Phylogenetic Analysis of Microlicieae (Melastomataceae), with Emphasis

applyparastyle “fig//caption/p[1]” parastyle “FigCapt”

Botanical Journal of the Linnean Society, 2021, 197, 35–60. With 6 figures.

Phylogenetic analysis of Microlicieae (Melastomataceae), with emphasis on the re-circumscription of the large genus Microlicia Keywords=Keywords=Keywords_First=Keywords 1, 2 3 HeadA=HeadB=HeadA=HeadB/HeadA ANA FLÁVIA ALVES VERSIANE *, ROSANA ROMERO , MARCELO REGINATO , Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 2 4 HeadB=HeadC=HeadB=HeadC/HeadB CASSIANO A. DORNELES WELKER , FABIÁN A. MICHELANGELI and RENATO GOLDENBERG5 HeadC=HeadD=HeadC=HeadD/HeadC Extract3=HeadA=Extract1=HeadA 1Programa de Pós-Graduação em Biologia Vegetal, Departamento de Biologia Vegetal, Universidade REV_HeadA=REV_HeadB=REV_HeadA=REV_HeadB/HeadA Estadual de Campinas, Rua Monteiro Lobato 255, Campinas, São Paulo, 13083–862, Brazil 2 REV_HeadB=REV_HeadC=REV_HeadB=REV_HeadC/HeadB Instituto de Biologia, Universidade Federal de Uberlândia, Rua Ceará s/n, Uberlândia, Minas Gerais, 38400–902, Brazil REV_HeadC=REV_HeadD=REV_HeadC=REV_HeadD/HeadC 3Departamento de Botânica, Universidade Federal do Rio Grande do Sul, Avenida Bento Gonçalves REV_Extract3=REV_HeadA=REV_Extract1=REV_HeadA 9500, Porto Alegre, Rio Grande do Sul, 91509–900, Brazil BOR_HeadA=BOR_HeadB=BOR_HeadA=BOR_HeadB/HeadA 4Institute of Systematic Botany, The New York Botanical Garden, Bronx, NY 10458–5126, USA BOR_HeadB=BOR_HeadC=BOR_HeadB=BOR_HeadC/HeadB 5Departamento de Botânica, Universidade Federal do Paraná, Avenida Coronel Francisco H. dos Santos BOR_HeadC=BOR_HeadD=BOR_HeadC=BOR_HeadD/HeadC 100, Curitiba, Paraná, 81531–970, Brazil BOR_Extract3=BOR_HeadA=BOR_Extract1=BOR_HeadA Received 8 April 2020; revised 3 August 2020; accepted for publication 14 January 2021 EDI_HeadA=EDI_HeadB=EDI_HeadA=EDI_HeadB/HeadA EDI_HeadB=EDI_HeadC=EDI_HeadB=EDI_HeadC/HeadB EDI_HeadC=EDI_HeadD=EDI_HeadC=EDI_HeadD/HeadC Microlicieae are a monophyletic tribe comprising seven genera: Chaetostoma, Lavoisiera, Microlicia s.s., Poteranthera, EDI_Extract3=EDI_HeadA=EDI_Extract1=EDI_HeadA Rhynchanthera, Stenodon and Trembleya. Microlicia s.s. includes 172 species predominantly distributed in the campo rupestre of Brazil. Its delimitation is complex because the generic boundaries, mostly with Lavoisiera and CORI_HeadA=CORI_HeadB=CORI_HeadA=CORI_HeadB/HeadA Trembleya, are unclear. Here we present a phylogenetic analysis for Microlicieae focusing on Microlicia s.s., with the CORI_HeadB=CORI_HeadC=CORI_HeadB=CORI_HeadC/HeadB specific goals: (1) to test the monophyly of Microlicia s.s.; (2) to investigate morphological characters that could help CORI_HeadC=CORI_HeadD=CORI_HeadC=CORI_HeadD/HeadC in circumscribing clades and/or genera in the tribe and (3) to provide an appropriate classification for Microlicia CORI_Extract3=CORI_HeadA=CORI_Extract1=CORI_HeadA s.s. and related genera. This study was based on plastid (atpF-atpH, trnS-trnG), nuclear ribosomal (nrITS, nrETS) and nuclear low-copy (waxy) DNA sequences, through maximum likelihood and Bayesian inference analyses. ERR_HeadA=ERR_HeadB=ERR_HeadA=ERR_HeadB/HeadA The history of 12 morphological characters was estimated based on ancestral state reconstruction analyses. Our ERR_HeadB=ERR_HeadC=ERR_HeadB=ERR_HeadC/HeadB analysis shows Microlicia s.s. to be paraphyletic with Chaetostoma, Lavoisiera, Stenodon and Trembleya nested in ERR_HeadC=ERR_HeadD=ERR_HeadC=ERR_HeadD/HeadC it. Most characters traditionally used to diagnose these genera are homoplastic. We propose the inclusion of these four genera in a broadly circumscribed Microlicia s.l., and provide new combinations and names for their species. ERR_Extract3=ERR_HeadA=ERR_Extract1=ERR_HeadA As here defined, Microlicieae has three genera, Rhynchanthera, Poteranthera and Microlicia s.l., Microlicia s.l. INRE_HeadA=INRE_HeadB=INRE_HeadA=INRE_HeadB/HeadA being the fourth richest genus in Melastomataceae with c. 245 species. INRE_HeadB=INRE_HeadC=INRE_HeadB=INRE_HeadC/HeadB ADDITIONAL KEYWORDS: campo rupestre – Chaetostoma – Lavoisiera – paraphyletic – phylogenetic – INRE_HeadC=INRE_HeadD=INRE_HeadC=INRE_HeadD/HeadC Poteranthera – Rhynchanthera – Stenodon – treespace – Trembleya. INRE_Extract3=INRE_HeadA=INRE_Extract1=INRE_HeadA App_Head=App_HeadA=App_Head=App_HeadA/App_Head BList1=SubBList1=BList1=SubBList INTRODUCTION phylogenetic relationships among species that can then be used to construct classifications consistent with BList1=SubBList3=BList1=SubBList2 Taxonomic classifications based on classical evolutionary processes and taxa that share common morphological approaches do not always reflect the SubBList1=SubSubBList3=SubBList1=SubSubBList2 ancestors; this phylogenetic approach based on molecular natural relationships between organisms (Egan, SubSubBList3=SubBList=SubSubBList=SubBList data has been effective in informing the classification Vatanparast & Cagle, 2016). Molecular sequences of large and complex groups such as Myrtaceae (Lucas SubSubBList2=SubBList=SubSubBList=SubBList provide an independent source of data for understanding SubBList2=BList=SubBList=BList et al., 2007, 2018; Mazine et al., 2014; Bünger et al., 2016; Amorim et al., 2019), Orchidaceae (Chase et al., 2015; *Corresponding author. E-mail: [email protected] Tang et al., 2015; D’haijère et al., 2019) and Poaceae

(Soreng et al., 2015). In Melastomataceae, it has been flowers solitary or in inflorescences, number of petals, applied successfully to recent advances and taxonomic number of locules in the ovary, capsule dehiscence realignments across different tribes (e.g. Penneys et al., (basipetal or acropetal) and the persistence of the 2010, 2020; Michelangeli et al., 2011, 2013, 2016, 2018; columella (Almeda & Martins, 2001; Fritsch et al., Rocha et al. 2016a; Veranso-Libalah et al., 2017; Bacci, 2004; Fidanza et al., 2013; Martins & Almeda, 2017). Michelangeli & Goldenberg, 2019; Bochorny et al., 2019; The morphological delimitation of the remaining Guimarães et al., 2019). genera, Chaetostoma, Poteranthera, Rhynchanthera Melastomataceae are among the largest tropical and Stenodon, is clearer than between Microlicia plant families worldwide with 177 genera and 5750 s.s., Lavoisiera and Trembleya. Chaetostoma can be species (Michelangeli et al., 2021), and Microlicieae recognized by the crown of bristles on the hypanthium

are one of the major tribes in the family. Currently, apex (Koschnitzke & Martins, 2006; Silva et al., 2018). Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 Microlicieae include 265 species in seven genera: Poteranthera are small annual herbs with glandular Chaetostoma DC. (12 accepted species), Lavoisiera hairs on the leaf margins (Kriebel, 2012; Rocha et al., DC. (41 species), Microlicia D.Don (172 species), 2016b; Almeda & Pacifico, 2018). Rhynchanthera can Poteranthera Bong. (five species), Rhynchanthera DC. be easily distinguished by its haplostemonous flowers (nom. cons.) (15 species), Stenodon Naudin (two species) with staminodia (Renner, 1990). Finally, Stenodon and Trembleya DC. (18 species) (Renner, 1990; Rocha has thick, woody, decorticating branches and et al., 2016b; Martins & Almeda, 2017; Silva et al., stamens with an inconspicuous ventral appendage 2018; Pacifico et al., 2019; Pacifico & Almeda, 2020; (Fritsch et al., 2004). Pacifico & Fidanza, 2021; Romero et al., 2021) (Fig. 1). Due to its high diversity, Microlicia s.s. shows non- Microlicieae are monophyletic (Clausing & Renner, exclusive and/or polymorphic characters that are 2001; Fritsch et al., 2004; Michelangeli et al., 2013; usually not informative for its recognition, particularly Rocha et al., 2016a, b), with a recent diversification when compared to Lavoisiera and Trembleya. At and a distribution nearly endemic to Brazil (Fritsch present, Microlicia s.s. can be recognized by its et al., 2004; Simon et al., 2009). solitary flowers that are usually pentamerous (seldom Microlicia s.s. is the largest genus of Microlicieae, hexamerous or octamerous), the hypanthium apex with > 170 species and a predominant distribution in lacking bristles, isomorphic to dimorphic stamens, the campo rupestre and cerrado of Brazil, both in the tetrasporangiate or polysporangiate anthers, three Brazilian Cerrado domain (Romero et al., 2021). Ten locular ovary with a glabrous apex, and fruits with species can be found in the Andes and Guiana Shield basipetal dehiscence and a deciduous columella areas; these occur in Bolivia (Microlicia arenariifolia (Almeda & Martins, 2001; Romero, 2003). DC., M. weddellii Naudin and M. woodii R.B.Pacifico, Most of our current phylogenetic understanding Almeda & Fidanza), Colombia (M. colombiana on the tribe stems from Fritsch et al. (2004). In this Humberto-Mend. & R.Romero), Peru (M. sphagnicola work, Rhynchanthera was recovered as sister to the Gleason), Venezuela (M. guanayana Wurdack), Bolivia remaining genera, and Lavoisiera and Trembleya and Peru (M. peruviana Cogn.), Bolivia and Brazil (M. were recovered as well-supported clades. The insignis Schtl. and M. windischii Versiane, D.Nunes position of the remaining genera, Chaetostoma, & R.Romero), and Brazil, Guyana and Venezuela (M. Microlicia s.s. and Stenodon, were weakly supported. benthamiana Triana) (Wurdack, 1958; Romero, 2003; This same study also showed that more samples Mendoza-Cifuentes et al., 2019; Pacifico et al., 2020; and more phylogenetically informative data were Versiane et al., 2020). From now on, we will refer to required to confirm the monophyly of these genera Microlicia as traditionally circumscribed as Microlicia and the relationships between them. Poteranthera s.s., for clarity and practical reasons, as we recommend was not sampled by Fritsch et al. (2004) since it was re-circumscription of the genus later. previously excluded from Microlicieae and included As morphological studies have advanced in Microlicia in Melastomateae by Renner (1993) and Almeda & s.s., Lavoisiera and Trembleya (e.g. Romero, 2000, 2003, Martins (2001). Nevertheless, Rocha et al. (2016b) 2005, 2010, 2013a; Romero & Woodgyer, 2010, 2014, recently re-established Poteranthera in the tribe based 2018; Fidanza, Martins & Almeda, 2013; Romero, Silva on molecular data and morphological features of the & Simão, 2014, 2015; Romero & Versiane, 2014, 2016; anthers and seeds. Pacifico & Fidanza, 2015, 2017; Diniz-Neres & Silva, A limiting factor in understanding phylogenetic 2017; Pacifico, Fidanza & Almeda, 2017; Romero et al., relationships and morphological evolution in 2017, 2019a, b; Diniz & Silva, 2018; Pacifico et al., Microlicieae has been that systematic studies to date 2019), it has become evident that some characters have either included a small number of taxa and traditionally used to segregate these genera are not markers (Fritsch et al., 2004; Rocha et al., 2016b) or reliable. These characters included the absence or included members of Microlicieae as outgroups and presence of secondary and tertiary veins on the leaves, not as the focus of the study (Michelangeli et al., 2013;

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 PHYLOGENETICS OF MICROLICIA 37 Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021

Figure 1. Species from the genera that have been traditionally recognized in Microlicieae. A, Chaetostoma armatum (Spreng.) Cogn.; B, Lavoisiera cordata Cogn.; C, Lavoisiera imbricata (Thunb.) DC.*; D, Microlicia amplexicaulis Cogn.; E, Microlicia ericoides D.Don*; F, Microlicia longipedicellata (Cogn.) Almeda & A.B.Martins; G, Poteranthera pusilla Bong.*; H, Rhynchanthera grandiflora (Aubl.) DC.*; I, Stenodon suberosus Naudin*; J, Trembleya rosmarinoides DC.*; K, Trembleya pradosiana Netto; L, Trembleya chamissoana Naudin ex Cogn. *Type species of the genus (Photographs: B–F, I–K: A.F.A. Versiane; A, H: R. Goldenberg; L, R. Romero; G: W. Fernandes).

