral defects.

Indeed Coil -/- mice may have perturbed gametogenesis. Lowered sperm production in males could lead to a lessened chance of every oocyte in the oviducts being fertilized. Conversely, females may be producing less oocytes to

147 be fertilized. This may explain the smaller litter sizes observed when the progeny genotypes are either Coil -/- or Coil -/+. Sub-optimal germ lines may also contribute to reduce litter number over a set time period.

We observed that Coil -/- mice appeared smaller than there litter mates at weaning (data not shown), but were eventually indistinguishable from those same litter mates as adults. Coil -/- mice could potentially be developmentally delayed and a consequence of this may be that sexual maturity is reached later in life. This would result in smaller litter numbers over a set time period because all the female or male mice were put into mating cages at the same age.

Whatever the reason for the reduced reproductive output it is clear that both the male and female Coil -/- mouse contributes to this phenotype. The contribution to this effect may be additive. When a male or female Coil -/- mouse is mated with a heterozygote the resulting litter is smaller then the control mating pair.

However, these litters are still larger then when both parents lacked coilin (Fig.

1A and 2A).

These studies show that coilin is not required for life or fertility, but is probably needed for optimal fitness during development and robust reproductive output. Since these mice are viable and fertile, albeit to a lesser extent, coilin’s role in snRNP biogenesis may only be modulatory and absence of this protein is permitable. Interestingly, when coilin is removed the “residual”

Cajal bodies lose their contact with the snRNP assembly and recycling machinery, the SMN complex (Tucker et al. 2001). SMN is not able to tether the complex to residual Cajal bodies, because it has lost it’s interacting partner, coilin

(Hebert et al. 2001). This lack of interaction between SMN and coilin in the nucleus may result in diminished snRNP recycling and/or turnover, which may

148 have downstream effects in development and gametogenesis. In the laboratory environmental stresses are kept to a minimum and conditions are such that these mice are given every advantage to thrive. Under these conditions a defect in a gene that has such a modulation effect on a house keeping function may be tolerated. However, such a null mutation would not likely be tolerated in a wild population. These animals would be less reproductively fit compared with their wild type counterparts and as a consequence the reproductive pool in a given population would be saturated with wild type mice.

149 Material & Methods

Animal care and genotyping

Mating cages typically consisted of one Coil +/- male and two Coil+/- females. Once females appeared pregnant they were put into separate cages and progeny were collected at P1, P10 or P21; these females were subsequently placed back into the mating cage for further mating. Approximately 2-3 mm of tail clipping from individual neonates was placed into a 1.5 ml microfuge tube and DNA extraction was carried out using the High Pure PCR Template

Preparation Kit (Roche) following the manufacturers protocol. Genotyping by multiplex PCR analysis (Fischer Scientific) was carried out with the following three primer scheme: Forward primer, 5′-AAAGCAAGGTCAGACTATCGTTCC-

3′; neo-reverse, 5′-TTTGC- CAAGTTCTAAT TCCATCAG-3′; coilin reverse, 5′

TTCACGTGGCTGCTTTGTTTT- ATC-3′.

Embryo extraction

Individual heterozygous females were placed in a cage with isolated heterozygous males over night. Early the next day these females were checked for plugs to ensure that mating had taken place. Plugged females were then housed in a cage until embryonic day 13.5 when they were then sacrifised by cerrvical dislocation. Embryos were excised from the uterus and individuals were carefully removed from the embryonic sac. Embryos were then washed 3X in ice cold 1XPBS (10XPBS: 580 mM Na2HPO4, 170 mM NaH2PO4•H2O, 680 mM

NaCl) to ensure all maternal tissues were removed. Genotyping of PCR products from tissues derived from the limb of the embryo was carried out as described above.

150 Histology of testes & ovaries

All mice were humanely euthanized according to protocols set forth by the

Institutional Animal Care and Use Committee (IACUC) and CWRU Animal

Resource Center (ARC). Testes or ovaries were excised from sacrificed mice, fixed in 10 % formalin and 10 µm tranverse sections were stained with hematoxylin and eosin.

Statistical analysis

Chi-sqaure, student’s T-test and ANOVA were performed using Smith’s

Statistical Package (SSP) version 2.75 for MAC OS 10.

151 BIBLIOGRAPHY

Abu-Baker A, Messaed C, Laganiere J, Gaspar C, Brais B, Rouleau GA (2003) Involvement of the ubiquitin-proteasome pathway and molecular chaperones in oculopharyngeal muscular dystrophy. Hum Mol Genet 12, 2609-2623

Adam SA, Sterne-Marr R, Gerace L (1992) Nuclear protein import using digitonin- permeabilized cells. Methods Enzymol 219, 97-110

Al-Maghrebi M, Brule H, Padkina M, Allen C, Holmes WM, Zehner ZE (2002) The 3' untranslated region of human vimentin mRNA interacts with protein complexes containing eEF-1gamma and HAX-1. Nucleic Acids Res 30, 5017-5028

Andrade LE, Chan EK, Raska I, Peebles CL, Roos G, Tan EM (1991) Human autoantibody to a novel protein of the nuclear coiled body: immunological characterization and cDNA cloning of p80-coilin. J Exp Med 173, 1407-1419

Arnold AS, Gueye M, Guettier-Sigrist S, Courdier-Fruh I, Coupin G, Poindron P, Gies JP (2004) Reduced expression of nicotinic AChRs in myotubes from spinal muscular atrophy I patients. Lab Invest 84, 1271-1278

Arthur JS, Elce JS, Hegadorn C, Williams K, Greer PA (2000) Disruption of the murine calpain small subunit gene, Capn4: calpain is essential for embryonic development but not for cell growth and division. Mol Cell Biol 20, 4474-4481

Azam M, Andrabi SS, Sahr KE, Kamath L, Kuliopulos A, Chishti AH (2001) Disruption of the mouse mu-calpain gene reveals an essential role in platelet function. Mol Cell Biol 21, 2213-2220

Baccon J, Pellizzoni L, Rappsilber J, Mann M, Dreyfuss G (2002) Identification and characterization of Gemin7, a novel component of the survival of motor neuron complex. J Biol Chem 277, 31957-31962

Bark C, Weller P, Zabielski J, Pettersson U (1986) Genes for human U4 small nuclear RNA. Gene 50, 333-344

Bartoli M, Richard I (2005) Calpains in muscle wasting. Int J Biochem Cell Biol 37, 2115-2133

152 Battle DJ, Kasim M, Wang J, Dreyfuss G (2007) SMN-independent subunits of the SMN complex. Identification of a small nuclear ribonucleoprotein assembly intermediate. J Biol Chem 282, 27953-27959

Battle DJ, Lau CK, Wan L, Deng H, Lotti F, Dreyfuss G (2006) The Gemin5 protein of the SMN complex identifies snRNAs. Mol Cell 23, 273-279

Bauer DW, Gall JG (1997) Coiled bodies without coilin. Mol Biol Cell 8, 73-82

Bertrandy S, Burlet P, Clermont O, Huber C, Fondrat C, Thierry-Mieg D, Munnich A, Lefebvre S (1999) The RNA-binding properties of SMN: deletion analysis of the zebrafish orthologue defines domains conserved in evolution. Hum Mol Genet 8, 775- 782

Biondi O, Grondard C, Lecolle S, Deforges S, Pariset C, Lopes P, Cifuentes-Diaz C, Li H, della Gaspera B, Chanoine C, Charbonnier F (2008) Exercise-induced activation of NMDA receptor promotes motor unit development and survival in a type 2 spinal muscular atrophy model mouse. J Neurosci 28, 953-962

Brahe C, Bertini E (1996) Spinal muscular atrophies: recent insights and impact on molecular diagnosis. J Mol Med 74, 555-562

