Iron- and Temperature-Dependent Regulation of Shigella Dysenteriae Virulence

Home , Effector (biology), Shigella dysenteriae, Shigella flexneri, Shigella sonnei

Iron- and Temperature-Dependent Regulation of Shigella Dysenteriae Virulence-

Associated Factors

A dissertation presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Doctor of Philosophy

Yahan Wei

December 2016

This dissertation titled

Iron- and Temperature-Dependent Regulation of Shigella Dysenteriae Virulence-

Associated Factors

YAHAN WEI

has been approved for

the Department of Biological Sciences

and the College of Arts and Sciences by

Erin R. Murphy

Associate Professor of Bacteriology

Robert Frank

Dean, College of Arts and Sciences 3

ABSTRACT

WEI, YAHAN, Ph.D., December 2016, Biological Sciences

Iron- and Temperature-Dependent Regulation of Shigella Dysenteriae Virulence-

Associated Factors

Director of Dissertation: Erin R. Murphy

Shigella is a genus of Gram-negative pathogenic bacteria that causes shigellosis, a severe form of bacillary dysentery in human with an infectious dose of less than 100 cells. The global burden of shigellosis is estimated to be no less than 125 million infections, with the majority of both infection and resulting deaths occurring in children under the age of five. These facts, in combination with the lack of a vaccine or universally effective treatment makes understanding the molecular mechanisms underlying the pathophysiology of Shigella of utmost importance. To survive and successfully colonize in the host, bacterial pathogens regulate the expression of multiple virulence-associated factors in response to the changes of environmental cues. This study focused on two of the important virulence-associated processes in the infections of S. dysenteriae, the most virulent species in the genus of Shigella: 1) acquisition of essential nutritional iron via the Shigella heme uptake (Shu) system from the iron-limited environment within the human host, and 2) secretion of effector proteins required for the invasion processes through the type III secretion system (T3SS). Investigations presented here identify the host-associated environmental factors that regulate the expression of the specific factors required to complete the processes listed above, and characterize the molecular mechanisms underlying each regulation. Specifically, studies focused on the 4 regulation of the Shu system demonstrate that its periplasmic binding component, ShuT, is subject to iron-dependent transcriptional regulation via the activity of the global transcriptional regulator Fur, and temperature-dependent post-transcriptionally mediated by an RNA thermometer located within the 5' untranslated region of the gene. Studies focused on the regulation of MxiG, a component of the T3SS, identify and characterize a functional RNA thermometer that mediates post-transcriptional temperature-dependent regulation. Findings in this study provide: 1) a unique example of Fur-mediated regulation via interacting with a sequence located downstream of the promoter region, and 1) the first evidence of RNA thermometer controlling expression of T3SS component. These findings could lead to revealing of further details about the molecular mechanisms of each regulatory system, and also contribute to the knowledge pool required in designing new strategies of defending against bacterial infections. 5

DEDICATION

I would like to dedicate this work to my mother, for her love and support

ACKNOWLEDGMENTS

I would like to acknowledge all the people and institutions for their support throughout my graduate career and numerous contributions to this work. Firstly, I want to express my sincere gratitude to my advisor Erin R. Murphy, who have been really patient, motivating, and continuously supporting me and guiding me through the project.

I would also like to thank my committee members, Peter Coschigano, Jennifer Hines,

Donald Holzschu, and Tomohiko Sugiyama, for their insightful comments and encouragement. My thanks also go to my lab mate Megan Firs, our lab technician

Michelle Pate, and former lab members Andrew Kouse and William Broach. Finally, I would like to thank Ohio University and the American Heart Association for their financial support.

TABLE OF CONTENTS

Page

Abstract ...... 3 Dedication ...... 5 Acknowledgments...... 6 List of Tables ...... 11 List of Figures ...... 12 Chapter 1: Introduction ...... 14 1.1 Significance ...... 14 1.2 Shigella ...... 16 1.2.1 Shigella species and evolutionary relationships ...... 16 1.2.2 Pathogenesis ...... 17 1.2.3 Shigella virulence factors ...... 19 1.3 Regulation of Shigella iron uptake systems ...... 21 1.3.1 Iron uptake systems in Shigella ...... 21 1.3.2 Regulation of iron uptakes systems ...... 29 1.4 Regulation of bacterial virulence-associated genes via RNA thermometers ...... 33 1.4.1 Families of RNA thermometers ...... 35 1.4.2 Bacteria virulence-associated genes regulated by RNA thermometer ...... 45 Chapter 2: Iron-dependent regulation of shuT ...... 49 2.1 Abstract ...... 49 2.2 Introduction ...... 49 2.2.1 Heme uptake system and bacterial pathogenesis ...... 49 2.2.2 Shigella heme uptake (Shu) system ...... 51 2.2.3 Transportation of heme via the Shu system ...... 52 2.2.4 Fur-mediated iron-dependent regulation of the Shu system...... 56 2.3 Methods and materials ...... 58 2.3.1 Strains and culture conditions ...... 58 2.3.2 Oligonucleotide primers ...... 60 2.3.3 Reporter plasmid construction ...... 61 8

2.3.4 RNA extraction and DNA removal ...... 62 2.3.5 Reverse transcriptase PCR ...... 64 2.3.6 Rapid amplification of cDNA 5' end analysis ...... 65 2.3.7 Beta-galactosidase assay ...... 66 2.3.8 Western blot analysis ...... 67 2.3.9 Quantitative Real-time PCR analysis ...... 68 2.3.10 Electrophoretic mobility shift assay ...... 69 2.3.11 In silico analyses ...... 71 2.3.12 Statistical analysis ...... 72 2.4 Results ...... 72 2.4.1 Fur mediates iron-dependent regulation of shuT ...... 72 2.4.2 Identification of shuT transcriptional start site ...... 74 2.4.3 Identification of shuT promoter region ...... 77 2.4.4 Sequences within shuT promoter and 5' untranslated region mediates iron- dependent regulation by Fur ...... 79 2.4.5 A functional Fur binding site is located immediately down-stream of the shuT transcription start site ...... 81 2.5 Discussion ...... 89 Chapter 3: Temperature-dependent regulation of shuT ...... 91 3.1 Abstract ...... 91 3.2 Introduction ...... 91 3.2.1 Temperature-dependent transcriptional regulation ...... 92 3.2.2 Temperature-dependent post-transcriptional regulation ...... 93 3.2.3 Temperature-dependent regulation of the Shu system ...... 94 3.3 Methods and Materials ...... 95 3.3.1 Strains and culture conditions ...... 95 3.3.2 Oligonucleotide primers ...... 96 3.3.3 Reporter plasmid construction ...... 97 3.3.4 RNA extraction and DNA removal ...... 98 3.3.5 Western blot analysis ...... 100 3.3.6 Quantitative Real-time PCR analysis ...... 101 3.3.7 Enzymatic RNA structure probing ...... 102 9

3.3.8 In silico analyses ...... 104 3.3.9 Statistical analysis ...... 104 3.4 Results ...... 104 3.4.1 Nucleic acid sequences within the shuT promoter and/or 5' UTR confer temperature-dependent post-transcriptional regulation ...... 104 3.4.2 Nucleic acid sequences composing the putative shuT RNA thermometer are sufficient to confer temperature-dependent post-transcriptional regulation ...... 108 3.4.3 A functional RNA thermometer is contained within the shuT 5' UTR ...... 109 3.4.4 Double-stranded structure containing the shuT ribosomal binding site gradually opens when environmental temperature increases ...... 112 3.4.5 Heme utilization in S. dysenteriae is regulated by environmental temperature ...... 114 3.5 Discussion ...... 116 Chapter 4: Other RNA thermometers in S. dysenteriae ...... 119 4.1 Abstract ...... 119 4.2 Introduction ...... 119 4.3 Methods and materials ...... 122 4.3.1 Strains and culture conditions ...... 122 4.3.2 Oligonucleotide primers ...... 124 4.3.3 Reporter plasmid construction ...... 125 4.3.4 RNA extraction and DNA removal ...... 125 4.3.5 Western blot analysis ...... 127 4.3.6 Quantitative Real-time PCR analysis ...... 128 4.3.7 In silico analyses ...... 129 4.3.8 Statistical analysis ...... 129 4.4 Results ...... 129 4.4.1 The ribosomal binding site of mxiG is predicted to be included in a hairpin resembling that of an RNA thermometer ...... 129 4.4.2 Stabilizing the inhibitory structure within the putative mxiG RNA thermometer abolishes translation of the reporter gene ...... 132 4.4.3 The 5' hairpin of mxiG RNA thermometer is required to confer temperature- dependent regulation ...... 134 4.4.4 In silico analysis identified an RNA thermometer-like structure incorporating the ribosomal binding site and start codon of gene shuX ...... 136 10

4.5 Discussion ...... 138 Chapter 5: Disscusion ...... 143 References ...... 147

LIST OF TABLES

Page

Table 1: Summary of the iron uptake systems in Shigella and the regulatory factors ...... 22 Table 2: Summary of bacterial strains and plasmid vectors ...... 58 Table 3: Summary of oligonucleotide primers ...... 60 Table 4: Summary of bacterial strains and plasmid vectors ...... 96 Table 5: Summary of oligonucleotide primers ...... 97 Table 6: Summary of bacterial strains and plasmid vectors ...... 123 Table 7: Summary of oligonucleotide primers ...... 124 Table 8: Summary of the identified intergenic RNA thermometers ...... 140

LIST OF FIGURES

Page

Figure 1: Cellular pathogenesis of Shigella...... 18 Figure 2: Iron uptake systems in Shigella...... 24 Figure 3: A schematic of the molecular mechanism of RNA thermometers...... 34 Figure 4: Structural features of the ROSE-like family of RNA thermometers...... 39 Figure 5: Structural features of the FourU family of RNA thermometers...... 41 Figure 6: Key virulence-associated processes controlled by RNA thermometers in bacteria...... 46 Figure 7: Schematic of the S. dysenteriae shu locus...... 52 Figure 8: Schematic of the Shu system...... 53 Figure 9: Schematic of Fur-mediated iron-dependent repression...... 57 Figure 10: shuT expression is regulated in response to iron by Fur...... 73 Figure 11: Identification of shuT transcriptional start site...... 75 Figure 12: Results of RNA sequencing and 5'-RACE analyses...... 77 Figure 13: Identification of shuT promoter...... 78 Figure 14: Sequences within shuT promoter and 5' untranslated region mediates iron- dependent regulation by Fur...... 80 Figure 15: A putative Fur-binding site is located immediately down-stream of the shuT transcription start site...... 82 Figure 16: Fur binds specifically to sequences within the shuT 5' UTR...... 86 Figure 17: Truncation of the Fur-binding site abolishes iron-dependent regulation...... 88 Figure 18: shuT is subject to temperature-dependent post-transcriptional regulation. ... 106 Figure 19: Predicted secondary structure of shuT 5' untranslated region...... 107 Figure 20: Sequences within shuT 5' untranslated region is enough to confer post- transcriptional temperature-dependent regulation...... 109 Figure 21: Destabilization of the putative shuT RNA thermometer abolishes translational inhibition at previously non-permissive temperature...... 111 Figure 22: The inhibitory hairpin within the shuT RNA thermometer gradually opens as environmental temperature increases...... 114 Figure 23: Heme utilization in S. dysenteriae is more efficient at higher environmental temperature...... 116 13

Figure 24: The ribosomal binding site of mxiG is incorporated within a functional putative RNA thermometer...... 131 Figure 25: Stabilizing mutations abolishes expression of the reporter gene at previous permissive temperature...... 134 Figure 26: The 5' hairpin of mxiG RNA thermometer is required to confer temperature- dependent regulation...... 136 Figure 27: Sequences including shuX ribosomal binding site and translational start codon forms a RNA thermometer-like structure...... 137 Figure 28: Model of shuT regulation in response to changes of iron-availability and environmental temperature...... 144

CHAPTER 1: INTRODUCTION

1.1 Significance

Shigella is a genus of pathogenic enterobacteria composed of four species, S. boydii, S. sonnei, S. flexneri, and S. dysenteriae. Shigella species are the causative agents of shigellosis, a form of severe infectious bacillary dysentery in humans, with a very low infectious dose (10~100 cells) (DuPont et al., 1989). In the last century, it was estimated that approximately 164 million infectious and 1.1 million deaths were caused by Shigella infection annually and globally (Kotloff et al., 1999). In the past couple years, though the case number of shigellosis-related death decreased dramatically, the global burden of

Shigella infection still remains no less than 125 million infections annually, with the majority of both infections and deaths occurring in children under the age of five

(Bardhan et al., 2010).

Currently, S. flexneri accounts for approximately 80% of the global burden of shigellosis, especially in developing countries; while in developed countries, S. sonnei is the main cause of shigellosis (Gu et al., 2012). Of the four Shigella species, S. dysenteriae causes the fewest number of infections; however, it is the only species known to cause epidemic outbreaks, has the highest fatality rate following infection, and is associated with significant post-infection sequelae including Hemolytic Uremic

Syndrome and Reiter’s syndrome (Calin, 1979; Mark Taylor, 2008; Kotloff et al., 1999).

Following entry into the host via the fecal-oral route, a successful Shigella infection requires sequential invasion into colonic epithelial cells, intracellular replication, and cell-to-cell spread by the pathogen. Collectively, these processes result 15 directly in the formation of lesions within the colonic epithelium, leading to the disruption of water balance and the bloody diarrhea associated with Shigella infections

(Schroeder and Hilbi, 2008). In addition to the above cellular destruction, S. dysenteriae also produces and secrets Shiga toxin, a cytotoxic toxin that directly kills eukaryotic cells and can lead to severe organ failure in patients (Tesh and O’Brien, 1991).

The use of antibiotics to treat an infection with S. dysenteriae is contra-indicated after the first 24 hours of infection, as antibiotic treatment increases production and release of the Shiga toxin by the pathogen (Zimmerhackl, 2000). Moreover, Center for

Disease Control (CDC) records indicate the development and spreading of multidrug resistance in all four Shigella species over recent years (CDC, 2013). These facts in combination with the lack of a vaccine to prevent shigellosis make understanding the molecular mechanisms underlying the ability of Shigella species to infect the human host and cause disease of utmost importance. It is only after such an understanding is achieved that this information can be used to guide the development of novel therapeutics designed to disrupt specific virulence-associated processes, and by doing so, lessen or eliminate the ability of Shigella to cause human disease.

This study is focusing on understanding, at the molecular level, the regulatory mechanisms controlling the ability of S. dysenteriae to complete two of the important virulence-associated processes: 1) the utilization of heme-bound iron as a source of nutritional iron, and 2) the secretion of effector proteins via the type III secretion system

(T3SS). Specifically, host-associated environmental factors that regulate the expression of the specific factors required to complete the listed processes were determined, and the 16 molecular mechanisms underlying the regulation of each were identified. Findings of these studies contribute to the knowledge pool required in designing new strategies for defending against bacterial infections.

1.2 Shigella

1.2.1 Shigella species and evolutionary relationships

Shigella is a genus of Gram negative, non-motile, and non-sporulating pathogenic bacillary bacteria, firstly identified in 1897 by Kiyoshi Shiga (Shiga, 1897). The first

Shigella species to be identified as a causative agent of epidemic bacillary dysentery in human was S. dysenteriae, the other three species were discovered sequentially in the following decades (Schroeder and Hilbi, 2008). Characterization of the four Shigella species is based on the serotypes of cell surface O-antigen, which also serves as the classification criteria for further division of each species into different serovars.

Though different in some physiological characteristics, such as mannitol fermentation and lysine decarboxylation, Shigella shares more than 90% genomic similarity with Escherichia coli (Zhang and Lin, 2012). Phylogenetic analysis suggest that Shigella species evolved from several E. coli ancestors independently, with the acquisition of virulence genes via horizontal transfer and the loss of genes in order to adaptive to the intracellular pathogenic lifestyle (The et al., 2016). In Shigella, acquired virulence-associated genes exist on both the bacterial chromosome and a large virulence plasmid (Schroeder and Hilbi, 2008).

1.2.2 Pathogenesis

Partially due to the horizontal transfer of virulence genes, Shigella shares several similarities with other bacterial pathogens, such as the fecal-oral route transmission,

T3SS-dependent invasion, and actin-based motility. However, Shigella infection is also unique in many aspects. For example, less than 100 cells of Shigella is sufficient to cause

Shigellosis in human (DuPont et al., 1989). As a comparison, other diarrhea-associated bacterial pathogens such as Salmonella and Vibrio cholera require the ingestion of at least 105 cells to establish infection (Blaser and Newman, 1982; Cash et al., 1974). The low infectious dose of Shigella is partially due to its ability to resist the low pH encountered in the human stomach and to down-regulate the production of antimicrobial factors within host cells (Gorden and Small, 1993; Islam et al., 2001).

Shigella invasion is initiated when the bacteria cell is engulfed by a microfold cell

(M cell) located within the large intestine epithelium (Figure 1). M cells are part of the mucosal innate immune system and constantly sample materials within the intestine lumen via phagocytosis and presenting antigens to macrophages contained within an intracellular pocket. Once engulfed by a macrophage, Shigella species induce apoptosis of the macrophage releasing the pathogen to the basolateral side of the colonic epithelium

(Schroeder and Hilbi, 2008).

Figure 1. Cellular pathogenesis of Shigella. Shigella cells initially invade (①) through microfold cell (M cell) and is transcytosed across the colonic epithelium and presented to a macrophage. Followed by induced apoptosis of the macrophage, bacteria invade into the epithelial cells from the basolateral side, and penetrated adjacent cells through actin- based movement. In addition, inflammation attrackes neutrophils, which lead to the disintegration of the tight junctions between epithelial cells, porviding Shigella an alternative way (②) to arrive at the basolateral side of the epithelium.

With the production of T3SS, Shigella adheres to the cholesterol-rich membrane rafts of the epithelial cell (Lafont et al., 2002). Effector proteins are secreted into the eukaryotic cell that function to remodel the eukaryotic actin cytoskeleton, which eventually leads to the internalization of Shigella by the epithelial cell. Cytoskeleton remodeling also prevents the vacuole containing Shigella from entering the lysosomal degradation pathway. After escaping from the vacuole, a process dependent upon the

T3SS, Shigella multiplies within the eukaryotic cell cytoplasm and penetrates adjacent cells via actin-based movement. Additionally, Shigella actively simulates the migration of neutrophils to the infected area, which further destroys the epithelial lining and 19 provides the pathogens with increased access to the basolateral side of epithelium without the help of M cells (Figure 1). (Schroeder and Hilbi, 2008)

1.2.3 Shigella virulence factors

During transmission and throughout the course of a natural infection, Shigella experience varied environmental conditions. Changes of environmental cues trigger expression of genes needed for Shigella to survive in the human body and to establish infections. Such virulence-associated genes encode the virulence factors of Shigella are located on both the chromosome and a large virulence plasmid, and vary between the four Shigella species (Schroeder and Hilbi, 2008). Generally, chromosomally encoded virulence-associated genes include those encoding toxins as well those whose protein products are involved in nutrient acquisition, antibiotic resistance, and evasion of the host immune response. Genes encoded on the virulence plasmid, on the other hand, are mainly involved in cell invasion and cell-to-cell spread.

The large virulence plasmid is carried by all Shigella species, range in size from

210~220kb, and contains a mosaic of approximately 100 genes (Buchrieser et al., 2000;

Jiang et al., 2005; Yang et al., 2005). Though the virulence plasmids are different within the four Shigella species, they share a 31kb conserved entry-region, containing more than

30 genes that are essential for Shigella to escape from macrophage and invade into epithelial cells (Sasakawa et al., 1988; Maurelli et al., 1985). The main part of this entry- region contains 20 mxi-spa genes that encode the structural components of the T3SS

(Buchrieser et al., 2000). Several effector proteins that are necessary for host cell 20 invasion and intracellular survival are also located within this region (Schroeder and

Hilbi, 2008). In addition, two transcriptional activators, VirB and MxiE, are encoded within the entry-region and function as the master regulators of multiple virulence genes

(Le Gall et al., 2005; Buchrieser et al., 2000). Additional T3SS effector proteins are encoded on the large virulence plasmid outside the entry-region (Killackey et al., 2016;

Buchrieser et al., 2000).

Expression of Shigella virulence-associated genes is tightly regulated in response to multiple environmental factors, such as temperature, pH, osmolality, and oxygen levels

(Nakayama and Watanabe, 1995; Kouse et al., 2013; Prosseda et al., 2004; Payne et al.,

2006). In addition, secretion of effector proteins requires direct contact of the T3SS apparatus with the membrane of an epithelial cell, a process possibly mediated by the presence of oxygen immediately adjacent to the epithelial membrane (Watarai et al.,

1995). Such multi-factored environmentally influenced regulation ensures the expression of essential virulence factors during each step of invasion, and also prevents the potential detrimental effects of producing these factor under non-favored conditions. It has been shown that the expression of virulence factors negatively affects cell growth. In addition, when a bacterium transits from the extracellular to the intracellular environment, the metabolic pathways utilized also switch. Without this switch, the expression of some virulence genes is inhibited. Since regulation by host-associated environmental factors is important for Shigella pathogenesis, understanding these mechanisms could advance the development of novel targets for effective treatments.

1.3 Regulation of Shigella iron uptake systems

1.3.1 Iron uptake systems in Shigella

The survival of Shigella, and thus its ability to cause disease, is strictly dependent on the ability of the organism to acquire essential nutrients, such as iron, from each encountered environment. The strict requirement of iron stems from the fact that this element is an essential co-factor of several enzymes involved in basic biological processes such as DNA replication and respiration. While iron is essential, too much of this element is toxic to a bacterium (Imlay et al., 1988). To balance the necessity and toxicity of the element, iron homeostasis must be precisely maintained, a requirement that is facilitated, at least in part, by regulation of bacterial iron-acquisition systems.

As an innate immune defense against invading pathogens, iron within the human body is sequestrated within iron binding compounds and proteins, generating a concentration of bioavailable iron of approximately 10-24M, a concentration that is far below the 10-7M required for the survival of most bacteria (Raymond et al., 2003;

Andrews et al., 2003). In response to this iron limitation, pathogenic bacteria have evolved several systems to utilize the various sources of iron present within the infected host. Regulating the production of these specific iron acquisition systems in response to environmental conditions allows the bacterium to most efficiently utilize host-associated forms of iron while avoiding iron-mediated toxicity.

The currently identified Shigella iron uptake systems can be grouped into three broad categories based on the form of iron that is being utilized; 1) systems for the utilization of ferric iron (Fe3+), 2) systems for the utilization of heme-bound iron, and 3) 22 systems for the utilization of ferrous iron (Fe2+). Each of the four Shigella species contains multiple iron uptake systems, however, the composition of iron acquisition systems varies by species. Each identified Shigella iron uptake system as well as their distributions among Shigella species is presented below (Table 1). Information of this section has been published in (Wei and Murphy, 2016a) under CC BY 4.0 license.

Available from: http://dx.doi.org/10.3389/fcimb.2016.00018

Table 1

Summary of the iron uptake systems in Shigella and the regulatory factors Iron uptake Effects of identified regulatory Distribution in Shigella Substrates systems factors species S. sonnei, S. dysenteriae, Ent/Fep Fe (↓) S. boydii*, S. flexneri* Iro Fe (↓) S. dysenteriae Fe (↓), O2 (↑), RyhB (↑) in E. S. sonnei, S. boydii, Fe3+ Iuc/Iut coli S. flexneri Fec Fe (↓), ECF (↑) S. sonnei, S. flexneri S. sonnei, S. dysenteriae, Fhu Fe (↓), O2 (↑) S. boydii, S. flexneri Heme Shu Fe (↓), High temperature (↑) S. dysenteriae, S. sonnei S. sonnei, S. dysenteriae, Feo Fe (↓), O2 (↓) S. boydii, S. flexneri S. sonnei, S. dysenteriae, Fe2+ Sit Fe (↓), O2 (↑) S. boydii, S. flexneri Efe Fe (↓), low pH (↑) S. sonnei * The biosynthetic system of enterobactin in S. boydii and S. flexneri is inactivated by the presence of a frameshift, a premature stop codon, and/ or an insertion within the coding genes; as a consequence, no detectable enterobactin is produced. © 2016 Wei Y, Murphy ER. Published in (Wei and Murphy, 2016a) under CC BY 4.0 license. Available from: http://dx.doi.org/10.3389/fcimb.2016.00018

1.3.1.1 Ferric iron utilization systems

To utilize Fe3+, Shigella have evolved several systems to synthesize, secrete, and uptake siderophores, a group of compounds with very high iron-binding affinities and functionally compete for iron bound within host-associated iron-sequestrating factors

(Hider and Kong, 2010; Carrano and Raymond, 1979). In Shigella, the combination of siderophores that are synthesized and utilized varies by species, but the uptake process is partially conserved (Figure 2). Specifically, transportation of each Fe3+-siderophore into the bacterial cell is initiated by binding of the complex with a specific outer-membrane receptor. Once bound by its receptor, the complex is transported across the outer- membrane, passed to a periplasmic binding protein (PBP), and finally transported across the inner-membrane by the activity of an ABC permease complex. Transportation across a membrane requires energy. Anchored within the inner-membrane, the

TonB/ExbB/ExbD complex transduces the energy generated by the proton gradient via

TonB to a given iron-binding outer-membrane receptor to provide the energy required to transport the associated cargo across the outer-membrane (Larsen et al., 1997). ATP hydrolysis generates the energy needed for the subsequent crossing of the iron-containing cargo across the inner-membrane. Compared to the outer-membrane receptors, PBPs have lower substrate specificity, thus one PBP can facilitate the transportation of multiple siderophores with similar chemical structures (Miethke and Marahiel, 2007). Once inside the bacterial cell, iron is either released from the siderophore for utilization, or bound within storage proteins for future use. Each identified siderophore and its transportation system in Shigella are discussed below. 24

Figure 2. Iron uptake systems in Shigella. This figure is a schematic of the Shigella iron uptake systems, which have been categorized into three broad groups based on the form of iron or iron-containing compounds that are being utilized. These three groups are 1) systems that transport ferrous iron (Fe2+), systems for the utilization of ferric iron (Fe3+), and systems for the uptake of heme (Heme). © 2016 Wei Y, Murphy ER. Published in (Wei and Murphy, 2016a) under CC BY 4.0 license. Available from: http://dx.doi.org/10.3389/fcimb.2016.00018

Enterobactin: Discovered in 1970, enterobactin is the siderophore with the highest known affinity for Fe3+ (~1049) (O’Brien, I et al., 1970; Pollack and Neilands, 1970;

Loomis and Raymond, 1991). Genes involved in the synthesis, secretion, and utilization of enterobactin are encoded in a single locus, with the ent genes encoding factors involved in the synthesis and secretion of the siderophore, and the fep genes encoding the uptake system (Laird et al., 1980). Specifically, fepA encodes a TonB-dependent outer- membrane receptor, fepB encodes a PBP, and fepCDG encode proteins composing the

ABC permease complex (Ozenberger et al., 1987). All four Shigella species contain the ent/fep locus, however some of these genes are inactivated in S. boydii as well as in some 25 strains of S. flexneri due to the presence of a frameshift, a premature stop codon, and/or an insertion (Payne, 1980; Payne et al., 1983). Due to its high iron-binding affinity, enterobactin can chelate iron from host iron-binding factors (Carrano and Raymond,

1979). For example, a recent study shows that enterobactin can overcome the sequestration of iron by ATP in the intracellular environment, and as such would promote survival of the pathogen within a macrophage (Tatano et al., 2015). However, in the extracellular environment, bacterial infection induces host cells to produce and secrete lipocalin-2, a protein that specifically binds enterobactin, thus preventing the bacterium from utilizing the iron within (Flo et al., 2004).