Rocha et al., 2016a, 2018). This study aims to provide DNA extraction a phylogenetic hypothesis for Microlicieae focusing Total genomic DNA was extracted from silica gel-dried on Microlicia s.s. This will allow us to understand leaves using the CTAB method following Doyle & Doyle morphological evolution in the tribe and provide the (1987) with modifications. We added 1.5 mL of sorbitol appropriate framework to delimit the genus. Therefore, and 30 μL of sarkosyl following Tel-Zur et al. (1999), our analysis provides both an increase in the number to improve DNA extraction for specimens with a high of taxa and molecular markers in comparison to concentration of secondary compounds. DNA from earlier studies (Fritsch et al., 2004; Michelangeli herbarium specimens (2–6 mg) was extracted using et al., 2013; Rocha et al., 2016a, b, 2018). Additionally, the NucleoSpin 96 Plant II extraction Kit (Düren, morphological characters traditionally used in the Germany), following the manufacturer’s instructions, delimitation of the genera were evaluated to improve with the addition of 2 μL proteinase K and incubating Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 the classification of Microlicieae. The specific goals of on thermoblock at 65 °C for a period of 3 h. The protocol this study were: (1) to test the monophyly of Microlicia is available on request. s.s. and related genera; (2) to investigate the evolution of traditional morphological characters that may circumscribe clades and/or genera in the tribe using PCR amplification, purification and sequencing ancestral state reconstruction and (3) to provide the We amplified and sequenced five loci, including two most appropriate classification of Microlicia s.s. and nuclear ribosomal loci, the internal transcribed spacer related genera. (nrITS) and the external transcribed spacer (nrETS), one low-copy nuclear locus (granule-bound starch synthase 1; waxy) and two plastid non-coding loci, MATERIAL AND METHODS the intergenic spacer regions atpF-atpH and trnS- trnG. All these regions have been previously used in Taxon sampling phylogenetic studies of Melastomataceae, showing One hundred and thirty taxa in ten genera were high informative value for phylogenetic inferences in sampled to produce a phylogenetic hypothesis for the family (Michelangeli et al., 2004, 2013; Reginato Microlicieae focusing on Microlicia s.s. This includes & Michelangeli, 2016a, b; Rocha et al., 2016a, b; 113 accepted species from the seven genera in Bacci et al., 2019; Bochorny et al., 2019). The nrITS Microlicieae, representing 43% of the 265 species region was amplified in two fragments that overlap in the tribe; 11 are unpublished new species of (nrITS1 + 5.8S and nrITS2) to avoid amplification Lavoisiera, Microlicia s.s. and Trembleya. Generic and sequencing problems associated with the whole sampling was: Chaetostoma (five species/41% of nrITS fragment (Michelangeli et al., 2004; Rocha the species); Lavoisiera (17/40%); Microlicia s.s. et al., 2016a, b; Veranso-Libalah et al., 2017; Bacci (72/45%); Poteranthera (one/20%); Rhynchanthera et al., 2019). Sequence data for Marcetieae, Rhexieae (four/36%); Stenodon (one/50%) and Trembleya (both missing waxy) and for Chaetostoma cupressinum (13/72%). Sampling included the type species of all (D.Don) Koschn. & A.B.Martins, Lavoisiera crassifolia genera of Microlicieae. Most samples were collected Mart. & Schrank ex DC., L. macrocarpa Naudin, in the field and determined by the authors. Whenever L. subulata Triana, Microlicia amblysepala Ule, possible, the full range of morphological variation Poteranthera pusilla Bong., Rhynchanthera bracteata and geographical distribution was sampled for each Triana, R. grandiflora (Aubl.) DC. and R. serrulata genus. Five samples were obtained from herbarium (Rich.) DC. were obtained from GenBank (https:// specimens [Chaetostoma stenocladon (Naudin) www.ncbi.nlm.nih.gov/genbank/). PCR primers used Koschn. & A.B.Martins, Microlicia flava R.Romero, in this study are detailed in Table 1. The amplification M. hatschbachii Wurdack, M. minima Markgr. and M. of all DNA regions was performed in 25 μL reactions parvula (Markgr.) Koschn. & A.B.Martins]. Vouchers containing 1.5 μL of genomic DNA, 2.5 μL of each were deposited at HUFU, NY, UEC, UFG and UPCB primer, 2.5 μL of betaine, 12.5 μL of Green Master (acronyms according to Thiers, 2020). As outgroup, six Taq DNA polymerase, 2 μL of 5 or 10% dimethyl accessions representing three genera from lineages sulphoxide and bovine serum albumin at 10 mg/mL. that are phylogenetically related to Microlicieae The PCR profile reactions were similar for all markers, were chosen: Rhexia Gronov. (two species) (Rhexieae), with small adjustments in the annealing temperature Marcetia DC. (two species) and Siphanthera Pohl ex and extension time, as follows: initial denaturation DC. (two species) (Marcetieae). The trees were rooted at 94 °C for 2 min; 40 cycles of denaturation at 94 °C with Marcetieae following Rocha et al. (2016a). The for 30 s (except for waxy, 94 °C for 45 s); annealing at specimens sampled for this study are listed in the 52 °C for 30 s (nrITS), 55 °C for 37 s (nrETS), 54 °C Supporting Informations (Table S1). for 45 s (waxy), 57 °C for 60s (atpF-atpH), 55 °C for

Table 1. List of molecular markers and primer sequences used in this study

Region Primer Sequence (5’–3’) Reference nrITS1 + 5.8S F: NY183 CCTTATCATTTAGAGGAAGGAG Michelangeli et al. (2004) R: NY887 ATTGATGGTTCGCGGGATTCTGC nrITS2 F: NY017 GCATCGATGAAGAACGCAGC White et al. (1990) and Michelangeli et al. (2004) R: NY207 CAGTGCCTCCTGCGACA nrETS F: NY320 AGACAAGCATATGACTACTGGCAGG Kriebel, Michelangeli & Kelly (2015) R: NY1428 ACGTGTCGCGTCTAGCAGGCT waxy F: NYF1 GRGGTCTTGGGGACGTGCTC Reginato & Michelangeli (2016a) R: NYR AGCAGTGTGCCARTCGTTGG Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 atpF-atpH F: NY822 ACTCGCACACACTCCCTTTCC Reginato, Michelangeli & Goldenberg (2010) R: NY823 GCTTTTATGGAAGCTTTAACAAT trnS-trnG F: NY904 GAACGAATCACACTTTTACCAC Shaw et al. (2005) R: NY905 GCCGCTTTAGTCCACTCAGC

45 s (trnS-trnG); extension at 72 °C for 40 s (except marker and the concatenated data set were estimated for waxy, 72 °C for 75 s) and a final extension at 72 °C using maximum likelihood (ML) and Bayesian for 7 min for all markers. PCR products were purified inference (BI). with polyethylene glycol (20%) by precipitation of the Maximum likelihood analyses were performed with primers and dNTPs following the protocol suggested RAxML using default parameters (Stamatakis, 2006) by Dunn & Blattner (1987). Cycle sequencing reactions and run through the CIPRES Science Gateway (Miller were carried out with the same amplification primers et al., 2010). Bootstrap support values (hereafter using the sequencing service at Macrogen, Inc. All referred to as BS) were estimated based on 1000 sequences generated in this study were deposited in replicates. Values for BS of 50–70% were considered GenBank (https://www.ncbi.nlm.nih.gov/genbank/) weak, 71–84% as moderate, and ≥ 85% as strong (Supporting Information, Table S1). (Kress, Prince & Williams, 2002). Bayesian inference analyses were performed using MrBayes v.3.1.2 run through the CIPRES Science Sequence alignment and model selection Gateway (Miller et al., 2010). The analyses were run The sequence fragments generated for each sample for 100 000 000 generations with four Markov chains, from bidirectional reads were assembled and edited of two independent runs, sampling one tree every using Geneious v.9.1.2 (Biomatters Ltd.). DNA 2000 generations. The convergence of the MCMC runs, sequence alignment was performed using the MAFFT effective sampling size values, and likelihood scores v.7 algorithm with the strategy E-INS-i (Katoh & were assessed in TRACER v.1.7 (Rambaut et al., 2018). Standley, 2013). The best evolutionary DNA model The first 25% of samples from each run were discarded for each marker was determined under the Bayesian as ‘burn-in’. Groups with posterior probabilities information criterion (BIC) using PartitionFinder (PP) < 0.90 were considered as weakly supported, PP v.2.1.1 (Lanfear et al., 2012) as implemented on the of 0.90–0.94 as moderately supported and PP ≥ 0.95 as CIPRES Science Gateway platform (Miller, Pfeiffer & strongly supported. Schwartz, 2010) using the three-model scheme (GTR, HKY, K80) with or without four discrete rate categories approximating a gamma distribution (+G) and/or Treespace invariant sites (+I). The resulting best partitioning Ideally, a single phylogenetic tree could be used scheme was used in all phylogenetic analyses. to visualize the evolutionary history of a set of sequences (Jombart et al., 2017). However, several biological and statistical factors may result in Phylogenetic inference phylogenetic incongruence between gene trees Phylogenetic analyses were performed individually for (Jeffroy et al., 2006; Galtier & Daubin, 2008; Kumar each marker, and the congruence among the topologies et al., 2012), and the existence of incongruence was visually evaluated. Once no significant conflicts impedes the achievement of the primary goals of among the topologies were found, the same analyses evolutionary research (Som, 2014). Here, we used were done with the concatenated alignments. For a treespace approach (Hillis, Heath & St. John, better tree inference, the phylogenetic trees for each 2005) to visualize possible incongruences across

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 40 A. F. A. VERSIANE ET AL. gene trees. This method provides a simple framework performed in R (R Core Team, 2020). Three models for exploring landscapes of phylogenetic trees and (‘ER’, Equal Rates; ‘SYM’, Symmetric and ‘ARD’, investigating phylogenetic incongruence using All Rates Different) were first evaluated under tree distances (Jombart et al., 2017). The analyses the corrected Akaike information criterion (AICc) were performed in R (R Core Team, 2020) using the using the fitDiscrete function of the R package package treespace v.1.1.3 (Jombart et al., 2017), geiger v.2.0.6 (Harmon et al., 2008). Ancestral state with default parameters (method = ‘treeVec’). In our reconstruction was performed through stochastic treespace analysis, we included the bootstrap and mapping implemented in the R package phytools best tree sets from ML analysis and the maximum v.0.6 (Revell, 2012), where for each character 1000 clade credibility (MCC) tree from the BI analysis for stochastic maps were generated and summarized

each data set. using the functions make.simmap and describe. Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 simmap (Revell, 2012). Taxa with polymorphic data were treated as having the same probability for each Rogue taxa possible state. The results were plotted over the The resolution in a consensus tree and the branch phylogenetic tree using the basic functions of the R support on the best-known tree can be substantially package ape (Paradis, Claude & Strimmer, 2004). deteriorated by rogues (Aberer, Krompass & Stamakis, 2013). Rogues are one or few taxa with unstable position due to missing data, an elevated Characters and coding substitution rate causing homoplasy or extremely low Twelve characters derived from the habit, leaves, rates inside and outside the clade, all of which can perianth, androecium, gynoecium and fruit were coded cause low BS (Sanderson & Shaffer, 2002). Here, we for all species (see Supporting Information, Table S2): used the RogueNaRok method (Aberer et al., 2013) to identify potential rogue taxa. RogueNaRok takes Habit: herbaceous (0), woody (1). Subshrubs, shrubs, a bootstrap tree set from ML analysis as input and small trees and trees have woody tissue, whereas in the analysis was performed in its web server (http:// herbs it is lacking. rnr.h-its.org/). RogueNaRok parameters were set as: threshold = extended majority-rule consensus, Leaf venation: absent (0), present (1). The secondary optimize = support, maximum dropset size = 1. and tertiary veins may form a reticulate pattern visible on the adaxial and/or abaxial surface (Fig. 2A), or they may be absent and only primary veins are visible. Morphology: ancestral state reconstruction A morphological matrix was compiled to investigate Flower arrangement: solitary (0), dichasium (1), the evolution of selected morphological characters paired or reduced to one flower (2), glomerulate (3). and to identify putative diagnostic characters for The inflorescence terminology followed Martins & selected clades (Supporting Information, Table S2). Almeda (2017). These characters were selected from those used to circumscribe the genera in Microlicieae by Don Petal number: fewer than five (0), five (1), more than (1823), Candolle (1828), Naudin (1849), Triana (1872), five (2). The number of petals is extremely important in Cogniaux (1891), Renner (1993), Almeda & Martins recognizing some groups in Melastomataceae, such as (2001) and Martins & Almeda (2017). The characters Acisanthera P.Browne (Rocha et al., 2016a), Marcetia were coded from observations in herbarium (Rocha et al., 2016a), Pterolepis Schrad. (Renner, specimens (BHCB, CEN, ESA, HUFU, IBGE, MBM, 1994) and Siphanthera (Almeda & Robinson, 2011). NY, RB, SPF, UB, UEC, UEG, UFG, UPCB, US; In Microlicieae, the variation ranges from four to nine, acronyms according to Thiers, 2020) and from the within and between genera (Almeda & Martins, 2001; literature (Renner, 1990; Martins, 1997; Romero, Fritsch et al., 2004). 2003; Woodgyer, 2005; Koschnitzke & Martins, 2006; Romero & Woodgyer, 2010; Romero, 2013b; Rocha Bristles on the hypanthium apex: absent (0), present et al., 2016b; Martins & Almeda, 2017; Romero et al., (1). The bristles are a series of rigidly set and erect 2017). The morphological matrix was edited using structures that form a crown on the outer surface of Mesquite v.3.04 (Maddison & Maddison, 2001). All the hypanthium apex (Fig. 2B1, B2). characters were mapped on the MCC tree, in which the stable posterior distributions were combined Number of whorls with fertile stamens: one whorl using LogCombiner v.1.7.5. and summarized on (0), two whorls (1). Most genera of Melastomataceae TreeAnnotator v.1.7.5 (Bouckaert et al., 2014). have androecia with two whorls, both with fertile The morphological character reconstruction was stamens (Rocha et al., 2016a). However, some species

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 PHYLOGENETICS OF MICROLICIA 41 Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021