Braun S, Croizat B, Lagrange MC, Warter JM, Poindron P (1995) Constitutive muscular abnormalities in culture in spinal muscular atrophy. Lancet 345, 694-695

Brichta L, Holker I, Haug K, Klockgether T, Wirth B (2006) In vivo activation of SMN in spinal muscular atrophy carriers and patients treated with valproate. Ann Neurol 59, 970-975

Briese M, Esmaeili B, Sattelle DB (2005) Is spinal muscular atrophy the result of defects in motor neuron processes? Bioessays 27, 946-957

Busch WA, Stromer MH, Goll DE, Suzuki A (1972) Ca 2+ -specific removal of Z lines from rabbit skeletal muscle. J Cell Biol 52, 367-381

Carissimi C, Baccon J, Straccia M, Chiarella P, Maiolica A, Sawyer A, Rappsilber J, Pellizzoni L (2005) Unrip is a component of SMN complexes active in snRNP assembly. FEBS Lett 579, 2348-2354

Carissimi C, Saieva L, Baccon J, Chiarella P, Maiolica A, Sawyer A, Rappsilber J, Pellizzoni L (2006a) Gemin8 is a novel component of the survival motor neuron complex and functions in small nuclear ribonucleoprotein assembly. J Biol Chem 281, 8126-8134

Carissimi C, Saieva L, Gabanella F, Pellizzoni L (2006b) Gemin8 is required for the architecture and function of the survival motor neuron complex. J Biol Chem 281, 37009- 37016

153

Carmo-Fonseca M, Pepperkok R, Sproat BS, Ansorge W, Swanson MS, Lamond AI (1991a) In vivo detection of snRNP-rich organelles in the nuclei of mammalian cells. EMBO J 10, 1863-1873

Carmo-Fonseca M, Tollervey D, Pepperkok R, Barabino SM, Merdes A, Brunner C, Zamore PD, Green MR, Hurt E, Lamond AI (1991b) Mammalian nuclei contain foci which are highly enriched in components of the pre-mRNA splicing machinery. EMBO J 10, 195-206

Carrel TL, McWhorter ML, Workman E, Zhang H, Wolstencroft EC, Lorson C, Bassell GJ, Burghes AH, Beattie CE (2006) Survival motor neuron function in motor axons is independent of functions required for small nuclear ribonucleoprotein biogenesis. J Neurosci 26, 11014-11022

Cartegni L, Krainer AR (2002) Disruption of an SF2/ASF-dependent exonic splicing enhancer in SMN2 causes spinal muscular atrophy in the absence of SMN1. Nat Genet 30, 377-384

Chabanon H, Mickleburgh I, Hesketh J (2004) Zipcodes and postage stamps: mRNA localisation signals and their trans-acting binding proteins. Brief Funct Genomic Proteomic 3, 240-256

Chae J, Minami N, Jin Y, Nakagawa M, Murayama K, Igarashi F, Nonaka I (2001) Calpain 3 gene mutations: genetic and clinico-pathologic findings in limb-girdle muscular dystrophy. Neuromuscul Disord 11, 547-555 Chan YB, Miguel-Aliaga I, Franks C, Thomas N, Trulzsch B, Sattelle DB, Davies KE, van den Heuvel M (2003) Neuromuscular defects in a Drosophila survival motor neuron gene mutant. Hum Mol Genet 12, 1367-1376

Chang HC, Dimlich DN, Yokokura T, Mukherjee A, Kankel MW, Sen A, Sridhar V, Fulga TA, Hart AC, Van Vactor D, Artavanis-Tsakonas S (2008) Modeling spinal muscular atrophy in Drosophila. PLoS ONE 3, e3209

Charroux B, Pellizzoni L, Perkinson RA, Shevchenko A, Mann M, Dreyfuss G (1999) Gemin3: A novel DEAD box protein that interacts with SMN, the spinal muscular atrophy gene product, and is a component of gems. J Cell Biol 147, 1181-1194

Charroux B, Pellizzoni L, Perkinson RA, Yong J, Shevchenko A, Mann M, Dreyfuss G (2000) Gemin4. A novel component of the SMN complex that is found in both gems and nucleoli. J Cell Biol 148, 1177-1186

Chou SM, Wang HS (1997) Aberrant glycosylation/phosphorylation in chromatolytic motoneurons of Werdnig-Hoffmann disease. J Neurol Sci 152, 198-209

154 Cifuentes-Diaz C, Frugier T, Tiziano FD, Lacene E, Roblot N, Joshi V, Moreau MH, Melki J (2001) Deletion of murine SMN exon 7 directed to skeletal muscle leads to severe muscular dystrophy. J Cell Biol 152, 1107-1114

Cifuentes-Diaz C, Nicole S, Velasco ME, Borra-Cebrian C, Panozzo C, Frugier T, Millet G, Roblot N, Joshi V, Melki J (2002) Neurofilament accumulation at the motor endplate and lack of axonal sprouting in a spinal muscular atrophy mouse model. Hum Mol Genet 11, 1439-1447

Clark KA, McElhinny AS, Beckerle MC, Gregorio CC (2002) Striated muscle cytoarchitecture: an intricate web of form and function. Annu Rev Cell Dev Biol 18, 637- 706

Collier S, Pendle A, Boudonck K, van Rij T, Dolan L, Shaw P (2006) A distant coilin homologue is required for the formation of cajal bodies in Arabidopsis. Mol Biol Cell 17, 2942-2951

Condeelis J, Singer RH (2005) How and why does beta-actin mRNA target? Biol Cell 97, 97-110

Cook AL, Curzon CL, Milazzo AS (2006) An infant with hypoplastic left heart syndrome and spinal muscular atrophy. Cardiol Young 16, 78-80

Corti S, Nizzardo M, Nardini M, Donadoni C, Salani S, Ronchi D, Saladino F, Bordoni A, Fortunato F, Del Bo R, Papadimitriou D, Locatelli F, Menozzi G, Strazzer S, Bresolin N, Comi GP (2008) Neural stem cell transplantation can ameliorate the phenotype of a mouse model of spinal muscular atrophy. J Clin Invest 118, 3316-3330

Cuerrier D, Moldoveanu T, Davies PL (2005) Determination of peptide substrate specificity for mu-calpain by a peptide library-based approach: the importance of primed side interactions. J Biol Chem 280, 40632-40641

Daniels RJ, Campbell L, Rodrigues NR, Francis MJ, Morrison KE, McLean M, MacKenzie A, Ignatius J, Dubowitz V, Davies KE (1995) Genomic rearrangements in childhood spinal muscular atrophy: linkage disequilibrium with a null allele. J Med Genet 32, 93-96

Darzacq X, Jady BE, Verheggen C, Kiss AM, Bertrand E, Kiss T (2002) Cajal body- specific small nuclear RNAs: a novel class of 2'-O-methylation and pseudouridylation guide RNAs. EMBO J 21, 2746-2756

Dayton WR, Goll DE, Zeece MG, Robson RM, Reville WJ (1976a) A Ca2+-activated protease possibly involved in myofibrillar protein turnover. Purification from porcine muscle. Biochemistry 15, 2150-2158

155 Dayton WR, Reville WJ, Goll DE, Stromer MH (1976b) A Ca2+-activated protease possibly involved in myofibrillar protein turnover. Partial characterization of the purified enzyme. Biochemistry 15, 2159-2167

De Bleecker JL, van den Abeele KG, De Reuck JL (1992) Variable involvement of rat skeletal muscles in paraoxon-induced necrotizing myopathy. Res Commun Chem Pathol Pharmacol 75, 309-322