Salmochelin: Due to their different chemical structures, some enterobactin derivatives are not recognized by lipocalin-2, and have been found to be important in bacterial virulence. One such enterobactin derivative is salmochelin, a siderophore produced by S. dysenteriae (Fischbach et al., 2006; Wyckoff et al., 2009). The iro locus contains genes encoding enzymes that modify enterobactin into salmochelin, a secretion transporter, and a salmochelin specific TonB-dependent outer-membrane receptor (IroN)

(Hantke et al., 2003). Other factors involved in salmochelin utilization, including the PBP and the ABC transporter, are the same as those used for enterobactin (Müller et al.,

2009).

Aerobactin: Some strains of S. flexneri, S. boydii, and S. sonnei produce aerobactin, a siderophore that has a different chemical structure from that of enterobactin; and as a result, can also escape the sequestration by host protein lipocalin-2 (Lawlor and

Payne, 1984; Flo et al., 2004). Aerobactin has been shown to promote the virulence of 26 uropathogenic E. coli; and in Shigella, production of aerobactin has been shown to facilitate the extracellular growth of the bacteria (Torres et al., 2001; de Lorenzo and

Martinez, 1988). iucABCD encode the enzymes required for the bio-synthesis of aerobactin are located in a single locus along with iutA, a gene encoding the aerobactin- specific TonB-dependent outer-membrane receptor (Carbonetti and Williams, 1984). The remaining factors required for the utilization of aerobactin are encoded within the fhu locus, and thus are the same as those utilized for the transportation of ferrichrome (Koster and Braun, 1990).

Xenosiderophores: Like many other bacterial species Shigella can utilize xenosiderophores, siderophores produced by other microorganisms (Payne, 1980). For example, ferrichrome, a fungal siderophore with a chemical structure similar to that of aerobactin is utilized by Shigella species via the Fhu system. fhuA encodes the ferrichrome-specific TonB-dependent outer-membrane receptor (Miethke and Marahiel,

2007; Koster and Braun, 1990).

Ferric-dicitrate: Ferric iron can also bind with citrate to form ferric-dicitrate. S. sonnei and one strain of S. flexneri have been shown to be able to utilize ferric-dicitrate as a source of nutrient iron using the Fec system (Luck et al., 2001; Wyckoff et al., 2009).

The ferric-dicitrate utilization system is encoded by genes within the fec locus, with fecA encoding the outer-membrane receptor, fecB encoding the PBP, and fecCDE encoding proteins composing the ABC transporter complex (Braun and Mahren, 2005).

1.3.1.2 Heme utilization system

The Shigella heme-uptake (Shu) system was identified in S. dysenteriae and is predicted to be present in some strains of S. sonnei (Wyckoff et al., 1998). A mutation of shuA, the outer-membrane heme receptor, eliminates the ability of S. dysenteriae to utilize heme as the sole iron source, suggesting that the Shu system is the only functional heme-utilization system in this species (Mills and Payne, 1997). In uropathogenic E. coli, inactivation of the orthologous gene chuA results in attenuation of virulence, a finding that directly implements the heme receptor as a virulence factor in this closely related species (Torres et al., 2001). Additional components of the Shu system including a PBP

(ShuT) and an inner-membrane ABC permease complex (ShuUV) (Wyckoff et al., 1998;

Eakanunkul et al., 2005; Burkhard and Wilks, 2008). The overall transportation processes are similar to those detailed above for siderophore utilization. Interestingly, the fact that

Shigella species that do not encode shu genes are able to utilize heme as a sole source of nutrient iron suggests the existence of yet unidentified heme-utilization system(s) in these bacteria (Payne et al., 2006).

1.3.1.3 Ferrous iron utilization systems

Under anaerobic and/ or acidic conditions, Fe2+ is the dominant form of bioavailable iron. The ability of a bacterium to utilize Fe2+ is important in several host- associated environments including that encountered within the anaerobic environment of the human colon. Three Fe2+-uptake systems have been identified in Shigella: the Feo 28 system, the Sit system, and the Efe system (Kammler et al., 1993; Zhou et al., 1999;

Große et al., 2006; Jin et al., 2002). (Figure 2)

Feo system: Despite being the first Fe2+ utilization system identified in Shigella, details of the molecular mechanism(s) underlying the activity of the Feo system remain largely unknown (Kammler et al., 1993). Only three genes have been identified in the

Feo system to date: feoA, feoB, and feoC. feoB encodes an inner-membrane transporter with GTPase activity and a structure similar to that of a eukaryotic G protein (Marlovits et al., 2002). FeoC contains an oxygen-responsive [4Fe-4S] cluster, and functions to promote the proteolysis of FeoB in the presence of oxygen (Kim et al., 2015; Hsueh et al., 2013). While known to be required for transporting Fe2+ by FeoB, the exact function of FeoA remains to be determined (Kim et al., 2012; Lau et al., 2013).

Sit system: The sit locus contains four genes: sitA encoding the PBP and sitBCD encoding components of the ABC permease complex (Zhou et al., 1999; Fisher et al.,

2009). Interestingly, no outer-membrane receptor has been identified to date, leading to the hypothesis that Fe2+ is either transported through the outer-membrane via non- specific porins and/or ion channels, or originated from reduced Fe3+ by an extracellular reductase (Andrews et al., 2003). Studies in Salmonella indicate that SitA has a higher affinity for manganese than for Fe2+, which suggests that the primary function of the Sit system might be to transport manganese (Kehres et al., 2002). It has been demonstrated, however, that S. flexneri 2a is able to use the Sit system as the sole iron uptake system to survive and form plaques in a monolayer of eukaryotic cells, suggesting a direct role for this system in pathogenesis (Runyen-Janecky et al., 2003). Thus, it remains a formal 29 possibility that in Shigella, the Sit system transports both manganese and iron.

Interestingly, the E. coli orthologues of the Shigella manganese transporter MntH and zinc transporter YgiE (MntH and ZupT, respectively) have been shown to transport Fe2+ in addition to their specific substrates, findings that support the hypothesis that additional

Fe2+ transport systems may exist in Shigella species (Kehres et al., 2000; Grass et al.,

2005).

Efe system: Formally called YcdNOB, the EfeUOB system is encoded by three genes present on a tricistronic transcript in at least one strain of S. sonnei, according to the analysis of genomic sequences (Große et al., 2006; Cao et al., 2007; Payne and

Alexandra, 2010). efeU encodes the inner membrane permease and is homologous to the yeast Fe2+ transporter Ftr1p (Große et al., 2006). Proteins EfeO and EfeB are both periplasmic and are necessary for Fe2+ transportation; however, their specific functions remain unknown. Production of the Efe system is induced under acidic conditions independent of oxygen status, unlike the Feo system, whose production is induced at anaerobic conditions (Cao et al., 2007).

1.3.2 Regulation of iron uptakes systems

To ensure that each iron acquisition system is optimally produced under the specific environmental conditions in which its function will be most advantageous to the pathogen, the production of Shigella iron uptake systems is tightly regulated by multiple regulatory factors, and via distinct molecular mechanisms (Table 1). The major 30 regulatory mechanisms governing the production of Shigella iron acquisition systems are detailed below.

1.3.2.1 Regulation by extracytoplasmic function (ECF) sigma factors

The Shigella Fec system, utilized for the uptake of ferric-dicitrate, is positively regulated by the ECF sigma factor FecI (Lonetto et al., 1994; Braun and Mahren, 2005).

Specifically, upon binding of ferric-dicitrate to FecA, the TonB-dependent outer- membrane receptor undergoes a conformational change resulting in the interaction of its

N-terminal domain with the C-terminal domain of the trans-membrane anti-sigma factor

FecR. The interaction of FecA with FecR results in the release of the alternative sigma factor FecI that, in turn, directs RNA polymerases to the alternative promoter region of the fecABCDE operon (Braun and Mahren, 2005). Such regulation results directly in increased production of the Fec system when Shigella is within an environment containing ferric citrate.

1.3.2.2 Regulation by Fur

Availability of iron influences the expression of Shigella iron-acquisition systems via Fur, an iron-responsive transcriptional regulator (Fleming et al., 1983; de Lorenzo et al., 1987; Wyckoff et al., 1998; Payne et al., 2006). When present, intracellular iron can bind with Fur and induce a conformational change in the protein that, in turn, enables Fur to dimerize and bind DNA at a specific binding sequences often located within, or near, the promoter region of a regulated gene (Troxell and Hassan, 2013). Direct regulation by 31

Fur most often inhibits target gene transcription under iron-rich conditions by physically blocking binding of RNA polymerase to the promoter (Troxell and Hassan, 2013).

Indirect Fur-mediated regulation is also observed and often involves the activity of RyhB, a regulatory small RNA (sRNA) (see below) (Massé and Gottesman, 2002).

1.3.2.3 Regulation by RyhB

RyhB, a Fur-repressed regulatory sRNA first identified in E. coli, plays an important role in achieving iron homeostasis in several bacterial species, including

Shigella, by promoting degradation of specific target transcripts in response to iron availability within the environment (Massé and Gottesman, 2002). Specifically, under iron-poor conditions, RyhB is produced and functions to repress the production of several targets in both E. coli and Shigella including, but not limited to, iron-containing enzymes such as SodB and iron-storage proteins such as ferritin (Massé and Gottesman, 2002;

Murphy and Payne, 2007). Under iron-rich conditions, RyhB production is inhibited by the activity of Fur, thus relieving the RyhB-dependent repression of genes encoding iron- containing enzymes and iron-storage proteins. In E. coli, RyhB also regulates the production of aerobactin, however the detailed mechanism(s) as well as whether Shigella contains the same regulatory pathway remains to be revealed (Porcheron et al., 2014).

1.3.2.4 Oxygen-dependent regulation

Within a given environment, the amount of oxygen influences the relative abundance of Fe3+ and Fe2+; thus it is reasonable that bacterial iron uptake systems are 32 also regulated in response to environmental oxygen. The ArcAB two component system and the DNA-binding regulator Fnr are two regulatory systems with over-lapping, yet non-identical regulons that function to control the production of bacterial iron acquisition systems in response to oxygen status: (Carpenter and Payne, 2014).

ArcAB system: Within the ArcAB two-component system, ArcB is a membrane- anchored kinase that senses the environmental oxygen status, and ArcA is a DNA- binding response regulator that functions to alter the expression of specific target genes

(Carpenter and Payne, 2014). Under anaerobic conditions, auto-phosphorylation of ArcB activates its kinase activity, which in turn activates ArcA by phosphorylation. Under aerobic conditions, the activity of ArcB is inhibited, resulting in the lack of ArcA activation and thus altered expression of ArcA-regulated genes. As a global regulator,

ArcA not only regulates the expression of iron uptake genes, but also the iron-responsive regulator Fur (Boulette and Payne, 2007).

Fnr: As a DNA-binding protein, the regulatory mechanism of Fnr is similar to that of Fur. However, unlike Fur whose conformation is modulated by binding with iron, the conformational change of Fnr is determined directly by the oxidative status of its oxygen- responsive [4Fe-4S] cluster, and thus indirectly by the oxygen status of the environment

(Carpenter and Payne, 2014). With increased levels of intracellular oxygen, the [4Fe-4S] cluster within Fnr is oxidized into [2Fe-2S], a transition that results into the loss of DNA- binding, and thus the loss of the regulatory activity of Fnr.

1.3.2.5 Temperature-dependent regulation

A change in environmental temperature to that encountered within the human body (37°C) is an important signal that indicates a transition from the non-host environment encountered during transmission to that encountered within the human host during infection. As such, temperature influences the expression of many Shigella virulence-associated genes, including shuA (Tobe et al., 1991; Kouse et al., 2013). The production of ShuA, an outer-membrane heme receptor, is regulated in response to temperature at the post-transcriptional level via the activity of an RNA thermometer located in the 5' untranslated region of the gene (Kouse et al., 2013). At relatively low temperatures, an inhibitory structure is predicted to form within the shuA 5' untranslated region that functions to prevent translation initiation by occluding the ribosomal binding site. At 37˚C, the body temperature of human, the inhibitory structure is destabilized and shuA translation proceeds. While ShuA is currently the only Shigella iron acquisition factor known to be regulated by the activity of an RNA thermometer, the full impact of this temperature-dependent regulatory mechanism on iron utilization by these pathogens remains to be determined.

1.4 Regulation of bacterial virulence-associated genes via RNA thermometers

RNA thermometer (RNAT), as dictated before, is a cis-regulatory RNA element that functions to modulate the translational efficiency for the transcript in which they are housed in response to alterations in temperature (Kortmann and Narberhaus, 2012)

(Figure 3). Though it is well established that translational efficiency is affected by the 34 secondary structure of an RNA transcript, it was not until 1989, however, that the first cis-encoded temperature-responsive RNA regulatory element was identified (Gold, 1988;

Altuvia et al., 1989). Since that time, the rate at which temperature-responsive cis- encoded regulatory RNA elements have been identified, and the concurrent understanding of how they function to control target gene expression has grown exponentially; a statement that is particularly true of temperature-sensing RNA regulatory elements in bacteria.

Figure 3. Schematic of the molecular mechanism of RNA thermometers. In the figure, the hairpin structure indicates the inhibitory hairpin of an RNA thermometer, with the red line representing the region of Shine-Dalgarno (SD) sequence. At relatively low, or non-permissive, temperatures, formation of the inhibitory hairpin inhibits translation from the transcript by preventing binding of ribosome to the SD sequences. As the environmental temperature increases to the permissive range, the inhibitory structure dissociates, giving the ribosome access to the SD sequence and thus permitting translation. © 2016 Wei Y, Murphy ER. Published in (Wei and Murphy, 2016b) under CC BY 3.0 license. Available from: http://dx.doi.org/10.5772/61968

With the ever-increasing number of characterized RNATs, variability within this class of regulators is now coming to light. While the majority of RNATs are composed of sequences within the 5 untranslated region (5 UTR) of the regulated gene, some have now been shown to be composed, at least in part, of sequences within the coding region of the regulated transcript or by sequences within the coding region of a preceding gene within a polycistronic transcript (Krajewski et al., 2014; Morita et al., 1999). In addition, 35 the number of stem loops composing different RNAT range from one in the simplest

RNATs, to five in the most complex RNATs (Klinkert et al., 2012; Kouse et al., 2013).

Despite the variability among RNATs, they all share several fundamental features.

Identifying and understanding the functional contribution of features conserved among characterized RNATs, as well as those that vary among this class of regulators, has and will continue to inform the foundational knowledge of the biological functions and chemical nature of these ubiquitous regulators. In this section, a summary of families of

RNATs, and the virulence-associated processes controlled by RNATs is provided.

Information of this section has been published in (Wei and Murphy, 2016b) under CC

BY 3.0 license. Available from: http://dx.doi.org/10.5772/61968

1.4.1 Families of RNA thermometers

Though responsive to temperature, RNAT-mediated regulation is not an all-or- nothing regulation but rather the shifting of equilibrium towards an open or closed configuration depending on temperature (Kortmann and Narberhaus, 2012). Furthermore, mutagenesis-based experimentation has clearly demonstrated that it is the altered stability of the inhibitory structure rather than the primary sequence that plays the most critical role in the regulatory function of RNATs (Nocker et al., 2001b).

The thermal sensing activity of an RNAT is largely dependent on the physical features of its secondary structure, specifically by those features that impact the stability, or the Tm, of the inhibitory hairpin. In addition to the base-stacking interactions and the hydration shell of an RNA helix, other critical features of RNATs include 1) the number 36 and stability of hairpins that are formed within the element; 2) the presence of canonical and non-canonical base-pairing within the inhibitory structure; 3) the existence of internal loops, bulges, or mismatches within the formed structure(s); and 4) the extent of base- pairing between sequences composing the SD site and/or start codon with upstream sequences contained on the transcript. Each of these features can directly impact the stability of the inhibitory structure within a given RNAT, which in turn dictates the responsiveness of the element to temperature. Despite sharing a common basic regulatory mechanism, different RNATs display different secondary structures and other key features, differences that are now used to classify bacterial RNATs into families. The two currently recognized families of RNATs are ROSE-like RNATs (repression of heat shock gene expression) and FourU RNATs. RNATs composing each of these two main families, as well as a several unique RNATs, are discussed below.

1.4.1.1 ROSE-like RNA thermometers

ROSE-like elements were first identified as conserved cis-regulatory elements located in the regions between the promoters and translational start codons of genes encoding small heat shock proteins (sHsps) in Bradyrhizobium japonicum, and within a short time were reported in other Rhizobium species as well as in Agrobacterium tumefaciens (Balsiger et al., 2004; Münchbach et al., 1999; Nocker et al., 2001a;

Narberhaus et al., 1998). The heat shock response is a highly conserved process among microorganisms, and while their numbers vary between organisms, small heat shock proteins play a critical role in preventing protein denaturation and aggregation under heat 37 stress. Based on the conservation of the biological process as well as the conservation of the primary sequence and secondary structure of the 17 originally identified ROSE-like elements, bioinformatics-based techniques were used to predict ROSE-like elements in the 5 UTRs of sHsp encoding genes from 120 different archaea and bacteria

(Waldminghaus et al., 2005; Nocker et al., 2001a). As a result of these studies, 27 additional ROSE-like elements were identified in 18 different - and -proteobacteria species (Waldminghaus et al., 2005). Likely as a result of the approaches used to identify them, nearly all ROSE-like elements identified to date control the production of factors involved in the heat shock response. However, as additional ROSE-like RNATs are identified and characterized, it is expected that the contribution of these regulatory elements will be expanded beyond the heat shock response and into other physiological processes. This notion is supported by the recent identification of a ROSE-like RNAT in

Pseudomonas aeruginosa that controls the production of rhamnolipids, a virulence factor that functions to protect the pathogen against killing by the human immune system

(Grosso-Becerra et al., 2014). Only with additional studies will the potentially full, and potentially expansive role of ROSE-like thermometers in controlling the physiology and virulence of bacterial species be revealed.

The ROSE-like family is the most extensively studied family of RNATs, harbouring approximately 70% of all RNATs identified to date. All RNATs within the

ROSE-like family are housed with 5 UTR regions that range from 60 nucleotides to more than 100 nucleotides in length, and that form (or are predicted for form) 2 to 4 hairpins (Waldminghaus et al., 2005; Grosso-Becerra et al., 2014). In cases where more 38 than one hairpin is formed, the 5-proximal hairpin often acts to stabilize the secondary structure and/or facilitate the correct folding of the other hairpins, while the 3-proximal hairpin contains the SD region of the regulated transcript (Chowdhury et al., 2006). The defining features of ROSE-like RNATs that contribute to their temperature-responsive regulatory function include 1) the presence of a conserved anti-SD sequence 5-UYGCU-

3 (Y stands for a pyrimidine) in the 3-proximal hairpin and 2) a “bulged” guanine within the SD sequestering hairpin (Figure 4) (Waldminghaus et al., 2005). As a feature shared by all ROSE-like elements, it has been proposed that the “bulged” guanine within the SD sequestering hairpin is essential for the thermo-responsiveness of the regulatory element, a prediction that is supported by various mutagenesis-based experimental approaches and by NMR spectroscopy (Chowdhury et al., 2006; Krajewski et al., 2013; Waldminghaus et al., 2009). These studies have not only demonstrated that the “budged” guanine is essential for function but also have revealed that the “bulged” guanine forms hydrogen bonds with the second guanine within the SD sequence of 5-AGGA-3. Additionally, towards the 3 end of the SD site, two pyrimidines from the anti-SD strand form a triple- base pair with an uracil from the SD site via hydrogen bonds (Figure 4). The existence of two highly unstable pairs, the G-G pair and the triple-base pair, within the inhibitory hairpin of ROSE-like RNATs enables it to respond to the subtle changes of environmental temperature, and thus to function as a temperature-sensitive regulatory element (Chowdhury et al., 2006).

Figure 4. Structural features of the ROSE-like family of RNA thermometers. The demonstrated schematic is the hspA RNA thermometer of B. japonicum. Within the four hairpins of hspA RNA thermometer, only the conserved structural features in the 3 proximal hairpin are shown in detail, with the varied number of upstream hairpins indicated by the general hairpin structure in parentheses. The red line indicates the location of the SD sequence, while the conserved G-G pairing and triple-base pair are highlighted by the green boxes. © 2016 Wei Y, Murphy ER. Published in (Wei and Murphy, 2016b) under CC BY 3.0 license. Available from: http://dx.doi.org/10.5772/61968

1.4.1.2 FourU RNA thermometers

FourU RNATs, so named due to the presence of four consecutive uracil residues within the SD sequestering inhibitory hairpin, represent the second family of identified

RNATs. First identified in Salmonella enterica, a total of eight FourU RNATs have now been identified and characterized in a variety of bacterial species (Waldminghaus et al.,

2007; Klinkert et al., 2012; Kouse et al., 2013; Weber et al., 2014; Böhme et al., 2012;

Hoe and Goguen, 1993). Unlike ROSE-like RNATs, only two characterized FourU

RNATs function to control the production of heat shock-related factors (Waldminghaus 40 et al., 2007; Klinkert et al., 2012). Instead, the majority of characterized FourU RNATs

(toxT from Vibrio cholera, lcrF/virF from Yersinia species, as well as shuA from S. dysenteriae and chuA from some pathogenic E. coli) function to regulate the production of virulence factors in response to alterations in environmental temperature (Kouse et al.,

2013; Weber et al., 2014; Böhme et al., 2012).

The structural features of FourU RNATs are largely varied. For example, the length of the 5 UTRs in which FourU RNATs are housed ranges from as short as 40 nucleotides (htrA from E. coli and Salmonella) to more than 280 nucleotides (shuA from

Shigella dysenteriae) in length (Klinkert et al., 2012; Kouse et al., 2013). Additionally, the number of hairpins varies from a single hairpin with internal loops (toxT from Vibrio cholerae) to five hairpins, including an inhibitory hairpin with no internal loops (shuA from S. dysenteriae) (Weber et al., 2014; Kouse et al., 2013). Despite these differences, there are also several key features shared among RNATs within the FourU family. The first shared feature of all RNATs within the FourU family is the presence of four consecutive uridine residues that form canonical A-U and/or non-canonical G-U base- pairs with SD sequences on the regulated transcript (Figure 5). Additionally, for RNATs within the FourU family, the SD sequestering hairpin is generated by no less than 5 continuous base-pairs, and often displays conserved destabilizing features including the presence of relatively few G-C pairs, as well as internal mismatches or loops within the inhibitory structures. In the studies of each characterized FourU RNAT, mutagenesis analyses that introduce G-C base-pairs into the inhibitory structure result in the expected stabilization and, importantly, loss of thermal sensing activity by the regulatory element 41

(Kouse et al., 2013; Weber et al., 2014; Waldminghaus et al., 2007). NMR spectroscopy analysis has been utilized to study the dynamics of the inhibitory hairpin within the agsA

FourU RNAT (Rinnenthal et al., 2011). Specifically, a point mutation that introduces a

C-G base-pair at the previously mismatched position adjacent to the SD region increased the melting temperature of the hairpin by 11°C. Additionally, two Mg2+ binding sites were found in the agsA FourU thermometer hairpin and it was demonstrated that Mg2+ functions to stabilize the inhibitory structure (Rinnenthal et al., 2011). The degree to which these important features are conserved among members of the FourU RNAT family will be revealed only after additional members are identified and experimentally characterized. Such experimentation will not only define the FourU RNAT family of regulators but will also advance our ability to identify new FourU RNATs.

Figure 5. Structural features of the FourU family of RNA thermometers. The demonstrated schematic is the shuA RNA thermometer from S. dysenteriae. Only the conserved portion of the inhibitory hairpin of shuA RNA thermometer is shown in this figure. The red line indicates the location of the SD sequences, while a green box indicates the location of the conserved four consecutive uracil residues. © 2016 Wei Y, Murphy ER. Published in (Wei and Murphy, 2016b) under CC BY 3.0 license. Available from: http://dx.doi.org/10.5772/61968

1.4.1.3 Additional types of RNA thermometers

It is important to note that not all characterized RNATs fit neatly into one of the two main families: ROSE-like and FourU. While all RNATs are thought to share a basic zipper-like thermosensing mechanism, several identified RNATs differ from those composing the main families in critical features, including primary sequence and/or secondary structure, features that impact the regulatory activity of these elements. It is the identification and characterization of the details of the molecular mechanisms underlying each of these additional types of RNATs that will expand our understanding of foundational principles governing RNA-mediated thermal sensing.