Figure 2. Morphological variation in the genera that have been traditionally recognized in Microlicieae used as potential diagnostic characters in this study. A, Leaf blade showing the secondary and tertiary veins in Trembleya (M. Monge et al. 2595, UEC); B1, bristles on the hypanthium apex in Chaetostoma, B2, detail of the same bristles (F. Almeda et al. 9434, UEC); C1, isomorphic stamen and tetrasporangiate anther in Microlicia s.s., C2, flower with isomorphic stamens (W. Ganev 2803, UEC); D1–D2, subisomorphic stamens and tetrasporangiate anthers in Microlicia s.s. (F.S. Meyer 1185, UEC); E1–E2,

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 42 A. F. A. VERSIANE ET AL. or even genera have androecia with one whorl of fertile Fruit dehiscence: basipetal (0), acropetal (1). The fruit stamens with the second whorl reduced to staminodes may present longitudinal rupturing lines from the or completely absent. apex to the base of the hypanthium (basipetal) (Fig. 2I) or from the base to the apex (acropetal) (Fig. 2J). Anther whorls: isomorphic (0), subisomorphic (1), dimorphic (2). Species with two whorls of fertile stamens Columella: persistent (0), deciduous (1). The columella can be classified as with isomorphic stamens when the is the central axis in a fruit, and it was first used by stamens from both whorls have the same length and Naudin (1844) to circumscribe Lavoisiera. In this form (Fig. 2C1, C2). The androecium is subisomorphic genus, the columella with conspicuous placental when the antepetalous and antesepalous stamens are intrusions persists long after the capsular tissue has

almost the same size, and the shape can be the same or disintegrated and fallen away (Martins & Almeda, Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 not in both whorls (Fig. 2D1, D2). It is dimorphic when 2017) (Fig. 2K). the stamens from the antepetalous whorl are half or less as long as the antesepalous (Fig. 2E1, E2). Species with the antepetalous whorl reduced to staminodes Nomenclatural adjustments were considered here as dimorphic. We followed the procedures and workflow proposed by Michelangeli et al. (2019) to choose whether a Anther, number of sporangia: tetrasporangiate species should receive a new combination, a new (0), polysporangiate (1). In Melastomataceae, the name or a synonymization under another epithet. anthers are usually described as tetrasporangiate Data on the names treated here were based on and bilocular at maturity (Baumgratz et al., 1996; taxonomic revisions (Cogniaux, 1891; Martins, 1997; Almeda & Martins, 2001). Nevertheless, multilocular Koschniztke & Martins, 2007; Martins & Almeda, (polysporangiate) anthers may occur in Microlicia 2017), protologues (Martins, 1995; Fidanza et al., s.s. and also in other genera, i.e. when the thecae 2013; Pacifico & Fidanza, 2015; Pacifico et al., 2019) are internally divided into numerous small locules and databases such as the International Plant Names along the dorso-lateral face (Baumgratz et al., 1996; Index (IPNI) (http://www.ipni.org), TROPICOS (http:// Lima, Romero & Simão, 2018; Caetano et al., 2020). www.tropicos.org), JSTOR Global Plants (https:// In general, tetra and polysporangiate anthers can plants.jstor.org/) and Goldenberg et al., (2021) (http:// be distinguished without a stereomicroscope, with floradobrasil.jbrj.gov.br/). Whenever new names had tetrasporangiate anthers having a smooth surface to be created, we tried to keep the same rationale (Fig. 2C1, 2D1, D2) and polysporangiate anthers used by the original author in the previous epithet having a bullate surface (Fig. 2E1, E2). (e.g. referring to the same locality, honouring the same person or using similar descriptive features). Ovary locule number: two (0), three (1), four (2), five Additional information was given only when new (3), more than five (4). This character is highly variable names were provided, to justify the new epithets. between and within each genus of Microlicieae. Author names and the abbreviated publication names follow IPNI (2020). Ovary position: superior (0), partly inferior (1), inferior (2). Although the ovary position is considered a stable character in angiosperms (Endress, 2010, 2011), RESULTS Melastomataceae species have perigynous flowers in which the ovary varies from superior to inferior Molecular markers (Basso-Alves, Goldenberg & Teixeira, 2017). The ovary Five hundred and three new sequences from five DNA is superior when there is no adnation between ovary regions were generated during this study (Supporting wall and hypanthium (Fig. 2F), partly inferior when Information, Table S1). The final alignment of the the adnation reaches half of the ovary length (Fig. concatenated sequences included 4475 base pairs 2G) and inferior when the ovary is fully adnate to the (bp), from which 1746 (39%) were variable and 1113 hypanthium (Fig. 2H). (24.9%) potentially parsimony informative within the

dimorphic stamens and polysporangiate anthers in Microlicia s.s. (F.S. Meyer 2053, UEC); F, superior ovary in Microlicia s.s. (F.S. Meyer 2053, UEC); G, partly inferior ovary in Lavoisiera (F. Almeda et al. 8562, UEC); H, inferior ovary in Lavoisiera (I.M. Araújo et al. 233, UEC); I, fruit showing the basipetal dehiscence in Microlicia s.s. (F. Almeda et al. 8305, UEC); J, fruit showing the acropetal dehiscence in Lavoisiera (F. Almeda et al. 8525, UEC); K, persistent columella with conspicuous placental intrusions in Lavoisiera (F. Almeda et al. 8525, UEC). Drawn by Klei Sousa.

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 PHYLOGENETICS OF MICROLICIA 43 ingroup. From these, the nrETS was the most variable marker (65.3%) and potentially parsimony informative (53.6%), and the atpF-atpH the least variable (26.6%) and potentially parsimony informative (12.4%). Among single loci analyses, the highest retention Total 129 4475 1746 (39%) 1113 (24.9%) 0.70 index (RI) was from nrITS (0.85) and the lowest from - waxy (0.6); in the trees obtained from the concatenated data, it was higher in the nuclear (0.74) and lower in the plastid datasets (0.68). The characteristics of each aligned locus and the best-fit nucleotide substitution Concatenated plastid 114 1954 599 (30.7%) 340 (17.4%) 0.68 - model are summarized in Table 2. Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021

Treespace A treespace depicting topological distances between the gene tree bootstrap sets, the concatenated bootstrap set, the best tree (i.e. the tree with the Concaten - ated nuclear 129 2521 1147 (45.5%) 773 (30.7%) 0.74 - maximum value of likelihood) and the MCC trees of all data set is presented in Figure 3. On the first axis, there is not a clear separation of the bootstrap tree sets across all data sets, whereas on the second axis the plastid and waxy trees are closer, nrITS appears trnS-trnG 86 1027 352 (34.3%) 225 (21.9%) 0.75 on an intermediary position overlapping with the GTR+I+G nuclear and total concatenated trees, and nrETS on the other extreme. The nuclear and total concatenated bootstrap sets show the highest cohesion in the treespace, indicating less phylogenetic uncertainty. atpF-atpH 107 927 247 (26.6%) 115 (12.4%) 0.69 Also, these two data sets are highly overlapping in GTR+I+G the tree space, indicating great similarity. All data sets, to some extent and with varied intensity, present some degree of overlap among them, indicating that incongruences among the data sets could at least be partially explained by uncertainty of the nuclear and waxy 95 843 381 (45.2%) 166 (19.7%) 0.6 K80+G plastid concatenated trees (available in the Supporting Information, Figs S1 and S2, respectively).

Phylogenetic analyses nrETS 119 674 440 (65.3%) 361 (53.6%) 0.79 Our analyses did not flag any terminal as a rogue, GTR+G so all species sequenced were included in the final combined analysis. Among the gene trees, the median PP across nodes ranged from 0.05 in the atpF-atpH tree to 0.59 in the nrETS tree. The nrETS tree also had nrITS 127 1004 326 (32.5%) 246 (24.5%) 0.85 the highest proportion of nodes with PP ≥ 0.95 (25% of GTR+I+G all nodes), followed by nrITS (20%) and waxy (19%); the plastid gene trees had lower PP values (atpF-atpH: 6% of the nodes, trnS-trnG: 19%). The median PP of the total concatenated tree was 0.76 and 38% of the nodes had support ≥ 95%. A summary of the PP values of the trees is provided in Table 3. From now on, all of the results and discussion are based on the concatenated analyses (nuclear + Data sets of each aligned locus and concatenated trees and the best-fit nucleotide substitution model obtained from the phylogenetic analyses aligned locus and concatenated trees the best-fit nucleotide Data sets of each plastid). The phylogenetic results showed three main clades in Microlicieae: Rhynchanthera, Poteranthera

and Microlicia s.l. (Fig. 4). Rhynchanthera (PP = 1; informative sites (bp) Table 2. Table Number of taxa sequenced Alignment length (bp) Variable sites Variable Potentially parsimony Potentially Retention index (RI) BS = 100) is recovered in all analyses as the sister DNA model (BIC criterion)

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 44 A. F. A. VERSIANE ET AL. Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021

Figure 3. View of the tree space occupied by 18 different data sets: bootstrap tree and best tree from maximum likelihood analysis, and maximum clade credibility (MCC) tree from Bayesian inference analysis.

Table 3. Summary statistics for the posterior probability (PP) values in Bayesian trees

Median % < 0.90 0.90 ≤ % < 0.95 % ≥ 0.95

Single trees nrITS 0.08 78 2 20 nrETS 0.59 70 5 25 waxy 0.33 76 5 19 atpF-atpH 0.05 91 3 6 trnS-trnG 0.18 80 1 19 Concatenated trees Nuclear 0.6 66 6 28 Plastid 0.04 87 1 12 Total 0.76 57 5 38

group of all other clades in the tribe (PP = 1; BS = 100) Netto (Fig. 4). Microlicia s.l. is the largest clade in and, with Poteranthera, these are the clades which Microlicieae, containing c. 85% of the taxa sampled probably first diverged in Microlicieae (Fig. 4). in this study. However, there is little resolution Microlicia s.l. (PP = 1; BS = 78) is a clade composed or support for most of its internal relationships. by Chaetostoma, Lavoisiera, Microlicia s.s., Stenodon Moreover, Microlicia s.l. includes almost all the and Trembleya, which were recovered in seven well- morphological variation found in the whole tribe, supported clades: Trembleya s.s., Stenodon and allies, except for the herbaceous species, found only in ‘Pinheiroa’, Lavoisiera, Chaetostoma, ‘Viminales’ Poteranthera. and ‘Ericoides’, supported only in the BI analysis Trembleya s.s. is a strongly supported clade (PP = 1; (PP = 0.99) (Fig. 4). Four species do not have a clear BS = 98) in this molecular phylogenetic hypothesis placement in the major clades of Microlicia s.l.: (Fig. 4). It contains eight of the 14 sampled Trembleya Microlicia flava, Trembleya hatschbachii Wurdack spp., including the type species of the genus, & E.Martins, T. phlogiformis DC. and T. pradosiana T. rosmarinoides DC. (Fig. 1J).

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 PHYLOGENETICS OF MICROLICIA 45 Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021

Figure 4. Majority consensus tree from Bayesian inference analysis of nuclear and plastid concatenated sequences. Numbers on the left are posterior probabilities (PP) from Bayesian inference analysis and on the right are bootstrap support values (BS) from maximum likelihood analysis (only PP ≥ 0.90 and BS ≥ 71 are shown). The type species of each genus is marked with an asterisk (*). The colour and form of the symbols represent distinct genera, as traditionally accepted.

Stenodon and allies are recovered as a strongly (Fig. 4). The clade includes the type species of Stenodon supported clade in the BI analysis (PP = 0.96), but (S. suberosus Naudin, Fig. 1I) and 15 of 81 species of with moderate support in the ML analysis (BS = 79) Microlicia s.s. sampled in our study.

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 46 A. F. A. VERSIANE ET AL. Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021

Figure 4. Continued.

‘Pinheiroa’ is a strongly supported clade (PP = 0.98; in Microlicieae have some degree of homoplasy. BS = 94) with two species, Microlicia pinheiroi Wurdack Leaf venation, flower arrangement and ovary locule and M. giuliettiana A.B.Martins & Almeda (Fig. 4). number were the characters with the highest number The Lavoisiera clade, as currently defined, is of changes in the tribe (Table 4, Fig. 5). On the other recovered as monophyletic and has strong support in hand, the habit, presence of bristles on the hypanthium all analyses (PP = 1; BS = 89) (Fig. 4). apex, ovary position, fruit dehiscence and persistence The Chaetostoma clade is strongly supported in the of the columella were the characters with fewest BI analysis (PP = 1) and moderately supported in the changes (Table 4, Supporting Information, Fig. S3). ML analysis (BS = 83) (Fig. 4). It includes the five Probably, the most recent common ancestor (MRCA) species of Chaetostoma sampled here. of Microlicieae was a woody plant with pentamerous,

The ‘Viminales’ clade was supported only in the diplostemonous, solitary flowers; the hypanthium Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 BI analysis (PP = 1) (Fig. 4). It includes six of the apex lacked bristles, the stamens were dimorphic with 81 species of Microlicia s.s. sampled in this study. tetrasporangiate anthers, the ovary was superior with Microlicia viminalis (DC.) Triana was recovered three locules, and the fruit had basipetal dehiscence as the first-diverging taxon branch, as sister to the with a deciduous columella (Table 4). Morphological remaining species in this clade, strongly supported in reconstructions are presented here in further detail for the BI analysis (PP = 1) but moderately supported in the six characters with most changes in the analysis the ML analysis (BS = 80). (Fig. 5). The remaining character reconstructions are The ‘Ericoides’ clade was strongly supported only in presented in the Supporting Information (Fig. S3). the BI analysis (PP = 0.96) (Fig. 4). It is formed by the Poteranthera is the only clade in the tribe with majority of Microlicia s.s. species sampled here (57 out of herbaceous species; Rhynchanthera and Microlicia s.l. 81) including the type species, Microlicia ericoides D.Don are composed of woody species (Supporting Information, (Fig. 1E), all undescribed species in the genus sampled Fig. S3A). The most common change in Microlicieae here, and a few Trembleya spp. (three of 14). This clade was from woody to herbaceous, which happened only is composed of seven well-supported internal clades, twice (Table 4). The ancestral state for leaf venation is some of them with a tendency of geographical grouping ambiguous, and this character has changed 18 times (e.g. from M. elegans Naudin to M. pilosissima Cogn., all within the tribe (Table 4). All species of Trembleya s.s. species occur in Serra do Cipó, Minas Gerais, Brazil). have leaves with secondary and tertiary veins, but these are absent in all species in the ‘Pinheiroa’, Chaetostoma and ‘Viminales’ clades, in which only primary veins are Ancestral state reconstruction present (Fig. 5A). In the remaining clades, the species Ancestral state reconstructions showed that most have leaves with secondary and tertiary veins and/or traditional characters used to segregate the genera these are absent (Fig. 5A).