Dean WL, Seufert AC, Schultz GA, Prather RS, Simerly C, Schatten G, Pilch DR, Marzluff WF (1989) The small nuclear RNAs for pre-mRNA splicing are coordinately regulated during oocyte maturation and early embryogenesis in the mouse. Development 106, 325-334 den Engelsman J GD, de Jong WW, Robbins J, Kato K, Boelens WC. (2005) Nuclear import of {alpha}B-crystallin is phosphorylation-dependent and hampered by hyperphosphorylation of the myopathy-related mutant R120G. J Biol Chem 280, 37139- 37148

Di Y, Li J, Zhang Y, He X, Lu H, Xu D, Ling J, Huo K, Wan D, Li YY, Gu J (2003) HCC-associated protein HCAP1, a variant of GEMIN4, interacts with zinc-finger proteins. J Biochem 133, 713-718

DiDonato CJ, Chen XN, Noya D, Korenberg JR, Nadeau JH, Simard LR (1997) Cloning, characterization, and copy number of the murine survival motor neuron gene: homolog of the spinal muscular atrophy-determining gene. Genome Res 7, 339-352

Dingwall C, Palacios I (1998) In vitro systems for the reconstitution of snRNP and protein nuclear import. Methods Cell Biol 53, 517-543

Doran B, Gherbesi N, Hendricks G, Flavell RA, Davis RJ, Gangwani L (2006) Deficiency of the zinc finger protein ZPR1 causes neurodegeneration. Proc Natl Acad Sci U S A 103, 7471-7475

Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G (2003) Numerous microRNPs in neuronal cells containing novel microRNAs. RNA 9, 180-186

Duguez S, Bartoli M, Richard I (2006) Calpain 3: a key regulator of the sarcomere? FEBS J 273, 3427-3436

Dundr M, Hebert MD, Karpova TS, Stanek D, Xu H, Shpargel KB, Meier UT, Neugebauer KM, Matera AG, Misteli T (2004) In vivo kinetics of Cajal body components. J Cell Biol 164, 831-842

Dutt P, Croall DE, Arthur JS, Veyra TD, Williams K, Elce JS, Greer PA (2006) m- Calpain is required for preimplantation embryonic development in mice. BMC Dev Biol 6, 3

156

Eggert C, Chari A, Laggerbauer B, Fischer U (2006) Spinal muscular atrophy: the RNP connection. Trends Mol Med 12, 113-121

El-Matary W, Kotagiri S, Cameron D, Peart I (2004) Spinal muscle atrophy type 1 (Werdnig-Hoffman disease) with complex cardiac malformation. Eur J Pediatr 163, 331- 332

Fakan S, Bernhard W (1971) Localisation of rapidly and slowly labelled nuclear RNA as visualized by high resolution autoradiography. Exp Cell Res 67, 129-141 Fan L, Simard LR (2002) Survival motor neuron (SMN) protein: role in neurite outgrowth and neuromuscular maturation during neuronal differentiation and development. Hum Mol Genet 11, 1605-1614

Fanin M, Nardetto L, Nascimbeni AC, Tasca E, Spinazzi M, Padoan R, Angelini C (2007) Correlations between clinical severity, genotype and muscle pathology in limb girdle muscular dystrophy type 2A. J Med Genet 44, 609-614

Felderhoff-Mueser U, Grohmann K, Harder A, Stadelmann C, Zerres K, Buhrer C, Obladen M (2002) Severe spinal muscular atrophy variant associated with congenital bone fractures. J Child Neurol 17, 718-721

Feldkotter M, Schwarzer V, Wirth R, Wienker TF, Wirth B (2002) Quantitative analyses of SMN1 and SMN2 based on real-time lightCycler PCR: fast and highly reliable carrier testing and prediction of severity of spinal muscular atrophy. Am J Hum Genet 70, 358- 368

Feng W, Gubitz AK, Wan L, Battle DJ, Dostie J, Golembe TJ, Dreyfuss G (2005) Gemins modulate the expression and activity of the SMN complex. Hum Mol Genet 14, 1605-1611

Fischer U, Liu Q, Dreyfuss G (1997) The SMN-SIP1 complex has an essential role in spliceosomal snRNP biogenesis. Cell 90, 1023-1029

Fischer U, Sumpter V, Sekine M, Satoh T, Luhrmann R (1993) Nucleo-cytoplasmic transport of U snRNPs: definition of a nuclear location signal in the Sm core domain that binds a transport receptor independently of the m3G cap. EMBO J 12, 573-583

Frank D, Kuhn C, Katus HA, Frey N (2006) The sarcomeric Z-disc: a nodal point in signalling and disease. J Mol Med 84, 446-468

Friesen WJ, Massenet S, Paushkin S, Wyce A, Dreyfuss G (2001a) SMN, the product of the spinal muscular atrophy gene, binds preferentially to dimethylarginine-containing protein targets. Mol Cell 7, 1111-1117

157 Friesen WJ, Paushkin S, Wyce A, Massenet S, Pesiridis GS, Van Duyne G, Rappsilber J, Mann M, Dreyfuss G (2001b) The methylosome, a 20S complex containing JBP1 and pICln, produces dimethylarginine-modified Sm proteins. Mol Cell Biol 21, 8289-8300

Frugier T, Tiziano FD, Cifuentes-Diaz C, Miniou P, Roblot N, Dierich A, Le Meur M, Melki J (2000) Nuclear targeting defect of SMN lacking the C-terminus in a mouse model of spinal muscular atrophy. Hum Mol Genet 9, 849-858

Fukuda N, Granzier HL, Ishiwata S, Kurihara S (2008) Physiological functions of the giant elastic protein titin in mammalian striated muscle. J Physiol Sci 58, 151-159

Gabanella F, Butchbach ME, Saieva L, Carissimi C, Burghes AH, Pellizzoni L (2007) Ribonucleoprotein assembly defects correlate with spinal muscular atrophy severity and preferentially affect a subset of spliceosomal snRNPs. PLoS ONE 2, e921

Gall JG, Bellini M, Wu Z, Murphy C (1999) Assembly of the nuclear transcription and processing machinery: Cajal bodies (coiled bodies) and transcriptosomes. Mol Biol Cell 10, 4385-4402

Gangwani L, Flavell RA, Davis RJ (2005) ZPR1 is essential for survival and is required for localization of the survival motor neurons (SMN) protein to Cajal bodies. Mol Cell Biol 25, 2744-2756

Gangwani L, Mikrut M, Theroux S, Sharma M, Davis RJ (2001) Spinal muscular atrophy disrupts the interaction of ZPR1 with the SMN protein. Nat Cell Biol 3, 376-383

Gavrilina TO, McGovern VL, Workman E, Crawford TO, Gogliotti RG, DiDonato CJ, Monani UR, Morris GE, Burghes AH (2008) Neuronal SMN expression corrects spinal muscular atrophy in severe SMA mice while muscle-specific SMN expression has no phenotypic effect. Hum Mol Genet 17, 1063-1075

Gillian AL, Svaren J (2004) The Ddx20/DP103 dead box protein represses transcriptional activation by Egr2/Krox-20. J Biol Chem 279, 9056-9063

Gissel H (2005) The role of Ca2+ in muscle cell damage. Ann N Y Acad Sci 1066, 166- 180

Goll DE, Dayton WR, Singh I, Robson RM (1991) Studies of the alpha-actinin/actin interaction in the Z-disk by using calpain. J Biol Chem 266, 8501-8510

Goll DE, Neti G, Mares SW, Thompson VF (2008) Myofibrillar protein turnover: the proteasome and the calpains. J Anim Sci 86, E19-35

Goll DE, Thompson VF, Li H, Wei W, Cong J (2003) The calpain system. Physiol Rev 83, 731-801