Although lacking the presence of four consecutive uracil residues, two RNATs are similar to FourU RNATs in that they display more than 5 continuous base-pairs within the SD region of their inhibitory hairpins: one RNAT controls the expression of an sHsp (Hsp17) from Synechocystis sp. PCC 6803, while the other controls the production of Salmonella GroES, a component of protein chaperon machinery (Cimdins et al., 2013;

Kortmann et al., 2011). RNAT-mediated regulation of hsp17 is important for the survival of Synechocystis under heat stress, because Hsp17 not only prevents denatured proteins from aggregation but also protects the integrity of cellular membranes (Lee et al., 1998;

Török et al., 2001). The 5 UTR of hsp17 has a single hairpin with an internal asymmetric loop (Kortmann et al., 2011). In the SD sequence-binding region, instead of four uracils as seen in the FourU thermometer, the hsp17 RNAT has a sequence of 5-UCCU-3 that forms four canonical pairs with the SD sequence, including two G-C pairs. The remaining base-pairs in the inhibitory hairpin are mainly A-U pairs with two non- 43 canonical G-U pairs. As the most stable base-pairs within the hsp17 RNAT, these two G-

C base-pairs contribute to the stability and thus the inhibitory function of the hairpin.

Other features such as the asymmetric internal loop and low ratio of G-C base-pairs destabilize the inhibitory structure, features that together enable the hairpin to dissociate with the increase of temperature. For the inhibitory hairpin of the groES RNAT, it has a mismatch of an adenine and a guanine that destabilizes this structure. While the secondary structure and temperature-responsive regulatory function of the groES RNAT has only been experimentally characterized in Salmonella and E. coli, this RNAT and its regulated factor, a necessary chaperon for proper folding of cellular components, are well conserved in enterobacteria (Cimdins et al., 2013).

In some RNATs, base-pairing involving the SD sequence is not complete but instead is disrupted by mismatches or “bulged” nucleotides, a feature also noted for

ROSE-like elements. For example, the inhibitory structure within the RNATs that control the production of two putative lipoproteins LigA and LigB in Leptospira interrogans have identical nucleic acid sequences that include a mismatch of an adenine and a guanine within the SD sequestering hairpin (Matsunaga et al., 2013). Genes hspX and hspY that encode sHsps in Pseudomonas putida are also regulated by RNATs that contain one or two A·G mismatches disrupting the otherwise continued base-pairing of the SD region (Krajewski et al., 2014). For these RNATs, further investigation is needed to the direct impact of the apparently conserved feature of mismatched or bulged sequences within the inhibitory structure on the regulatory activity of these elements. 44

For some RNATs, the function and stability of the inhibitory hairpin are impacted by base-pairing with sequences other than those within the SD region. For example, in the 5 UTR of prfA, a transcriptional factor controlling virulence genes in Listeria monocytogenes, a major portion of the SD region and the start codon are confined within internal loops and thus are partially single-stranded (Johansson et al., 2002). It has been demonstrated, however, that the hairpin within the prfA 5 UTR containing the SD region and start codon does function as an RNA thermometer, an activity that is dependent on base-pairs that are located upstream of the SD site, which function to stabilize the unusually long hairpin. Another example of sequences other than those within the SD region that directly impact the regulatory function of an RNAT is the repeated nucleotide sequence of 5-UAUACUUA-3 in the RNAT of cssA, a gene involved in capsule production from Neisseria meningitidis (Loh et al., 2013). These 8-nucleotide sequences are located upstream of the SD region and enable the RNAT to sense mild changes of environmental temperature, which is important for the survival of N. meningitides. As an opportunistic pathogen that colonizes only humans, it is important that N. meningitidis can sense and respond to a mild increase of temperature, as would be encountered during a fever response.

A unique example among currently identified RNATs is the one that controls the production of heat-shock response alternative sigma factor RpoH (σ32) in E. coli (Morita et al., 1999). Binding of the ribosome to the SD region within the ropH transcript is facilitated by a sequence (named downstream box) located between the SD site and the start codon (Nagai et al., 1991). The rpoH RNAT inhibits translation via embedding this 45 downstream box in the junction region of three stem loops instead of forming base-pairs within a single inhibitory hairpin as is the usual conformation in RNATs (Morita et al.,

1999). As the environmental temperature increases, two stems that paired with the downstream box melt at the junction position exposing the downstream box as a single strand, a conformation that facilitates ribosome binding to the transcript.

Lastly, there are currently three characterized RNATs that are located within intergenic regions of a polycistronic transcripts: ibpB, encoding a small heat shock protein in E. coli, lcrF, encoding a master transcriptional activator of virulence genes in

Yersinia species, and hspY, encoding a putative small heat shock protein in P. putida

(Böhme et al., 2012; Krajewski et al., 2014; Gaubig et al., 2011). Their location within polycistronic transcripts differentiates these three RNATs from all others found in the 5

UTR of monocistronic or polycistronic transcripts.

Although they display key features that differ from those possessed by RNATs in the ROSE-like or FourU families, many of the unique RNATs highlighted above are conserved between several bacterial species. There is little doubt that, as additional bacterial RNATs are identified and characterized, commonalities will emerge and additional families will be recognized.

1.4.2 Bacteria virulence-associated genes regulated by RNA thermometer

Once within the body of the host, and throughout the course of a natural infection, pathogenic bacteria face several challenges, including but not limited to 1) the need to adhere to host cells, 2) the need to evade killing by the host immune system, and 3) the 46 need to acquire essential nutrients. To overcome these challenges and progress of an infection, bacteria produce specific virulence factors. As the production of virulence factors is most beneficial to an invading bacterium when it is within the host, several levels of regulation are often employed to ensure that the production of these important factors occurs only when the bacteria is within an environment that resembles that encountered within the infected host. RNATs are involved in regulating the production of a variety of virulence factors in several species of pathogenic bacteria (Figure 6), ensuring that these factors are most efficiently produced at the relatively high temperatures encountered within the infected host.

Figure 6. Key virulence-associated processes controlled by RNA thermometers in bacteria. The influence of RNA thermometers on the bacterial virulence is indicated by highlighting the different groups of genes whose expression is directly regulated by an RNA thermometer. © 2016 Wei Y, Murphy ER. Published in (Wei and Murphy, 2016b) under CC BY 3.0 license. Available from: http://dx.doi.org/10.5772/61968

The expression of many virulence-associated genes is controlled by protein-based regulation, specifically that carried out by transcriptional regulators. Interestingly,

RNATs have been found to directly control the production of three transcriptional activators that, in turn, function to control the expression of virulence-associated genes: 47 prfA from L. monocytogenes, lcrF from Y. pestis, and toxT from V. cholera (Johansson et al., 2002; Böhme et al., 2012; Weber et al., 2014). Another regulatory system that controls the expression of multiple virulence factors is quorum sensing. To date, one gene whose product is involved in quorum sensing-dependent modulation of virulence gene expression has been found to be regulated by an RNAT; this gene is lasI from P. aeruginosa (Grosso-Becerra et al., 2014). RNATs within lcrF and toxT are FourU

RNATs, while the RNATs controlling the expression of prfA and lasI have a currently unique structure.

RNATs have also been implicated in controlling the expression of virulence- associated genes that encode factors involved in adhesion and immune evasion. For example, three virulence-associated genes in N. meningitis have been found to be regulated by RNATs: cssA, a gene encoding a factor involved in capsule production; fHbp, a gene encoding a factor H binding protein; and lst, a gene encoding a factor required for modifications of lipopolysacccharides (Loh et al., 2013). In L. interrogans, ligA and ligB, two genes encoding putative lipoprotein, are also regulated by RNATs

(Matsunaga et al., 2013). Additionally P. aeruginosa rhlA, a gene encoding an enzyme required for the synthesis of rhamnolipid, a compound that can prevent killing of the bacteria by host immune system, is regulated by an RNAT (Grosso-Becerra et al., 2014).

Except for rhlA RNAT, which is a member of the RSOE-like family, these other RNATs have unique structures and thus are not members of the ROSE-like or FourU families of regulators. 48

To date, two genes involved in the acquisition of essential nutrients have been shown to be regulated by RNATs: S. dysenteriae shuA, a gene encoding an outer membrane heme-binding protein, and its homologous gene chuA in pathogenic E. coli

(Kouse et al., 2013). Translation of shuA/chuA is controlled by a FourU RNAT located in the relative long 5 UTR of the corresponding gene. Production of ShuA or ChuA facilitates the utilization of iron from heme, a potential source of essential iron found only within the relatively warm environment of the infected host (Wyckoff et al., 1998).

For many pathogenic bacteria, the transmission from one host to the next involves exposure to environments with different temperatures. The expression of many virulence- associated genes is influenced by environmental temperature, a signal that varies between the host and non-host environments. With an increasing number of virulence-associated genes that are now known to be regulated by the activity of RNATs, it is possible that temperature-dependent regulation mediated by RNATs will emerge as one of the basic regulatory strategies utilized by pathogenic bacteria. The full and potentially expansive role that RNATs play in controlling virulence of pathogenic bacteria is yet to be revealed. 49

CHAPTER 2: IRON-DEPENDENT REGULATION OF SHUT

2.1 Abstract

To survive within human body, pathogenic bacteria must acquire iron from each of the unique environments encountered throughout the infection cycle. Using the

Shigella heme utilization (Shu) system, S. dysenteriae is able to acquire iron from heme, a potentially rich source of nutritional iron within the otherwise iron-limited environment of the human host. To balance between the necessity and toxicity of iron, production of the Shu system is tightly regulated in response to specific environmental conditions, including iron availability. In this chapter, experimental techniques, such as RNA sequencing and Rapid Amplification of cDNA 5'-ends analyses, were applied to localize the transcriptional start site and promoter region of S. dysenteriae shuT, a gene encoding a periplasmic heme binding protein, was localized, and the molecular mechanisms underlying iron-dependent transcriptional regulation of this gene was characterized.

2.2 Introduction

2.2.1 Heme uptake system and bacterial pathogenesis

In the human body, as an innate host immune defense against infection, the level of bio-available iron is maintained at exceedingly low concentrations by sequestration of the element within host compounds, such as heme. Binding approximately 95% of all iron within the human body, heme represents the most abundant potential source of nutritional iron for an invading pathogen (Otto et al., 1992). The utilization of heme- bound iron is one mechanism used by some pathogenic bacteria to overcome the extreme 50 iron limitation encountered within the host. Examples of heme utilization systems in pathogenic bacteria include, but are not limited to, the Has system in Serritia marcescens, the Bhu system in Bordetella species, the Hut system in Bartonella quintana, and multiple heme-acquisition systems in Haemophilus influenzae (Vanderpool and

Armstrong, 2001; Ghigo et al., 1997; Parrow et al., 2009; Whitby et al., 2009; Murphy et al., 2002). Importantly, the ability of a bacterial pathogen to utilize heme as a source of nutritional iron is often positively associated with virulence (Otto et al., 1992).

In the bacteria genus Shigella, only one heme utilization system has been identified, the Shigella heme uptake (Shu) system. The Shu system was first identified in

S. dysenteriae, yet it is predicted to be present in some strains of S. sonnei (Wyckoff et al., 1998; Mills and Payne, 1995). Inactivation of shuA, a gene encoding the outer- membrane heme receptor, eliminates the ability of S. dysenteriae to utilize heme as a sole source of nutritional iron, suggesting that the Shu system is the only functional heme- utilization system in this species (Mills and Payne, 1997). Direct measurement of the contribution of the Shu system to S. dysenteriae pathogenesis is difficult given the limitations of in vitro tissue-culture based analyses. However, several studies indicate a positive association of the Shu system, or orthologous systems, with bacterial virulence.

The connections between the Shu system and virulence include the fact that only pathogenic bacterial strains encode the shu or orthologous genes, such as chu genes in pathogenic Escherichia coli and hmu genes in Yersinia species (Mills and Payne, 1995;

Wyckoff et al., 1998). Additionally, inactivation of chuA, the shuA ortholog in uropathogenic E coli, diminishes the ability of the strain to colonize mice as compared to 51 that of the wild-type strain (Torres et al., 2001). Together these data support the conclusion that the ability to utilize heme as a source of nutritional iron facilitates bacterial virulence including, most likely, that of Shigella species.

2.2.2 Shigella heme uptake (Shu) system

Components of the Shu system are encoded within the shu locus, a 9.1kb genomic sequence predicted to contain eight coding genes. Homologous genomic sequences of the shu locus were also identified in Yersinia pestis, Y. enterocolitica, Vibrio cholera, and several pathogenic E. coli strains, in which the corresponding DNA region is termed the chu locus (Mills and Payne, 1995; Wyckoff et al., 1998). The S. dysenteriae shu locus is predicted to contain four promoters, transcription from which would generate two monocistronic transcripts (shuA and shuS), and two polycistronic transcripts (shuTWXY and shuUV) (Wyckoff et al., 1998) (Figure 7). However, according to previous results obtained in the Murphy lab, specifically those from RT-PCR analyses targeting the intergenic regions between each shu gene, two large polycistronic transcripts are generated from within the shu locus (shuAS, and shuTWXYUV) were identified in the shu locus (Kouse, 2014) (Figure 7). Though these data cannot exclude the possibility that gene shuU and shuS have their own promoters, the importance of shuA and shuT promoter regions are increased, as the activation of these two promoters could lead to the production of the two large transcripts encoding components composing the complete

Shu system.

Figure 7. Schematic of the S. dysenteriae shu locus. Schematic of the S. dysenteriae shu locus adapted from Wyckoff E. with some modifications according to the latest research results (Wyckoff et al., 1998). Each arrow box indicates an open reading frame, with the name of the gene on top of the arrow box. Arrow lines indicate the putative promoters. Two thick lines indicate the promoters of shuT and shuA, from which transcripts of the complete shu locus could be produced. Two thin arrows starting from shuS and shuU indicate the previously predicted promoters.

2.2.3 Transportation of heme via the Shu system

It is thought that the utilization of heme-bound iron is initiated when heme is bound by the outer-membrane receptor ShuA (Figure 8). As the first identified protein in the Shu system, ShuA is 73 kDa in size and shows structural homology to the well- characterized outer membrane heme binding protein HasR (Mills and Payne, 1997;

Burkhard and Wilks, 2007). Binding of ShuA and free heme seems to be non-specific and physiologically irrelevant, given that free heme is unstable in aqueous solution and also toxic to the host (Burkhard and Wilks, 2007). Instead of free heme, ShuA shows a high binding affinity to oxidized hemoglobin, which is likely to be the physiological substrate for ShuA (Burkhard and Wilks, 2007). The energy needed for transportation of ShuA bound heme across the S. dysenteriae outer membrane is provided by the inner membrane complex TonB/ExbB/ExbD (Burkhard and Wilks, 2007).

Figure 8. Schematic of the Shu system. The schematic of the Shu system includes an outer membrane heme binding receptor (ShuA), a periplasmic heme binding protein (ShuT), a ABC permease complex (ShuUV), and a cytoplasmic heme binding protein (ShuS). Transportation directions are indicated by straight arrows. In addition, the TonB/ExbB/ExbD complex, which provides energy for transportation crossing the outer membrane is also shown.

Once translocated across the outer membrane, the periplasmic heme binding protein ShuT is involved in further heme transportation (Figure 8). Mature ShuT protein has been detected in periplasmic cellular fractions and has been demonstrated to have a molecular mass of 28.3 kDa (Eakanunkul et al., 2005). Based on the amino acid sequences and structural features, ShuT has low homology to previously characterized periplasmic binding proteins (PBPs), and has now been grouped as type III PBPs. Other members in the type III PBPs including the heme binding protein PhuT from

Pseudomonas aeruginosa, the vitamin B12-binding protein BtuF from Treponema pallidum, as well as the enterobactin-binding protein FepB and iron-hydroxamate binding 54 protein FhuD both from Escherichia coli (Eakanunkul et al., 2005; Ho et al., 2007;

Stephens et al., 1995; Clarke et al., 2002). Experimental results suggest that one ShuT monomer binds to one heme molecule with very high binding affinity, although the actual

Kd value is hard to measure due to the instability of heme in aqueous solution

(Eakanunkul et al., 2005). It is thought that the relatively higher heme binding-affinity of

ShuT as compared to that of ShuA is part of the driving force of heme transportation. In some cross membrane transportation systems, such as FhuA, the outer membrane receptor has an extremely high binding affinity to its substrate (Locher and Rosenbusch,

1997; Rohrbach et al., 1995); however, in general, the outer membrane receptor has a lesser substrate affinity as compared to that of the PBPs. Such differential affinities promote the transportation of substrate across the outer membrane. Besides promoting transportation, the other function of ShuT is in complexing to the ABC permease and triggering the transportation of heme across the cytoplasmic membrane of S. dysenteriae.

The S. dysenteriae heme ABC permease complex (ShuUV) contains two domains: a nucleotide-binding domain (ShuV) and a transmembrane domain (ShuU)

(Figure 8). After binding of ShuU with the heme-ShuT complex in the bacterial periplasm, binding and hydrolysis of cytoplasmic ATP by ShuV induces conformational changes within the ABC permease that promote the translocation of heme across the cytoplasmic membrane (Burkhard and Wilks, 2008). Besides ShuT, the cytoplasmic heme binding protein, ShuS, is also suggested to be involved in the translocation of heme across the inner membrane. Direct protein-protein interactions between ShuUV and ShuS have been confirmed by site-specific mutation studies (Burkhard and Wilks, 2008). 55

Moreover, the presence of ShuS is required for the release of heme by the ABC permease

(Burkhard and Wilks, 2008). Together these findings suggest that the process of translocation heme across S. dysenteriae inner membrane is coupled by multiple protein components of the Shu system.

In addition to facilitating heme transportation, ShuS is regarded as an important regulator for iron hemostasis (Wyckoff et al., 2005). Although ChuS, the ShuS homolog in E. coli, has been characterized to have heme degrading properties, such an ability is appears to be absent in ShuS (Ouellet et al., 2016; Wyckoff et al., 2005). Instead, one study suggests that ShuS binds with DNA in a sequence non-specific manner, and is supposed to protect DNA against the oxidative damage results from excess heme or iron

(Wilks, 2001; Kaur and Wilks, 2007). Once within the cytoplasmic space, the fate of heme-bound iron remains unclear. One model suggest that in order to extract iron from heme, ShuS transports heme to an uncharacterized heme-degrading protein; alternatively, excess heme may been stored in a heme-storage protein other than ShuS (Wyckoff et al.,

2005) (Figure 8).

The function of the proteins encoded by the remaining three open reading frames

(shuW, shuX, and shuY) within the shu locus remains unknown (Figure 7). ShuW has weak homology with HemN of E. coli, an enzyme involved in the biosynthesis of heme; however, a stop codon within the ShuW coding region renders it as a pseudogene

(Wyckoff et al., 1998). ChuX, the ShuX homologous in E. coli, has been identified to be a cytoplasmic heme binding protein that helps in maintaining iron homeostasis (Suits et 56 al., 2009). However, whether ShuX shares a function with its homolog remains to be verified.

2.2.4 Fur-mediated iron-dependent regulation of the Shu system.

While iron is essential, the element is toxic when in excess (Everse and Hsia,

1997). As a means to maintain the critical balance between the necessity and toxicity of iron, the production of bacterial iron uptake systems is tightly regulated. As a direct indication of the requirement of uptake nutritional iron, the availability of intracellular iron regulates production of multiple bacterial iron utilization systems. Such regulatory mechanism is utilized by a wide variety of pathogenic bacteria, as well as Shigella, is that of transcriptional modulation by the Ferric uptake regulator (Fur) (Bagg and Neilands,

1987). Specifically, intracellular bio-available iron interacts with Fur and induces a conformational change in the protein that enables it to bind with DNA in a sequence specific manner (Troxell and Hassan, 2013) (Figure 9). Typically, the Fur binding site overlaps with the promoter region of the target gene; thus binding of Fur to the DNA occludes RNA polymerase from its recognition site, and as a consequence inhibits target gene transcription.

Figure 9. Schematic of Fur-mediated iron-dependent repression. The blue box in each side represents the target gene. Transcription is indicated by the arrow. When the bacterium is under iron rich conditions, intracellular bio-available iron interacts with Fur induces a conformational change of the protein, which enables it to bind its binding site and block transcription. Under iron poor conditions, apo-Fur can’t bind with DNA, thus permit binding of ribosome to the promoter region to initiate transcription.

With the identification of the shu locus structure, putative Fur-binding sites were identified in close proximity to each predicted shu promoter (Figure 7), suggesting that the production of the S. dysenteriae Shu system is regulated in response to iron availability by the activity of Fur (Wyckoff et al., 1998). Indeed, the Fur-mediated iron- dependent regulation of shuA has been experimentally demonstrated (Mills and Payne,

1997). However, whether production of the other polycistronic transcript (shuTWXYUV) from the shu locus is also regulated in response to iron availability by the activity of Fur remained to be experimentally verified. In this chapter, iron-dependent regulation of shuT transcription has been verified and the regulatory molecular mechanism underlying this regulation been characterized.

2.3 Methods and materials

2.3.1 Strains and culture conditions

All bacterial strains and plasmids used in this research are shown in Table 2.

Escherichia coli was cultured in Luria-Bertani (LB) broth (1% tryptone, 0.5% yeast extract, and 1% NaCl) or on LB agar plates (LB with 1.6% (wt vol-1)) at 37˚C. S. dysenteriae was cultured in LB broth or on Tryptic soy broth agar plates (Becton,

Dickenson and Company, Sparks, MD) containing 0.01% (wt vol-1) Congo red dye (ISC

BioExpress, Kaysville, UT) at the indicated temperatures. “Iron-rich” media (+Fe) refers to the LB broth, while “iron-poor” media (-Fe) refers to LB broth containing 150µM 2,2'- bipyridine (Alfa Aesar, A Johnson Matthey Company) as an iron chelating reagent.

Chloramphenicol and Ampicillin were used at a final concentration of 30 (µg ml-1) and

150 (µg ml-1), respectively, for the growth of bacterial strains carrying plasmids.

Table 2

Summary of bacterial strains and plasmid vectors Destination Description Reference/ source Strains Escherichia coli DH5α Life Technologies Shigella dysenteriae O-4576S1 (Murphy and (aka ND100) Wild-type S. dysenteriae. Payne, 2007) (Murphy and Δfur fur deletion in O-4576S1 Payne, 2007) Plasmids Cloning vector that has a lacZ gene, whose (Castellanos et al., pHJW20 promoter region can be cut out by the restriction 2009) enzymes SalI and XbaI. Cmr 59

Table 2: continued Reporter plasmid that has the shuT putative pT-lacZ promoter region inserted right before the reporter This study gene lacZ of plasmid pHJW20. Cmr pHJW20 carrying a Promoter-less lacZ gene, (Castellanos et al., pMic-21 working as the negative control of β- 2009) galactosidase assay. Cmr Low-copy plasmid containing a PLtetO-1 (Urban and Vogel, pXG10 constitutive promoter and a report gene gfp, 2007) which lacks the start codon. Cmr Reporter plasmid that has the shuT promoter, 5' pT-UTR UTR, and start codon inserted right before the This study reporter gene gfp of plasmid pXG10. Cmr Reporter plasmid that has the shuT full 5' UTR pF-UTR and start codon inserted right before the reporter This study gene gfp of plasmid pXG10. Cmr Reporter plasmid that has the truncated shuT 5' pS-UTR UTR and start codon inserted right before the This study reporter gene gfp of plasmid pXG10. Cmr Plasmid that have the PLtetO-1 constitutive promoter immediately in front of the coding pXG-1 region of gfp. Used in electrophoresis mobility This study shift assay to produce DNA fragment working as negative control. Cmr Purchased plasmid vector that has thymine pGEM-T PROMEGA, overhang at the 3' end of each strand and can be easy vector Madison, MI used to ligate with PCR products directly. Ampr Purchased plasmid vector containing a gene encoding glutathione S-transferase (GST), whose pGEX-2T expression is controlled by promoter Ptac. In GE Healthcare frame cloning sites exist after GST coding region. Ampr Plasmid that has the coding region of Shigella Fur cloned in frame after the coding region of GST. pGEX-fur This study Used to produce the GST-Fur fusion protein, which is induced by IPTG. Ampr Cmr: the plasmid contains Chloramphenicol resistant gene. Ampr: the plasmid contains Ampicillin resistant gene.

2.3.2 Oligonucleotide primers

All oligonucleotide primers were designed based on the chromosomal sequences of S. dysenteriae and synthesized by Integrated DNA Technologies. Primer sequences used in this research are summarized in Table 3.