Table 4. Summary of the morphological characters indicating the probable state at the most recent common ancestor (MRCA), the total number of changes (mean over × stochastic maps), the retention index (RI) in each character and the most common change between the character states, considering only Microlicieae. RI measures the degree of tree likeness; if RI values are equal to one, this means that there is no homoplasy

Character State at the MRCA of Total RI Most common change Microlicieae changes

Habit Woody (1) 2 0.50 Woody (1) to herbaceous (0) Leaf venation Uncertain 18 0.48 Absent (0) to presente (1) Flower arrangement Solitary (0) 25 0.55 Solitary flowers (0) to dichasia (1) Petal number Five (1) 8 0.64 Five (1) to more than five (2) Bristles on the hypanthium apex Absent (0) 1 1.00 Absent (0) to presente (1) Number of whorls with fertile Two whorls (1) 5 0.50 Two whorls (1) to one whorl (0) stamens Anther whorls Dimorphic (2) 11 0.33 Subisomorphic (1) to dimorphic (2) Anther, number of sporangia Tetrasporangiate (0) 14 0.40 Tetrasporangiate (0) to polysporangiate (1) Ovary locule number Three (1) 29 0.59 Three (1) to four (2) Ovary position Superior (0) 2 1.00 Superior (0) to partly inferior (1) Fruit dehiscence Basipetal (0) 4 0.79 Basipetal (0) to acropetal (1) Columella Deciduous (1) 1 1.00 Deciduous (1) to persistent (1)

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 48 A. F. A. VERSIANE ET AL. Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021

Figure 5. Stochastic mapping of selected characters in the tribe Microlicieae. A, Leaf venation; B, flower arrangement; C, petal number; D, anther whorls; E, anther, number of sporangia and F, ovary locule number. The estimated posterior

The most common change in flower arrangement was as the sister group of the remaining genera in from solitary flowers to dichasia (Table 4, Fig. 5B), and Microlicieae was already suggested by Fritsch et al. it happened less frequently from glomerulate to paired (2004) and Rocha et al. (2016b). Poteranthera was first or reduced to one flower (Supporting Information, included in the tribe Lasiandrales (=Melastomateae) Table S3). The most common change in petal number (Naudin, 1849), then transferred to Microlicieae was from five to more than five (Tables 4, S3). The (Triana, 1872) and kept there by Cogniaux (1891). Lavoisiera clade shows the most considerable variation Renner (1993) placed Poteranthera in Melastomateae, in this character; in the other clades a pentamerous but Rocha et al. (2016b) brought it back to Microlicieae, flowers is the most common character state (Fig. 5C). which was confirmed in our study (Fig. 4). In our The bristles on the hypanthium apex are a character analyses, Poteranthera was recovered as sister to

exclusive to Chaetostoma (Supporting Information, the big clade with Microlicia s.l., unlike Rocha et al. Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 Fig. S3B). (2016b), who placed Poteranthera as unresolved within The most common change in the number of stamen this clade. whorls was from two to one (Tables 4, S3). In Microlicia Trembleya as traditionally circumscribed is s.l., Lavoisiera is the only clade with both two and one polyphyletic and fully embedded in Microlicia s.l., as whorls of fertile stamens; in the remaining clades the already suggested by Pacifico et al. (2019). The position flowers always have two whorls of fertile stamens of Chaetostoma was weakly supported in Fritsch (Supporting Information, Fig. S3C). The relative shape et al. (2004), probably because only one species was of the two staminal whorls changed at least 11 times sampled in that study. Here we included other four in Microlicieae (Table 4, Fig. 5D); the most common additional species, including the type of the genus, change was from subisomorphic to dimorphic (Tables and Chaetostoma was recovered as monophyletic, 4, S3). The only change in the number of sporangia although inside Microlicia s.l. Fritsch et al. (2004) was from tetrasporangiate to polysporangiate and it recovered Lavoisiera as monophyletic, which was also probably happened 14 times (Tables 4, S3, Fig. 5E). confirmed in our study. This strongly supported clade The number of locules in the ovary was the most includes all species of Lavoisiera, as delimited by homoplastic character studied here with 29 inferred Martins & Almeda (2017), but the relationships within changes (Table 4, Fig. 5F). In Microlicieae, a trilocular the clade are poorly resolved and weakly supported. ovary is the most common condition, followed by five Stenodon was placed in a strongly supported clade to six locules; two and seven to ten locules are less with Microlicia s.s. and Lavoisiera by Fritsch et al. frequently seen (Tables 4, S3). The most common (2004); in this study, Stenodon was placed in a well- change in the ovary position was from superior to supported clade only along with species of Microlicia partly inferior (Tables 4, S3, Fig. S3D). The most s.s. (Fig. 4). As for Microlicia s.s., Fritsch et al. (2004) common change in the fruit dehiscence was from had already suggested that it was paraphyletic, but basipetal to acropetal (Tables 4, S3) and the acropetal they did not discuss the relationships between its dehiscence is exclusive in the Lavoisiera clade species due to the limited sampling in their study. The (Supporting Information, Fig. S3E). The most common position of four taxa (Microlicia flava, T. hatschbachii, change in the columella was from deciduous to Trembleya phlogiformis and T. pradosiana) in our persistent (Tables 4, S3). Lavoisiera was the only clade phylogenetic analysis was unclear, and these species with an exclusively persistent columella; ‘Ericoides’ did not group with any of the clades here described. has both persistent and deciduous columellae, and Additional discussion on the clades recovered in our the remaining clades have only deciduous columellae phylogenetic analysis is presented in Supporting (Supporting Information, Fig. S3F). Information, Text S1.

Morphology DISCUSSION The low degree of homoplasy in habit (Table 4) Our results have shown that Microlicia s.s. as reinforces its usefulness to characterize the clades traditionally circumscribed is paraphyletic, with in Microlicieae (Supporting Information, Fig. S3A), Chaetostoma, Lavoisiera, Stenodon and Trembleya and the herbaceous habit found in Poteranthera is an recovered within it. The position of Rhynchanthera innovation in Microlicieae (Supporting Information, probabilities of the probably ancestral states are indicated by pie charts on the corresponding nodes. The letters next to bars in the fan trees indicate Marcetieae (A), Rhexieae (B), Rhynchanthera (C), Poteranthera (D), Microlicia s.l. (E–K), Trembleya s.s. (E), Stenodon and allies (F), ‘Pinheiroa’ (G), Lavoisiera (H), Chaetostoma (I), ‘Viminales’ (J), ‘Ericoides’ (K). RI, retention index.

Fig. S3A). Almeda & Pacifico (2018) suggested that the stenodonoides D.O.Diniz-Neres & M.J.Silva, M. herbaceous habit in Poteranthera is an adaptation to longipedicellata (Cogn.) Almeda & A.B.Martins and the wetlands and periodically flooded habitats where Trembleya inversa Fidanza, A.B.Martins & Almeda its species grow. However, Rhynchanthera spp. are may have flowers with some variation in the number woody plants and also grow in wet places (Renner, of petals (Naudin, 1844; Almeda & Martins, 2001; 1990). In Microlicia s.l., all the species are woody and Diniz-Neres & Silva, 2017; Fig. 5C); Two species occur in open, rocky, nutrient-poor habitats, mainly in that were not sampled in our analysis, Chaetostoma the campo rupestre. Therefore, the habit and habitat hexapetalum D.Nunes, D.O.Diniz, Koschn. & M.J.Silva may not be correlated in Microlicieae clades. and Poteranthera leptalea (Almeda) M.J.Rocha, In Microlicieae, leaf venation (Fig. 5A) has been used P.J.Guim. & R.Romero, have exclusively hexamerous

to distinguish Trembleya from Microlicia s.s. (Martins, and tetramerous flowers, respectively (Almeda, Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 1997; Fidanza et al., 2013; Pacifico & Fidanza, 2015). 1999; Rocha et al., 2016b; Silva et al., 2018). In the As traditionally circumscribed, Trembleya included remaining species, as in most Melastomataceae, the species with visible secondary and tertiary veins, number of petals is usually fixed, and the flowers are whereas in Microlicia s.s. only the primary veins pentamerous. Therefore, due to the high variability should be visible (Martins, 1997). Our reconstruction in the petal number across the clades and species in analysis did not recover this pattern since the leaf Microlicieae (Fig. 5C), this character is not diagnostic venation has changed several times in Microlicia for the clades recovered in this phylogenetic study. s.l. (Table 4, Fig. 5A). However, if combined with the The flowers in Melastomataceae are usually presence of petioles, the adaxial surface with spherical diplostemonous with both stamen whorls fertile. If short-stalked glands and becoming blackish-green or the stamens are dimorphic then the larger stamens blackish when dry, flowers in dichasia or reduced to usually are those from the outer whorl and opposite one or two bracteate flowers, capsules with basipetal to the sepals, whereas the shorter stamens are usually dehiscence and deciduous columella, the presence of from the inner whorl and opposite to the petals (Renner, secondary and tertiary veins is useful to recognize the 1989). Some species are haplostemonous, i.e. the inner Trembleya s.s. clade. whorl may be staminodial or lacking entirely (Renner, Flower arrangement has also been used to 1989, 1993). In Rhynchanthera, all species have one distinguish genera in Microlicieae, mainly Trembleya whorl of fertile stamens and the second whorl reduced from Microlicia s.s. In Trembleya the flowers should to staminodia (Renner, 1990). In Poteranthera, some be disposed in simple or compound dichasia, or species may have flowers with one whorl of fertile reduced to an inflorescence with one or two bracteate stamens, whereas the other one may be absent or flowers, whereas Microlicia s.s. has been recognized reduced to staminodia, or both whorls bearing fertile by the solitary flowers without bracts (Martins, 1997; stamens. In Microlicia s.l. only Lavoisiera confertiflora Almeda & Martins, 2001; Fidanza et al., 2013; Pacifico Naudin has flowers with one whorl of fertile stamens & Fidanza, 2015; Pacifico et al., 2019). Nevertheless, and the other reduced to staminodia (see Martins & we noticed that some species of Microlicia s.s. do Almeda, 2017); all remaining species have two whorls have multi-flowered inflorescences. Furthermore, our of fertile stamens. The number of whorls seems to be a morphological analyses revealed that some kind of reliable character to segregate the clades and species inflorescence is present in at least some members of in Microlicieae (Supporting Information, Fig. S3C). almost every clade (Fig. 5B) except Chaetostoma, in In Microlicieae, dimorphic stamens are the most which all species have exclusively solitary flowers (Fig. common condition when compared to subisomorphic 5B). Therefore, due to its plasticity, flower arrangement ones, whereas isomorphic stamens are even less is not suitable to diagnose major clades in Microlicieae. frequent (Fig. 5D). All species in the Rhynchanthera, Ontogenic studies are needed to better understand the Trembleya s.s., Lavoisiera, Chaetostoma and ‘Pinheiroa flower arrangement in the tribe. clades have only dimorphic stamens (Fig. 5D; see Lavoisiera exhibits some extraordinary interspecific Koschnitzke & Martins, 2007; Martins & Almeda, and intraspecific diversity in the number of flower 2017). Species in the Poteranthera, Stenodon and parts (Martins & Almeda, 2017). The genus has allies, ‘Viminales’ and ‘Ericoides’ clades may have eight species that are exclusively pentamerous and subisomorphic or dimorphic stamens. It is important nine exclusively hexamerous; all the others vary: 12 to reinforce that in all Rhynchanthera spp., three species are penta- or hexamerous; eight species are Poteranthera spp. and Lavoisiera confertiflora (see usually octomerous but sometimes vary from hexa- Kriebel, 2012; Almeda & Pacifico, 2018), this condition is to heptamerous to nono- or decamerous; one species extreme since the inner whorl is reduced to staminodia. is hexa- to heptamerous and two species are hexa- Poteranthera spp. with subisomorphic stamens (see to octomerous (Martins & Almeda, 2017). Across the Almeda, 1999; Kriebel, 2012; Almeda & Pacifico, 2018) remaining clades, Stenodon suberosus, Microlicia and species of Microlicia s.s. with isomorphic stamens