158 Green RC, Seyfried TN (1991) Kindling susceptibility and genetic seizure predisposition in inbred mice. Epilepsia 32, 22-26

Grimmler M, Bauer L, Nousiainen M, Korner R, Meister G, Fischer U (2005a) Phosphorylation regulates the activity of the SMN complex during assembly of spliceosomal U snRNPs. EMBO Rep 6, 70-76

Grimmler M, Otter S, Peter C, Muller F, Chari A, Fischer U (2005b) Unrip, a factor implicated in cap-independent translation, associates with the cytosolic SMN complex and influences its intracellular localization. Hum Mol Genet 14, 3099-3111

Grondard C, Biondi O, Armand AS, Lecolle S, Della Gaspera B, Pariset C, Li H, Gallien CL, Vidal PP, Chanoine C, Charbonnier F (2005) Regular exercise prolongs survival in a type 2 spinal muscular atrophy model mouse. J Neurosci 25, 7615-7622

Grundhoff AT, Kremmer E, Tureci O, Glieden A, Gindorf C, Atz J, Mueller-Lantzsch N, Schubach WH, Grasser FA (1999) Characterization of DP103, a novel DEAD box protein that binds to the Epstein-Barr virus nuclear proteins EBNA2 and EBNA3C. J Biol Chem 274, 19136-19144

Gubitz AK, Mourelatos Z, Abel L, Rappsilber J, Mann M, Dreyfuss G (2002) Gemin5, a novel WD repeat protein component of the SMN complex that binds Sm proteins. J Biol Chem 277, 5631-5636

Guettier-Sigrist S, Coupin G, Braun S, Rogovitz D, Courdier I, Warter JM, Poindron P (2001) On the possible role of muscle in the pathogenesis of spinal muscular atrophy. Fundam Clin Pharmacol 15, 31-40

Guettier-Sigrist S, Hugel B, Coupin G, Freyssinet JM, Poindron P, Warter JM (2002) Possible pathogenic role of muscle cell dysfunction in motor neuron death in spinal muscular atrophy. Muscle Nerve 25, 700-708

Haldar SM, Ibrahim OA, Jain MK (2007) Kruppel-like Factors (KLFs) in muscle biology. J Mol Cell Cardiol 43, 1-10

Hannus S, Buhler D, Romano M, Seraphin B, Fischer U (2000) The Schizosaccharomyces pombe protein Yab8p and a novel factor, Yip1p, share structural and functional similarity with the spinal muscular atrophy-associated proteins SMN and SIP1. Hum Mol Genet 9, 663-674

Hao le T, Fuller HR, Lam le T, Le TT, Burghes AH, Morris GE (2007) Absence of gemin5 from SMN complexes in nuclear Cajal bodies. BMC Cell Biol 8, 28

Hasselgren PO, Fischer JE (2001) Muscle cachexia: current concepts of intracellular mechanisms and molecular regulation. Ann Surg 233, 9-17

159 Hebert MD, Shpargel KB, Ospina JK, Tucker KE, Matera AG (2002) Coilin methylation regulates nuclear body formation. Dev Cell 3, 329-337

Hebert MD, Szymczyk PW, Shpargel KB, Matera AG (2001) Coilin forms the bridge between Cajal bodies and SMN, the spinal muscular atrophy protein. Genes Dev 15, 2720-2729

Hsieh-Li HM, Chang JG, Jong YJ, Wu MH, Wang NM, Tsai CH, Li H (2000) A mouse model for spinal muscular atrophy. Nat Genet 24, 66-70

Huber J, Cronshagen U, Kadokura M, Marshallsay C, Wada T, Sekine M, Luhrmann R (1998) Snurportin1, an m3G-cap-specific nuclear import receptor with a novel domain structure. EMBO J 17, 4114-4126

Huber J, Dickmanns A, Luhrmann R (2002) The importin-beta binding domain of snurportin1 is responsible for the Ran- and energy-independent nuclear import of spliceosomal U snRNPs in vitro. J Cell Biol 156, 467-479

Hutvagner G, Zamore PD (2002) A microRNA in a multiple-turnover RNAi enzyme complex. Science 297, 2056-2060

Izaurralde E, Mattaj IW (1995) RNA export. Cell 81, 153-159

Jablonka S, Beck M, Lechner BD, Mayer C, Sendtner M (2007) Defective Ca2+ channel clustering in axon terminals disturbs excitability in motoneurons in spinal muscular atrophy. J Cell Biol 179, 139-149

Jablonka S, Holtmann B, Meister G, Bandilla M, Rossoll W, Fischer U, Sendtner M (2002) Gene targeting of Gemin2 in mice reveals a correlation between defects in the biogenesis of U snRNPs and motoneuron cell death. Proc Natl Acad Sci U S A 99, 10126-10131

Jady BE, Darzacq X, Tucker KE, Matera AG, Bertrand E, Kiss T (2003) Modification of Sm small nuclear RNAs occurs in the nucleoplasmic Cajal body following import from the cytoplasm. EMBO J 22, 1878-1888

Jagoe RT, Goldberg AL (2001) What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? Curr Opin Clin Nutr Metab Care 4, 183-190

Jans DA, Hubner S (1996) Regulation of protein transport to the nucleus: central role of phosphorylation. Physiol Rev 76, 651-685

Jong YJ, Chang JG, Wu JR (1998) Large-scale deletions in a Chinese infant associated with a variant form of Werdnig-Hoffmann disease. Neurology 51, 878-879

160 Kariya S, Park GH, Maeno-Hikichi Y, Leykekhman O, Lutz C, Arkovitz MS, Landmesser LT, Monani UR (2008) Reduced SMN protein impairs maturation of the neuromuscular junctions in mouse models of spinal muscular atrophy. Hum Mol Genet

Kashima T, Manley JL (2003) A negative element in SMN2 exon 7 inhibits splicing in spinal muscular atrophy. Nat Genet 34, 460-463

Keira Y, Noguchi S, Minami N, Hayashi YK, Nishino I (2003) Localization of calpain 3 in human skeletal muscle and its alteration in limb-girdle muscular dystrophy 2A muscle. J Biochem 133, 659-664

Kinali M, Mercuri E, Main M, De Biasia F, Karatza A, Higgins R, Banks LM, Manzur AY, Muntoni F (2002) Pilot trial of albuterol in spinal muscular atrophy. Neurology 59, 609-610

Kiss AM, Jady BE, Darzacq X, Verheggen C, Bertrand E, Kiss T (2002) A Cajal body- specific pseudouridylation guide RNA is composed of two box H/ACA snoRNA-like domains. Nucleic Acids Res 30, 4643-4649

Kiss T (2004) Biogenesis of small nuclear RNPs. J Cell Sci 117, 5949-5951

Kizilates SU, Talim B, Sel K, Kose G, Caglar M (2005) Severe lethal spinal muscular atrophy variant with arthrogryposis. Pediatr Neurol 32, 201-204

Kolb SJ, Battle DJ, Dreyfuss G (2007) Molecular functions of the SMN complex. J Child Neurol 22, 990-994

Kramerova I, Kudryashova E, Tidball JG, Spencer MJ (2004) Null mutation of calpain 3 (p94) in mice causes abnormal sarcomere formation in vivo and in vitro. Hum Mol Genet 13, 1373-1388

Kramerova I, Kudryashova E, Venkatraman G, Spencer MJ (2005) Calpain 3 participates in sarcomere remodeling by acting upstream of the ubiquitin-proteasome pathway. Hum Mol Genet 14, 2125-2134

Kroiss M, Schultz J, Wiesner J, Chari A, Sickmann A, Fischer U (2008) Evolution of an RNP assembly system: a minimal SMN complex facilitates formation of UsnRNPs in Drosophila melanogaster. Proc Natl Acad Sci U S A 105, 10045-10050