Table 3

Summary of oligonucleotide primers Primer Sequence Function shuT-R CAGTTTGGCGGTTTCTG Reverse shuT-F1 CAAGGATCATCACTAGGC transcriptase PCR identifying the shuT-F2 TTCTCAATTTGATAAGAGTTCTC region of shuT-F3 TTGAATCGACGGTTGTATTTC transcription start shuT-F4 ATATCTCTGGGTTCTCAGC site shuT outer TTTGGCGGTTTCTGGTGGATAAGATGTC 5'-RACE outer Localizing the GCTGATGGCGATGAATGAACACTG primer transcription start GTCAGCGATCCTCCTGCGACCACGATAC site by Rapid shuT inner G amplification of 5'-RACE inner CGCGGATCCGAACACTGCGTTTGCTGGCT cDNA 5' end primer TTGATG CTAGAATTTGAGTTATATATGAAATACAA Constructing shuT-1-3 CCGTCGATTCAATACGCAAGGCGTTACA plasmid pT-lacZ AGCGTATTTAG for β- TCGACTAAATACGCTTGTAACGCCTTGCG galactosidase shuT-1-5 TATTGAATCGACGGTTGTATTTCATATAT assay AACTCAAATT shuT-for- GTGACGTCTGCGTATTGAATCGACGG XG10-60 Constructing shuT-rev- plasmid pT-UTR GTGCTAGCCATAATATGAGAACTCTTATC XG10-2 TGATAATCATGATCATTCTCAATTTGATA shuT-5UTR-F AGAGTTCTCATATTATGG Constructing CTAGCCATAATATGAGAACTCTTATCAAA plasmid pF-UTR shuT-5UTR-R TTGAGAATGATCATGATTATCATGCA TTCATGATCATTCTCAATTTGATAAGAGT Constructing T-RNAt F TCTCATATTATGG plasmid pS-UTR

Table 3: continued CTAGCCATAATATGAGAACTCTTATCAAA Constructing T-RNAt R TTGAGAATGATCATGAATGCA plasmid pS-UTR Fur-gst tag-for CCGGAATTCTTATTTGCCTTCGTGCG Constructing CGCGGATCCATGACTGATAACAATACCG plasmid pGEX- Fur-gst tag-rev CC fur Primers used for pXG10-for CTCTTACGTGCCGATCAACG colony screening and generating DNA fragments pXG10-rev2 AGGTAGTTTTCCAGTAGTGC for gel mobility shift assay Primers target S. rrsAforRT AACGTCAATGAGCAAAGGTATTAAC dysenteriea house-keeping rrsArevRT TACGGGAGGCAGCAGTGG gene in qRT-PCR assay GfpforRT CCGTTCAACTAGCAGACCATTATC Primers target report gene gfp in GfprevRT CTCATCCATGCCATGTGTAATCC qRT-PCR assay

2.3.3 Reporter plasmid construction

pT-lacZ: Complementary oligonucleotides containing the nucleic acid sequences of the putative shuT promoter region (Table 3) were hydrated in STE buffer (0.1M NaCl,

10mM Tris-HCl, 1mM EDTA, pH 8.0). The putative shuT promoter region was reconstructed by combining the complementarity oligonucleotides, boiling the molecules in a water-bath for 10 minutes and allowing them to cool slowly to room temperature.

The annealed double-stranded DNA molecule was then ligated into plasmid pHJW20

(Castellanos et al., 2009) digested with restriction enzymes SalI (New England Biolabs inc.) and XbaI (New England Biolabs Inc.). Such cloning placed the DNA fragment containing the putative shuT promoter region immediately upstream of the report lacZ gene of pHJW20. 62

pT-UTR: Primers were designed to amplify the region containing the promoter and full 5'-UTR of shuT (Table 3) by PCR using genomic DNA of wild type S. dysenteriae as template. The amplified fragment was purified by gel extraction and digested with restriction enzymes AatII (New England Biolabs Inc.) and NheI (New

England Biolabs Inc.). The digested fragment was then purified and ligated into plasmid pXG10 (Urban and Vogel, 2007) that had been digested with AatII (New England

Biolabs Inc.) and NheI (New England Biolabs Inc.) to generate plasmid pT-UTR. Such cloning removed the PLtetO-1 constitutive promoter of pXG-10 and placed the putative promoter and full 5' UTR of shuT immediately upstream of the reporter gfp gene.

pF-UTR and pS-UTR: Complementary oligonucleotide primers containing the indicated nucleic acid sequences (Table 3) were combined and annealed in STE buffer

(0.1M NaCl, 10mM Tris-HCl, 1mM EDTA, pH 8.0) by boiling in a water-bath for 10 minutes followed by slow cooling to room temperature. The generated double-stranded

DNA products were then ligated into plasmid pXG10 (Urban and Vogel, 2007) that had been digested with restriction enzymes NsiI (New England Biolabs Inc.) and NheI (New

England Biolabs Inc.). Such cloning placed the DNA fragment encoding the putative

RNA thermometer being investigated between the PLtetO-1 constitutive promoter and the reporter gfp gene of pXG-10.

2.3.4 RNA extraction and DNA removal

Total RNA was harvested from wild-type S. dysenteriae cultured to the mid- logarithmic phase under the indicated growth condition. Following growth to mid- 63 logarithmic phase, RNA preserving buffer (95% ethanol and 5% phenol, pH 4.5) was added to each culture at a culture:buffer ratio of 4:1, and the incubated at 4˚C overnight.

Following overnight incubation, cells present in 3ml of bacterial culture were pelleted by centrifugation at 17,000g for 2 minutes. After discarding the supernatant, bacterial cells

-1 were re-suspended in 357.3µl DEPC treated ddH2O, 40µl 10% (wt vol ) sodium dodecyl sulfate (SDS), and 2.67µl 3M sodium acetate (pH 5.2) by vortexing for 15 seconds. Lysis of the bacterial cells was achieved by incubating each resuspended sample at 90˚C for 7 minutes. After lysis, 1ml of Trizol reagent (Ambion) was added to each sample, the sample transferred to a 2ml phase-lock gel tube (5 PRIME Inc., Gaitherburg, MD) and the reaction incubated at room temperature (~25˚C) for 5 minutes. Trizol reagent was extracted from each sample by the addition of 250µl chloroform followed by vigorous shaking for 30 seconds to 1 minute and then incubation at room temperature for 2 minutes. Each sample was then subjected to centrifugation for 2 minutes at 17,000g and the nucleic acid containing aqueous phase transferred to a clean 2ml microfuge tube. 1ml of 100% ethanol was added to each sample and the samples incubated overnight at -80˚C.

Following overnight incubation at -80˚C, nucleic acid present in each sample was pelleted by centrifugation at 17,000g for 15 minutes at 4˚C. Each pellet was washed by the addition of 1 ml cold 70% ethanol followed by centrifugation as described above. The supernatant was then removed and each pellet dried by centrifugation in a vacufuge

(Eppendorf) for approximately 2 minutes in Alcohol Mode. Finally, each RNA pellet was resuspended in 53μl of nuclease free water. 64

Following DNA removal from each RNA sample using TURBO DNA-free kit

(Ambion) as directed, the absence of contaminating DNA was confirmed by PCR analysis; using the RNA sample as template, the lack of amplification by a known primer set indicates the absence of DNA in the RNA sample. Finally, the concentration of the total RNA present in each sample was measured using a ND-1000 spectrophotometer

(NanoDrop Technologies, Wilmington, DE).

2.3.5 Reverse transcriptase PCR

After harvesting total RNA from wild-type S. dysenteriae cultured under the indicated conditions via the procedure dictated above, a cDNA library was generated by using the iScript cDNA Synthesis Kit (Bio-Rad) as directed. PCR amplification was conducted to identify the approximate shuT transcriptional start site by using the generated cDNA library as template. Sequences of the four forward primers (shuT-F1, shuT-F2, shuT-F3, and shuT-F4) and one conserved reverse downstream primer (shuT-R) are detailed in Table 3. Validation of each primer set was achieved by using each in a

PCR reaction containing genomic DNA of wild-type S. dysenteriae as template. Total

RNA was used as PCR template with each primer set to confirm the absence of contaminating DNA; and double distilled sterilized water was used as PCR template to confirm the absence of DNA contamination in reagents used for the PCR reaction. PCR products were detected by gel electrophoresis and UV light detection.

2.3.6 Rapid amplification of cDNA 5' end analysis

Following isolation of total RNA from S. dysenteriae cultured to the mid-log phase under iron-poor conditions at 37˚C and DNA removal (as detailed above), ribosomal RNA was depleted from each sample using the RiboMinus Transcriptome

Isolation Kit for bacteria (Ambion) as directed, and the RNA sample concentrated by ethanol precipitation. Rapid amplification of cDNA 5' end (5'-RACE) analysis was completed using the FirstChoice RLM-RACE Kit (Ambion) with the following modifications. Firstly, approximately 250ng of mRNAs was treated with the Tobacco

Acid Pyrophosphatase provided by the FirstChoice RLM-RACE Kit prior to adaptor ligation. Secondly, a shuT specific primer and SuperScript III Reverse Transcriptase

(Invitrogen) were used to generate shuT specific cDNA separately from adaptor-ligated

RNA (experiment group) and RNA without adaptors (control group), which were then used as the templates for PCR amplification. The first round of PCR amplification was performed using the outer primer pair that binds within shuT and to the 5' region of the adaptor sequence (Table 3). Amplified products that were present in the experiment group and absent in the control group were gel purified and used as the templates for a second round of PCR. The second PCR round was completed to increase the specific amplification of shuT using the inner primer pair: an upstream primer that binds to shuT at a location upstream to that bound by the primer used in the first amplification and a downstream primer that binds to the 3' region of the adaptor sequence (Table 3). Lastly, the amplified products of the second round of PCR were purified by gel extraction and 66 ligated directly into the plasmid pGEM-T easy (PROMEGA, Madison, MI) for nucleic acid sequencing.

2.3.7 Beta-galactosidase assay

The Miller method was used to complete all beta-galactosidase analyses (Ausubel et al, 1995; Miller, 1992.). Briefly, S. dysenteriae containing a given reporter plasmid

(pT-lacZ) or pMic21 control vector was cultured at 37°C to stationary-phase in 3ml LB broth and then sub-cultured in 3ml LB broth to the logarithmic-phase (OD600: 0.28-0.7) at

37°C. 30 (µg ml-1) Chloramphenicol was added to each culture to ensure maintenance of the reporter or control plasmid. Following incubation of each culture on ice for 20 minutes, bacteria present in 1ml of the culture were pelleted by centrifuging at 5,000g for

5 minutes. Next, each bacterial cell pellet was resuspended in 1ml Z buffer (0.06M

Na2HPO4, 0.04M NaH2PO4, 0.01M KCl, 0.001M MgSO4, 0.05M β-mercaptoethanol, pH

7.0) and the OD600 measured using a ND-1000 spectrophotometer (NanoDrop

Technologies, Wilmington, DE). Next, 400µl of the resuspended cells was diluted 1:1 with Z buffer and the bacterial cells permeabilized by the addition of 50µl 0.1% SDS and

100µl chloroform prior to vortexing for 10 seconds. Following incubation at 30˚C for 15 minutes, 160µl of 4 (mg ml-1), Ortho-Nitrophenyl-β-galactopyranoside (ONPG) was added to each sample and the incubated at 37˚C until the sample developed a visible yellow color. Once a given sample developed a detectable yellow color, the time of incubation was noted, 400µl of 1M Na2CO3 was added to stop the reaction and the sample was subjected to centrifugation at maximum speed for 2 minutes. The supernatant 67 of each sample was then collected and the OD420 and OD550 measured using the ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). Miller units were calculated using the following equation: - =

[ .] (t stands for the reaction time in minutes; V represents the volume ×× of culture used in milliliters, which, in this case, is 0.4ml). A reaction containing all reaction components except the cell culture was used as a negative control in each beta- galactosidase assay. Additionally, S. dysenteriae carrying plasmid pMic21, a reporter plasmid containing no cloned promoter, was used to measure background beta- galactosidase in the strain.

2.3.8 Western blot analysis

All western blot analyses were completed using whole cell extracts. Specifically,

S. dysenteriae containing the indicated plasmid was cultured to mid-logarithmic phase under the indicated conditions and the OD600 measured using the ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). A total of 5x108 bacterial cells were pelleted by centrifugation at 17,000g for 2 minutes and suspended in 200µl

Laemmli protein dye (Bio-Rad) containing 5% β-mercaptoethanol. Samples were boiled for 10 minutes and then stored at -20˚C until use.

Proteins present in 15µl of each sample were separated on a 7.5% gel using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). PVDF was cut to size, pre-soaked in methanol for 10 minutes and rinsed with water prior to transfer of all protein from the acrylamide gel to PVDF membrane at 350 milliamperes for 1 hour. 68

Next, the membrane was blocked in 10% non-fat milk dissolved in PBS with 0.1% (wt ml-1) Tween 20 (PBST) overnight at 4˚C. After blocking, the membrane was incubated for 1 hour at 4˚C in a solution of mouse anti-GFP antibody (Roche) diluted 1:1000 in 5% milk with PBST. Next, the membrane was washed 3 times for 15 minutes each in PBST and blocked in 10% non-fat milk dissolved in PBS with 0.1% (wt ml-1) Tween 20 (PBST) prior to incubation for 1 hour at 4˚C in a solution of goat anti-mouse HRP conjugated IgG

(Bio-Rad) diluted 1:20,000 in 5% (wt ml-1) milk with PBST. Following incubation with the secondary antibody the membrane was washed with PBST 3 times for 15 minutes as detailed above. Then the Chemiluminescent HRP Substrate (Millipore Corporation,

Billerica, MA) was added to the membrane, the reaction incubated at room temperature for approximately 3 minutes and the membrane imaged using the Molecular Imager

ChemiDoc XRS+ imaging system (Bio-Rad). Total protein present on each membrane was visualized by staining with Ponceau S, following completion of the Western blot procedure to ensure even loading of all lanes.

2.3.9 Quantitative Real-time PCR analysis

For samples to be analyzed by both Western blot and quantitative Real-time PCR

(qRT-PCR), total RNAs was harvested from the same culture used to generate the corresponding whole cell protein preparations using the procedures detailed above. After the isolation of total RNA and subsequent DNA removal as detailed above, the iScript cDNA Synthesis Kit (Bio-Rad) was used to generate a cDNA library as directed. Each cDNA sample was diluted 1:10 in double distilled water. 5µl of diluted cDNA sample 69 was mixed with 10µl of iTaq Universal SYBR Green Supermix (Bio-Rad) and 5µl of each primer set at an optimum concentration, making an amplification reaction mixture with a total volume of 20µl. All amplification reactions were performed in a CFX96

Real-Time System (Bio-Rad) under reaction conditions optimized for each primer set.

For each target gene, a six-point standard curve was generated to ensure that acceptable amplification efficiency was achieved and that all experimental samples amplify within the linear portion of the standard curve. Using the ΔΔCt calculation method the expression level of each target gene was normalized to that of a house-keeping gene, rrsA, present in each sample and expressed relative to that within a selected control sample. All primers used in qRT-PCR were designed using Beacon Designer 7.5 and are detailed in Table 3.

2.3.10 Electrophoretic mobility shift assay

Generation of labeled DNA species: Primer pXG10-for was labeled with 32P at the 5' end by T4 polynucleotide kinase (New England Biolabs Inc.) based on the manufactural protocol. The radio-labeled primer was then used to generate 32P end- labeled DNA fragments for EMSA via PCR amplification (Table 3). Plasmid pF-UTR was used as template in a PCR reaction to generate a DNA fragment containing the putative Fur binding site. To generate a non-specific DNA control fragment, plasmid pXG-1 was constructed. Specifically, Plasmid pXG10 (Urban and Vogel, 2007) was digested with restriction enzymes NsiI and NheI (New England Biolabs Inc.) in order to remove the DNA sequence between the PLtetO-1 constitutive promoter and the gfp 70 coding region. Next, the digested plasmid was blunted with DNA Polymerase I, Large

(Klenow) Fragment (New England Biolabs Inc.), circularized using DNA ligation, and introduced into the host bacterium by transformation. Colonies containing the constructed plasmid were selected for by growth on LB plates containing 30 (µg ml-1)

Chloramphenicol, and its presence verified by PCR-based screening. Once constructed, pXG-1 was purified and used as template to amplify a DNA fragment identical to that generated above but lacking all shuT derived sequences.

Production and purification of S. dysenteriae Fur: PCR primers were designed based on S. dysenteriae fur gene sequence to generate a DNA fragment that contains a

BamHI and EcoRI recognition site at the 5' and 3' end respectively (Table 3). Purchased plasmid vector pGEX-2T (GE Healthcare) and the amplified DNA fragment were both digested with BamHI and EcoRI (New England Biolabs) and ligated together to construct plasmid pGEX-fur, the sequence of which was confirmed by nucleic acid sequencing.

The constructed plasmid has the Shigella fur gene fused in frame with the gene encoding glutathione S-transferase (GST), all under control of the Ptac promoter. Expression of the

GST-Fur fused protein was induced by 1 mM isopropyl-β D-thiogalactoside (IPTG).

After purification with a Sephorase 4B gel (GE Healthcare) column, thrombin (GE

Healthcare) was used to cleave the GST tag from the purified GST-Fur protein.

Previously published data has indicated the proper DNA-binding activity of Fur proteins expressed via this method (Pohl et al., 2003). Purified Fur protein was confirmed by western blot assay with antibody provided by Dr. Michael Vasil. Protein concentration 71 was measured according to the readings of OD280 by using a ND-1000 spectrophotometer

(NanoDrop Technologies, Wilmington, DE).

EMSA: EMSAs were carried out based on previously published protocols (de

Lorenzo et al., 1988; Hassett et al., 1997). Specifically, the binding reaction was prepared as mixing the radio-labeled DNA (less than 1nM) with purified Fur protein (10nM) in the binding buffer (10mM Bis-Tris borate, 40mM KCl, 0.1mM MnSO4, and 1mM MgSO4, pH is 7.5) with 100 (μg ml-1) bovine serum albumin (Sigma) and 50 (μg ml-1) poly dI-dC

(Thermo Scientific), followed by incubation at 37°C for about 20 minutes. Competitor

DNA concentrations were prepared as 10nM, 50nM, and 100nM, and added to the indicated reaction mixture before the incubation. After incubation, protein-bound and unbound DNA fragments were separated by electrophoresis on an 8% polyacrylamide gel. Radio signals were detected by the phosphor-imaging system.

2.3.11 In silico analyses

Promoter prediction: The putative shuT promoter region was identified using

Bprom

(http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfin db) (Solovyev and Salamov, 2011).

Binding site prediction: Bprom and Virtual Footprint

(http://www.prodoric.de/vfp/vfp_promoter.php) were used to identify the putative Fur- binding site within shuT (Solovyev and Salamov, 2011; Münch et al., 2005).

2.3.12 Statistical analysis

All experimental analyses were performed in biological triplicate. Statistical analysis was conducted in the computer program R (https://www.r- project.org/about.html). An F-test was conducted to test whether the comparing groups have equal variances or not, followed by the corresponding two tailed Student’s t tests to determine significance (P≤0.05).

2.4 Results

2.4.1 Fur mediates iron-dependent regulation of shuT

To experimentally determine if expression of shuT is regulated in response to iron availability, quantitative real-time PCR (qRT-PCR) was performed to measure the relative amount of shuT transcript in wild-type S. dysenteriae cultured to the mid- logarithmic phase of growth under iron-rich and iron-poor conditions. Following growth under iron-poor conditions, the relative amount of shuT transcript measured in wild-type

S. dysenteriae was significantly higher than that measured following growth of the strain under iron-rich conditions (Figure 10). These data confirm that shuT expression is influenced by iron availability, and suggest that this regulation is mediated by an iron- responsive alteration in transcriptional efficiency and/or transcript stability; an observation consistent with the prediction of Fur-dependent regulation of shuT transcription. To test whether Fur is involved in mediating the observed iron-dependent regulation of shuT expression, the relative amount of shuT transcript present in S. dysenteriae lacking fur was measured following growth of the strain under iron-rich 73 conditions, conditions under which Fur-mediated repression would be predicted to occur.

Deletion of fur eliminates the observed iron-dependent decrease in the relative amount of shuT transcript, returning transcript levels to those observed in the wild-type strain cultured under iron-poor conditions (Figure 10). Taken together, these data demonstrate that the expression of shuT is regulated in response to iron availability and that the iron- dependent decrease in transcript levels is mediated, directly or indirectly, by the iron- dependent transcriptional regulator Fur.

Figure 10. shuT expression is regulated in response to iron by Fur. Quantitative Real- time PCR targeting shuT was performed following growth of wild-type and Δfur S. dysenteriae to mid-logarithmic phase at 37 ̊C under the indicated culture conditions. “+Fe” indicates “iron-rich” conditions achieved by culturing in Luria-Bertani broth, while “-Fe” represents “iron-poor” conditions achieved by culturing in Luria-Bertani broth containing 150µM 2,2'-bipyridine. Using the ΔΔCt method of calculation, the expression level of shuT is normalized to that of rrsA present in each sample and is expressed relative to the amount of the transcript present in the first wild-type sample cultured under iron-rich conditions. All analyses were carried out in biological triplicate. Error bars indicate the standard deviation. Statistical significance (p-value ≤ 0.05) is indicated by stars: “*” represents 0.01 < p-value ≤ 0.05 and “**” indicates 0.001 < p- value ≤ 0.01.

2.4.2 Identification of shuT transcriptional start site

When direct, Fur regulates target gene transcription via iron-dependent binding to specific DNA sequences, termed Fur-binding site(s). For genes whose expression is directly repressed by Fur, the Fur-binding site(s) most often overlap the promoter region of a target gene (Bagg and Neilands, 1987). In these cases, binding by the regulator effectively blocks binding by RNA polymerase, and by doing so, prevents transcription initiation.

The first required step in characterizing the molecular mechanism underlying Fur- dependent regulation of shuT expression was to experimentally identify the transcription start site and promoter region of the gene. Based on the predicted transcript structure, four forward primers (F1, F2, F3, and F4) and one reverse primer (R) were generated and utilized in a series of reverse transcriptase PCR analyses designed to localize the shuT transcription start site (Figure 11A) (Wyckoff et al., 1998). The ability to amplify a specific product using each upstream primer (F1, F2, F3 or F4) paired with the conserved downstream primer (R) would indicate that the shuT transcript extends at least as far upstream as the binding site for the utilized upstream primer. While each primer set mediated amplification when S. dysenteriae genomic DNA was used as template, only primers F1 and F2 facilitated amplification when the amplification template was cDNA generated from RNA isolated from wild-type S. dysenteriae cultured under iron-limiting conditions (Figure 11B). The isolated RNA was confirmed to be free of DNA contamination by the lack of amplification by any of the utilized primer pairs when the

RNA itself was used as template (Figure 11B). Together these data demonstrate that the 75 shuT transcription start site falls within the 28-nucleotide region that separates primer F2 from primer F3.

Figure 11. Identification of shuT transcriptional start site. A) A schematic of the shuT transcriptional start site obtained from 5'-RACE analysis. The identified transcription start site is indicated with an arrow and “+1”. The solid line represents the genome of wild-type S. dysenteriae while the dashed line represents the furthest reading from 5'- RACE analysis. Arrows represent the primers used in the reverse transcriptase PCR analysis shown in panel B. B) Reverse transcriptase PCR confirmation of the existence of the shuT transcript and estimation of the length of the 5' UTR. Total RNA was isolated from wild-type S. dysenteriae cultured in LB broth containing 150µM 2,2'- bipyridine and cDNA generated with random primers. Amplification was performed using the series of upstream primers (F1, F2, F3 & F4) and a single conserved downstream primer (R) depicted in panel A. Double ended arrows at the top of the image indicate the template used in each set of amplification reactions. Genomic DNA and water were used as positive and negative amplification controls, respectively. RNA template was used as template to demonstrate a lack of DNA contamination in each RNA sample.

To further define the transcriptional start site of shuT, rapid amplification of cDNA 5' end (5'-RACE) analysis was performed using total RNA isolated from wild-type

S. dysenteriae grown to the mid-logarithmic phase under iron-poor conditions. Results obtained following sequencing of the products generated by 5'-RACE are consistent with 76 those obtained by reverse-transcription PCR analysis and indicate that the transcriptional start site of shuT is located 42 nucleotides upstream of the start codon (Figure 11A).

It’s noted that through the 5'-RACE analysis, besides the transcriptional start site described above (Figure 11A, and “transcription start site 1” in Figure 12), a second putative transcriptional start site of shuT (“transcription start site 2” in Figure 12) have been identified located downstream into the coding region. However, this identification is highly possible to be an artifact of the 5'-RACE technique, based on the following two aspects. Firstly, if this transcriptional start site does exist, this shorter transcript would produce a cytoplasmic protein, as it lacks the periplasmic signal peptide. However, previous researches indicated that the matured ShuT, which lacking the signal peptide, was harvested from the periplasmic region, which counteract with the above prediction

(Eakanunkul et al., 2005). Secondly, in the results of RNA sequencing analyses, transcriptional start site would be shown as a sharp and clear edge of transcript readings, which is not seen at the predicted position (Figure 12). Due to the above reasons, this second identified transcriptional start site is not considered in the following analyses.

Figure 12. Results of RNA sequencing and 5'-RACE analyses. Transcripts in the forward direction were shown as green (right side); while the reverse transcripts were indicated by red color (left side). Direction of shuT open reading frame was indicated as the yellow arrow. Sequences of the F1 and F2 primers used in reverse transcriptase PCR analysis (Figure 11) were each indicated by a black underlined arrow with the genomic sequence. The transcriptional start sites identified via 5'-RACE were indicated by thick arrows. Sequence of shuT start codon was highlighted by a box.

2.4.3 Identification of shuT promoter region

Guided by the experimentally confirmed location of the transcriptional start site and by in silico analysis (Bprom) a putative shuT promoter was identified ( Solovyev and

Salamov, 2011). The activity of the predicted shuT promoter was tested experimentally using beta-galactosidase analyses. Specifically, a transcriptional reporter plasmid (pT- lacZ) was constructed by cloning the predicted shuT promoter directly upstream of a promoter-less lacZ gene (Figure 13A). The cloned S. dysenteriae sequence contains only one predicted promoter, and ends with the nucleotide immediately 5' to the identified transcription start site. Wild-type S. dysenteriae carrying reporter plasmid pT-lacZ or the empty vector control (pMic21) were cultured to the mid-logarithmic phase under iron- poor conditions; and a basic beta-galactosidase assay was used to determine if the sequence cloned into pT-lacZ contains an active promoter. Significantly higher beta- galactosidase activity was measured from wild-type S. dysenteriae carrying pT-lacZ as compared to that of the strain carrying the promoter-less negative control (pMic21) 78

(Figure 13B). These data confirmed that the cloned sequences contain an active promoter, data consistent with the predicted localization of the shuT promoter (Figure 13A).