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 PHYLOGENETICS OF MICROLICIA 51 were not sampled here. Polysporangiate anthers have in M. balsamifera Cogn. and M. longipedicellata been considered a character exclusive to Microlicia s.s. (A.F.A.V., pers. obs.). Of these, only the latter species in Microlicieae (Baumgratz et al., 1996; Lima et al., was sampled in our phylogenetic analysis, and it was 2018). However, species with polysporangiate anthers recovered in the ‘Ericoides’ clade (Figs 4, S3F). have evolved more than once in Microlicia s.l. (Fig. 5E). The number of locules has also been used as an important character to segregate the genera in the A new classification for Microlicia tribe, mainly between Microlicia s.s. (three locules) Acceptance of paraphyletic genera is not an and Trembleya (five locules; Naudin, 1849; Triana, option (see Hennig, 1965; Welzen, 1997; Dias, 1872; Cogniaux, 1891). However, this has already Assis & Udulutsch, 2005) because it reduces the

been questioned (Martins, 1997; Almeda & Martins, information content of the classification and can Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 2001) since this character is quite variable and be misleading about evolutionary relationships. unsatisfactory for distinguishing these genera. Our According to Larridon et al. (2013), there are two analysis shows a high degree of homoplasy in the main strategies that can be implemented to develop number of ovary locules, among and within clades new classifications encompassing the concept of (Fig. 5F), reinforcing the idea that it is not a useful monophyly for large paraphyletic groups and their diagnostic character. segregate genera: (1) to split paraphyletic genera or The ontogenetic features in the floral development (2) to lump segregated genera into a monophyletic in Melastomataceae are labile enough to explain one. Because we did not find a set of morphological changes in ovary position (Basso-Alves et al., 2017). characteristics that allow us to define and segregate In Microlicieae, Lavoisiera is the only clade with Microlicia s.s. into several genera and also some a partly inferior and/or inferior ovary (Supporting clades have medium or low support and there are Information, Fig. S3D); in the remaining clades the some polytomies in Microlicia s.l., we are not able ovary is always superior. Semi-inferior and inferior to propose an alternative strategy that would ovaries result from the concomitant growth of the segregate different clades into diagnosable and carpel base and the gynoecial hypanthium, whereas in stable genera. Therefore, we propose to expand the superior ovaries the carpels are not affected by the the circumscription of Microlicia s.s. by including hypanthial growth (Basso-Alves et al., 2017). Whether Chaetostoma, Lavoisiera, Stenodon and Trembleya this difference reflects an adaptative history related to into a single genus. Given the phylogenetic results stamen growth or to the maturation and dehiscence of recovered here and the character states that define the fruits remains to be tested. these genera, this is the most likely way to achieve Species in Microlicieae have capsular fruits with a stable classification in Microlicieae. This has been basipetal or acropetal dehiscence (Almeda & Martins, a common approach in large and taxonomically 2001; Fritsch et al., 2004). This character has been complex groups in Myrtales, as in Melastomataceae used to distinguish Lavoisiera from the other genera (Miconia Ruiz & Pav.: Michelangeli et al., 2016, in Microlicieae (see Almeda & Martins, 2001). 2018) and Myrtaceae (Myrcia DC. ex Guill.: Lima, Although most Lavoisiera spp. do show acropetal 2017; Eugenia L.: Bünger et al., 2016). dehiscence, six of them have fruits with basipetal In consequence of our decision, we provide here the dehiscence (Martins & Almeda, 2017). From these, transfers of 67 taxa from Lavoisiera, Chaetostoma, we sampled Lavoisiera cordata Cogn., L. macrocarpa Stenodon and Trembleya to Microlicia. These transfers Naudin and L. pulcherrima Mart. & Schrank ex DC., required 48 new combinations and 19 new names; five and they were all resolved in the Lavoisiera clade were names re-established in Microlicia (see next). We (Figs 4, S3E). Therefore, species in the Lavoisiera present the new circumscription of Microlicia and all clade may have basipetal or acropetal dehiscence, nomenclatural updates in the following. Microlicia s.l. whereas the remaining clades of Microlicieae only now has about 245 species, being the fourth richest have fruits with basipetal dehiscence (Supporting genus in Melastomataceae, after Miconia, Medinilla, Information, Fig. S4B). and Memecylon, and the second in the Neotropics. In Microlicieae, most capsular fruits have deciduous columellae. This character has also been used to segregate Lavoisiera spp. (Supporting Information, New circumscription of Microlicia Fig. S3F), with persistent columellae, from the Microlicia D.Don, Mem. Wern. Nat. Hist. Soc. 4: 283, remaining genera in Microlicieae (Naudin, 1844; 301–303. 1823. Type: Microlicia ericoides D.Don, Almeda & Martins, 2001; Martins & Almeda, 2017). Mem. Wern. Nat. Hist. Soc. 4: 302. 1823. Pataro, Romero & Roque (2013) reported a persistent = Lavoisiera DC., Prodr. 3: 102. 1828. syn. nov. columella for M. pulchra Pataro & R.Romero, which Type: Lavoisiera imbricata (Thunb.) DC. Prodr. 3: can also be found (along with deciduous ones) 102. 1828.

= Chaetostoma DC., Prodr. 3: 112. 1828. syn. nov. Type: Microlicia albiflora (Naudin) Versiane & R.Romero, Chaetostoma armatum (Spreng.) Cogn. in Martius, comb. nov. ≡ Chaetostoma pungens var. albiflorum Eichler & Urban, Fl. Bras. 14 (3): 31. 1883. Naudin, Ann. Sci. Nat., Bot. sér. 3, 3: 191. 1845. = Trembleya DC., Prodr. 3: 125. 1828. syn. nov. Type: ≡ Chaetostoma albiflorum (Naudin) Koschn. & Trembleya rosmarinoides DC., Prodr. 3: 125. 1828. A.B.Martins, Novon 9 (2): 202, 1999. = Stenodon Naudin, Ann. Sci. Nat., Bot. sér. 3, 2: 146. Microlicia altoparaisensis (R.B.Pacifico, Almeda 1844. syn. nov. Type: Stenodon suberosus Naudin, & Fidanza) Versiane & R.Romero, comb. nov. ≡ Ann. Sci. Nat., Bot. sér. 3, 2: 146. 1844. Trembleya altoparaisensis R.B.Pacifico, Almeda & Subshrubs, shrubs, small or seldom dwarf trees. Fidanza, Phytotaxa 391 (5): 291. 2019. Branches variously pubescent or glabrous, Microlicia angustifolia (Cogn.) Versiane &

quadrangular to terete; older branches usually R.Romero, comb. nov. ≡ Lavoisiera angustifolia Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 becoming subterete, defoliating and decorticating Cogn. in Martius, Eichler & Urban, Fl. Bras. 14 (4): basally with age. Leaves sessile, subsessile or petiolate, 595. 1888. ascending or horizontal, spreading or imbricate, flat Microlicia arachnoidea (Almeda & A.B.Martins) or keeled, membranaceous, chartaceous or coriaceous, Versiane & R.Romero, comb. nov. ≡ Lavoisiera entire, serrulate or crenulate, narrowly or callose- arachnoidea Almeda & A.B.Martins, Phytotaxa 315: thickened or not, variously pubescent or glabrous. 51. 2017. Flowers solitary, paired or reduced to one flower, or in Microlicia armata (Spreng.) Versiane & R.Romero, simple or compound dichasia, these lax or congested comb. nov. ≡ Rhexia armata Spreng., Syst. Veg. (glomerulate head); bracts lacking or present, in 2: 308. 1825. ≡ Chaetostoma armatum (Spreng.) this case sessile, subsessile or petiolate, variously Cogn. in Martius, Eichler & Urban, Fl. Bras. 14 pubescent or glabrous; pedicels lacking or present. (3): 31. 1883. Hypanthium with bristles at the apex, or these Microlicia australis (A.St-Hil. ex Naudin) Versiane lacking. Sepals persistent or early to late caducous. & R.Romero, comb. nov. ≡ Lavoisiera australis Petals 5(–9–10), pink, magenta, cream, white or yellow, A.St-Hil. ex Naudin, Ann. Sci. Nat., Bot. sér. 3, 2: sometimes with a yellow, white or greenish patch at 151. 1844. = the base. Stamens (5−)10−18(−20), diplostemonous, Lavoisiera pulchella Cham., Linnaea 9 (3): 370–371. seldom haplostemonous (then with staminodia in M. 1834. Non Microlicia pulchella Cham., nec Microlicia congestiflora), dimorphic, subisomorphic or seldom pulchella Mart. isomorphic, with a single colour or bicoloured; anthers Note: Since the epithet ‘pulchella’ was already in use tetra or polysporangiate; pedoconnective prolonged in Microlicia, we chose to make a new combination below the thecae, ventrally dilated into poorly or well- for a heterotypic synonym, L. australis (see Martins developed appendages. Ovary superior or partly to & Almeda, 2017). completely inferior, (bi-)tri- to penta- (to deca-)locular, Microlicia belinelloi (A.B.Martins & Almeda) glabrous; style glabrous, straight or curved at the Versiane & R.Romero, comb. nov. ≡ Lavoisiera apex; stigma punctiform. Capsule dry, loculicidal, with belinelloi A.B.Martins & Almeda, Phytotaxa 315: basipetal or acropetal dehiscence; columella caducous 54. 2017. or persistent. Seeds slightly curved or subreniform to Microlicia calycina (Cham.) Versiane & R.Romero, oblong and nearly straight or rarely subcochleate or comb. nov. ≡ Trembleya calycina Cham., Linnaea 9 L-shaped, testa foveolate. (4): 430. 1835. Microlicia acuminifolia Versiane & R.Romero, Microlicia caryophyllea (Naudin) Versiane & nom. nov. ≡ Trembleya acuminata R.B.Pacifico R.Romero, comb. nov. ≡ Lavoisiera caryophyllea & Fidanza, Phytotaxa 238 (2): 164. 2015. Non Naudin, Ann. Sci. Nat., Bot. sér. 3, 2: 150. 1844. Microlicia acuminata Naudin, nec Microlicia Microlicia cataphracta (Mart. & Schrank ex DC.) acuminata Cogn. Versiane & R.Romero, comb. nov. ≡ Lavoisiera Note: The new epithet refers to the acuminate- cataphracta Mart. & Schrank ex DC., Prodr. 3: 102. cuspidate apex of the leaves, typical for this species. 1828. Microlicia adamantium (Barreto ex Pedersoli) = Lavoisiera imbricata (Thunb.) DC. Prodr. 3: 103. Versiane & R.Romero, comb. nov. ≡ Lavoisiera 1828. ≡ Rhexia imbricata Thunb., Pl. Bras. Dec. 1: adamantium Barreto ex Pedersoli, Oreades 10. 1817. Non Microlicia imbricata Cham. 1979/1980: 21–22. Note: Since the epithet ‘imbricata’ was already used Microlicia alba (Mart. & Schrank ex DC.) Versiane in Microlicia, we chose to make a new combination & R.Romero, comb. nov. ≡ Lavoisiera alba Mart. & for a heterotypic synonym, L. cataphracta (see Schrank ex DC., Prodr. 3: 103–104. 1828. Martins & Almeda, 2017).

Microlicia chamissoana (Naudin) Versiane & Note: The new epithet refers to the glandular R.Romero, comb. nov. ≡ Trembleya chamissoana trichomes on both leaf surfaces in this species. Naudin, Ann. Sci. Nat., Bot. sér. 3, 12: 270. 1849. Microlicia glaziovii (Cogn.) Versiane & R.Romero, Microlicia congestiflora Versiane & R.Romero, comb. nov. ≡ Chaetostoma glaziovii Cogn. in nom. nov. ≡ Lavoisiera confertiflora Naudin, Ann. Martius, Eichler & Urban, Fl. Bras. 14 (3): 30. 1883. Sci. Nat., Bot. sér. 3, 2: 149. 1844. Non Microlicia Microlicia hexapetala (D.Nunes, D.O.Diniz, Koschn. confertiflora Naudin. & M.J.Silva) Versiane & R.Romero, comb. nov. Note: The new epithet refers to the flowers that are ≡ Chaetostoma hexapetalum D.Nunes, D.O.Diniz, crowded in this species. Koschn. & M.J.Silva, Syst. Bot. 43 (4): 988. 2018. Microlicia cordifolia Versiane & R.Romero, nom. Microlicia hilairei Versiane & R.Romero, nom. nov.

nov. ≡ Lavoisiera cordata Cogn. in Martius, Eichler ≡ Lavoisiera chamaepitys A.St-Hil. ex Naudin, Ann. Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 & Urban, Fl. Bras. 14 (3): 140. 1883. Non Microlicia Sci. Nat., Bot. sér. 3, 2: 153. 1844. Non Microlicia cordata (Spreng.) Cham. chamaepitys Naudin. Note: The new epithet refers to the leaf shape in this Note: The new epithet honours Auguste de Saint- species. Hilaire (1779–1853), the French botanist that Microlicia crassifolia (Mart. & Schrank ex DC.) collected the type of this species. Versiane & R.Romero, comb. nov. ≡ Lavoisiera Microlicia inermis (Naudin) Versiane & R.Romero, crassifolia Mart. & Schrank ex DC., Prodr. 3: comb. nov. ≡ Chaetostoma inerme Naudin, Ann. Sci. 104. 1828. Nat., Bot. sér. 3. 3: 191. 1845. Microlicia curtiana Versiane & R.Romero, nom. Microlicia inversa (Fidanza, A.B.Martins & Almeda) nov. ≡ Lavoisiera bradeana Barreto, Bol. Mus. Versiane & R.Romero, comb. nov. ≡ Trembleya Nac. Rio de Janeiro 12: 70. 1936. Non Microlicia inversa Fidanza, A.B.Martins & Almeda, Brittonia bradeana Hoehne. 65 (3): 281. 2013. Note: The new epithet keeps the honour to Alexander Microlicia itambana (Mart. & Schrank ex DC.) Curt Brade (1881–1971), the German botanist that Versiane & R.Romero, comb. nov. ≡ Lavoisiera collected the type of this species. itambana Mart. & Schrank ex DC., Prodr. 3: 104. 1828. Microlicia daviesiana (Almeda & A.B.Martins) Microlicia macrantha Versiane & R.Romero, nom. Versiane & R.Romero, comb. nov. ≡ Lavoisiera nov. ≡ Lavoisiera grandiflora A.St-Hil. ex Naudin, daviesiana Almeda & A.B.Martins, Phytotaxa 315: Ann. Sci. Nat., Bot. sér. 3, 2: 148. 1844. Non Microlicia 87. 2017. grandiflora Baill. Microlicia fastigiata (Naudin) Versiane & R.Romero, Note: The new epithet refers to the large flowers of comb. nov. ≡ Chaetostoma fastigiatum Naudin, this species. Ann. Sci. Nat., Bot. sér. 3, 3: 191. 1845. Microlicia macrocarpa (Naudin) Versiane & Microlicia firmula (Mart. & Schrank ex DC.) R.Romero, comb. nov. ≡ Lavoisiera macrocarpa Versiane & R.Romero, comb. nov. ≡ Lavoisiera Naudin, Ann. Sci. Nat., Bot. sér. 3, 2: 148. 1844. firmula Mart. & Schrank ex DC., Prodr. 3: Microlicia matogrossensis Versiane & R.Romero, 104. 1828. nom. nov. ≡ Chaetostoma riedelianum Cogn. in Microlicia flaviflora Versiane & R.Romero, Martius, Eichler & Urban, Fl. Bras. 14 (3): 33. 1883. nom. nov. ≡ Trembleya hatschbachii Wurdack & Non Microlicia riedeliana Cogn. E.Martins, Bol. Bot. Univ. São Paulo 14: 40. 1995. Note: The new epithet refers to the state of Mato Non Microlicia hatschbachii Wurdack. Grosso, Brazil, to which this species is endemic. Note: The new epithet refers to the yellow petals of Microlicia mellobarretoi (Markgr.) Versiane & this species. R.Romero, comb. nov. ≡ Lavoisiera mellobarretoi Microlicia flavipetala Versiane & R.Romero, nom. Markgr., Notizbl. Bot. Gart. Berlin-Dahlem 15: nov. ≡ Chaetostoma flavum Koschn. & A.B.Martins, 220. 1940. Novon 9 (2): 204. 1999. Non Microlicia flava Microlicia minensis Versiane & R. Romero, R.Romero. nom. nov. ≡ Lavoisiera canastrensis Almeda & Note: The new epithet refers to the yellow petals of A.B.Martins, Phytotaxa 315: 60. 2017. Non Microlicia this species. canastrensis Naudin. Microlicia gentianoides (DC.) Versiane & R.Romero, Note: The new specific epithet refers the Minas comb. nov. ≡ Lavoisiera gentianoides DC., Prodr. 3: Gerais state, Brazil, to which this species is endemic. 104. 1828. Microlicia minor Versiane & R.Romero, nom. nov. ≡ Microlicia glandulifolia Versiane & R.Romero, Lavoisiera humilis Naudin, Ann. Sci. Nat., Bot. sér. nom. nov. ≡ Lavoisiera glandulifera Naudin, Ann. 3, 2: 153. 1844. Non Microlicia humilis Naudin. Sci. Nat., Bot. sér. 3, 2: 149. 1844. Non Microlicia Note: The new epithet refers to the small size of the glandulifera Naudin. plants in this species.