Kunkel GR, Maser RL, Calvet JP, Pederson T (1986) U6 small nuclear RNA is transcribed by RNA polymerase III. Proc Natl Acad Sci U S A 83, 8575-8579

Kvist AP, Latvanlehto A, Sund M, Eklund L, Vaisanen T, Hagg P, Sormunen R, Komulainen J, Fassler R, Pihlajaniemi T (2001) Lack of cytosolic and transmembrane domains of type XIII collagen results in progressive myopathy. Am J Pathol 159, 1581- 1592

161

Lange A, Mills RE, Lange CJ, Stewart M, Devine SE, Corbett AH (2007) Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem 282, 5101-5105

Lange S, Ehler E, Gautel M (2006) From A to Z and back? Multicompartment proteins in the sarcomere. Trends Cell Biol 16, 11-18

Le TT, Coovert DD, Monani UR, Morris GE, Burghes AH (2000) The survival motor neuron (SMN) protein: effect of exon loss and mutation on protein localization. Neurogenetics 3, 7-16

Le TT, Pham LT, Butchbach ME, Zhang HL, Monani UR, Coovert DD, Gavrilina TO, Xing L, Bassell GJ, Burghes AH (2005) SMNDelta7, the major product of the centromeric survival motor neuron (SMN2) gene, extends survival in mice with spinal muscular atrophy and associates with full-length SMN. Hum Mol Genet 14, 845-857

Leung AK, Nagai K (2005) Gemin 6 and 7 lend a hand to snRNP assembly. Structure 13, 833-834

Liang WC, Yuo CY, Chang JG, Chen YC, Chang YF, Wang HY, Ju YH, Chiou SS, Jong YJ (2008) The effect of hydroxyurea in spinal muscular atrophy cells and patients. J Neurol Sci 268, 87-94

Liu Q, Fischer U, Wang F, Dreyfuss G (1997) The spinal muscular atrophy disease gene product, SMN, and its associated protein SIP1 are in a complex with spliceosomal snRNP proteins. Cell 90, 1013-1021

Lobo SM, Marzluff WF, Seufert AC, Dean WL, Schultz GA, Simerly C, Schatten G (1988) Localization and expression of U1 RNA in early mouse embryo development. Dev Biol 127, 349-361

Lorson CL, Hahnen E, Androphy EJ, Wirth B (1999) A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. Proc Natl Acad Sci U S A 96, 6307-6311

Lorson MA, Dickson AM, Shaw DJ, Todd AG, Young EC, Morse R, Wolstencroft C, Lorson CL, Young PJ (2008a) Identification and characterisation of a nuclear localisation signal in the SMN associated protein, Gemin4. Biochem Biophys Res Commun 375, 33- 37

Lorson MA, Spate LD, Prather RS, Lorson CL (2008b) Identification and characterization of the porcine (Sus scrofa) survival motor neuron (SMN1) gene: an animal model for therapeutic studies. Dev Dyn 237, 2268-2278

162 Ma Y, Dostie J, Dreyfuss G, Van Duyne GD (2005) The Gemin6-Gemin7 heterodimer from the survival of motor neurons complex has an Sm protein-like structure. Structure 13, 883-892

Marshallsay C, Luhrmann R (1994) In vitro nuclear import of snRNPs: cytosolic factors mediate m3G-cap dependence of U1 and U2 snRNP transport. EMBO J 13, 222-231 Masuyama K, Taniguchi I, Kataoka N, Ohno M (2004) RNA length defines RNA export pathway. Genes Dev 18, 2074-2085

Matera AG (1998) Of coiled bodies, gems, and salmon. J Cell Biochem 70, 181-192 Matera AG, Frey MR, Margelot K, Wolin SL (1995) A perinucleolar compartment contains several RNA polymerase III transcripts as well as the polypyrimidine tract- binding protein, hnRNP I. J Cell Biol 129, 1181-1193

Matera AG, Shpargel KB (2006) Pumping RNA: nuclear bodybuilding along the RNP pipeline. Curr Opin Cell Biol 18, 317-324

Matera AG, Ward DC (1993) Nucleoplasmic organization of small nuclear ribonucleoproteins in cultured human cells. J Cell Biol 121, 715-727

Mattaj IW (1986) Cap trimethylation of U snRNA is cytoplasmic and dependent on U snRNP protein binding. Cell 46, 905-911

Mattaj IW, Zeller R (1983) Xenopus laevis U2 snRNA genes: tandemly repeated transcription units sharing 5' and 3' flanking homology with other RNA polymerase II transcribed genes. EMBO J 2, 1883-1891

McElhinny AS, Kazmierski ST, Labeit S, Gregorio CC (2003) Nebulin: the nebulous, multifunctional giant of striated muscle. Trends Cardiovasc Med 13, 195-201

McGovern VL, Gavrilina TO, Beattie CE, Burghes AH (2008) Embryonic motor axon development in the severe SMA mouse. Hum Mol Genet 17, 2900-2909

McWhorter ML, Boon KL, Horan ES, Burghes AH, Beattie CE (2008) The SMN binding protein Gemin2 is not involved in motor axon outgrowth. Dev Neurobiol 68, 182-194

McWhorter ML, Monani UR, Burghes AH, Beattie CE (2003) Knockdown of the survival motor neuron (Smn) protein in zebrafish causes defects in motor axon outgrowth and pathfinding. J Cell Biol 162, 919-931

Meister G, Buhler D, Pillai R, Lottspeich F, Fischer U (2001a) A multiprotein complex mediates the ATP-dependent assembly of spliceosomal U snRNPs. Nat Cell Biol 3, 945- 949

163 Meister G, Eggert C, Buhler D, Brahms H, Kambach C, Fischer U (2001b) Methylation of Sm proteins by a complex containing PRMT5 and the putative U snRNP assembly factor pICln. Curr Biol 11, 1990-1994

Meister G, Fischer U (2002) Assisted RNP assembly: SMN and PRMT5 complexes cooperate in the formation of spliceosomal UsnRNPs. EMBO J 21, 5853-5863

Menke LA, Poll-The BT, Clur SA, Bilardo CM, van der Wal AC, Lemmink HH, Cobben JM (2008) Congenital heart defects in spinal muscular atrophy type I: a clinical report of two siblings and a review of the literature. Am J Med Genet A 146A, 740-744

Mercuri E, Bertini E, Messina S, Pelliccioni M, D'Amico A, Colitto F, Mirabella M, Tiziano FD, Vitali T, Angelozzi C, Kinali M, Main M, Brahe C (2004) Pilot trial of phenylbutyrate in spinal muscular atrophy. Neuromuscul Disord 14, 130-135

Miguel-Aliaga I, Chan YB, Davies KE, van den Heuvel M (2000) Disruption of SMN function by ectopic expression of the human SMN gene in Drosophila. FEBS Lett 486, 99-102

Miguel-Aliaga I, Culetto E, Walker DS, Baylis HA, Sattelle DB, Davies KE (1999) The Caenorhabditis elegans orthologue of the human gene responsible for spinal muscular atrophy is a maternal product critical for germline maturation and embryonic viability. Hum Mol Genet 8, 2133-2143

Mishra AK, Gangwani L, Davis RJ, Lambright DG (2007) Structural insights into the interaction of the evolutionarily conserved ZPR1 domain tandem with eukaryotic EF1A, receptors, and SMN complexes. Proc Natl Acad Sci U S A 104, 13930-13935

Moller P, Moe N, Saugstad OD, Skullerud K, Velken M, Berg K, Nitter-Hauge S, Borresen AL (1990) Spinal muscular atrophy type I combined with atrial septal defect in three sibs. Clin Genet 38, 81-83