Figure 13. Identification of shuT promoter. A) A schematic of the plasmid pT-lacZ. “shuT-P” represents a 62-nucleotide region of the genome of S. dysenteriae that starts from 26 nucleotides upstream of the putative promoter of shuT and extends to the nucleotide before the identified transcription start site. The -35 and -10 promoter regions are highlighted by grey boxes and the nucleotide before the predicted transcription start site of shuT is labeled as “-1”. B) Measurement of beta-galactosidase activity from wild- type S. dysenteriae containing pT-lacZ or the negative control plasmid pMic21. Plasmid pMic21 contains a promoter-less lacZ, and function as a negative control; while plasmid pT-lacZ has the putative promoter of shuT cloned immediately before the lacZ reporter gene. S. dysenteriae carrying the indicated plasmid was cultured to the mid-logarithmic phase in LB broth with 150µM 2,2'-bipyridine at 37℃. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation and statistically significance difference (p-value ≤ 0.05) is indicated by stars, with "****" represents p- value ≤ 0.0001.

2.4.4 Sequences within shuT promoter and 5' untranslated region mediates iron-

dependent regulation by Fur

In order to experimentally determine if the observed iron-dependent regulation of shuT expression is mediated by specific nucleic acid sequences within the 5' UTR and/or promoter region of the gene, a transcriptional reporter plasmid (pT-UTR) was constructed

(Figure 14 A). pT-UTR carries a large insert containing the native promoter and full 42- nucleotide 5' UTR of shuT cloned immediately upstream of a promoter-less gfp reporter gene. Expression of gfp from the pT-UTR reporter plasmid is under direct control of the identified shuT promoter and is subject to modulation by any regulatory element located within the promoter and/or 5' UTR of the gene. Following introduction of pT-UTR into wild-type S. dysenteriae or S. dysenteriae Δfur, production of Gfp protein and gfp transcript were measured via Western blot and qRT-PCR analysis respectively. The data obtained demonstrate that both the Gfp protein and transcript levels are significantly higher in wild-type S. dysenteriae carrying pT-UTR following growth of the strain in iron-poor media as compared to the level of each following grown of the strain in iron- rich media (Figure 14 B & C). Furthermore, deletion of fur relieves the iron-dependent inhibition of gfp transcription under iron-rich conditions, as is seen upon analysis of S. dysenteriae Δfur carrying pT-UTR (Figure 14 B). Taken together, these data indicate that the cloned DNA segment containing both the promoter and 5' UTR of shuT, are sufficient to confer the observed iron-dependent Fur-mediated regulation.

Figure 14. Sequences within shuT promoter and 5' untranslated region mediates iron- dependent regulation by Fur. A) Schematic of plasmid pT-UTR, which has shuT promoter and the full sequence of the 5' untranslated region of shuT inserted immediately in front of reporter gfp. B) Quantitative Real-time PCR (qRT-PCR) analyses of the relative levels of gfp transcript present in wild-type and Δfur S. dysenteriae carrying pT-UTR. Host cells were cultured under 37°C to mid-logarithmic phase in either LB broth (+Fe for iron-rich conditions) or LB broth containing 150µM 2.2'-bipyridine (-Fe for iron-poor conditions). Using the ΔΔCt method, the relative abundance of gfp is normalized to the amount of rrsA present in each sample and expressed relative to the amount of gfp transcript present in one of the wild-type samples grown under iron-rich conditions (WT+Fe). C) Western blot analysis detecting Gfp levels in wild-type S. dysenteriae carrying pT-UTR following growth under the indicated conditions. Histograms indicate the relative intensity of the detected Gfp specific bands. All analyses shown in this figure were carried out in biological triplicate. Error bars indicate one standard deviation. Statistically significant difference (p-value ≤ 0.05) is indicated by stars with “*” represents 0.01 < p-value ≤ 0.05 and “**” indicates 0.001 < p-value ≤ 0.01.

2.4.5 A functional Fur binding site is located immediately down-stream of the shuT

transcription start site

In silico analyses using Bprom and Virtual Footprint were completed in order to identify and localize a putative Fur-binding site within the sequences composing the shuT promoter and 5' UTR. Using these approaches a 19-nucleotide putative Fur binding site that differs by only three nucleotides from the consensus Fur-binding site sequence was identified immediately downstream of the shuT transcription start site, from +1 to +19 of shuT (Figure 15A) (Lavrrar and Mcintosh, 2003). The prediction of a Fur-binding site within DNA encoding a 5' UTR is unusual, as in most cases of Fur-mediated iron- dependent repression, the Fur-binding site overlaps with the -35 region of the regulated promoter.

Figure 15. A putative Fur-binding site is located immediately down-stream of the shuT transcription start site. A) Full sequence of the 5' untranslated region of shuT as well as the sequence of a consensus Fur binding site. Nucleotides within the identified putative Fur binding site that differ from the consensus Fur binding site sequence are indicated with an arrow. Regions between the dashed-lines indicate the region of shuT that has been inserted into plasmid pF-UTR. B) Measurement of beta-galactosidase activity from wild-type S. dysenteriae containing plasmid pT-lacZ, a reporter plasmid on which the constitutive plasmid promoter immediately upstream of the lacZ reporter gene has been replaced with the shuT promoter. Cultures were grown to mid-logarithmic phase in LB broth (+Fe) or LB broth containing 150µM 2.2'-bipyridine (-Fe). C) Quantitative Real- time PCR analyses of the relative levels of gfp transcript present in wild-type and Δfur S. dysenteriae carrying plasmid pF-UTR. Host cells were cultured under 37°C to mid- logarithmic phase in either LB broth (+Fe for iron-rich conditions) or LB broth containing 150µM 2.2'-bipyridine (-Fe for iron-poor conditions). Using the ΔΔCt method, the relative abundance of gfp is normalized to the amount of rrsA present in each sample and expressed relative to the amount of gfp transcript present in one of the wild-type samples grown under iron-rich conditions (WT+Fe). D) Western blot analysis detecting Gfp levels in wild-type S. dysenteriae carrying pF-UTR following growth under the indicated conditions. Histograms indicate the relative intensity of the detected Gfp specific bands. E) All analyses shown in this figure were carried out in biological triplicate. Error bars indicate one standard deviation. Statistical significance (p-value ≤ 0.05) is indicated by stars: “*” represents 0.01 < p-value ≤ 0.05, “**” indicates 0.001 < p-value ≤ 0.01, and “***” means 0.0001 < p-value ≤ 0.001.

To confirm that sequences within the shuT promoter region do not mediate iron- dependent transcriptional regulation, a beta-galactosidase assay using the reporter plasmid pT-lacZ was conducted. This previously constructed reporter plasmid, pT-lacZ, contains nucleic acid sequences composing just the shuT promoter region cloned immediately upstream of the promoter-less lacZ reporter gene, sequences that do not include the putative Fur binding site (Figure 13A). As expected, no significant difference was measured in the amount of beta-galactosidase activity detected from wild-type S. dysenteriae carrying pT-lacZ grown under iron-rich or iron-poor conditions (Figure 15B).

These data confirm that the activity of shuT promoter itself is not influenced by iron availability.

To determine if nucleic acid sequences within the shuT 5' UTR, the region containing the identified putative Fur binding site, are sufficient to confer iron-dependent regulation, the reporter plasmid pF-UTR was constructed. pF-UTR contains the full 42- nucleotide shuT 5' UTR cloned between a constitutive plasmid promoter and the reporter gene gfp (Figure 15A). As cloned, expression of gfp from pF-UTR is driven by the constitutive plasmid promoter and subject to regulation mediated solely via sequences contained within the cloned shuT 5' UTR. Western blot and qRT-PCR analyses were used to measure the relative amounts of Gfp protein and gfp transcript in wild-type and Δfur S. dysenteriae carrying pF-UTR, following growth of each strain under iron-rich or iron- poor conditions as indicated. The amount of Gfp protein (Figure 15D) and gfp transcript

(Figure 15C) measured from wild-type S. dysenteriae carrying pF-UTR cultured under iron-poor conditions were significantly higher than those measured following growth of 84 the strain under iron-rich conditions. Moreover, under iron-rich conditions, the level of gfp transcripts produced by Δfur strain was significantly higher than that detected from wild-type S. dysenteriae cultured under similar conditions (Figure 15C). Taken together, these data confirm that sequences within the shuT 5' UTR are sufficient to confer iron- dependent regulation and that this regulation is influenced, directly or indirectly, by the activity of Fur.

Following up on the finding that sequences encoding the shuT 5' UTR harbor a putative Fur binding site and are sufficient to mediate iron-dependent regulation, electrophoretic mobility shift assays (EMSA) were conducted to determine if Fur binds directly to these nucleic acid sequences. 32P end-labeled primers were used to generate radio-labeled DNA fragments via PCR amplification. Plasmid pF-UTR, which has been confirmed to mediate iron-dependent regulation, was used as PCR template to generate a

DNA fragment containing the putative Fur binding site (Figure 16A). As a non-specific control, an identical DNA fragment lacking the shuT specific sequences were amplified from plasmid pXG-1, which contains the constitutive promoter located immediately upstream of the gfp coding region. As shown in Figure 16, purified Shigella Fur protein binds both the DNA fragment containing sequences of the shuT 5' UTR and the non- specific control (Figure 16B). Increasing amounts of competitor DNA (shuT 5' UTR or non-specific competitor) were added to the reaction mixture to determine specificity of binding between Fur and each DNA species. The addition of increasing amounts of un- labeled non-specific control DNA did not disrupt binding between Fur and the shuT 5'

UTR. The addition of increasing amounts of un-labeled shuT 5' UTR, on the other hand, 85 competed Fur away from the labeled non-specific DNA fragment (Figure 16). These data indicate that compared to the plasmid sequences, Fur more preferentially to bind with the nucleic acid sequences within the shuT 5' UTR, and directly mediates the iron-dependent regulation of gfp that have been seen in S. dysenteriae carrying pF-UTR and absent in S. dysenteriae carrying the control plasmid pXG-10 (data not shown). The binding seen between Fur and the negative control could possibly result from binding with the plasmid promoter sequence. In addition, it’s also been published that Fur has the ability to bind with sequences other than the exact consensus sequence (Baichoo and Helmann, 2002;

Lavrrar and Mcintosh, 2003).

Figure 16. Fur binds specifically to sequences within the shuT 5' UTR. Electrophoretic mobility shift assay testing direct binding between Fur and DNA containing shuT 5' UTR. A) 32P-labeled DNA fragments were generated by PCR amplification from plasmid pF-UTR (shuT-UTR) or pXG-1 (Negative Control) using radio-labeled primers. Fragment “shuT-UTR”, which is amplified from pF-UTR, contains the full 42-nucleotide shuT 5' UTR; while fragment “Negative control”, amplified from pXG-1, has the same sequence as “shuT-UTR” but is lacking the 42-nucleotide shuT 5' UTR. Sequences from the plasmid promoter region and gfp coding region are indicated respectively by a box with diagonal lines and a white box. B) For the left five reactions indicated by “shuT- UTR”, non-labeled “Negative Control” fragment serves as the competitor DNA; while for the right four reactions indicated as “Negative Control”, the competitor DNA is non- labeled “shuT-UTR”. The ratio between Fur protein (10nM) and each radio-labeled DNA species (less than 1nM) is about 10:1; concentrations of the competitor DNA are either 10 times, 50 times, or 100 times higher than that of the labeled DNA as indicated. After incubating the binding reactions at 37°C for 15 minutes, samples were separated on an 8% acrylamide gel. “+” and “-” represents the existence of the indicated component.

If Fur-dependent regulation of shuT is mediated by the identified putative Fur- binding site, disruption of this site would be expected to decrease or eliminate the observed iron-dependent regulation. To test this hypothesis directly, a transcriptional reporter plasmid (pS-UTR) was constructed in which a truncated version of the shuT 5'

UTR was cloned between the constitutive plasmid promoter and the reporter gene gfp

(Figure 17 A). The truncated 5' UTR cloned within pS-UTR lacks the first 5 nucleotides of the predicted Fur-binding site, deleting approximately one fourth of the putative site.

Western blot and qRT-PCR assays were carried out to measure the relative amounts of

Gfp protein and gfp transcript produced by wild-type S. dysenteriae carrying pS-UTR growing in iron-rich and iron-poor media. No significant differences in Gfp protein levels or relative amounts of gfp transcript were detected following growth of wild-type S. dysenteriae carrying pS-UTR under iron-rich or iron-poor conditions (Figure 17 B&C).

Additionally, the amount of gfp transcript measured in Δfur S. dysenteriae carrying pS-

UTR following growth in iron-rich media was equivalent to that measured in wild-type S. dysenteriae cultured in both iron-rich and iron-poor media (Figure 17 C). Together these results demonstrate that, unlike sequences contained within the full-length shuT 5' UTR, sequences contained within the truncated shuT 5' UTR do not confer iron-dependent regulation. These data support the conclusion that the observed iron-responsive, Fur- dependent regulation of shuT expression is mediated by the Fur-binding site identified within the 5' UTR of the gene.

Figure 17. Truncation of the Fur-binding site abolishes iron-dependent regulation. A) Full sequence of the 5' untranslated region of shuT as well as the sequence of a consensus Fur binding site. Nucleotides within the identified putative Fur binding site that differ from the consensus Fur binding site sequence are indicated with an arrow. Regions between the dashed-lines indicate the region of shuT that has been inserted into plasmid pS-UTR. B) Quantitative Real-time PCR analyses of the relative levels of gfp transcript present in wild-type and Δfur S. dysenteriae carrying pS-UTR. Host cells were cultured under 37°C to mid-logarithmic phase in either LB broth (+Fe for iron-rich conditions) or LB broth containing 150µM 2.2'-bipyridine (-Fe for iron-poor conditions). Using the ΔΔCt method, the relative abundance of gfp is normalized to the amount of rrsA present in each sample and expressed relative to the amount of gfp transcript present in one of the wild-type samples grown under iron-rich conditions (WT+Fe). C) Western blot analysis detecting Gfp levels in wild-type S. dysenteriae carrying pS-UTR following growth under the indicated conditions. Histograms indicate the relative intensity of the detected Gfp specific bands. All analyses shown in this figure were carried out in biological triplicate. Error bars indicate one standard deviation and "*" indicates a statistically significance difference (p-value ≤ 0.05).

2.5 Discussion

With a localization of shuT promoter region and transcription start site, research results presented in this chapter demonstrate that Fur mediates iron-dependent transcriptional regulation of shuT expression by directly binding to DNA region located immediately downstream of the transcription start site of the gene. The current model of the molecular mechanism underlying Fur-mediated repression of bacterial gene expression is that binding of the Fur protein within the promoter region of the regulated gene prevents the initiation of transcription by physically blocking binding of RNA polymerase (Troxell and Hassan, 2013). Specifically, for genes whose transcription is repressed by Fur, Fur-binding sites are most commonly located adjacent to, or overlapping with, the -35 region of the gene’s promoter (Escolar et al., 1997, 1998;

Christoffersen et al., 2001). Located immediately downstream of the shuT promoter, the nucleic acid sequence mediating Fur-dependent regulation is in a relatively unique location with respect to the promoter of the regulated gene. Although the precise molecular mechanism remains to be characterized, it is possible that, similar to the accepted model of Fur-mediated regulation, binding of Fur to sequences immediately downstream of the promoter region acts to prevent transcription initiation by physically blocking binding by RNA polymerase. This regulatory model is supported by previous results of DNA foot-printing assays, which have demonstrated that, even though the core binding site is only 19 nucleotides, the DNA regions protected by Fur binding are no less than 31 nucleotides, and potentially up to 100 nucleotides, due to the fact that Fur can form multimeric complexes (Escolar et al., 2000; Baichoo and Helmann, 2002). A second 90 potential mechanism underlying Fur-mediated repression of shuT expression is that binding by Fur prevents transcription elongation by physically blocking the processivity of RNA polymerase. The possibility of such a mechanism is supported by the identification of functional Fur-binding sites within the coding region of four genes in E. coli: gspC, garP, yahA, and fadD other bacterial genes (Chen et al., 2007). To verify which of the above models that Fur actually uses to mediate iron-dependent repression of shuT transcription, further experimental assays are needed. One experimental technique that could be used is DNA foot-printing, which would reveal the Fur-protected region overlaps with shuT promoter region or not. 91

CHAPTER 3: TEMPERATURE-DEPENDENT REGULATION OF SHUT

3.1 Abstract

An RNA thermometer is a sequence of transcript that incorporates the ribosomal binding site into a temperature responsive hairpin structure and prevents translation at non-permissive environmental temperatures. Currently, RNA thermometers have been characterized in regulating an increasing number of virulence-associated bacterial genes, including shuA from Shigella dysentariae, which is involved in the utilization of heme, a host-associated iron source. This research indicates that besides shuA, another shu gene, shuT, encoding the periplasmic heme-binding protein, is also regulated by an RNA thermometer in response to changes in environmental temperature. A temperature- dependent cis-acting regulatory element is predicted in the 5'-UTR of shuT by in silico analysis, whose regulatory function was confirmed by Real-time PCR and Western Blot analysis. Subsequently, the predicted secondary structure of the shuT RNA thermometer and mechanisms of the inhibitory hairpin responding to temperature changes were characterized by the RNA structure probing assay in vitro.

3.2 Introduction

As the potential sources of nutritional iron vary depending upon the environment, the production of different iron acquisition systems by pathogenic bacteria is often regulated in response to multiple environment-specific signals, such as iron availability, presence of oxygen, pH value, and presence of heme (Carpenter and Payne, 2014; Kouse et al., 2013; Wei and Murphy, 2016a; Vanderpool and Armstrong, 2003). Such multi- 92 factored regulation ensures the production of a given iron-acquisition system when, and only when, a bacterium is within an environment likely to contain the corresponding iron source. One of such environmental signal is temperature. Specifically, the increase of temperature from a variable room temperature of approximately 25°C to a constant 37°C corresponds to entry of a pathogen into the human body, and can trigger the production of factors that facilitate bacterial survival and/or virulence in this often harsh environment.

3.2.1 Temperature-dependent transcriptional regulation

In enteric bacterial pathogens, histone-like nucleoid structuring protein (H-NS) is known to mediate temperature-dependent transcriptional regulation of various genes

(Lam et al., 2015). In Salmonella enterica serovar Typhimurium, more than 200 genes are regulated by H-NS in response to environmental temperature (Ono et al., 2005);

While in E. coli, approximately 5% of total genes are regulated by this protein (Hommais et al., 2001). Though H-NS has been known as a master regulator and studied for decades, its regulatory mechanism still remains un-fully characterized. Generally, as a nucleoid structuring protein, H-NS represses gene expression at non-permissive temperature (relative low temperature, such as the 25°C room temperature) via altering its regional topology, which leads to the occluding of RNA polymerase from recognizing to the promoter region of the target gene; while at permissive temperature, increasing of environmental temperature changes the configuration of both H-NS and DNA, dissociates binding between H-NS and DNA in a yet undefined mechanism, and permits transcription initiation as a consequence (Prosseda et al., 2004; Stella et al., 2006). In 93 addition, it is also thought that binding of H-NS could also physically block the binding of RNA polymerase by masking the promoter region (Ono et al., 2005). To fully understand the molecular mechanism of H-NS mediated temperature-dependent regulation, further investigations are required.

3.2.2 Temperature-dependent post-transcriptional regulation

Besides transcriptional regulation, environmental temperature is also known to regulate gene expression at post-transcriptional level in both cis- and trans-regulatory methods. The characterized cis-regulatory element is RNA thermometer, which is usually located in the 5' untranslated region (5' UTR) and inhibits translation of the target gene in which they are housed. At non-permissive temperatures, an inhibitory hairpin is formed within the regulated transcript that physically occludes the Shine-Dalgarno (SD) sequence, thus preventing ribosomal binding and translation initiation (Kortmann and

Narberhaus, 2012). RNA thermometers are most often implicated in regulating the production of heat shock proteins and specific bacterial virulence determinants

(Kortmann and Narberhaus, 2012; Wei and Murphy, 2016b).

Trans-acting thermal regulation is mediated by small RNAs (sRNAs) and/ or

RNases. sRNA binds with its target transcript in a sequence-specific manner, inhibits translation by either blocking the binding of ribosome to the SD sequence or leading to degradation of the sRNA-mRNA complex. In addition, environmental temperature also effects the activity of RNases. For example, RNase E auto-regulates its synthesis via controlling the rate of transcript degradation by cleaving its own 5' UTR (Jain and 94

Belasco, 1995; Schuck et al., 2009). When switching the culturing conditions from 30°C to 44°C, higher efficiency of RNase E auto-digestions leads to increased stability of the target transcripts (Le Derout et al., 2002).

3.2.3 Temperature-dependent regulation of the Shu system

Production of Shigella Shu system is known to be regulated in response to environmental temperature. In previous researches, production of Shigella outer membrane heme binding protein, ShuA, has been demonstrated to be regulated by environmental temperature via an RNA thermometer located within 5' UTR of the gene

(Kouse et al., 2013). Whether temperature changes also influence expression of other shu genes, especially those encoded on transcripts separated from that of shuA, remained unknown. It has been shown that genes located within the same locus could be regulated by temperature independently (Krajewski et al., 2014; Narberhaus et al., 1998). shuT is encoded in the opposite direction of shuA, with more than 300-nucleotides separating the transcriptional start sites of these two genes (Wyckoff et al., 1998). In addition, research results in the previous chapter demonstrate that shuT contains a 42-nucleotide 5' UTR, a relative long untranslated region comparing to the average of less than 10 nucleotides in bacterial genes (Lodish et al., 2004). In this chapter, the possibility of shuT being regulated by environmental temperature was tested, following characterization of the molecular mechanisms underlying the identified regulation. These studies contribute to the understandings of regulating the Shu system expression in response to host-associated environmental cues. 95

3.3 Methods and Materials

3.3.1 Strains and culture conditions

All bacterial strains and plasmids used in this research are shown in Table 4.

Dickenson and Company, Sparks, MD) containing 0.01% (wt vol-1) Congo red dye (ISC

Chloramphenicol and Ampicillin were used at a final concentration of 30 (µg ml-1) and

150 (µg ml-1), respectively, for the growth of bacterial strains carrying plasmids.

Specifically for the heme utilization assay, the “Iron-poor” media (-Fe) is generated by adding 2,2'-bipyridine (Alfa Aesar, A Johnson Matthey Company) to LB broth (+Fe) at a final concentration of 225 µM. To generate the growth condition in which heme represents the major source of iron, heme (Sigma) was added to the –Fe media at a final concentration of 100 (µg ml-1).

Table 4

Summary of bacterial strains and plasmid vectors Reference/ Destination Description source Escherichia coli Life DH5α Technologies Shigella dysenteriae O-4576S1 (aka (Murphy and ND100) Wild-type S. dysenteriae. Payne, 2007) Plasmids Low-copy plasmid containing a PLtetO-1 (Urban and pXG10 constitutive promoter and a report gene gfp, Vogel, 2007) which lacks the start codon. Cmr Reporter plasmid that has the shuT promoter, 5' pT-UTR UTR, and start codon inserted right before the This study reporter gene gfp of plasmid pXG10. Cmr Reporter plasmid that has the shuT full 5' UTR pF-UTR and start codon inserted right before the This study reporter gene gfp of plasmid pXG10. Cmr Reporter plasmid that has the mutated shuT 5' pD-UTR UTR and start codon inserted right before the This study reporter gene gfp of plasmid pXG10. Cmr Cloning vector that has the T7 promoter leading the transcription of a 57-nucleotide transcript pT7-T This study that includes the full 5' UTR and 5 codons of shuT, followed by a NheI cutting site. Cmr Cmr: the plasmid contains Chloramphenicol resistant gene. Ampr: the plasmid contains Ampicillin resistant gene.

3.3.2 Oligonucleotide primers

Table 5

Summary of oligonucleotide primers Primer Sequence Function shuT-for- GTGACGTCTGCGTATTGAATCGACGG XG10-60 Constructing shuT-rev- plasmid pT-UTR GTGCTAGCCATAATATGAGAACTCTTATC XG10-2 shuT- TGATAATCATGATCATTCTCAATTTGATAAG 5UTR-F AGTTCTCATATTATGG Constructing shuT- CTAGCCATAATATGAGAACTCTTATCAAAT plasmid pF-UTR 5UTR-R TGAGAATGATCATGATTATCATGCA TGATAATCATGATCAACCTCAATTTGATAA shuT-2D-F GAGTTCTCATATTATGG Constructing CTAGCCATAATATGAGAACTCTTATCAAAT plasmid pD-UTR shuT-2D-R TGAGGTTGATCATGATTATCATGCA CTAATACGACTCACTATAGGGATAATCATG shuT- ATCATTCTCAATTTGATAAGAGTTCTCATAT RNAT-F TATGCCAAGGATCG Constructing CTAGCGATCCTTGGCATAATATGAGAACTC plasmid pT7-T shuT- TTATCAAATTGAGAATGATCATGATTATCC RNAT-R CTATAGTGAGTCGTATTAGACGT Primers target S. rrsAforRT AACGTCAATGAGCAAAGGTATTAAC dysenteriea house- keeping gene in rrsArevRT TACGGGAGGCAGCAGTGG qRT-PCR assay GfpforRT CCGTTCAACTAGCAGACCATTATC Primers target report gene gfp in GfprevRT CTCATCCATGCCATGTGTAATCC qRT-PCR assay

3.3.3 Reporter plasmid construction

pT-UTR: Primers were designed to amplify the region containing the promoter and full 5' UTR of shuT (Table 5) by PCR using genomic DNA of wild type S. dysenteriae as template. The amplified fragment was purified by gel extraction and digested with restriction enzymes AatII (New England Biolabs Inc.) and NheI (New

England Biolabs Inc.). The digested fragment was then purified and ligated into plasmid pXG10 (Urban and Vogel, 2007) that had been digested with AatII (New England 98

Biolabs Inc.) and NheI (New England Biolabs Inc.) to generate plasmid pT-UTR. Such cloning removed the PLtetO-1 constitutive promoter of pXG-10 and placed the promoter and full 5' UTR of shuT immediately upstream of the reporter gfp gene.

pF-UTR and pD-UTR: Complementary oligonucleotide primers containing the indicated nucleic acid sequences (Table 5) were combined and annealed in STE buffer

(0.1M NaCl, 10mM Tris-HCl, 1mM EDTA, pH 8.0) by boiling in a water-bath for 10 minutes followed by slow cooling to room temperature. The generated double-stranded

DNA products were then ligated into plasmid pXG10 (Urban and Vogel, 2007) that had been digested with restriction enzymes NsiI (New England Biolabs Inc.) and NheI (New

England Biolabs Inc.). Such cloning placed the DNA fragment encoding the putative

RNA thermometer being investigated between the PLtetO-1 constitutive promoter and the reporter gfp gene of pXG-10.