Microlicia mucorifera (Mart. & Schrank ex DC.) Almeda, Phytotaxa 315: 128. 2017. Non Microlicia Versiane & R.Romero, comb. nov. ≡ Lavoisiera minima Markgr. mucorifera Mart. & Schrank ex DC., Prodr. 3: Note: The new epithet refers to the tiny leaf blades 103. 1828. in this species. Microlicia neogracilis Versiane & R.Romero, nom. Microlicia quinquenervis (Wurdack) Versiane & nov. ≡ Stenodon gracilis O.Berg ex Triana, Trans. R.Romero, comb. nov. ≡ Lavoisiera quinquenervis Linn. Soc. London 28 (1): 25. 1872 [‘1871’]. Wurdack, Phytologia 29 (2): 136. 1974. Microlicia neopyrenaica (Naudin) Versiane & Microlicia rigida (Cogn.) Versiane & R.Romero, R.Romero, comb. nov. ≡ Trembleya neopyrenaica comb. nov. ≡ Lavoisiera rigida Cogn. in Martius, Naudin, Ann. Sci. Nat., Bot. sér. 3, 2: 154. 1844. Eichler & Urban, Fl. Bras. 14 (3): 144. 1883.

Microlicia nervulosa (Naudin) Versiane & R.Romero, Microlicia rosmarinoides (DC.) Versiane & Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 comb. nov. ≡ Lavoisiera nervulosa Naudin, Ann. R.Romero, comb. nov. ≡ Trembleya rosmarinoides Sci. Nat., Bot. sér. 3, 2: 149. 1844. DC., Prodr. 3: 125. 1828. Microlicia parviflora (D.Don) Versiane & R.Romero, Microlicia rundeliana (Almeda & A.B.Martins) comb. nov. ≡ Meriania parviflora D.Don, Mem. Versiane & R.Romero, comb. nov. ≡ Lavoisiera Wern. Nat. Hist. Soc. 4: 323. 1823. ≡ Trembleya rundeliana Almeda & A.B.Martins, Phytotaxa 315: parviflora (D.Don) Cogn. in Martius, Eichler & 154. 2017. Urban, Fl. Bras. 14 (3): 127. 1883. Microlicia sampaioana (Barreto) Versiane & Microlicia pentagona (Naudin) Versiane & R.Romero, comb. nov. ≡ Lavoisiera sampaioana R.Romero, comb. nov. ≡ Trembleya pentagona Barreto, Arq. Inst. Biol. Veg. 2 (1): 10. 1935. Naudin, Ann. Sci. Nat., Bot. sér. 3, 2: 154. 1844. Microlicia scaberula (Naudin) Versiane & R.Romero, Microlicia phlogiformis (DC.) Versiane & R.Romero, comb. nov. ≡ Lavoisiera scaberula Naudin, Ann. comb. nov. ≡ Trembleya phlogiformis DC., Prodr. 3: Sci. Nat., Bot. sér. 3, 2: 151. 1844. 126. 1828. Microlicia senae (Schwacke) Versiane & R.Romero, Microlicia pilosa Versiane & R.Romero, nom. nov. ≡ comb. nov. ≡ Lavoisiera senae Schwacke, Pl. Nov. Lavoisiera vestita Almeda & A.B.Martins, Phytotaxa Mineir. 2: 3. 1900. 315: 171. 2017. Non Microlicia vestita Naudin. Microlicia serratifolia Versiane & R.Romero, nom. Note: The new epithet refers to the dense nov. ≡ Trembleya serrulata Fidanza, A.B.Martins & indumentum on branches, leaves, hypanthia, Almeda, Brittonia 65 (3): 288. 2013. Non Microlicia and sepals. serrulata Cham. Microlicia pithyoides (Cham.) Versiane & R.Romero, Note: The new epithet refers to the conspicuously comb. nov. ≡ Trembleya pithyoides Cham., Linnaea serrulate margins of the leaf blades. 9 (4): 428. 1835. Microlicia setifolia Versiane & R.Romero, nom. Microlicia plinervia Versiane & R.Romero, nom. nov. ≡ Lavoisiera setosa A.B.Martins & Almeda, nov. ≡ Lavoisiera cogniauxiana [‘cogniauxana’] Phytotaxa 315: 164. 2017. Non Microlicia setosa Barreto, Bol. Mus. Nac. Rio de Janeiro 12 (1): 63. (Spreng.) DC., nec Microlicia setosa Mart. 1936. Non Microlicia cogniauxiana R.Romero. Note: The new epithet refers to the prominent bristle Note: The new epithet refers to the seven- to nine- on the apex of each leaf blade. plinerved leaf blades typical for this species. Microlicia speciosa Versiane & R.Romero, nom. [see Martins & Almeda (2017)]. nov. ≡ Lavoisiera elegans Cogn. in Martius, Eichler Microlicia pohliana (O.Berg ex Triana) Versiane & & Urban, Fl. Bras. 14 (3): 160–161. 1883. ≡ Trembleya R.Romero, comb. nov. ≡ Lavoisiera pohliana O.Berg elegans (Cogn.) Almeda & A.B.Martins, Novon 11 ex Triana, Trans. Linn. Soc. London 28 (1): 30. 1872 (1): 6. 2001. Non Microlicia elegans Naudin. [‘1871’]. Note: The new epithet means splendid, which has Microlicia pradosiana (Netto) Versiane & R.Romero, a similar meaning as the old name for this species comb. nov. ≡ Trembleya pradosiana Netto, Ann. Sci. (elegans = elegant). Nat., Bot. sér. 5, 3: 378. 1865. Microlicia suberosa (Naudin) Versiane & R.Romero, Microlicia pulcherrima (Mart. & Schrank ex DC.) comb. nov. ≡ Stenodon suberosus Naudin, Ann. Sci. Versiane & R.Romero, comb. nov. ≡ Lavoisiera Nat., Bot. sér. 3, 2: 146. 1844. pulcherrima Mart. & Schrank ex DC., Prodr. 3: Microlicia subulata (Triana) Versiane & R.Romero, 104. 1828. comb. nov. ≡ Lavoisiera subulata Triana, Trans. Microlicia punctata (Mart. & Schrank ex DC.) Linn. Soc. London 28 (1): 30. 1872 [‘1871’]. Versiane & R.Romero, comb. nov. ≡ Lavoisiera Microlicia tetragona (Mart. & Schrank ex DC.) punctata Mart. & Schrank ex DC., Prodr. 3: 104. 1828. Versiane & R.Romero, comb. nov. ≡ Lavoisiera Microlicia pusillifolia Versiane & R.Romero, tetragona Mart. & Schrank ex DC., Prodr. 3: nom. nov. ≡ Lavoisiera minima A.B.Martins & 103. 1828.

Microlicia thomazii (R.B.Pacifico & Fidanza) Andreza S.S. Pereira, Elisa Cândido, Juliana Amaral de Versiane & R.Romero, comb. nov. ≡ Trembleya Oliveira and Suzana Maria Costa for assistance in the thomazii R.B.Pacifico & Fidanza, Phytotaxa 238 (2): laboratory, Fabiano Rodrigo da Maia for the CNPq grant 171. 2015. management, André Vito Scatigna and Danielle Diniz for Microlicia tridentata (Naudin) Versiane & sending specimens, and Wesley Fernandes for providing R.Romero, comb. nov. ≡ Trembleya tridentata the field photograph of Poteranthera pusilla, and the Naudin, Ann. Sci. Nat., Bot. sér. 3, 2: 154. 1844. anonymous reviewers for valuable contributions. The authors declare that they have no competing interests.

Re-established names

Microlicia clavillosa Wurdack, Phytologia 50 (5): Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 297. 1982. REFERENCES = Chaetostoma scoparium Cogn. in Engler, Bot. Jahrb. Aberer AJ, Krompass D, Stamatakis A. 2013. Pruning Syst. 21 (4): 447. 1896. Non Microlicia scoparia DC., rogue taxa improves phylogenetic accuracy: an efficient nec Microlicia scoparia Cham. algorithm and webservice. Systematic Biology 62: 162–166. Note: Microlicia clavillosa was described by Wurdack Almeda F. 1999. A new Acisanthera (Melastomataceae: (1982) based on the gathering Gates & Estabrook Melastomeae) from Noel Kempff Mercado National Park, 215. During the taxonomic revision of Chaetostoma, Bolivia. Brittonia 51: 159–162. Koschnitzke & Martins (2006) realized that this Almeda F, Martins AB. 2001. New combinations and new species was already published by Cogniaux (1896) names in some Brazilian Microlicieae (Melastomataceae), as Chaetostoma scoparium, based in a specimen with notes on the delimitation of Lavoisiera, Microlicia and collected by Ule (1854–1915). Then, M. clavillosa was Trembleya. Novon 11: 1–7. synonymized under C. scoparium as a heterotypic Almeda F, Pacifico R. 2018. Neotropical Poteranthera synomym. Since the epithet ‘scoparia’ was already (Melastomataceae: Microlicieae) revisited. Systematic used in Microlicia, here we decide to re-establish Botany 43: 552–556. Microlicia clavillosa as the correct name for this Almeda F, Robinson OR. 2011. Systematics and phylogeny species. of Siphanthera (Melastomataceae). Systematic Botany Microlicia cupressina D.Don, Mem. Wern. Nat. Monographs 93: 1–101. Hist. Soc. 4: 302. 1823. ≡ Chaetostoma cupressinum Amorim BS, Vasconcelos TNC, Souza G, Alves M, (D.Don) Koschn. & A.B.Martins, Novon 9 (2): Antonellie A, Lucas E. 2019. Advanced understanding 202. 1999. of phylogenetic relationships, morphological evolution and Microlicia laniflora (D.Don) Baill., Adansonia biogeographic history of the mega-diverse plant genus 12: 95. 1876. ≡ Melastoma laniflorum [‘laniflora’] Myrcia and its relatives (Myrtaceae: Myrteae). Molecular Phylogenetics and Evolution 138: 65–88. D.Don, Mem. Wern. Nat. Hist. Soc. 4: 292. 1823. ≡ Bacci LF, Michelangeli FA, Goldenberg R. 2019. Revisiting Trembleya laniflora (D.Don.) Cogn. in Martius, the classification of Melastomataceae: implications for habit Eichler & Urban, Fl. Bras. 14 (3): 130. 1883. and fruit evolution. Botanical Journal of the Linnean Society Microlicia selaginea Naudin, Ann. Sci. Nat., Bot. sér. 190: 1–24. 3, 3: 188. 1845. ≡ Chaetostoma selagineum (Naudin) Basso-Alves JP, Goldenberg R, Teixeira SP. 2017. Koschn. & A.B.Martins, Novon 9 (2): 202. 1999. The ontogenetic bases for variation in ovary position in Microlicia stenocladon Naudin, Ann. Sci. Nat., Bot. sér. Melastomataceae. American Journal of Botany 104: 1142–1156. 3, 3: 188. 1845. ≡ Chaetostoma stenocladon (Naudin) Baumgratz JFA, Souza MLDR, Woodgyer EM, Koschn. & A.B.Martins, Novon 9 (2): 202. 1999. Nic Lughadha EM. 1996. Polysporangiate anthers: described for the first time in Melastomataceae. Kew Bulletin 51: 133–144. Bochorny T, Michelangeli FA, Almeda F, Goldenberg R. 2019. Phylogenetics, morphology and circumscription of ACKNOWLEDGEMENTS Cambessedesieae: a new Neotropical tribe of Melastomataceae. Botanical Journal of the Linnean Society 190: 281–302. We thank the curators and staff of BHCB, CEN, ESA, Bouckaert R, Heled J, Kühnert D, Vaughan T, Wu CH, HUFU, IBGE, MBM, NY, RB, SPF, UB, UEC, UEG, Xie D, Suchard MA, Rambaut A, Drummond AJ. 2014. UPCB and US herbaria for specimen loans or assistance BEAST 2: a software platform for bayesian evolutionary during visits. Financial support was provided by analysis. PLoS Computational Biology 10: e1003537. Coordenacão de Aperfeiçoamento de Pessoal de Nível Bünger MO, Mazine FF, Forest F, Bueno ML, Superior (CAPES; Finance Code 001) and Conselho Stehmann JR, Lucas EJ. 2016. The evolutionary history Nacional de Desenvolvimento Científico e Tecnológico of Eugenia sect. Phyllocalyx (Myrtaceae) corroborates (CNPq; numbers 457510/2014-5 and 142384/2018-6). historically stable areas in the southern Atlantic forests. AFAV would like to thank Ana Carolina D. Castello, Annals of Botany 118: 1209–1223.