Monani UR (2005) Spinal muscular atrophy: a deficiency in a ubiquitous protein; a motor neuron-specific disease. Neuron 48, 885-896

Monani UR, Coovert DD, Burghes AH (2000a) Animal models of spinal muscular atrophy. Hum Mol Genet 9, 2451-2457

Monani UR, Lorson CL, Parsons DW, Prior TW, Androphy EJ, Burghes AH, McPherson JD (1999) A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2. Hum Mol Genet 8, 1177-1183

Monani UR, Pastore MT, Gavrilina TO, Jablonka S, Le TT, Andreassi C, DiCocco JM, Lorson C, Androphy EJ, Sendtner M, Podell M, Burghes AH (2003) A transgene carrying an A2G missense mutation in the SMN gene modulates phenotypic severity in mice with severe (type I) spinal muscular atrophy. J Cell Biol 160, 41-52

164

Monani UR, Sendtner M, Coovert DD, Parsons DW, Andreassi C, Le TT, Jablonka S, Schrank B, Rossoll W, Prior TW, Morris GE, Burghes AH (2000b) The human centromeric survival motor neuron gene (SMN2) rescues embryonic lethality in Smn(-/-) mice and results in a mouse with spinal muscular atrophy. Hum Mol Genet 9, 333-339

Morris EJ, Fulton AB (1994) Rearrangement of mRNAs for costamere proteins during costamere development in cultured skeletal muscle from chicken. J Cell Sci 107 ( Pt 3), 377-386

Morris GE (2008) The Cajal body. Biochim Biophys Acta 1783, 2108-2115

Mouaikel J, Narayanan U, Verheggen C, Matera AG, Bertrand E, Tazi J, Bordonne R (2003) Interaction between the small-nuclear-RNA cap hypermethylase and the spinal muscular atrophy protein, survival of motor neuron. EMBO Rep 4, 616-622

Mouaikel J, Verheggen C, Bertrand E, Tazi J, Bordonne R (2002) Hypermethylation of the cap structure of both yeast snRNAs and snoRNAs requires a conserved methyltransferase that is localized to the nucleolus. Mol Cell 9, 891-901

Mouillet JF, Yan X, Ou Q, Jin L, Muglia LJ, Crawford PA, Sadovsky Y (2008) DEAD- box protein-103 (DP103, Ddx20) is essential for early embryonic development and modulates ovarian morphology and function. Endocrinology 149, 2168-2175

Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G (2002) miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev 16, 720-728

Mulleners WM, van Ravenswaay CM, Gabreels FJ, Hamel BC, van Oort A, Sengers RC (1996) Spinal muscular atrophy combined with congenital heart disease: a report of two cases. Neuropediatrics 27, 333-334

Murphy JT, Burgess RR, Dahlberg JE, Lund E (1982) Transcription of a gene for human U1 small nuclear RNA. Cell 29, 265-274

Nakano S, Engel AG, Waclawik AJ, Emslie-Smith AM, Busis NA (1996) Myofibrillar myopathy with abnormal foci of desmin positivity. I. Light and electron microscopy analysis of 10 cases. J Neuropathol Exp Neurol 55, 549-562

Narayanan U, Achsel T, Luhrmann R, Matera AG (2004) Coupled in vitro import of U snRNPs and SMN, the spinal muscular atrophy protein. Mol Cell 16, 223-234

Narayanan U, Ospina JK, Frey MR, Hebert MD, Matera AG (2002) SMN, the spinal muscular atrophy protein, forms a pre-import snRNP complex with snurportin1 and importin beta. Hum Mol Genet 11, 1785-1795

165 Nelson PT, Hatzigeorgiou AG, Mourelatos Z (2004) miRNP:mRNA association in polyribosomes in a human neuronal cell line. RNA 10, 387-394

Nesic D, Tanackovic G, Kramer A (2004) A role for Cajal bodies in the final steps of U2 snRNP biogenesis. J Cell Sci 117, 4423-4433

Neuenkirchen N, Chari A, Fischer U (2008) Deciphering the assembly pathway of Sm- class U snRNPs. FEBS Lett 582, 1997-2003

Nicole S, Desforges B, Millet G, Lesbordes J, Cifuentes-Diaz C, Vertes D, Cao ML, De Backer F, Languille L, Roblot N, Joshi V, Gillis JM, Melki J (2003) Intact satellite cells lead to remarkable protection against Smn gene defect in differentiated skeletal muscle. J Cell Biol 161, 571-582

Nishimura AL, Mitne-Neto M, Silva HC, Richieri-Costa A, Middleton S, Cascio D, Kok F, Oliveira JR, Gillingwater T, Webb J, Skehel P, Zatz M (2004) A mutation in the vesicle-trafficking protein VAPB causes late-onset spinal muscular atrophy and amyotrophic lateral sclerosis. Am J Hum Genet 75, 822-831

Nury D, Doucet C, Coux O (2007) Roles and potential therapeutic targets of the ubiquitin proteasome system in muscle wasting. BMC Biochem 8 Suppl 1, S7

Ogawa C, Usui K, Aoki M, Ito F, Itoh M, Kai C, Kanamori-Katayama M, Hayashizaki Y, Suzuki H (2007) Gemin2 plays an important role in stabilizing the survival of motor neuron complex. J Biol Chem 282, 11122-11134

Ohno M, Segref A, Bachi A, Wilm M, Mattaj IW (2000) PHAX, a mediator of U snRNA nuclear export whose activity is regulated by phosphorylation. Cell 101, 187-198

Oprea GE, Krober S, McWhorter ML, Rossoll W, Muller S, Krawczak M, Bassell GJ, Beattie CE, Wirth B (2008) Plastin 3 is a protective modifier of autosomal recessive spinal muscular atrophy. Science 320, 524-527

Oskoui M, Kaufmann P (2008) Spinal muscular atrophy. Neurotherapeutics 5, 499-506

Ospina JK, Gonsalvez GB, Bednenko J, Darzynkiewicz E, Gerace L, Matera AG (2005) Cross-talk between snurportin1 subdomains. Mol Biol Cell 16, 4660-4671

Otter S, Grimmler M, Neuenkirchen N, Chari A, Sickmann A, Fischer U (2007) A comprehensive interaction map of the human survival of motor neuron (SMN) complex. J Biol Chem 282, 5825-5833

Ou Q, Mouillet JF, Yan X, Dorn C, Crawford PA, Sadovsky Y (2001) The DEAD box protein DP103 is a regulator of steroidogenic factor-1. Mol Endocrinol 15, 69-79

166 Owen N, Doe CL, Mellor J, Davies KE (2000) Characterization of the Schizosaccharomyces pombe orthologue of the human survival motor neuron (SMN) protein. Hum Mol Genet 9, 675-684

Pacheco A, de Quinto SL, Ramajo J, Fernandez N, Martinez-Salas E (2008) A novel role for Gemin5 in mRNA translation. Nucleic Acids Res

Park JW, Voss PG, Grabski S, Wang JL, Patterson RJ (2001) Association of galectin-1 and galectin-3 with Gemin4 in complexes containing the SMN protein. Nucleic Acids Res 29, 3595-3602

Paushkin S, Charroux B, Abel L, Perkinson RA, Pellizzoni L, Dreyfuss G (2000) The survival motor neuron protein of Schizosacharomyces pombe. Conservation of survival motor neuron interaction domains in divergent organisms. J Biol Chem 275, 23841- 23846

Pellizzoni L (2007) Chaperoning ribonucleoprotein biogenesis in health and disease. EMBO Rep 8, 340-345