3.3.4 RNA extraction and DNA removal

Total RNA was harvested from wild-type S. dysenteriae cultured to the mid- logarithmic phase under the indicated growth condition. Following growth to mid- logarithmic phase, RNA preserving buffer (95% ethanol and 5% phenol, pH 4.5) was added to each culture at a culture:buffer ratio of 4:1, and the mixture incubated at 4˚C overnight. Following overnight incubation, cells present in 3ml of bacterial culture were pelleted by centrifugation at 17,000g for 2 minutes. After discarding the supernatant,

-1 bacterial cells were re-suspended in 357.3µl DEPC treated ddH2O, 40µl 10% (wt vol ) sodium dodecyl sulfate (SDS), and 2.67µl 3M sodium acetate (pH 5.2) by vortexing for 99

15 seconds. Lysis of the bacterial cells was achieved by incubating each resuspended sample at 90˚C for 7 minutes. After lysis, 1ml of Trizol reagent (Ambion) was added to each sample, the sample transferred to a 2ml phase-lock gel tube (5 PRIME Inc.,

Gaitherburg, MD) and the reaction incubated at room temperature (~25˚C) for 5 minutes.

Trizol reagent was extracted from each sample by the addition of 250µl chloroform followed by vigorous shaking for 30 seconds to 1 minute and then incubation at room temperature for 2 minutes. Each sample was then subjected to centrifugation for 2 minutes at 17,000g and the nucleic acid containing aqueous phase transferred to a clean

2ml microfuge tube. 1ml of 100% ethanol was added to each sample and the samples incubated overnight at -80˚C. Following overnight incubation at -80˚C, nucleic acid present in each sample was pelleted by centrifugation at 17,000g for 15 minutes at 4˚C.

Each pellet was washed by the addition of 1 ml cold 70% ethanol followed by centrifugation as described above. The supernatant was then removed and each pellet dried by centrifugation in a vacufuge (Eppendorf) for approximately 2 minutes in

Alcohol Mode. Finally, each RNA pellet was resuspended in 53μl of nuclease free water.

Following DNA removal from each RNA sample using TURBO DNA-free kit

(NanoDrop Technologies, Wilmington, DE).

100

3.3.5 Western blot analysis

All western blot analyses were completed using whole cell extracts. Specifically,

Laemmli protein dye (Bio-Rad) containing 5% β-mercaptoethanol. Samples were boiled for 10 minutes and then stored at -20˚C until use.

Billerica, MA) was added to the membrane, the reaction incubated at room temperature 101 for approximately 3 minutes and the membrane imaged using the Molecular Imager

3.3.6 Quantitative Real-time PCR analysis

For samples to be analyzed by both Western blot and quantitative Real-time PCR

(qRT-PCR), total RNAs was harvested from the same culture used to generate the corresponding whole cell protein preparations using the procedures detailed above. After the isolation of total RNA and subsequent DNA removal as detailed above, the iScript cDNA Synthesis Kit (Bio-Rad) was used to generate a cDNA library as directed. Each cDNA sample was diluted 1:10 in double distilled water. 5µl of diluted cDNA sample was mixed with 10µl of iTaq Universal SYBR Green Supermix (Bio-Rad) and 5µl of each primer set at an optimum concentration, making an amplification reaction mixture with a total volume of 20µl. All amplification reactions were performed in a CFX96

Real-Time System (Bio-Rad) under reaction conditions optimized for each primer set.

For each target gene, a six-point standard curve was generated to ensure that acceptable amplification efficiency was achieved and that all experimental samples amplify within the linear portion of the standard curve. Using the ΔΔCt calculation method the expression level of each target gene was normalized to that of a house keeping gene, rrsA, present in each sample and expressed relative to that within a selected control 102 sample. All primers used in qRT-PCR were designed using Beacon Designer 7.5 and are detailed in Table 5.

3.3.7 Enzymatic RNA structure probing

Construction of the run-off plasmid pT7-T: Complementary oligonucleotides containing the nucleic acid sequences of the T7 promoter, the full shuT 5' UTR, and the first 5 codons of shuT (Table 5) were combined and annealed in STE buffer (0.1M NaCl,

10mM Tris-HCl, 1mM EDTA, pH 8.0) by boiling in a water bath for 10 minutes followed by slow cooling to room temperature. The generated double-stranded DNA was then ligated into plasmid pXG10 (Urban and Vogel, 2007) that had been digested by restriction enzymes AatII (New England Biolabs inc.) and NheI (New England Biolabs inc.) to generate the run-off plasmid pT7-T, from which the 5' portion of the shuT transcript would be generated for subsequent enzymatic RNA structure probing analysis.

In vitro transcription: E. coli strain DH5α carrying the run-off plasmid pT7-T was cultured to the stationary phase of growth in 3ml LB broth with 30 (μg ml-1) chloramphenicol at 37°C. Following extraction, purified pT7-T was linearized by digestion with restriction enzyme NheI-HF (New England Biolabs Inc.) at 37°C for 2 hours. After purification by gel extraction, the linear DNA was used as template in an in vitro transcription reaction carried out according to the protocol provided by

AmpliScribeTM T7-FlashTM Transcription kit (epicenter, an Illumina company).

Following completion of the in vitro transcription reaction, 1μl of DNase was added to the reaction mixture, and the mixture was incubated at 37°C for 15 minutes. Next, RNA 103 products were precipitated at -80°C for more than 15 minutes following addition of 1ml

100% ethanol and 40μl 3M sodium acetate (pH 5.2). Precipitated RNA was pelleted by centrifugation at 17,000g for 15 minutes at 4°C and the RNA pellet washed twice by 1ml ice-chilled 70% ethanol followed by centrifugation as described above. After drying by centrifugation in a vacufuge set on “Alcohol mode” (Eppendorf) for approximately 2 minutes, the RNA pellet was rehydrated in 15μl DEPC treated double-distilled water.

Radio-labeling and enzymatic probing: Following synthesis and purification of the shuT transcript by in vitro transcription, the sample was treated with Calf Intestinal

Alkaline Phosphatase (CIP) (New England Biolabs inc.) for 1 hour at 37°C to remove the

5' triphosphate from each RNA molecule. Next, the CIP was removed from sample by phenol extraction and the RNA precipitated and dried as described above. The RNA pellet was rehydrated in 7μl nuclease-free water and 5' end radio-labeled as follows: T4 polynucleotide kinase (New England Biolabs Inc.) was used to transfer the γ-32P- phosphate group from γ-32P-ATP to the RNA sample. Radio-labeled transcripts were purified and extracted from 8% acrylamide gel (UreaGel-8, National Diagnostics) with elution buffer (10 mM ethylenediaminetetraacetic acid (EDTA), 0.5 % SDS, and 0.1 M sodium acetate, pH 5.6), followed by RNA precipitation. Finally, structure probing assays were conducted using RNase T1 (Ambion), according to the procedures described in previous studies (Waldminghaus et al., 2007). 104

3.3.8 In silico analyses

RNA structure prediction: The secondary structure of shuT 5' UTR and its stabilizing energy under various temperatures were predicted using Mfold

(http://unafold.rna.albany.edu/?q=mfold/RNA-Folding-Form2.3) (Zuker, 2003).

3.3.9 Statistical analysis

3.4 Results

3.4.1 Nucleic acid sequences within the shuT promoter and/or 5' UTR confer

temperature-dependent post-transcriptional regulation

To experimentally determine whether expression of shuT responds to the change of environmental temperature, previously constructed reporter plasmid pT-UTR (Figure

14 A) was applied to measure the effects of temperature alternations in expression of the reporter gene gfp. As described above, pT-UTR carries the shuT promoter and full 5'

UTR region cloned immediately upstream of the start codon of a gfp gene. As a result of this arrangement, expression of gfp from the pT-UTR is driven by the shuT promoter and subject to regulation via any regulatory element located within the shuT promoter and/or 105

5' UTR. Following growth of wild-type S. dysenteriae carrying pT-UTR in iron-poor media at either 25 °C or 37 °C, the relative levels of both gfp transcript and Gfp protein were measured by qRT-PCR and Western Blot analyses, respectively. Given that sequences within the 5' UTR of shuT confer iron-dependent regulation, iron-poor media was used in these analyses to minimize the iron-dependent repression of shuT transcription. The data obtained demonstrate that while there was no significant difference in the relative amount of gfp transcript measured following growth of the strain at either temperature tested (Figure 18A), Gfp protein levels were significantly higher following growth of the strain at 37°C as compared to those measured following growth of the strain at 25°C (Figure 18 B). Taken together, these data demonstrate that the nucleic acid sequences within the shuT promoter and/or 5' UTR mediate temperature- dependent post-transcriptional regulation onto expression of the reporter gfp gene.

106

Figure 18. shuT is subject to temperature-dependent post-transcriptional regulation. Wild type S. dysenteriae carrying pT-UTR (reporter plasmid on which the constitutive plasmid promoter immediately upstream of gfp has been replaced by the shuT promoter and full-length 5' UTR) were cultured to mid-logarithmic phase at 25°C or 37°C in LB broth containing 150µM 2,2'- bipyridine, and the relative amounts of gfp transcript or Gfp protein measured by qRT-PCR (A) or Western blot analysis (B), respectively. Protein and RNA samples were prepared from the same set of cultures to ensure relevant comparisons. For the qRT-PCR analyses, the ΔΔCt method was used to normalize the level of gfp to that of rrsA present in each sample and express it relative to that measured in the first 37°C sample. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation and "*" indicates a statistically significance difference with the p-value falls into the range between 0.01 and 0.05.

As shown before, post-transcriptional regulation could be mediated by either cis- or trans-regulatory elements. Since the transcript levels remain equivalent under different temperature (Figure 18 B), the temperature-dependent regulation mediated by shuT promoter and/ or 5' UTR is more likely to be a cis-acting regulation, suggesting that an

RNA thermometer might be involved. In silico analysis using Mfold predicts the presence of a structure that when formed would occlude the SD site within the shuT 5'

UTR (Figure 19) (Zuker, 2003). Moreover, the predicted stabilizing energy (ΔG) of this putative inhibitory structure changes from -9.05 (kcal mol-1) to -5.10 (kcal mol-1) when temperature increases from 25°C to 37°C. The identification of a putative temperature- 107 sensitive structure within the shuT 5' UTR that occludes the SD site supports the hypothesis that shuT translation is regulated in response to temperature via the activity of an RNA thermometer.

Figure 19. Predicted secondary structure of shuT 5' untranslated region. A schematic of the secondary structure formed by the nucleic acid sequence of the S. dysenteriae shuT 5' untranslated region as predicted by Mfold analysis. Transcription start site is indicated by “+1”. Sequences composing the ribosomal binding site are indicated by a bolded line and the translational start codon is in bold text.

108

3.4.2 Nucleic acid sequences composing the putative shuT RNA thermometer are

sufficient to confer temperature-dependent post-transcriptional regulation

According to the in silico prediction, the 5' UTR of shuT forms a single hairpin that resembles an RNA thermometer, a regulatory element that would be predicted to confer temperature-dependent post-transcriptional regulation. To determine whether the observed temperature-dependent regulation of gfp expression from pT-UTR is mediated by nucleic acid sequences contained solely within the shuT 5' UTR, wild-type S. dysenteriae carrying the pF-UTR reporter plasmid (Figure 15A) were grown in iron-poor media at either 25°C or 37°C. As detailed above, pF-UTR contains the full 42-nucleotide shuT 5' UTR cloned between a constitutive plasmid promoter and the reporter gene gfp

(Figure 15 A). As cloned, expression of gfp from pF-UTR is driven by the constitutive plasmid promoter and subject to regulation mediated solely via sequences contained within the cloned shuT 5' UTR. Following growth to mid-logarithmic phase at 25°C or

37°C, the relative amounts of gfp transcript and Gfp protein were measured by qRT-PCR and Western blot analyses, respectively (Figure 20 A&B). The data demonstrate that while there was no significant difference in the relative amount of gfp transcript measured in bacteria grown at either temperature (Figure 20 A); however, Gfp protein levels were significantly higher following growth of the strain at 37°C compared to that measured following growth of the strain at 25°C (Figure 20 B). These data demonstrate that nucleic acid sequences within the shuT 5' UTR, sequences that are predicted to form an RNA thermometer, are sufficient to confer temperature-dependent post-transcriptional regulation. 109

Figure 20. Sequences within shuT 5' untranslated region is enough to confer post- transcriptional temperature-dependent regulation. A) Quantitative Real-time PCR analyzing the relative amounts of gfp transcript present in wild-type S. dysenteriae carrying plasmid pF-UTR and grown under the indicated conditions. Using the ΔΔCt method, the relative amount of gfp is normalized to the level of rrsA present in each sample and is expressed relative to the level measured in the first 37°C sample. B) Western blot analysis detecting the relative amount of Gfp in wild-type S. dysenteriae carrying pF-UTR and grown under the indicated conditions. Histograms indicate the relative intensity of Gfp specific bands. In all analyses presented, the indicated bacterial strain was cultured to mid-log phase in LB broth containing 150µM 2.2'-bipyridine. Plasmid pF-UTR contains a constitutive promoter and the wild-type sequence of the full shuT 5' UTR, followed by the reporter gene gfp. Protein and RNA samples were generated from the same set of cultures to ensure relevant comparisons. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation and "*" indicates a statistically significance difference with the p-value falls into the range of 0.01-0.05.

3.4.3 A functional RNA thermometer is contained within the shuT 5' UTR

Given that the regulatory activity of an RNA thermometer is dependent on a dynamic secondary structure, destabilizing the inhibitory hairpin structure of a functional

RNA thermometer would be expected to alter its regulatory activity, specifically resulting in increased expression of the regulated gene at previously inhibitory temperatures. Site- specific mutagenesis was utilized to determine if the putative regulatory element 110 identified within the shuT 5' UTR is a functional RNA thermometer. To destabilize the inhibitory hairpin within the shuT 5' UTR, the uracils at position +15 and +16

(transcription start site is +1) were replaced by an adenine and a cytosine, respectively

(Figure 21A). As was done for the construction of the wild-type reporter (pF-UTR), the mutated 5' UTR of shuT was cloned between a constitutive promoter and the reporter gene gfp, making plasmid pD-UTR (Figure 21B). Since plasmid pD-UTR and pF-UTR are identical, with the exception of the destabilizing mutations within the cloned shuT 5'

UTR, plasmid pF-UTR was used as the wild-type control in these analyses. According to the results of Western blot and qRT-PCR analyses, S. dysenteriae carrying pD-UTR produced significantly higher amount of Gfp protein as compared to the strain carrying the wild-type reporter pF-UTR (Figure 21C) when each strain was cultured at the previously inhibitory temperature of 25°C; under these conditions gfp transcripts levels were equivalent (Figure 21D). Thus, as expected, destabilization of the inhibitory structures within the putative regulatory element results in more efficient translation of the target gene at a non-permissive temperature. These data demonstrate that sequences within the shuT 5' UTR of shuT contain a functional RNA thermometer.

111

Figure 21. Destabilization of the putative shuT RNA thermometer abolishes translational inhibition at previously non-permissive temperature. A) schematic of the secondary structure formed by the nucleic acid sequence of the S. dysenteriae shuT 5' UTR as predicted by Mfold analysis. Sequences composing the ribosomal binding site are indicated by a bolded line and the translational start codon is in bold text. Arrows indicate the bases that were changed by site-directed mutagenesis to generate the destabilized version of the element (U15 was changed to A and U16 was changed to C). B) Schematic of plasmid pF-UTR and pD-UTR. Plasmid pF-UTR contains a constitutive promoter and the wild-type sequence of the full shuT 5' UTR, followed by the reporter gene gfp; while plasmid pD-UTR has the mutated 5' UTR of shuT inserted between the constitutive promoter and the gfp reporter gene. C) Western blot analysis detecting the relative amount of Gfp in wild-type S. dysenteriae carrying the indicated reporter plasmid and grown under the indicated conditions. Histograms indicate the relative intensity of Gfp specific bands. D) Quantitative Real-time PCR analyzing the relative amounts of gfp transcript present in wild-type S. dysenteriae carrying the indicated reporter plasmid and grown under the indicated conditions. Using the ΔΔCt method, the relative amount of gfp is normalized to the level of rrsA present in each sample and is expressed relative to the level measured in the first pD-UTR samples. In all analyses presented, the indicated bacterial strain was cultured to mid-logarithmic phase in LB broth containing 150µM 2.2'-bipyridine. Protein and RNA samples were prepared from the same set of cultures to ensure relevant comparisons. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation and "*" indicates a statistically significance difference with the p-value falls between 0.01 and 0.05.

112

3.4.4 Double-stranded structure containing the shuT ribosomal binding site gradually

opens when environmental temperature increases

A feature that defines an RNA thermometer is a temperature-responsive alteration in structure that results in increased access of the ribosomal binding site at permissive temperatures. To determine how the secondary structure of the shuT RNA thermometer responds to temperature change, enzymatic probing of the in vitro transcribed shuT RNA thermometer was performed at experimentally validated permissive (37°C) and non- permissive (25°C) temperatures using RNase T1, an RNase that specifically digests 3' of each single-stranded guanine (Figure 22 A&B). In order to account for the potential difference of enzyme activity at different temperatures, the intensity of each detected band resulted from digestion at each native guanine is normalized by that of the band resulting from digestion at G27, a site that is predicted and confirmed by this experiment to be single-stranded at each temperature tested (Figure 22 A&B). Completion of the structure probing analyses revealed that as the temperature increased from 25°C to 37°C, the band intensity associated with G32 and G34 increased significantly, indicating increased sensitivity of these residues to RNase T1 (Figure 22 C). These results indicate that the double stranded structure containing the ribosomal binding site of shuT gradually opens when the environmental temperature increases. Moreover, the relative intensity of the band resulting from digestion at G32 has a higher fold change (about 2.1 fold) when the temperature increases than that associated with digestion at G34 (about 1.8 fold), data suggesting that the dissociation of base pairs initiates from the loop region and proceeds down the length of the hairpin stem. Aside from those associated with digestion at 113 position 32 and 34, none of the detected bands resulting from digestion at other native guanine residues demonstrated a significant change in intensity at the temperatures tested, data suggesting that these regions of the structure are less sensitive to alterations in environmental temperature (Figure 22 C). Together these data demonstrate that the region of the shuT RNA thermometer structure containing G32 and G34 is most sensitive to alterations in environmental temperature, a sensitivity that would preferentially expose the SD sequences at permissive temperatures.

114

Figure 22. The inhibitory hairpin within the shuT RNA thermometer gradually opens as environmental temperature increases. In vitro transcribed RNA molecules were radio- labeled at the 5' end, and then partially digested by RNase T1, which specifically cut immediately 3' to single-stranded guanines. A) Schematic of the shuT RNA thermometer with the Shine-Dalgarno (SD) sequence highlighted with a line, the start codon in bold text and sequence from the engineered NheI site bracketed. All potential RNase T1 cutting sites are indicated with arrows. B) Representative gel showing the radio-labeled bands generated by digestion of the in vitro transcribed shuT RNA molecules. Control lanes: lane C contains RNA samples prior to the enzymatic or alkaline digestion, showing the background digestion of the experiment processes, lane L contains the sequencing ladder, and lane T1 contains the bands generated by RNase T1 digestion of the denatured template. Experimental lanes: lanes labeled 25°C and 37°C contain the bands resulting from digestion of the shuT RNA thermometer at the indicated temperature with RNase T1 at a 5-fold dilution. C) As a means to increase the sensitivity of the assay, it was repeated using a lesser concentration of RNase (10-fold diluted) and the results quantified. Relative intensities of each band were normalized to that of the G27-associated band in the same lane. G27 is predicted to be single stranded and thus subject to equal digestion at each temperature tested. All statistics were generated from three independent repeats. Error bars indicate one standard deviation. Statistical significance (p-value ≤ 0.05) is indicated by stars, with “**” represents 0.001 < p-value ≤ 0.01.

3.4.5 Heme utilization in S. dysenteriae is regulated by environmental temperature

As a means to determine if the observed regulation translates into a physiologically relevant phenotype, a series of growth analyses were completed. 115

Specifically, it was investigated whether temperature-dependent regulation of shu genes translates into an impact on the ability of the pathogen to utilize heme as a sole source of iron at various temperatures. Wild-type Shigella dysenteriae was cultured to stationary phase under the indicated conditions and the OD600 value was measured as an indication of the cell growth status. LB broth alone was used as the iron-rich (+Fe) condition, and the low-iron (-Fe) conditions was generated by the addition of 2,2'-bipyridine to the LB broth (-Fe) (Figure 23). Heme was added to the iron-poor (-Fe) media, generating a growth environment in which heme represents the major source of nutritional iron. When cultured at 37°C, the addition of heme to the iron-poor media restores the growth of wild- type S. dysenteriae to that observe in the iron-rich media. When cultured at 25°C, however, the addition of heme to the iron-poor growth environment does not return growth of wild-type S. dysenteriae to the level observed for this strain when cultured in an iron-rich environment. These data demonstrate that the ability of S. dysenteriae to utilize heme as a sole source of nutritional iron is influenced by temperature, with decreased efficiency observed during growth of the pathogen at reduced temperatures.

116

Figure 23. Heme utilization in S. dysenteriae is more efficient at higher environmental temperature. Wild-type S. dysenteriae cells were grown to stationary phase under indicated conditions, and the optical density (OD600) was measured as an indication of growth. Values were normalized to that of cells cultured in LB broth (+Fe) at each temperature (37°C or 25°C). Iron-rich (+Fe) indicates growth of the strain in LB broth while iron-poor (-Fe) indicates growth in LB broth supplemented with 225 μM 2,2'- bipyridine. To measure growth in the presence of heme as the major source of iron (Heme) 100 (µg ml-1) heme was added to iron-poor media. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation. Statistically significance (p-value ≤ 0.05) is indicated by stars: “*” represents 0.01 < p-value ≤ 0.05, “**” indicates 0.001 < p-value ≤ 0.01, “***” means 0.0001 < p-value ≤ 0.001, and “****” stands for p-value ≤ 0.0001.

3.5 Discussion

The shuT RNA thermometer is the second RNA thermometer identified within the

S. dysenteriae shu locus; the first being that housed within the 5' UTR of shuA (Kouse et al., 2013). Though these two RNA thermometers are located in the same gene locus and regulate components of the same transportation system, they are distinct from each other in at least two aspects; aspects that result in them being classified within different families of RNA thermometers. Firstly, the shuT 5' UTR contains only 42 nucleotides and forms a single hairpin, which is the RNA thermometer. As a comparison, shuA 5' UTR is 117 approximately 300-nucleotide in length and is predicted to contain eight hairpins, the 3'- most having been identified as the functional RNA thermometer (Kouse et al., 2013). The role of the remaining nucleic acid sequences and/or structures within the shuA 5' UTR in controlling expression of the gene in response to temperature or other signals remains unknown. Secondly, a comparison of shuT and shuA reveals differences in the nucleic acid sequences of both the SD and anti-SD regions of each. Significantly, unlike the shuT

RNA thermometer, the shuA RNA thermometer contains four uracils that base pair with sequences contained within the SD region to form the inhibitory structure of the element, a feature that results in its classification as a member of the FourU class of RNA thermometers (Kouse et al., 2013).

While the shuT RNA thermometer is distinct from the shuA RNA thermometer, it does share at least four similarities with the RNA thermometer shown to regulate expression of a small heat shock protein, Hsp17, in cyanobacteria Synechocystis

(Kortmann et al., 2011). The features conserved between the shuT and hsp17 RNA thermometers include: 1) a single stem-loop structure formed by sequences constituting the entire 5' UTR; 2) complete pairing between sequences of the SD site and anti-SD site;

3) the presence of both an asymmetric internal loop and a large terminal loop within the inhibitory structure; and 4) the vast majority of the of the inhibitory structure being composed of relatively weak A-U or G-U pairs, with only two G-C pairs predicted. These features in the hsp17 RNA thermometer, particularly the presence of an asymmetry internal loop and the low number of G-C pairs ensure the thermo-sensing property of the hairpin by making it increasingly responsive to alterations in environmental temperature, 118 a functional feature likely conserved in the shuT thermometer (Wagner et al., 2015).

Given the conservation of key features, shuT represents a second member of a now formed hsp17-like family of RNA thermometers. The identification and characterization of additional members of this newly formed family of RNA thermometers will advance the foundational understanding of not only how these elements function, but of what cellular processes they control. Such knowledge is essential to improving the ability to first identify RNA thermometers, and second manipulate their activity for research and industrial applications. 119

CHAPTER 4: OTHER RNA THERMOMETERS IN S. DYSENTERIAE

4.1 Abstract

To survive and successfully colonize in the host, bacterial pathogens regulate the expression of multiple virulence factors in response to the changes of environmental cues that alter upon transition of the pathogen from non-host to human host environments. It is well established that expression of multiple virulence genes in a variety of different bacterial species is regulated in response to changes in environmental temperature. One mechanism by which bacterial gene expression is regulated in response to temperature is via the activity of RNA thermometers, a cis-acting regulatory RNA elements that confers post-transcriptional regulation on the transcript in which they are housed. In this study, two putative RNA thermometers from Shigella dysenteriae were tested, each located within a virulence-associated gene; mxiG, a gene encoding a component of the type III secretion system inner membrane ring and shuX, a gene encoding a putative protein involved in the heme uptake system.