Caetano AP, Reginato M, Goldenberg R, Cortez PA, Fidanza K, Martins AB, Almeda F. 2013. Four new species Basso-Alves JP, Michelangeli FA, Carmello- of Trembleya (Melastomataceae: Microlicieae) from Serra do Guerreiro SM, Teixeira SP. 2020. Structure and evolution Cabral, Minas Gerais, Brazil. Brittonia 65: 280–291. of polysporangiate anthers in Melastomataceae. Perspectives Fritsch PW, Almeda F, Renner SS, Martins AB, Cruz BC. in Plant Ecology, Evolution and Systematics 46: 125556. 2004. Phylogeny and circumscription of the near-endemic de Candolle AP. 1828. Melastomaceae. In: de Candolle AP, ed. Brazilian tribe Microlicieae (Melastomataceae). American Prodromus systematis naturalis regni vegetabilis 3. Paris: Journal of Botany 91: 1105–1114. Treuttel & Wurtz, 99–202. Galtier N, Daubin V. 2008. Dealing with incongruence in Chase MW, Cameron KM, Freudenstein JV, Pridgeon AM, phylogenomic analyses. Philosophical Transactions of the Salazar G, Van Den Berg C, Schuiteman A. 2015. An Royal Society B 363: 4023–4029. updated classification of Orchidaceae. Botanical Journal of Goldenberg R, Baumgratz JFA, Michelangeli FA, the Linnean Society 177: 151–174. Guimarães PJF, Romero R, Versiane AFA, Fidanza K, Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 Clausing G, Renner SS. 2001. Molecular phylogenetics Völtz RR, Silva DN, Lima LFG, Gonçalves KC, Bacci LF, of Melastomataceae and Memecylaceae: implications Fontelas JC, Pacifico R, Brito ES, Rocha MJR, for character evolution. American Journal of Botany 88: Caddah MK, Meirelles J, Rosa P, Ferreira-Alves R, 486–498. Santos AKA, Moreira KVC, Reginato M, Oliveira LFA, Cogniaux CA. 1891. Melastomataceae. In: Candolle ALPP, Freire-Fierro A, Amorim AMA, Martins AB, Candolle ACP, eds. Monographiae Phanerogamarum 7. Koschnitzke C, Almeda F, Jesus JC, Hinoshita LKR, Paris: G. Masson, 1–1256. Kriebel R. 2021. Melastomataceae in Flora do Brasil Cogniaux CA. 1896. Melastomataceae. In: Taubert P, Ule E, eds. 2020 under construction. Jardim Botânico do Rio de Beitrage zur Kenntnis der Flora des centralbrasilienischen Janeiro. Available at: http://floradobrasil.jbrj.gov.br/reflora/ States Goyas. Leipzig: Botanischer Jahrbücher für floradobrasil/FB161 (accessed 04 February 2021). Systematik, Pflanzengeschichte und Pflanzengeographie, Guimarães PJF, Michelangeli FA, Sosa K, Gómez JRS. 446–448. 2019. Systematics of Tibouchina and allies (Melastomataceae: D’haijère T, Mardulyn P, Dong L, Plunkett GM, Simo- Melastomateae): a new taxonomic classification. Taxon 68: Droissart M, Droissart V, Stévart T. 2019. Molecular 937–1002. phylogeny and taxonomic synopsis of the angraecoid genus Harmon LJ, Weir JT, Brock CD, Glor RE, Challenger W. Ypsilopus (Orchidaceae, Vandeae). Taxon 68: 455–470 2008. GEIGER: investigating evolutionary radiations. Dias P, Assis LCS, Udulutsch RG. 2005. Monophyly vs. Bioinformatics 24: 129–131. paraphyly in plant systematics. Taxon 54: 1039–1040. Hennig W. 1965. Phylogenetic systematics. Annual Review of Diniz DO, Silva MJ. 2018. A noteworthy new species Entomology 10: 97–116. of Microlicia (Melastomataceae, Microlicieae) from the Hillis DM, Heath TA, St. John K. 2005. Analysis and highlands of the state of Goiás, Brazil. Journal of the Torrey visualization of tree space. Systematic Biology 54: 471–482. Botanical Society 145: 175–181. IPNI. 2020. International Plant Names Index. Available at: Diniz-Neres DO, Silva MJ. 2017. A remarkable new species http://www.ipni.org (accessed 02 February 2020). of Microlicia (Melastomataceae) including an identification Jeffroy O, Brinkmann H, Delsuc F, Philippe H. 2006. key to species of the genus from the Chapada dos Veadeiros Phylogenomics: the beginning of incongruence? Trends in National Park, Goiás, Brazil. Systematic Botany 42: 554–561. Genetics 22: 225–231. Don D. 1823. An illustration of the natural family of plants Jombart T, Kendall M, Almagro-Garcia J, Colijn C. called Melastomaceae. Memoirs of the Wernerian Natural 2017. TREESPACE: statistical exploration of landscapes History Society 4: 276–329. of phylogenetic trees. Molecular Ecology Resources 17: Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure 1385–1392. for small quantities of fresh leaf tissue. Phytochemical Katoh S, Standley DM. 2013. MAFFT multiple Bulletin, Botanical Society of America 19: 11–15. sequence alignment software version 7: improvements Dunn IS, Blattner FR. 1987. Charons 36 to 40: multi-enzyme, in performance and usability. Molecular Biology and high capacity, recombination deﬁcient replacement vectors Evolution 30: 772–780. with polylinkers and polystuffers. Nucleic Acids Research 15: Koschnitzke C, Martins AB. 2006. Revisão taxonômica de 2677–2698. Chaetostoma DC. (Melastomataceae, Microlicieae). Arquivos Egan AN, Vatanparast M, Cagle W. 2016. Parsing do Museu Nacional 64: 95–119. polyphyletic Pueraria: delimiting distinct evolutionary Koschnitzke C, Martins AB. 2007. Nomenclatural alterations lineages through phylogeny. Molecular Phylogenetics and in Microlicieae (Melastomataceae). Novon 17: 472–475. Evolution 104: 44–59. Kress WJ, Prince LM, Williams KJ. 2002. The phylogeny and a Endress PK. 2010. Flower structure and trends of evolution new classification of the gingers (Zingiberaceae): evidence from in eudicots and their major subclades. Annals of the Missouri molecular data. American Journal of Botany 89: 1682–1696. Botanical Garden 97: 541–583. Kriebel R. 2012. A synopsis of the genus Poteranthera Endress PK. 2011. Changing views of flower evolution and new (Melastomeae: Melastomataceae) with the description of a questions. In: Wanntorp L, Ronse De Craene LP, eds. Flowers on new, apparently pollinator deceiving species. Brittonia 62: the tree of life. Cambridge: Cambridge University Press, 120–141. 6–14.

Kriebel R, Michelangeli FA, Kelly LM. 2015. Discovery 2016. (2462) Proposal to conserve the name Miconia, nom. of unusual anatomical and continuous characters in cons. against the additional names Maieta and Tococa the evolutionary history of Conostegia (Miconieae: (Melastomataceae, Miconieae). Taxon 65: 892–893. Melastomataceae). Molecular Phylogenetics and Evolution Michelangeli F, Almeda F, Goldenberg R, Penneys D. 82: 289–313. 2020. A guide to curating New World Melastomataceae Kumar S, Filipski AJ, Battistuzzi FU, Pond SLK, collections with a linear generic sequence to world-wide Tamura K. 2012. Statistics and truth in phylogenomics. Melastomataceae. Preprints 2020: 2020100203. Molecular Biology and Evolution 29: 457–472. Michelangeli FA, Goldenberg R, Almeda F, Judd WS, Lanfear R, Calcott B, Ho SYW, Guindon S. 2012. Bécquer ER, Ocampo G, Ionta GM, Skean Jr JD, PartitionFinder: combined selection of partitioning schemes Majure LC, Penneys DS. 2019. Nomenclatural novelties in and substitution models for phylogenetic analyses. Molecular Miconia (Melastomataceae: Miconieae). Brittonia 71: 82–121. Biology and Evolution 29: 1695–1701. Michelangeli FA, Guimarães PJF, Penneys DS, Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 Larridon I, Bauters K, Reynders M, Huygh W, Almeda F, Kriebel R. 2013. Phylogenetic relationships and Muasya AM, Simpson DA, Goetghebeur P. 2013. distribution of New World Melastomeae (Melastomataceae). Towards a new classification of the giant paraphyletic Botanical Journal of the Linnean Society 171: 38–60. genus Cyperus (Cyperaceae): phylogenetic relationships and Michelangeli FA, Nicolas A, Morales-P ME, David H.

generic delimitation in C4 Cyperus. Botanical Journal of the 2011. Phylogenetic relationships of Allomaieta, Alloneuron, Linnean Society 172: 106–126. Cyphostyla, and Wurdastom (Melastomataceae) and the Lima DFS. 2017. Estudos filogenéticos e taxonômicos em resurrection of the tribe Cyphostyleae. International Journal Myrcia DC. sensu lato (Myrtaceae), com ênfase no clado of Plant Sciences 172: 165–1178. Guianensis. Unpublished D. Phil. Thesis, Universidade Michelangeli FA, Penneys DS, Giza J, Soltis D, Hils MH, Estadual de Campinas. Skean JD. 2004. A preliminary phylogeny of the tribe Lima JF, Romero R, Simão DG. 2018. Polysporangiate Miconieae (Melastomataceae) based on nrITS sequence data anthers in Microlicia D.Don (Melastomataceae Juss.). Feddes and its implications on inflorescence position. Taxon 53: Repertorium 130: 9–18 279–290. Lucas EJ, Amorim BS, Lima DF, Lima-Lourenço AR, Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the Nic Lughadha EM, Proença CEB, Rosa PO, Rosário AS, CIPRES Science Gateway for inference of large phylogenetic Santos LL, Santos MF, Souza MC, Staggemeier VG, trees. In: Proceedings of the Gateway Computing Vasconcelos TNC, Sobral M. 2018. A new infra-generic Environments Workshop (GCE). New Orleans, 1–8. Available classification of the species-rich Neotropical genus Myrcia at: http://www.phylo.org/ (accessed 02 February 2020). s.l. Kew Bulletin 73: 9. Naudin C. 1844. Additions à la flore du Brésil méridional. Lucas EJ, Harris SA, Mazine FF, Belsham SR, Description de genres nouveaux, et rectification de quelques Nic Lughadha EM, Telford A, Gasson PE, Chase MW. anciens genres appartenant à la famille des Mélastomacées. 2007. Suprageneric phylogenetics of Myrteae, the generically Annales des Sciences Naturelles, Botanique, série 3 2: richest tribe in Myrtaceae (Myrtales). Taxon 56: 1105–1128. 140–155. Maddison WP, Maddison DR. 2001. MESQUITE: a modular Naudin C. 1849. Melastomacearum quae in Musaeo Parisiensi system for evolutionary analysis, version 3.04. Available at: continentur monographicae descriptionis et secundum http://mesquiteproject.org (accessed 02 February 2020). affinitates distributionis tentamen. Annales des Sciences Martins AB, Almeda F. 2017. A monograph of the Brazilian Naturelles, Botanique, série 3 12: 196–284. endemic genus Lavoisiera (Melastomataceae: Microlicieae). Pacifico R, Almeda F. 2020. Microlicia morrensis Phytotaxa 135: 1–194. (Melastomataceae): the third species in the genus endemic Martins E. 1995. Nova espécie do gênero Trembleya DC. to Morro do Chapéu, Bahia, Brazil. Phytotaxa 454: 137–144. (Microlicieae - Melastomataceae). Boletim de Botânica da Pacifico R, Almeda F, Rodrigues LJG, Fidanza K. 2020. Universidade de São Paulo 14: 39–42. Novelties in Microlicia (Melastomataceae: Microlicieae) from Martins E. 1997. Revisão taxonômica do gênero Trembleya the Bolivian Cerrado. Phytotaxa 433: 225–234. DC. (Melastomataceae). Unpublished D. Phil. Thesis, Pacifico R, Fidanza K. 2021. Trembleya in Flora do Brasil Universidade Estadual de Campinas. 2020 under construction. Jardim Botânico do Rio de Mazine FF, Souza VC, Sobral M, Forest FF, Lucas E. 2014. Janeiro. Available at: http://floradobrasil.jbrj.gov.br/reflora/ A preliminary phylogenetic analysis of Eugenia (Myrtaceae: floradobrasil/FB9979. (accessed 04 February 2021). Myrteae), with a focus on Neotropical species. Kew Bulletin Pacifico RB, Almeda F, Carmo AA, Fidanza K. 2019. A 69: 1–14. new species of Trembleya (Melastomataceae: Microlicieae) Mendoza-Cifuentes H, Ariza W, Granados DE, Romero R. with notes on leaf anatomy and generic circumscription. 2019. A new species of Microlicia (Melastomataceae): first Phytotaxa 391: 289–300. record of the genus for Colombia. PhytoKeys 122: 87–96. Pacifico RB, Fidanza K. 2015. Three new endangered Michelangeli FA, Almeda F, Alvear M, Bécquer ER, species of Trembleya DC. (Melastomataceae: Microlicieae) Burke J, Caddah MK, Goldenberg R, Ionta GM, from Minas Gerais, Brazil. Phytotaxa 238: 163–173. Judd WS, Majure LC, Meirelles J, Nicolas AN, Pacifico RB, Fidanza K. 2017. Microlicia sciophylla Ocampo G, Penneys DS, Skean Jr JD, Ulloa-Ulloa C. (Melastomataceae: Microlicieae), a new micro-endemic