Pellizzoni L, Baccon J, Rappsilber J, Mann M, Dreyfuss G (2002a) Purification of native survival of motor neurons complexes and identification of Gemin6 as a novel component. J Biol Chem 277, 7540-7545

Pellizzoni L, Charroux B, Dreyfuss G (1999) SMN mutants of spinal muscular atrophy patients are defective in binding to snRNP proteins. Proc Natl Acad Sci U S A 96, 11167- 11172

Pellizzoni L, Yong J, Dreyfuss G (2002b) Essential role for the SMN complex in the specificity of snRNP assembly. Science 298, 1775-1779

Plessel G, Fischer U, Luhrmann R (1994) m3G cap hypermethylation of U1 small nuclear ribonucleoprotein (snRNP) in vitro: evidence that the U1 small nuclear RNA- (guanosine-N2)-methyltransferase is a non-snRNP cytoplasmic protein that requires a binding site on the Sm core domain. Mol Cell Biol 14, 4160-4172

Pu WT, Krapivinsky GB, Krapivinsky L, Clapham DE (1999) pICln inhibits snRNP biogenesis by binding core spliceosomal proteins. Mol Cell Biol 19, 4113-4120

Pyle WG, Solaro RJ (2004) At the crossroads of myocardial signaling: the role of Z-discs in intracellular signaling and cardiac function. Circ Res 94, 296-305

Rajendra TK, Gonsalvez GB, Walker MP, Shpargel KB, Salz HK, Matera AG (2007) A Drosophila melanogaster model of spinal muscular atrophy reveals a function for SMN in striated muscle. J Cell Biol 176, 831-841

167 Raska I, Andrade LE, Ochs RL, Chan EK, Chang CM, Roos G, Tan EM (1991) Immunological and ultrastructural studies of the nuclear coiled body with autoimmune antibodies. Exp Cell Res 195, 27-37

Richard I, Broux O, Allamand V, Fougerousse F, Chiannilkulchai N, Bourg N, Brenguier L, Devaud C, Pasturaud P, Roudaut C, et al. (1995) Mutations in the proteolytic enzyme calpain 3 cause limb-girdle muscular dystrophy type 2A. Cell 81, 27-40 Richard P, Darzacq X, Bertrand E, Jady BE, Verheggen C, Kiss T (2003) A common sequence motif determines the Cajal body-specific localization of box H/ACA scaRNAs. EMBO J 22, 4283-4293

Rodrigues NR, Owen N, Talbot K, Ignatius J, Dubowitz V, Davies KE (1995) Deletions in the survival motor neuron gene on 5q13 in autosomal recessive spinal muscular atrophy. Hum Mol Genet 4, 631-634

Rossoll W, Jablonka S, Andreassi C, Kroning AK, Karle K, Monani UR, Sendtner M (2003) Smn, the spinal muscular atrophy-determining gene product, modulates axon growth and localization of beta-actin mRNA in growth cones of motoneurons. J Cell Biol 163, 801-812

Rossoll W, Kroning AK, Ohndorf UM, Steegborn C, Jablonka S, Sendtner M (2002) Specific interaction of Smn, the spinal muscular atrophy determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: a role for Smn in RNA processing in motor axons? Hum Mol Genet 11, 93-105

Russman BS (2007) Spinal muscular atrophy: clinical classification and disease heterogeneity. J Child Neurol 22, 946-951

Russman BS, Iannaccone ST, Samaha FJ (2003) A phase 1 trial of riluzole in spinal muscular atrophy. Arch Neurol 60, 1601-1603

Sakai K, Akanuma H, Imahori K, Kawashima S (1987) A unique specificity of a calcium activated neutral protease indicated in histone hydrolysis. J Biochem 101, 911-918

Schlenstedt G (1996) Protein import into the nucleus. FEBS Lett 389, 75-79

Schrank B, Gotz R, Gunnersen JM, Ure JM, Toyka KV, Smith AG, Sendtner M (1997) Inactivation of the survival motor neuron gene, a candidate gene for human spinal muscular atrophy, leads to massive cell death in early mouse embryos. Proc Natl Acad Sci U S A 94, 9920-9925

Segref A, Mattaj IW, Ohno M (2001) The evolutionarily conserved region of the U snRNA export mediator PHAX is a novel RNA-binding domain that is essential for U snRNA export. RNA 7, 351-360

168 Seipelt RL, Zheng B, Asuru A, Rymond BC (1999) U1 snRNA is cleaved by RNase III and processed through an Sm site-dependent pathway. Nucleic Acids Res 27, 587-595 Selcen D, Engel AG (2004) Mutations in myotilin cause myofibrillar myopathy. Neurology 62, 1363-1371

Shafey D, Cote PD, Kothary R (2005) Hypomorphic Smn knockdown C2C12 myoblasts reveal intrinsic defects in myoblast fusion and myotube morphology. Exp Cell Res 311, 49-61

Sharma A, Lambrechts A, Hao le T, Le TT, Sewry CA, Ampe C, Burghes AH, Morris GE (2005) A role for complexes of survival of motor neurons (SMN) protein with gemins and profilin in neurite-like cytoplasmic extensions of cultured nerve cells. Exp Cell Res 309, 185-197

Shpargel KB, Matera AG (2005) Gemin proteins are required for efficient assembly of Sm-class ribonucleoproteins. Proc Natl Acad Sci U S A 102, 17372-17377

Shpargel KB, Praveen K, Rajendra TK, Matera AG (2008) Gemin3 Is an Essential Gene Required for Larval Motor Function and Pupation in Drosophila. Mol Biol Cell Simic G, Mladinov M, Seso Simic D, Jovanov Milosevic N, Islam A, Pajtak A, Barisic N, Sertic J, Lucassen PJ, Hof PR, Kruslin B (2008) Abnormal motoneuron migration, differentiation, and axon outgrowth in spinal muscular atrophy. Acta Neuropathol 115, 313-326

Simic G, Seso-Simic D, Lucassen PJ, Islam A, Krsnik Z, Cviko A, Jelasic D, Barisic N, Winblad B, Kostovic I, Kruslin B (2000) Ultrastructural analysis and TUNEL demonstrate motor neuron apoptosis in Werdnig-Hoffmann disease. J Neuropathol Exp Neurol 59, 398-407

Singh NN, Androphy EJ, Singh RN (2004) An extended inhibitory context causes skipping of exon 7 of SMN2 in spinal muscular atrophy. Biochem Biophys Res Commun 315, 381-388

Singh SK, Pal Bhadra M, Girschick HJ, Bhadra U (2008) MicroRNAs - micro in size but macro in function. FEBS J Sjoblom B, Salmazo A, Djinovic-Carugo K (2008) Alpha-actinin structure and regulation. Cell Mol Life Sci 65, 2688-2701

Smith M, Calabro V, Chong B, Gardiner N, Cowie S, du Sart D (2007) Population screening and cascade testing for carriers of SMA. Eur J Hum Genet 15, 759-766 Solomon V, Goldberg AL (1996) Importance of the ATP-ubiquitin-proteasome pathway in the degradation of soluble and myofibrillar proteins in rabbit muscle extracts. J Biol Chem 271, 26690-26697

Sorimachi H, Kinbara K, Kimura S, Takahashi M, Ishiura S, Sasagawa N, Sorimachi N, Shimada H, Tagawa K, Maruyama K, et al. (1995) Muscle-specific calpain, p94,

169 responsible for limb girdle muscular dystrophy type 2A, associates with connectin through IS2, a p94-specific sequence. J Biol Chem 270, 31158-31162

Sperling J, Azubel M, Sperling R (2008) Structure and function of the Pre-mRNA splicing machine. Structure 16, 1605-1615