4.2 Introduction

As they transit from the non-host to the human host environment, pathogenic bacteria face several challenges including killing effects of host immune system, limitation of essential nutrients, and a series of alternations in environmental conditions.

To survive these challenges and successfully establish an infection, bacterial pathogens must express multiple virulence factors such as nutrient acquisition systems, toxins, 120 specialized secretion systems and multiple effector proteins that alter the host cell cellular processes in the favor of the pathogens (Schroeder and Hilbi, 2008).

For many Gram-negative pathogenic bacteria, the presence of a functional Type

Three Secretion System (T3SS) allows the bacterium to directly inject effector proteins into the host cell by a needle like transportation system (Portaliou et al., 2016). T3SSs is involved in pathogenic processes including, but not limited to, the induction of macrophage apoptosis, invasion into host cells, and intracellular survival (Schroeder and

Hilbi, 2008). Generally, one type of T3SS is responsible for the secretion of a series of effector proteins. For example, in Salmonella, the effector proteins secreted by the T3SS encoded in the region of Salmonella pathogenic island-1 (SPI-1) are largely involved in epithelial cell invasion (Galan, 2001), while the T3SS encoded in the region of SPI-2 is responsible for secretion of effector proteins involved in intracellular survival and proliferation (Kuhle and Hensel, 2004). In Shigella, more than 20 effector proteins are secreted by a single T3SS encoded on the virulence plasmid that participate in eukaryotic cell invasions, intracellular survival, and cell to cell spreading (Killackey et al., 2016).

The Shigella T3SS is encoded by genes within the mxi-spa operon located in the entry-region of the virulence plasmid (Buchrieser et al., 2000). Proteins that assemble the

T3SS can be categorized into three groups: 1) extracellular components, such as the needle filaments (MxiH and IpaD), and the translocators (IpaB and IpaC) that function to form the pore in host cell membranes, 2) the basal body, which includes the outer membrane ring (MxiD), the inner membrane ring (MxiG and MxiJ), and the export apparatus (MxiA and four Spa proteins) that function in the assembly of the membrane 121 ring components; and finally 3) cytoplasmic components like the cytoplasmic ring

(Spa33), ATPase (Spa47), and chaperons (Ipg proteins) that function to keep the effector proteins unfolded in the cytoplasm before transportation (Portaliou et al., 2016).

Production of T3SS is an energy consuming process. In addition, secretion of the effector proteins to the extracellular area instead of directly into the cytoplasm of eukaryotic cell would put the pathogen at the risk of triggering host immune defense.

Thus the production of T3SS have to be tightly regulated. Such specific expression is achieved by regulating the production of components of the T3SS in response to several host-associated environmental factors, including pH, oxygen levels, and environmental temperature (Falconi et al., 1998; Schroeder and Hilbi, 2008). Compared to the non-host environment, the temperature inside human host is generally higher and more constant.

Thus, in many pathogenic bacteria, production of virulence factors is triggered by an increase of temperature, as it indicates successful invasion into the human body.

Specifically, regulation of genes encoding components of the Shigella T3SS by environmental temperature is indirectly mediated by a transcriptional activator VirF. It is suggested that temperature regulates the transcription of VirF via the DNA binding protein H-NS (Prosseda et al., 2004; Falconi et al., 1998). VirF activates the production of another transcriptional activator, VirB, which directly activates transcription of the mxi-spa operon (Tobe et al., 1991).

Besides transcriptional regulation via the VirF/VirB pathway, not much is known about the post-transcriptional regulation of individual genes within the mxi-spa operon.

This study provides the first evidence of direct temperature-dependent regulation of a 122 gene located within the polycistronic transcript generated from the mxi-spa operon.

Specifically, an novel type of RNA thermometer mediates post-transcriptional regulation of mxiG, the fourth gene transcribed within the mxi-spa operon, a gene encoding a protein component of the T3SS inner membrane ring (Barison et al., 2012).

4.3 Methods and materials

4.3.1 Strains and culture conditions

All bacterial strains and plasmids used in this research are shown in Table 6.

Dickenson and Company, Sparks, MD) containing 0.01% (wt vol-1) Congo red dye (ISC

Chloramphenicol was used at a final concentration of 30 (µg ml-1), for the growth of bacterial strains carrying plasmids.

123

Table 6

Summary of bacterial strains and plasmid vectors Destination Description Reference/ source Strains Escherichia coli DH5α Life Technologies Shigella dysenteriae (Murphy and O-4576S1 (aka ND100) Wild-type S. dysenteriae. Payne, 2007) Plasmids Low-copy plasmid containing a PLtetO-1 constitutive promoter and a (Urban and Vogel, pXG10 report gene gfp, which lacks the start 2007) codon. Cmr Reporter plasmid that has the putative mxiG RNA thermometer inserted pG-gfp between a constitutive promoter and this study reporter gene gfp of plasmid pXG10. Cmr Reporter plasmid that has the stabilizing mutated mxiG RNA pS-gfp thermometer inserted between a this study constitutive promoter and reporter gfp of plasmid pXG10. Cmr Reporter plasmid that has the 3' hairpin of the putatitive mxiG RNA p3G-gfp thermometer inserted between a this study constitutive promoter and reporter gene gfp of plasmid pXG10. Cmr Reporter plasmid that has the putative shuX RNA thermometer inserted pX-gfp between a constitutive promoter and this study reporter gene gfp of plasmid pXG10. Cmr Cmr: the plasmid contains Chloramphenicol resistant gene. Ampr: the plasmid contains Ampicillin resistant gene.

124

4.3.2 Oligonucleotide primers

Table 7

Summary of oligonucleotide primers Primer Sequence Function TTATCTATAAACGCTATTTGCGGATAGCAGC mxiG-F AGAGAGCAAGCAGAATAATCGAAGGATATA AGAGGATTTATGG Constructing CTAGCCATAAATCCTCTTATATCCTTCGATT plasmid pG-gfp mxiG-R ATTCTGCTTGCTCTCTGCTGCTATCCGCAAAT AGCGTTTATAGATAATGCA TTATCTATAAACGCTATTTGCGGATAGCAGC mxiG-S-F AGAGAGCAAGCAGAATCCTCGAAGGATATA AGAGGATTTATGG Constructing CTAGCCATAAATCCTCTTATATCCTTCGAGG plasmid pS-gfp mxiG-S-R ATTCTGCTTGCTCTCTGCTGCTATCCGCAAAT AGCGTTTATAGATAATGCA TAGAATAATCGAAGGATATAAGAGGATTTA mxiG-3-F TGG Constructing CTAGCCATAAATCCTCTTATATCCTTCGATT plasmid p3G-gfp mxiG-3-R ATTCTATGCA shuX-T-F TAACAGGAGTGATTTATGAGCCATG Constructing CTAGCATGGCTCATAAATCACTCCTGTTATG shuX-T-R plasmid pX-gfp CA pXG10-for CTCTTACGTGCCGATCAACG Primers used for pXG10-rev2 AGGTAGTTTTCCAGTAGTGC colony screening Primers target S. rrsAforRT AACGTCAATGAGCAAAGGTATTAAC dysenteriea house-keeping rrsArevRT TACGGGAGGCAGCAGTGG gene in qRT- PCR assay Primers target GfpforRT CCGTTCAACTAGCAGACCATTATC report gene gfp in qRT-PCR GfprevRT CTCATCCATGCCATGTGTAATCC assay 125

4.3.3 Reporter plasmid construction

pG-gfp, pS-gfp, p3G-gfp, and pX-gfp: Complementary oligonucleotide primers containing the indicated nucleic acid sequences (Table 7) were combined and annealed in

STE buffer (0.1M NaCl, 10mM Tris-HCl, 1mM EDTA, pH 8.0) by boiling in a water- bath for 10 minutes followed by slow cooling to room temperature. The generated double-stranded DNA products were then ligated into plasmid pXG10 (Urban and Vogel,

2007) that had been digested with restriction enzymes NsiI (New England Biolabs Inc.) and NheI (New England Biolabs Inc.). Such cloning placed the DNA fragment encoding the putative RNA thermometer being investigated between the PLtetO-1 constitutive promoter and the reporter gfp gene of pXG-10.

4.3.4 RNA extraction and DNA removal

-1 bacterial cells were re-suspended in 357.3µl DEPC treated ddH2O, 40µl 10% (wt vol ) sodium dodecyl sulfate (SDS), and 2.67µl 3M sodium acetate (pH 5.2) by vortexing for

15 seconds. Lysis of the bacterial cells was achieved by incubating each resuspended sample at 90˚C for 7 minutes. After lysis, 1ml of Trizol reagent (Ambion) was added to 126 each sample, the sample transferred to a 2ml phase-lock gel tube (5 PRIME Inc.,

Gaitherburg, MD) and the reaction incubated at room temperature (~25˚C) for 5 minutes.

Alcohol Mode. Finally, each RNA pellet was resuspended in 53μl of nuclease free water.

Following DNA removal from each RNA sample using TURBO DNA-free kit

(NanoDrop Technologies, Wilmington, DE).

127

4.3.5 Western blot analysis

All western blot analyses were completed using whole cell extracts. Specifically,

Laemmli protein dye (Bio-Rad) containing 5% β-mercaptoethanol. Samples were boiled for 10 minutes and then stored at -20˚C until use.

Billerica, MA) was added to the membrane, the reaction incubated at room temperature 128 for approximately 3 minutes and the membrane imaged using the Molecular Imager

4.3.6 Quantitative Real-time PCR analysis

For samples to be analyzed by both Western blot and quantitative Real-time PCR

(qRT-PCR), total RNAs was harvested from the same culture used to generate the corresponding whole cell protein preparations using the procedures detailed above. After the isolation of total RNA and subsequent DNA removal as detailed above, the iScript cDNA Synthesis Kit (Bio-Rad) was used to generate a cDNA library as directed. Each cDNA sample was diluted 1:10 in double distilled water. 5µl of diluted cDNA sample was mixed with 10µl of iTaq Universal SYBR Green Supermix (Bio-Rad) and 5µl of each primer set at an optimum concentration, making an amplification reaction mixture with a total volume of 20µl. All amplification reactions were performed in a CFX96

Real-Time System (Bio-Rad) under reaction conditions optimized for each primer set.

For each target gene, a six-point standard curve was generated to ensure that acceptable amplification efficiency was achieved and that all experimental samples amplify within the linear portion of the standard curve. Using the ΔΔCt calculation method the expression level of each target gene was normalized to that of a house keeping gene, rrsA, present in each sample and expressed relative to that within a selected control 129 sample. All primers used in qRT-PCR were designed using Beacon Designer 7.5 and are detailed in Table 7.

4.3.7 In silico analyses

RNA structure prediction: The secondary structure of mxiG RNA thermometer and its stabilizing energy under various temperatures were predicted using Mfold

(http://unafold.rna.albany.edu/?q=mfold/RNA-Folding-Form2.3) (Zuker, 2003).

4.3.8 Statistical analysis

4.4 Results

4.4.1 The ribosomal binding site of mxiG is predicted to be included in a hairpin

resembling that of an RNA thermometer

Generally, RNA thermometers have two important structural features enabling them to regulate translation of the target gene in response to alternations of environmental temperature: 1) incorporating the Shine-Dalgarno (SD) sequence, i.e. the ribosomal binding site, within an inhibitory hairpin by base pairing; and 2) the stability of 130 the inhibitory hairpin changes under different environmental temperatures, permitting exposure of the SD sequence and binding by ribosome at permissive temperatures. Based on the above two features, the Mfold predicted secondary structures of the transcripts of virulence-associated genes in Shigella dysenteriae were screened by in silico analysis for putative RNA thermometers. In this way, expression of gene mxiG, encoding an essential component of the inner membrane ring of the T3SS, was predicted to be controlled by an

RNA thermometer formed by sequences upstream of the open reading frame. As shown in Figure 24A, the putative mxiG RNA thermometer is 72-nucleotide in length. In silico analyses (Mfold) indicate two hairpins exist in this putative RNA thermometer, with the

3' hairpin sequestering the mixG ribosomal binding site. The predicted stabilizing energy of the putative inhibitory structure increases from -17.38 (kcal mole-1) to -12.90 (kcal mole-1) when the environmental temperature increases from 25°C to 37°C. These features suggest that the identified 72-nucleotide-long sequence could function as an RNA thermometer to mediate temperature-responsive translational onto the expression of mxiG.

131

Figure 24. The ribosomal binding site of mxiG is incorporated within a functional putative RNA thermometer. A) A schematic of the secondary structure formed by the nucleic acid sequence of the putative S. dysenteriae mxiG RNA thermometer as predicted by Mfold analysis. Sequences composing the ribosomal binding site (“SD”) are highlighted with a grey box and the translational start codon is indicated by a bold line. B) Plasmid pG-gfp contains a constitutive promoter and the wild-type sequence of the full mxiG RNA thermometer, followed by the reporter gene gfp. C) Quantitative Real-time PCR analyzing the relative amounts of gfp transcript present in wild-type S. dysenteriae carrying pG-gfp and grown under the indicated conditions. Using the ΔΔCt method, the relative amount of gfp is normalized to the level of rrsA present in each sample and is expressed relative to the level measured in the first 37°C sample. D) Western blot analysis detecting the relative amount of Gfp in wild-type S. dysenteriae carrying pG-gfp and grown under the indicated conditions. Histograms indicate the relative intensity of Gfp specific bands. Protein and RNA samples were prepared from the same set of cultures to ensure relevant comparisons. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation and "**" indicates a statistically significance difference with p-value falls between 0.01 and 0.05.

To directly test whether the predicted mxiG RNA thermometer confers temperature-dependent regulation, a reporter plasmid pG-gfp was constructed. To construct pG-gfp, the 72-nucleotide putative mxiG RNA thermometer was inserted between the constitutive promoter and reporter gene gfp of plasmid pXG10 (Figure 24B).

Quantitative Real-time PCR (qRT-PCR) and Western blot assays were conducted respectively to measure the production of gfp transcripts and Gfp protein levels, 132 respectively, in wild-type S. dysenteriae carrying pG-gfp cultured to the mid-logarithmic phase of growth at either 25°C or 37°C. While gfp transcript levels display no significant difference following growth of the strain at either tested temperature (Figure 24C), Gfp protein levels were significantly higher in the bacteria following grown at 37°C as compared to those measured following grown at 25°C (Figure 24D). These results indicate that the inserted 72-nucleotide sequence from S. dysenteriae is able to conferring post-transcriptional temperature-dependent regulation, a finding that is consistent with this sequencing housing a functional RNA thermometer.

4.4.2 Stabilizing the inhibitory structure within the putative mxiG RNA thermometer

abolishes translation of the reporter gene

The stability of its secondary structure, rather than the primary nucleotide sequence is most important for the regulatory function of an RNA thermometer

(Kortmann and Narberhaus, 2012). Mutations that stabilize the hairpin containing the SD sequence within a given RNA thermometer would diminish or even abolish expression of the target gene at previously permissive temperatures. To test whether the 72-nucleotides of S. dysenteriae sequence cloned within pG-gfp truly functions as an RNA thermometer, site-specific stabilizing mutations were introduced. Two adenines at positions +47 and

+48 (the 5' end nucleotide of the cloned S. dysenteriae sequence is +1) were both mutated to cytosines (Figure 25A), mutations that are predicted to stabilize the inhibitory hairpin by introducing two G-C pairs. As was done with the wild-type reporter pG-gfp, plasmid pS-gfp was constructed by inserting the mutated sequence between the constitutive 133 promoter and reporter gfp of plasmid pXG10 (Figure 25B). Wild-type S. dysenteriae carrying either pG-gfp or pS-gfp were grown to mid-logarithmic phase at 37°C, the temperature at which production of Gfp was previously observed with the wild-type reporter. Western blot and qRT-PCR analyses were conducted to measure the levels of

Gfp protein and gfp transcript, respectively. According to the results, when cultured at the permissive temperature of 37°C S. dysenteriae carrying pG-gfp produces Gfp while the production of Gfp by S. dysenteriae carrying pS-mxiG is hardly detectable (Figure 25D); gfp transcript levels demonstrate no significant difference between these two strains

(Figure 25C). Thus, as expected, introducing stabilizing mutations results in the repression of target gene expression at a previously permissive temperature, confirming that the cloned 72-nucleotide sequence functions as an RNA thermometer.

134

Figure 25. Stabilizing mutations abolishes expression of the reporter gene at previous permissive temperature. A) A schematic of the secondary structure formed by the nucleic acid sequence of the putative S. dysenteriae mxiG RNA thermometer as predicted by Mfold analysis. Sequences composing the ribosomal binding site (“SD”) are highlighted by a grey box and the translational start codon is indicated by a bold line. Arrows indicate the bases that were changed by site-directed mutagenesis to generate the destabilized version of the element (A47 and A48 were both changed to C). B) Plasmid pG-gfp contains a constitutive promoter and the wild-type sequence of the full mxiG RNA thermometer, followed by the reporter gene gfp; while plasmid pS-mxiG has the mutated sequence of mxiG RNA thermometer inserted between the constitutive promoter and the gfp reporter gene. C) Quantitative Real-time PCR analyzing the relative amounts of gfp transcript present in wild-type S. dysenteriae carrying the indicated reporter plasmid and grown under the indicated conditions. Using the ΔΔCt method, the relative amount of gfp is normalized to the level of rrsA present in each sample and is expressed relative to the level measured in the first pG-gfp sample. D) Western blot analysis detecting the relative amount of Gfp in wild-type S. dysenteriae carrying the indicated reporter plasmid and grown under the indicated conditions. Protein and RNA samples were generated from the same set of cultures to ensure relevant comparisons. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation, "*" indicates a statistically significance difference (p-value ≤ 0.05), and “n.s.” indicates statistically non-significant (p-value > 0.05).

4.4.3 The 5' hairpin of mxiG RNA thermometer is required to confer temperature-

dependent regulation

Based on the predicted secondary structure, mxiG RNA thermometer contains two hairpins in which the mxiG ribosomal binding site is incorporated within the 3' hairpin, 135 functioning as the inhibitory hairpin that would be predicted to be responsible for the observed temperature-dependent regulation (Figure 24A). To test whether the 3' hairpin alone is enough to mediate regulation an additional reporter plasmid (p3G-gfp) was constructed. Plasmid p3G-gfp contains the 31-nucleotide sequence that forms the 3' hairpin of mxiG RNA thermometer cloned between the constitutive plasmid promoter and the reporter gfp gene (Figure 26A&B). Wild-type S. dysenteriae containing p3G-gfp were cultured to the mid-logarithmic phase of growth at either 25°C or 37°C, and subjected to

Western blot and qRT-PCR analyses as described previously. Interestingly, the production levels of both the gfp transcripts and Gfp proteins were equivalent in the strain grown under each temperature tested (Figure 26C&D). These data indicate that the 3' hairpin of mxiG RNA thermometer alone is not sufficient to confer post-transcriptional temperature-dependent regulation; and thus the 5' hairpin is also required to mediate this regulation.

136

Figure 26. The 5' hairpin of mxiG RNA thermometer is required to confer temperature- dependent regulation. A) schematic of the secondary structure formed by the nucleic acid sequence of the 3' hairpin of S. dysenteriae mxiG RNA thermometer as predicted by Mfold analysis. Sequences composing the ribosomal binding site (“SD”) are highlighted by a grey box and the translational start codon is indicated by a bolded line. B) Plasmid p3G-gfp contains a constitutive promoter and the sequence of the 3' hairpin of mxiG RNA thermometer, followed by the reporter gene gfp. C) Quantitative Real-time PCR analyzing the relative amounts of gfp transcript present in wild-type S. dysenteriae carrying the plasmid p3G-gfp and grown under the indicated conditions. Using the ΔΔCt method, the relative amount of gfp is normalized to the level of rrsA present in each sample and is expressed relative to the level measured in the first 37°C sample. D) Western blot analysis detecting the relative amount of Gfp in wild-type S. dysenteriae carrying p3G-gfp and grown under the indicated conditions. Histograms indicate the relative intensity of Gfp specific bands. Protein and RNA samples were generated from the same set of cultures to ensure relevant comparisons. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation and "*" indicates a statistically significance difference (p-value ≤ 0.05).

4.4.4 In silico analysis identified an RNA thermometer-like structure incorporating the

ribosomal binding site and start codon of gene shuX

In addition to mxiG, shuX, a gene involved in S. dysenteriae heme uptake system, is also predicted to house an RNA thermometer. The function of ShuX protein remains uncharacterized; however, the orthologous protein in E. coli, ChuX, was identified to be a cytoplasmic heme binding protein involved in maintaining intracellular iron homeostasis 137

(Suits et al., 2009). shuX is the third gene transcribed within a large polycistronic transcript (shuTWXY). The start codon of shuX is just 12 nucleotides away from the stop codon of the preceding gene, shuW. However, shuW contains a pre-matured stop codon, making it likely that the remaining codons of shuW are not transcribed. According to in silico analyses of the structure within shuTWXY transcript, the ribosomal binding site and start codon of shuX are predicted to be sequestered within a 23-nucleotide hairpin-like structure (Figure 27A).

Figure 27. Sequences including shuX ribosomal binding site and translational start codon forms a RNA thermometer-like structure. A) A schematic of the secondary structure formed by the nucleic acid sequence of the putative S. dysenteriae shuX RNA thermometer as predicted by Mfold analysis. Sequences composing the ribosomal binding site (“SD”) are highlighted by a grey box and the translational start codon is indicated by a bolded line. B) Plasmid pX-gfp contains a constitutive promoter and the wild-type sequence of the putative shuX RNA thermometer, followed by the reporter gene gfp. C) Quantitative Real-time PCR analyzing the relative amounts of gfp transcript present in wild-type S. dysenteriae carrying plasmid pX-gfp and grown under the indicated conditions. Using the ΔΔCt method, the relative amount of gfp is normalized to the level of rrsA present in each sample and is expressed relative to the level measured in the first 37°C sample. All analyses were carried out in biological triplicate. Error bars indicate one standard deviation and "*" indicates a statistically significance difference (p-value ≤ 0.05).

138

To test whether the 23-nucleotide hairpin predicted in the upstream region of shuX functions as an RNA thermometer, reporter plasmid pX-gfp was constructed as detailed above for pG-gfp (Figure 27B). Following growth of S. dysenteriae carrying pX- gfp to the mid-logarithmic phase at either 25°C or 37°C, Western blot and qRT-PCR analyses were performed to measuring the relative abundance of Gfp protein and gfp transcript respectively. While gfp transcript levels were detected and demonstrated no significant differences between cells cultured at either temperature (Figure 27C), no Gfp proteins was detected in the strain under any conditions tested (data not shown). These data suggest that the cloned S. dysenteriae sequence is not permitting translation regardless of temperatures, an unexpected finding and one that prevents any conclusion regarding the putative shuX RNA thermometer from being drawn at this time.

4.5 Discussion

The presented data tested the regulatory functions of two putative intergenic RNA thermometers identified in S. dysenteriae, each predicted to control the expression of a virulence-associated gene; mxiG and shuX. While the presented results demonstrate that a functional RNA thermometer mediates post-transcriptional temperature-dependent regulation of mxiG, a definitive conclusion cannot yet be drawn about the putative RNA thermometer located upstream of shuX.

With the identification of mxiG RNA thermometer, this study provides the first evidence of direct post-transcriptional regulation of expressing component of T3SS in response to environmental temperature. Previously, production of MxiG, a protein 139 forming T3SS inner membrane ring, has been identified to be regulated at transcriptional level indirectly by temperature. Such regulation is mediated by H-NS, a DNA-binding protein that regulates expression of a transcriptional activator, VirF (Falconi et al., 1998).

When present, VirF activates the production of another transcriptional regulator VirB, which directly activates transcription of the mxi-spa operon (Tobe et al., 1993, 1991).

Gene regulation in response to a single environmental factor at multiple expression levels is beneficial to pathogenic bacteria by ensuring a more efficient response to the change of environmental cues. In addition, as an intergenic regulatory element, mxiG RNA thermometer permits different translational efficiencies and independent regulations of genes transcribed in the same transcript.

As the fourth gene been transcribed in the mxi-spa operon, the mxiG open reading frame starts just 8-nucleotide downstream of the stop codon of the proceeding gene, ipgF, encoding a periplasmic pepetidoglycanase (Figure 24A) (Allaoui et al., 1993; Zahrl et al.,

2005). This fact makes mxiG RNA thermometer the fourth intergenic RNA thermometer that has been identified. The other three intergenic RNA thermometers have been shown to regulate the expression of lcrF (virF) from Yersinia species, hspY from Pseudomonas putida, and ibpB from E.coli (Waldminghaus et al., 2005; Böhme et al., 2012; Krajewski et al., 2014; Gaubig et al., 2011) (Table 8). Besides lcrF, which encodes a transcriptional activator for virulence genes, the other two genes are both involved in heat-shock response. Moreover, though ibpB RNA thermometer is located within an intergenic region, it is suggested that this RNA thermometer is only functional when the upstream gene ibpA has been cleaved off (Gaubig et al., 2011). Comparing to all these three 140 previously identified intergenic RNA thermometers, mxiG RNA thermometer is similar to that of hspY in that the intergenic region only makes about half of the inhibitory hairpin, with the majority of the sequence comes from the coding region of the upstream gene. However, whether these two RNA thermometers could be characterized into a new family of RNA thermometers needs further researches.