species from the rocky fields of Minas Gerais, Brazil. Kew Rocha MJR, Guimarães PJF, Michelangeli FA, Bulletin 72: 5. Batista JAN. 2018. Taxonomy of Marcetieae: a new Pacifico RB, Fidanza K, Almeda F. 2017. Two new species neotropical tribe of Melastomataceae. International Journal of Microlicia (Melastomataceae) from the rupestrian of Plant Sciences 179: 50–74. grasslands of Serra do Cipó, Minas Gerais, Brazil. Phytotaxa Romero R. 2000. A new species of Microlicia (Melastomataceae) 316: 39–50. from Brazil. Brittonia 52: 142–144. Paradis E, Claude J, Strimmer K. 2004. APE: analyses of Romero R. 2003. Revisão taxonômica de Microlicia sect. phylogenetics and evolution in R language. Bioinformatics Chaetostomoides (Melastomataceae). Revista Brasileira de 20: 289–290. Botânica 26: 429–435. Pataro L, Romero R, Roque N. 2013. Four new species of Romero R. 2005. A new species of Microlicia (Melastomataceae) Microlicia (Melastomataceae) from Chapada Diamantina, from Minas Gerais, Brazil. Novon 15: 358–360. Bahia, Brazil. Kew Bulletin 68: 285–293. Romero R. 2010. Uma nova espécie de Microlicia Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 Penneys DS, Almeda A, Michelangeli FA, Goldenberg R, (Melastomataceae) do estado de Minas Gerais, Brasil. Martins AB, Fritsch PW. 2020. Lithobieae and Eriocnemeae: Rodriguésia 61: S15–S18. two new Neotropical tribes of Melastomataceae. Phytotaxa Romero R. 2013a. A new species of Microlicia 453: 157–178. (Melastomataceae) from the Espinhaço Range, Minas Gerais, Penneys DS, Michelangeli FA, Judd WS, Almeda F. 2010. Brazil. Phytotaxa 88: 1–5. Henrietteeae (Melastomataceae): a new Neotropical berry- Romero R. 2013b. Taxonomic notes in Microlicia fruited tribe. Systematic Botany 35: 783–800. (Melastomataceae, Microlicieae). Phytotaxa 110: 48–54. R Core Team. 2020. R: a language and environment for Romero R, Caetano APS, Santos KF, De-Paula OC, statistical computing. Vienna: R Foundation for statistical Versiane AFA. 2019a. Two new species of Microlicia D.Don computing. Available at: http://www.Rproject.org/ (accessed (Melastomataceae) from campos rupestres in eastern Brazil. 02 February 2020). Nordic Journal of Botany 37: 1–11. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. Romero R, Fontelas JC, Versiane AFA, De-Paula OC. 2018. Posterior summarisation in Bayesian phylogenetics 2019b. Microlicia longirostrata, a new species of using Tracer 1.7. Systematic Biology 67: 901–904. Melastomataceae from Goiás in Central Brazil. Systematic Reginato M, Michelangeli FA. 2016a. Primers for low-copy Botany 44: 394–354. nuclear genes in the Melastomataceae. Applications in Plant Romero R, Fontelas JC, Moreira KVC, Ferreira-Alves R, Sciences 4: 1500092. Oliveira LFA, Versiane AFA. 2021. Microlicia in Flora do Reginato M, Michelangeli FA. 2016b. Untangling the Brasil 2020 under construction. Jardim Botânico do Rio de phylogeny of Leandra s.str. (Melastomataceae, Miconieae). Janeiro. Available at: http://floradobrasil.jbrj.gov.br/reflora/ Molecular Phylogenetics and Evolution 96: 17–32. floradobrasil/FB9782 (accessed 04 February 2021). Reginato M, Michelangeli FA, Goldenberg R. 2010. Romero R, Silva KR, Simão DG. 2014. Microlicia crassa Phylogeny of Pleiochiton (Melastomataceae, Miconieae): and M. maculata spp. nov. (Melastomataceae) from Minas total evidence. Botanical Journal of the Linnean Society 162: Gerais, Brazil: morphology and leaf anatomy. Nordic Jounal 423–434. of Botany 33: 178–185. Renner SS. 1989. A survey of reproductive biology in Romero R, Silva KR, Simão DG. 2015. Microlicia Neotropical Melastomataceae and Memecylaceae. Annals of cogniauxiana and Microlicia naudiniana (Melastomataceae), the Missouri Botanical Garden 76: 496–518. two new species from the Espinhaço Range, Brazil. Systematic Renner SS. 1990. A revision of Rhynchanthera Botany 40: 1012–1021. (Melastomataceae). Nordic Journal of Botany 9: 601–630. Romero R, Versiane AFA. 2014. A new species of Microlicia Renner SS. 1993. Phylogeny and classification of the and a checklist of Melastomataceae from the mountains of Melastomataceae and Memecylaceae. Nordic Journal of Capitólio municipality, Minas Gerais, Brazil. Phytotaxa 170: Botany 13: 519–540. 118–124. Renner SS. 1994. A revision of Pterolepis (Melastomataceae: Romero R, Versiane AFA. 2016. Microlicia candolleana Melastomeae). Nordic Journal of Botany 14: 73–104. (Melastomataceae): a new endemic species to the Espinhaço Revell LJ. 2012. phytools: an R package for phylogenetic range, Minas Gerais, Brazil. Phytotaxa 261: 275–281. comparative biology (and other things). Methods in Ecology Romero R, Versiane AFA, Fontelas JC, Diniz-Neres DO, and Evolution 3: 217–223. de Paula CO. 2017. A new species of Microlicia Rocha MJR, Batista JAN, Guimarães PJF, (Melastomataceae) with bright golden cuticle from Chapada Michelangeli FA. 2016a. Phylogenetic relationships in dos Veadeiros, Goiás (Central Brazil). Systematic Botany 42: the Marcetia alliance (Melastomeae, Melastomataceae) and 562–568. implications for generic circumscription. Botanical Journal Romero R, Woodgyer E. 2010. Validation of the name Microlicia of the Linnean Society 181: 585–609. petiolulata (Melastomataceae), a new species from the Rocha MJR, Guimarães PJF, Michelangeli FA, Romero R. Espinhaço Range, Minas Gerais, Brazil. Kew Bulletin 65: 69–72. 2016b. Phylogenetic placement and a new circumscription Romero R, Woodgyer E. 2014. Rediscovery of two species of Poteranthera (Microlicieae; Melastomataceae). Phytotaxa of Microlicia (Melastomataceae) in Minas Gerais, Brazil. 263: 219–232. Phytotaxa 173: 41–48.

Romero R, Woodgyer E. 2018. Six new species of Microlicia Tel-Zur N, Abbo S, Myslabodski S, Mizrahi Y. 1999. (Melastomataceae) from Bahia, Brazil. Kew Bulletin 73: 22. Modified CTAB procedure for DNA isolation from epiphytic Sanderson MJ, Shaffer HB. 2002. Troubleshooting cacti of the genera Hylocereus and Selenicereus (Cactaceae). molecular phylogenetic analyses. Annual Review of Ecology Plant Molecular Biology Reporter 17: 249–254. and Systematics 33: 49–72. Thiers B. 2020. Index Herbariorum: a global directory of Shaw J, Lickey EB, Beck JT, Farmer SB, Liu W, Miller J, public herbaria and associated staff. New York Botanical Siripun KC, Winder CT, Schilling EE, Small RL. 2005. Garden’s Virtual Herbarium. Available at: http://sweetgum. The tortoise and the hare II: relative utility of 21 noncoding nybg.org/ih/ (accessed 06 January 2020). chloroplast DNA sequences for phylogenetic analysis. Triana J. 1872 [‘1871’]. Les Melastomacées. Transactions of American Journal of Botany 92: 142–166. the Linnean Society of London 28: 1–188. Silva DN, Diniz DO, Koschnitzke C, Guimarães PJF, Veranso-Libalah MC, Stone RD, Fongod AGN, Silva MJ, Maia VH. 2018. Chaetostoma hexapetalum Couvreur TLP, Kadereit G. 2017. Phylogeny and Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 (Microlicieae, Melastomataceae): a new species from the Chapada systematics of African Melastomateae (Melastomataceae). dos Veadeiros, Goiás, Brazil. Systematic Botany 43: 986–992. Taxon 66: 584–614. Simon MF, Grether R, Queiroz LP, Skema C, Pennington RT, Versiane AFA, Silva DN, Romero R. 2020. A new species of Hughes CE. 2009. Recent assembly of the Cerrado, a Microlicia (Melastomataceae) from Bolivia and Brazil, a new Neotropical plant diversity hotspot, by in situ evolution of synonym, and an identification key for the genus in Mato adaptations to fire. Proceedings of the National Academy of Grosso, Brazil. Phytotaxa 455: 9−20. Sciences of the United States of America 6: 20359–20364. van Welzen PC. 1997. Paraphyletic groups or what should a Som A. 2014. Causes, consequences and solutions of classification entail. Taxon 46: 99–103. phylogenetic incongruence. Briefings in Bioinformatics 16: White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification 536–548. and direct sequencing of fungal ribosomal RNA genes Soreng RJ, Peterson PM, Romaschenko K, Davidse G, for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, Zuloaga FO, Judziewicz MJ, Filgueiras TS, Davis JI, White TJ. eds. PCR protocols: a guide to methods and Morrone O. 2015. A worldwide phylogenetic classification applications. San Diego: Academic Press, 315–322. of the Poaceae (Gramineae). Journal of Systematics and Woodgyer E. 2005. Multi-access key and checklist to the Evolution 53: 117–137. species of Microlicia (Melastomataceae) in Bahia, Brazil. Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood Kew Bulletin 60: 441–448. based phylogenetic analyses with thousands of taxa and Wurdack JJ. 1958. Melastomataceae. In: Maguire B, mixed models. Bioinformatics 22: 2688–2690. Wurdack JJ, eds. The botany of Guayana Highland - Part III. Tang Y, Yukawa T, Bateman RM, Jiang H, Peng H. 2015. New York: Memoirs of the New York Botanical Garden 10: Phylogeny and classification of the East Asian Amitostigma 95–117. alliance (Orchidaceae: Orchideae) based on six DNA markers. Wurdack JJ. 1982. Certamen Melastomataceis XXXIV. BMC Evolutionary Biology 15: 96. Phytologia 50: 297–298.

SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Supplementary Table S1. Voucher information and GenBank accession numbers for taxa included in this study. A dash (–) indicates that the DNA region was not sequenced. Acronyms: BO (Bolivia), BR (Brazil), PE (Peru), US (United States), VE (Venezuela). Supplementary Table S2. Morphological characters and character states scored in this study as primary homology hypotheses. A, Habit: herbaceous (0), woody (1); B, Leaf venation: absent (0), present (1); C, Flower arrangement: solitary (0), dichasium (1), paired or reduced to one flower (2), glomerule (3); D, Petal number: less than five (0), five (1), more than five (2); E, Bristles on the hypanthium apex: absent (0), present (1); F, Number of whorls with fertile stamens: one whorl (0), two whorls (1); G, Anther whorls: isomorphic (0), subisomorphic (1), dimorphic (2); H, Anther, number of sporangia: tetrasporangiate (0), polysporangiate (1); I, Ovary locule number: two (0), three (1), four (2), five (3), more than five (4); J, Ovary position: (0) superior, (1) partly inferior, (2) inferior; K, Fruit dehiscence: basipetal (0), acropetal (1); L, Columella: persistent (0), deciduous (1). Supplementary Table S3. The number of changes between all morphological character states, considering only the Microlicieae. Habit: herbaceous (0), woody (1); Leaf venation: absent (0), present (1); Flower arrangement: solitary (0), dichasium (1), paired or reduced to one flower (2), glomerulate (3); Petal number: less than five (0), five (1), more than five (2); Bristles on the hypanthium apex: absent (0), present (1); Number of whorls with fertile stamens: one whorl (0), two whorls (1); Anther whorls: isomorphic (0), subisomorphic (1), dimorphic (2); Anther, number of sporangia: tetrasporangiate (0), polysporangiate (1); Ovary locule number: two (0), three (1), four (2),

© 2021 The Linnean Society of London, Botanical Journal of the Linnean Society, 2021, 197, 35–60 60 A. F. A. VERSIANE ET AL. five (3), more than five (4); Ovary position: (0) superior, (1) partly inferior, (2) inferior; Fruit dehiscence: basipetal (0), acropetal (1); Columella: persistent (0), deciduous (1). Supplementary Figure S1. Majority consensus tree from Bayesian inference analysis of nuclear DNA sequences. Numbers are posterior probabilities (PP) from Bayesian inference analysis (only PP ≥ 0.90). The type species of each genus is marked with an asterisk (*). Supplementary Figure S2. Majority consensus tree from Bayesian inference analysis of plastidial DNA sequences. Numbers are posterior probabilities (PP) from Bayesian inference analysis (only PP ≥ 0.90). The type species of each genus is marked with an asterisk (*) Supplementary Figure S3. Stochastic mapping of selected characters in the tribe Microlicieae. A, habit; B, bristles on the hypanthium apex; C, number of whorls with fertile stamens; D, ovary position; E, fruit dehiscence;

F, columella. The estimated posterior probabilities of the probably ancestral states are indicated by pie charts Downloaded from https://academic.oup.com/botlinnean/article/197/1/35/6188938 by guest on 01 October 2021 on the corresponding nodes. The letters next to the bars in the fan trees indicate Marcetieae (A), Rhexieae (B), Rhynchanthera (C), Poteranthera (D), Microlicia s.l. (E–K), Trembleya s.s. (E), Stenodon and allies (F), ‘Pinheiroa’ (G); Lavoisiera (H), Chaetostoma (I), ‘Viminales’ (J), ‘Ericoides’ (K). RI, retention index. Supplementary Text S1. Additional discussion about the clades formed in Microlicieae.