Spiegel R, Hagmann A, Boltshauser E, Moser H (1996) [Molecular genetic diagnosis and deletion analysis in Type I-III spinal muscular atrophy]. Schweiz Med Wochenschr 126, 907-914

Stabach PR, Cianci CD, Glantz SB, Zhang Z, Morrow JS (1997) Site-directed mutagenesis of alpha II spectrin at codon 1175 modulates its mu-calpain susceptibility. Biochemistry 36, 57-65

Starling A, de Paula F, Silva H, Vainzof M, Zatz M (2003) Calpainopathy: how broad is the spectrum of clinical variability? J Mol Neurosci 21, 233-236

Stockholm D, Bartoli M, Sillon G, Bourg N, Davoust J, Richard I (2005) Imaging calpain protease activity by multiphoton FRET in living mice. J Mol Biol 346, 215-222

Sumner CJ (2007) Molecular mechanisms of spinal muscular atrophy. J Child Neurol 22, 979-989

Sun J, Xu H, Subramony SH, Hebert MD (2005) Interactions between coilin and PIASy partially link Cajal bodies to PML bodies. J Cell Sci 118, 4995-5003

Sussman MA, Baque S, Uhm CS, Daniels MP, Price RL, Simpson D, Terracio L, Kedes L (1998) Altered expression of tropomodulin in cardiomyocytes disrupts the sarcomeric structure of myofibrils. Circ Res 82, 94-105

Tagawa K, Taya C, Hayashi Y, Nakagawa M, Ono Y, Fukuda R, Karasuyama H, Toyama-Sorimachi N, Katsui Y, Hata S, Ishiura S, Nonaka I, Seyama Y, Arahata K, Yonekawa H, Sorimachi H, Suzuki K (2000) Myopathy phenotype of transgenic mice expressing active site-mutated inactive p94 skeletal muscle-specific calpain, the gene product responsible for limb girdle muscular dystrophy type 2A. Hum Mol Genet 9, 1393-1402

Taillandier D, Aurousseau E, Meynial-Denis D, Bechet D, Ferrara M, Cottin P, Ducastaing A, Bigard X, Guezennec CY, Schmid HP, et al. (1996) Coordinate activation of lysosomal, Ca 2+-activated and ATP-ubiquitin-dependent proteinases in the unweighted rat soleus muscle. Biochem J 316 ( Pt 1), 65-72

Tompa P, Buzder-Lantos P, Tantos A, Farkas A, Szilagyi A, Banoczi Z, Hudecz F, Friedrich P (2004) On the sequential determinants of calpain cleavage. J Biol Chem 279, 20775-20785

170 Tucker KE, Berciano MT, Jacobs EY, LePage DF, Shpargel KB, Rossire JJ, Chan EK, Lafarga M, Conlon RA, Matera AG (2001) Residual Cajal bodies in coilin knockout mice fail to recruit Sm snRNPs and SMN, the spinal muscular atrophy gene product. J Cell Biol 154, 293-307

Tucker KE, Massello LK, Gao L, Barber TJ, Hebert MD, Chan EK, Matera AG (2000) Structure and characterization of the murine p80 coilin gene, Coil. J Struct Biol 129, 269- 277

Vaidla E, Talvik I, Kulla A, Sibul H, Maasalu K, Metsvaht T, Piirsoo A, Talvik T (2007) Neonatal spinal muscular atrophy type 1 with bone fractures and heart defect. J Child Neurol 22, 67-70 van Bergeijk J, Rydel-Konecke K, Grothe C, Claus P (2007) The spinal muscular atrophy gene product regulates neurite outgrowth: importance of the C terminus. FASEB J 21, 1492-1502

Vitte JM, Davoult B, Roblot N, Mayer M, Joshi V, Courageot S, Tronche F, Vadrot J, Moreau MH, Kemeny F, Melki J (2004) Deletion of murine Smn exon 7 directed to liver leads to severe defect of liver development associated with iron overload. Am J Pathol 165, 1731-1741

Wan L, Battle DJ, Yong J, Gubitz AK, Kolb SJ, Wang J, Dreyfuss G (2005) The survival of motor neurons protein determines the capacity for snRNP assembly: biochemical deficiency in spinal muscular atrophy. Mol Cell Biol 25, 5543-5551

Wang J, Dreyfuss G (2001) A cell system with targeted disruption of the SMN gene: functional conservation of the SMN protein and dependence of Gemin2 on SMN. J Biol Chem 276, 9599-9605

Wang J, Maldonado MA (2006) The ubiquitin-proteasome system and its role in inflammatory and autoimmune diseases. Cell Mol Immunol 3, 255-261

Wirth B (2000) An update of the mutation spectrum of the survival motor neuron gene (SMN1) in autosomal recessive spinal muscular atrophy (SMA). Hum Mutat 15, 228-237

Wirth B, Brichta L, Hahnen E (2006) Spinal muscular atrophy: from gene to therapy. Semin Pediatr Neurol 13, 121-131

Wirth B, Hahnen E, Morgan K, DiDonato CJ, Dadze A, Rudnik-Schoneborn S, Simard LR, Zerres K, Burghes AH (1995) Allelic association and deletions in autosomal recessive proximal spinal muscular atrophy: association of marker genotype with disease severity and candidate cDNAs. Hum Mol Genet 4, 1273-1284

Witt CC, Witt SH, Lerche S, Labeit D, Back W, Labeit S (2008) Cooperative control of striated muscle mass and metabolism by MuRF1 and MuRF2. EMBO J 27, 350-360

171 Wu HY, Lynch DR (2006) Calpain and synaptic function. Mol Neurobiol 33, 215-236 Yan X, Mouillet JF, Ou Q, Sadovsky Y (2003) A novel domain within the DEAD-box protein DP103 is essential for transcriptional repression and helicase activity. Mol Cell Biol 23, 414-423

Yong J, Golembe TJ, Battle DJ, Pellizzoni L, Dreyfuss G (2004) snRNAs contain specific SMN-binding domains that are essential for snRNP assembly. Mol Cell Biol 24, 2747-2756

Young PJ, Le TT, Dunckley M, Nguyen TM, Burghes AH, Morris GE (2001) Nuclear gems and Cajal (coiled) bodies in fetal tissues: nucleolar distribution of the spinal muscular atrophy protein, SMN. Exp Cell Res 265, 252-261

Young PJ, Le TT, thi Man N, Burghes AH, Morris GE (2000) The relationship between SMN, the spinal muscular atrophy protein, and nuclear coiled bodies in differentiated tissues and cultured cells. Exp Cell Res 256, 365-374

Zapletalova E, Hedvicakova P, Kozak L, Vondracek P, Gaillyova R, Marikova T, Kalina Z, Juttnerova V, Fajkus J, Fajkusova L (2007) Analysis of point mutations in the SMN1 gene in SMA patients bearing a single SMN1 copy. Neuromuscul Disord 17, 476-481

Zerres K, Wirth B, Rudnik-Schoneborn S (1997) Spinal muscular atrophy--clinical and genetic correlations. Neuromuscul Disord 7, 202-207

Zhang H, Xing L, Rossoll W, Wichterle H, Singer RH, Bassell GJ (2006) Multiprotein complexes of the survival of motor neuron protein SMN with Gemins traffic to neuronal processes and growth cones of motor neurons. J Neurosci 26, 8622-8632

Zhang HL, Pan F, Hong D, Shenoy SM, Singer RH, Bassell GJ (2003) Active transport of the survival motor neuron protein and the role of exon-7 in cytoplasmic localization. J Neurosci 23, 6627-6637

Zimmerman UJ, Boring L, Pak JH, Mukerjee N, Wang KK (2000) The calpain small subunit gene is essential: its inactivation results in embryonic lethality. IUBMB Life 50, 63-68

172