Table 8

Summary of the identified intergenic RNA thermometers Length in Hairpin Gene Function of the gene Reference nucleotides* numbers (Waldminghaus Small heat shock et al., 2005; ibpBa 112 4 protein Gaubig et al., 2011) Putative small heat (Krajewski et hspY 100 (27) 2 shock protein al., 2014) Transcriptional (Böhme et al., LcrF/virF activator of multiple 124 2 2012) virulence genes Component of T3SS mxiG 72 (8) 2 This study inner membrane ring aThough this RNA thermometer is located in the intergenic region, it is thought to be functional only when the unstream gene has been cleaved off. *No parenthesis indicates that the intergenic region makes the complete RNA thermometer; otherwise, the length of the intergenic region was shown within the parentheses.

Previously, non-inhibitory hairpins of RNA thermometers have been shown to facilitate in destabilizing the 3' inhibitory hairpin, making it more sensitive to changes of environmental temperature (Chowdhury et al., 2003). However, the presented research results suggest that the non-inhibitory hairpin of mxiG RNA thermometer is actually involved in mediating translational inhibition. Though different from previous 141 identification, this result is not surprising based on the structural features of the 3' hairpin of mxiG RNA thermometer. Having an internal loop within the stem of the 3' hairpin, and only containing one G-C pair out of total six base pairs, the 3' hairpin of mxiG RNA thermometer is quite unstable (Figure 26). Thus it is proposed that the presence of the 5' hairpin of mxiG RNA thermometer stabilizes the 3' hairpin, possibly through tertiary interactions between the hairpins. Another possibility for the requirement of the predicted

5' hairpin in mediating temperature-sensing is that mxiG RNA thermometer could function via switching between two mutually exclusive structures at different temperatures. To test these possibilities, and further reveal the temperature-sensing mechanism of the mxiG RNA thermometer, enzymatic structure probing assay and toe- printing assay will be carried out in future studies.

Another putative RNA thermometer tested in this study is suggested to control the expression of shuX. No detection of Gfp protein at either tested temperatures suggests that the inserted sequence might form a very stable secondary structure, which does not response to changes of environmental temperature and constantly inhibits translation.

Indeed, according to the predicted hairpin structure (Figure 27A), half of the base pairs within the inhibitory hairpin are G-C pairs, functioning as a lock that prevents the opening of the hairpin. To permit translation of the target gene, upstream or downstream secondary structures might be needed to destabilize the inhibitory hairpin of putative shuX RNA thermometer. It should also be noted that three codons including shuX start codon are incorporated within the putative RNA thermometer. This addition of codons in the reporter gfp coding region could result into structural changes of the produced Gfp 142 protein, which renders it undetectable by the antibodies. In that case, toe-printing assay could be applied to directly test the interactions of ribosome with the putative shuX RNA thermometer under different environmental temperature.

In summary, this study is the first report of T3SS component been directly regulated by an RNA thermometer, and also provides the first example of requiring non- inhibitory hairpin in mediating temperature-dependent inhibition. To fully characterize the temperature sensing mechanisms, future researches are needed.

143

CHAPTER 5: DISSCUSION

In this study, the host-associated environmental factors that regulate the production of S. dysenteriae Shu system and T3SS are identified, and the underlying regulatory mechanisms of each regulatory pathway is characterized.

Specifically, data presented in Chapter 2 and 3 demonstrate that nucleic acid sequences harbored within the 5' UTR of S. dysenteriae shuT confer both iron-dependent transcriptional regulation and temperature-dependent post-transcriptional regulation onto expression of the gene by distinct molecular mechanisms. Thus, as is the case of ShuA,

ShuT production is limited to environments that mimic those encountered within the human host (low iron-availability and relatively higher temperature compared to non-host environment), the only environment in which heme will be present as a potential source of nutritional iron (Figure 28) (Kouse et al., 2013; Mills and Payne, 1997). In addition, having multiple host-associated environmental factors involved in regulating multiple components of the heme acquisition system is likely beneficial to the pathogenic bacterium in at least two ways: 1) ensuring efficient response of the bacteria to changes of environmental factors; and 2) saving energy for other cellular processes when bio- available iron sources are relatively abundant and/or when heme is not likely to be encountered. While it is now established that both shuA and shuT are subject to post- transcriptional temperature-dependent regulation, it remains a distinct possibility that the expression of the other shu genes is influenced in response to temperature or another host-associated environmental condition, by as of yet unidentified regulatory mechanism(s) (Kouse et al., 2013). Continuing studies that further elucidate the 144 molecular events underlying the Fur-mediated regulation, as well as reveal novel regulatory mechanisms of the Shu system could contribute to a complete understanding of bacterial pathogenesis and have the potential to inform the development of therapeutic agents to disrupt these key processes, and by doing so limit the morbidity and mortality associated with bacterial infection.

Figure 28. Model of shuT regulation in response to changes of iron-availability and environmental temperature.

Data presented in Chapter 4 provides the first evidence of direct temperature- dependent regulation of S. dysenteriae T3SS via the activity of an RNA thermometer. In addition, it is also suggested that a third temperature-sensing RNA element could possibly exist in the S. dysenteriae shu locus. Each of the RNA thermometers identified 145 in this study harbors a unique secondary structure comparing to previously identified

RNA thermometers (Figure 19, 24, & 27) (Wei and Murphy, 2016b). Such diversity of

RNA thermometer structural features, as well as the wild spread of RNA thermometer regulated biological processes, suggest that RNA thermometer might serves as a fundamental regulatory pathway that wildly dispersed in bacteria genome. A hypotheses that could be verified with the future application of structuromics analysis, a high- throughput sequencing analysis that has been used to identify the structures of every

RNA molecule (RNA structurome) within a single organism (Westhof and Romby, 2010;

Righetti et al., 2016).

Of note, though RNATs vary in key structural features, all currently characterized

RNATs are thought to share the same basic zipper-like temperature-responsive molecular mechanism based on which both experimental and therapeutic applications can be derived. For example, artificial RNATs that have only a single hairpin to perform the temperature-dependent inhibition of translation have now been designed (Neupert et al.,

2008). These artificial RNATs can be used as genetic tools to manipulate target gene expression. In the aspect of applying knowledge of RNATs in developing therapeutics, it is conservable that compounds can be developed that would specifically stabilize the inhibitory structure within a given RNAT, thus decreasing expression of this target gene.

Utilizing such an approach to inhibit the production of an essential gene product or virulence factor could prevent or limit infections by a variety of pathogenic bacteria.

Future applications of RNATs as genetic tools and/or drug targets are dependent on an increased understanding of these ubiquitous regulatory elements. With the 146 maturation and development of experimental techniques, we could identify additional

RNATs and study the molecular mechanisms underlying their regulatory activity in even greater detail. Moreover, due to the fundamental roles of RNA in the biological world, there is a great potential that RNATs also exist in archaea and eukaryotes. Further investigation and characterization of the conserved features and mechanisms of RNATs along with an understanding of the function of their regulatory targets could provide insight into the complex evolution of gene regulation. With the rate at which advances have been made in the field of RNA-mediated regulation, and specifically within the study of RNATs, there is no doubt that these and other important findings will be revealed sooner than later.

147

REFERENCES

Allaoui, A., Ménard, R., Sansonetti, P. J., and Parsot, C. (1993). Characterization of the

Shigella flexneri ipgD and ipgF genes, which are located in the proximal part of the

mxi locus. Infect. Immun. 61, 1707–1714.

Altuvia, S., Kornitzer, D., Teff, D., and Oppenheim, A. B. (1989). Alternative mRNA

structures of the cIII gene of bacteriophage λ determine the rate of its translation

initiation. J. Mol. Biol. 210, 265–280.

Andrews, S. C., Robinson, A. K., and Rodríguez-Quiñones, F. (2003). Bacterial iron

homeostasis. FEMS Microbiol. Rev. 27, 215–237.

Bagg, A., and Neilands, J. B. (1987). Ferric uptake regulation protein acts as a repressor,

employing iron (II) as a cofactor to bind the operator of an iron transport operon in

Escherichia coli. Biochemistry 26, 5471–5477.

Baichoo, N., and Helmann, J. D. (2002). Recognition of DNA by Fur : a reinterpretation

of the Fur Box consensus sequence. J. Bacteriol. 184, 5826–5832.

Balsiger, S., Ragaz, C., Baron, C., and Narberhaus, F. (2004). Replicon-specific

regulation of small heat shock genes in Agrobacterium tumefaciens. J. Bacteriol.

186, 6824–6829.

Bardhan, P., Faruque, A. S. G., Naheed, A., and Sack, D. A. (2010). Decrease in

shigellosis-related deaths without Shigella spp.- specific interventions, Asia. Emerg.

Infect. Dis. 16, 1718–1723.

Barison, N., Lambers, J., Hurwitz, R., and Kolbe, M. (2012). Interaction of MxiG with

the cytosolic complex of the type III secretion system controls Shigella virulence. 148

FASEB J. 26, 1717–1726.

Blaser, M. J., and Newman, L. S. (1982). A review of human salmonellosis: I. Infective

dose. Rev. Infect. Dis. 4, 1096–1106.

Böhme, K., Steinmann, R., Kortmann, J., Seekircher, S., Heroven, A. K., Berger, E.,

Pisano, F., Thiermann, T., Wolf-Watz, H., Narberhaus, F., et al. (2012). Concerted

actions of a thermo-labile regulator and a unique intergenic RNA thermosensor

control Yersinia virulence. PLoS Pathog. 8.

Boulette, M. L., and Payne, S. M. (2007). Anaerobic regulation of Shigella flexneri

virulence: ArcA regulates fur and iron acquisition genes. J. Bacteriol. 189, 6957–

6967.

Braun, V., and Mahren, S. (2005). Transmembrane transcriptional control (surface

signalling) of the Escherichia coli Fec type. FEMS Microbiol. Rev. 29, 673–684.

Buchrieser, C., Glaser, P., Rusniok, C., Nedjari, H., D’Hauteville, H., Kunst, F.,

Sansonetti, P., and Parsot, C. (2000). The virulence plasmid pWR100 and the

repertoire of proteins secreted by the type III secretion apparatus of Shigella

flexneri. Mol. Microbiol. 38, 760–771.

Burkhard, K. A., and Wilks, A. (2007). Characterization of the outer membrane receptor

ShuA from the heme uptake system of Shigella dysenteriae. Substrate specificity

and identification of the heme protein ligands. J. Biol. Chem. 282, 15126–15136.

Burkhard, K. a, and Wilks, A. (2008). Functional characterization of the Shigella

dysenteriae heme ABC transporter. Biochemistry 47, 7977–9.

Calin, A. (1979). The relationship between genetics and environment in the pathogenesis 149

of rheumatic diseases. West. J. Med. 131, 205–218.

Cao, J., Woodhall, M. R., Alvarez, J., Cartron, M. L., and Andrews, S. C. (2007).

EfeUOB (YcdNOB) is a tripartite, acid-induced and CpxAR-regulated, low-pH Fe2+

transporter that is cryptic in Escherichia coli K-12 but functional in E. coli

O157:H7. Mol. Microbiol. 65, 857–875.

Carbonetti, N. H., and Williams, P. H. (1984). A cluster of five genes specifying the

aerobactin iron uptake system of plasmid ColV-K30. Infect. Immun. 46, 7–12.

Carpenter, C., and Payne, S. M. (2014). Regulation of iron transport systems in

Enterobacteriaceae in response to oxygen and iron availability. J. Inorg. Biochem.

133, 110–117.

Carrano, C. J., and Raymond, K. N. (1979). Ferric ion sequestering agents. 2. Kinetics

and mechanism of iron removal from transferrin by enterobactin and synthetic

tricatechols. J. Am. Chem. Soc. 101, 5401–5404.

Cash, R. A., Music, S. I., Libonati, J. P., Snyder, M. J., Wenzel, R. P., and Hornick, R. B.

(1974). Response of man to infection with Vibrio cholerae. I. Clinical, serologic,

and bacteriologic responses to a known inoculum. J. Infect. Dis. 129, 45–52.

Castellanos, M. I., Harrison, D. J., Smith, J. M., Labahn, S. K., Levy, K. M., and Wing,

H. J. (2009). VirB alleviates H-NS repression of the icsP promoter in Shigella

flexneri from sites more than one kilobase upstream of the transcription start site. J.

Bacteriol. 191, 4047–4050.

CDC (2013). Antibiotic resistance threats in the United States, 2013. Current, 114.

Chen, Z., Lewis, K. a., Shultzaberger, R. K., Lyakhov, I. G., Zheng, M., Doan, B., Storz, 150

G., and Schneider, T. D. (2007). Discovery of Fur binding site clusters in

Escherichia coli by information theory models. Nucleic Acids Res. 35, 6762–6777.

Chowdhury, S., Maris, C., Allain, F. H.-T., and Narberhaus, F. (2006). Molecular basis

for temperature sensing by an RNA thermometer. EMBO J. 25, 2487–2497.

Chowdhury, S., Ragaz, C., Kreuger, E., and Narberhaus, F. (2003). Temperature-

controlled Structural Alterations of an RNA Thermometer. J. Biol. Chem. 278,

47915–47921.

Christoffersen, C. A., Brickman, T. J., Hook-Barnard, I., and McIntosh, M. A. (2001).

Regulatory architecture of the iron-regulated fepD-ybdA bidirectional promoter

region in Escherichia coli. J. Bacteriol. 183, 2059–2070.

Cimdins, A., Roßmanith, J., Langklotz, S., Bandow, J. E., and Narberhaus, F. (2013).

Differential control of Salmonella heat shock operons by structured mRNAs. Mol.

Microbiol. 89, 715–731.

Clarke, T. E., Rohrbach, M. R., Tari, L. W., Vogel, H. J., and Koster, W. (2002). Ferric

hydroxamate binding protein FhuD from Escherichia coli: mutants in conserved and

non-conserved regions. Biometals 15, 121–131.

Le Derout, J., Régnier, P., and Hajnsdorf, E. (2002). Both temperature and medium

composition regulate RNase E processing efficiency of the rpsO mRNA coding for

ribosomal protein S15 of Escherichia coli. J. Mol. Biol. 319, 341–349.

DuPont, H. L., Levine, M. M., Hornick, R. B., and Formal, S. B. (1989). Inoculum size in

shigellosis and implications for expected mode of transmission. J. Infect. Dis. 159,

1126–1128. 151

Eakanunkul, S., Lukat-Rodgers, G. S., Sumithran, S., Ghosh, A., Rodgers, K. R.,

Dawson, J. H., and Wilks, A. (2005). Characterization of the periplasmic heme-

binding protein ShuT from the heme uptake system of Shigella dysenteriae.

Biochemistry 44, 13179–13191.

Escolar, L., de Lorenzo, V., and Perez-Martin, J. (1997). Metalloregulation in vitro of the

aerobactin promoter of Escherichia coli by the Fur (ferric uptake regulation) protein.

Mol. Microbiol. 26, 799–808.

Escolar, L., Perez-Martin, J., and de Lorenzo, V. (1998). Coordinated repression in vitro

of the divergent fepA-fes promoters of Escherichia coli by the iron uptake regulation

(Fur) protein. J. Bacteriol. 180, 2579–2582.

Escolar, L., Pérez-Martín, J., and De Lorenzo, V. (2000). Evidence of an unusually long

operator for the Fur repressor in the aerobactin promoter of Escherichia coli. J. Biol.

Chem. 275, 24709–24714.

Everse, J., and Hsia, N. (1997). The toxicities of native and modified hemoglobins. Free

Radic. Biol. Med. 22, 1075–1099.

Falconi, M., Colonna, B., Prosseda, G., Micheli, G., and Gualerzi, C. O. (1998).

Thermoregulation of Shigella and Escherichia coli EIEC pathogenicity. A

temperature-dependent structural transition of DNA modulates accessibility of virF

promoter to transcriptional repressor H-NS. EMBO J. 17, 7033–7043.

Fischbach, M. a, Lin, H., Zhou, L., Yu, Y., Abergel, R. J., Liu, D. R., Raymond, K. N.,

Wanner, B. L., Strong, R. K., Walsh, C. T., et al. (2006). The pathogen-associated

iroA gene cluster mediates bacterial evasion of lipocalin 2. Proc. Natl. Acad. Sci. U. 152

S. A. 103, 16502–16507.

Fisher, C. R., Davies, N. M. L. L., Wyckoff, E. E., Feng, Z., Oaks, E. V, and Payne, S.

M. (2009). Genetics and virulence association of the Shigella flexneri sit iron

transport system. Infect. Immun. 77, 1992–9.

Fleming, T. P., Nahlik, M. S., and McIntosh, M. a (1983). Regulation of enterobactin iron

transport in Escherichia coli: characterization of ent::Mu d(Apr lac) operon fusions.

J. Bacteriol. 156, 1171–7.

Flo, T. H., Smith, K. D., Sato, S., Rodriguez, D. J., Holmes, M. a, Strong, R. K., Akira,

S., and Aderem, a (2004). Lipocalin 2 mediates an innate immune response to

bacterial infection by sequestrating iron. Nature 432, 917–921.

Galan, J. E. (2001). Salmonella interactions with host cells: type III secretion at work.

Annu. Rev. Cell Dev. Biol. 17, 53–86.

Le Gall, T., Mavris, M., Martino, M. C., Bernardini, M. L., Denamur, E., and Parsot, C.

(2005). Analysis of virulence plasmid gene expression defines three classes of

effectors in the type III secretion system of Shigella flexneri. Microbiology 151,

951–962.

Gaubig, L. C., Waldminghaus, T., and Narberhaus, F. (2011). Multiple layers of control

govern expression of the Escherichia coli ibpAB heat-shock operon. Microbiology

157, 66–76.

Ghigo, J. M., Letoffe, S., and Wandersman, C. (1997). A new type of hemophore-

dependent heme acquisition system of Serratia marcescens reconstituted in

Escherichia coli. J. Bacteriol. 179, 3572–3579. 153

Gold, L. (1988). Posttranscriptional regulatory mechanisms in Escherichia coli. Annu.

Rev. Biochem. 57, 199–233.

Gorden, J., and Small, P. L. (1993). Acid resistance in enteric bacteria. Infect Immun 61,

364–367.

Grass, G., Grass, G., Franke, S., Franke, S., Taudte, N., Taudte, N., Nies, D. H., Nies, D.

H., Kucharski, L. M., Kucharski, L. M., et al. (2005). The metal permease ZupT

from Escherichia coli is a transporter with a broad substrate spectrum. J. Bacteriol.

187, 1604–1611.

Große, C., Scherer, J., Koch, D., Otto, M., Taudte, N., and Grass, G. (2006). A new

ferrous iron-uptake transporter, EfeU (YcdN), from Escherichia coli. Mol Microbiol

62, 120–131.

Grosso-Becerra, M. V., Croda-García, G., Merino, E., Servin-González, L., Mojica-

Espinosa, R., and Soberón-Chávez, G. (2014). Regulation of Pseudomonas

aeruginosa virulence factors by two novel RNA thermometers. Proc. Natl. Acad.

Sci. 111, 15562–15567.

Gu, B., Cao, Y., Pan, S., Zhuang, L., Yu, R., Peng, Z., Qian, H., Wei, Y., Zhao, L., Liu,

G., et al. (2012). Comparison of the prevalence and changing resistance to nalidixic

acid and ciprofloxacin of Shigella between Europe-America and Asia-Africa from

1998 to 2009. Int. J. Antimicrob. Agents 40, 9–17.

Hantke, K., Nicholson, G., Rabsch, W., and Winkelmann, G. (2003). Salmochelins,

siderophores of Salmonella enterica and uropathogenic Escherichia coli strains, are

recognized by the outer membrane receptor IroN. Proc. Natl. Acad. Sci. U. S. A. 154

100, 3677–3682.

Hider, R. C., and Kong, X. (2010). Chemistry and biology of siderophores. Nat. Prod.

Rep. 27, 637.

Ho, W. W., Li, H., Eakanunkul, S., Tong, Y., Wilks, A., Guo, M., and Poulos, T. L.

(2007). Holo- and apo-bound structures of bacterial periplasmic heme-binding

proteins. J. Biol. Chem. 282, 35796–802.

Hoe, N. P., and Goguen, J. D. (1993). Temperature sensing in Yersinia pestis: translation

of the LcrF activator protein is thermally regulated. J. Bacteriol. 175, 7901–7909.

Hommais, F., Krin, E., Laurent-Winter, C., Soutourina, O., Malpertuy, A., Le Caer, J. P.,

Danchin, A., and Bertin, P. (2001). Large-scale monitoring of pleiotropic regulation

of gene expression by the prokaryotic nucleoid-associated protein, H-NS. Mol.

Microbiol. 40, 20–36.

Hsueh, K.-L., Yu, L.-K., Chen, Y.-H., Cheng, Y.-H., Hsieh, Y.-C., Ke, S.-C., Hung, K.-

W., Chen, C.-J., and Huang, T.-H. (2013). FeoC from Klebsiella pneumoniae

contains a [4Fe-4S] cluster. J. Bacteriol. 3, 4726–4734.

Imlay, J. A., Chin, S. M., and Linn, S. (1988). Toxic DNA damage by hydrogen peroxide

through the Fenton reaction in vivo and in vitro. Science 240, 640–642.

Islam, D., Bandholtz, L., Nilsson, J., Wigzell, H., Christensson, B., Agerberth, B., and

Gudmundsson, G. (2001). Downregulation of bactericidal peptides in enteric

infections: a novel immune escape mechanism with bacterial DNA as a potential

regulator. Nat. Med. 7, 180–185.

Jain, C., and Belasco, J. G. (1995). RNase E autoregulates its synthesis by controlling the 155

degradation rate of its own mRNA in Escherichia coli: Unusual sensitivity of the rne

transcript to RNase E activity. Genes Dev. 9, 84–96.

Jiang, Y., Yang, F., Zhang, X., Yang, J., Chen, L., Yan, Y., Nie, H., Xiong, Z., Wang, J.,

Dong, J., et al. (2005). The complete sequence and analysis of the large virulence

plasmid pSS of Shigella sonnei. Plasmid 54, 149–159.

Jin, Q., Yuan, Z., Xu, J., Wang, Y., Shen, Y., Lu, W., Wang, J., Liu, H., Yang, J., Yang,

F., et al. (2002). Genome sequence of Shigella flexneri 2a: insights into

pathogenicity through comparison with genomes of Escherichia coli K12 and O157.

Nucleic Acids Res. 30, 4432–41.

Johansson, J., Mandin, P., Renzoni, A., Chiaruttini, C., Springer, M., and Cossart, P.

(2002). An RNA thermosensor controls expression of virulence genes in Listeria

monocytogenes. Cell 110, 551–561.

Kammler, M., Schon, C., and Hantke, K. (1993). Characterization of the ferrous iron

uptake system of Escherichia coli. J. Bacteriol. 175, 6212–6219.

Kaur, A. P., and Wilks, A. (2007). Heme inhibits the DNA binding properties of the

cytoplasmic heme binding protein of Shigella dysenteriae (ShuS). Biochemistry 46,

2994–3000.

Kehres, D. G., Janakiraman, A., Slauch, J. M., and Maguire, M. E. (2002). SitABCD is

the alkaline Mn(2+) transporter of Salmonella enterica serovar Typhimurium. J.

Bacteriol. 184, 3159–66.

Kehres, D. G., Zaharik, M. L., Finlay, B. B., and Maguire, M. E. (2000). The NRAMP

proteins of Salmonella typhimurium and Escherichia coli are selective manganese 156

transporters involved in the response to reactive oxygen. Mol. Microbiol. 36, 1085–

1100.

Killackey, S. A., Sorbara, M. T., and Girardin, S. E. (2016). Cellular aspects of Shigella

pathogenesis: focus on the manipulation of host cell processes. Front. Cell. Infect.

Microbiol. 6, 38.

Kim, H., Lee, H., and Shin, D. (2015). Lon-mediated proteolysis of the FeoC protein

prevents Salmonella enterica from accumulating the Fe(II) transporter FeoB under

high-oxygen conditions. J. Bacteriol. 197, 92–98.

Kim, H., Lee, H., and Shin, D. (2012). The FeoA protein is necessary for the FeoB

transporter to import ferrous iron. Biochem. Biophys. Res. Commun. 423, 733–8.

Klinkert, B., Cimdins, A., Gaubig, L. C., Roßmanith, J., Aschke-Sonnenborn, U., and

Narberhaus, F. (2012). Thermogenetic tools to monitor temperature-dependent gene

expression in bacteria. J. Biotechnol. 160, 55–63.

Kortmann, J., and Narberhaus, F. (2012). Bacterial RNA thermometers : molecular

zippers and switches. Nat. Rev. Microbiol. 10, 255–265.

Kortmann, J., Sczodrok, S., Rinnenthal, J., Schwalbe, H., and Narberhaus, F. (2011).

Translation on demand by a simple RNA-based thermosensor. Nucleic Acids Res.

39, 2855–68.

Koster, W., and Braun, V. (1990). Iron (III) hydroxamate transport into Escherichia coli.

Substrate binding to the periplasmic FhuD protein. J. Biol. Chem. 265, 21407–

21410.

Kotloff, K. L., Winickoff, J. P., Ivanoff, B., Clemens, J. D., Swerdlow, D. L., Sansonetti, 157

P. J., Adak, G. K., and Levine, M. M. (1999). Global burden of Shigella infections:

implications for vaccine development and implementation of control strategies. Bull.

World Health Organ. 77, 651–666.

Kouse, A. B. (2014). Thermoregulation of Shigella dysenteriae factors by RNA

thermometers. Ph.D. thesis.

Kouse, A. B., Righetti, F., Kortmann, J., Narberhaus, F., and Murphy, E. R. (2013).

RNA-mediated thermoregulation of iron-acquisition genes in Shigella dysenteriae

and pathogenic Escherichia coli. PLoS One 8, e63781.

Krajewski, S. S., Joswig, M., Nagel, M., and Narberhaus, F. (2014). A tricistronic heat

shock operon is important for stress tolerance of Pseudomonas putida and conserved

in many environmental bacteria. Environ. Microbiol. 16, 1835–1853.

Krajewski, S. S., Nagel, M., and Narberhaus, F. (2013). Short ROSE-Like RNA

thermometers control IbpA synthesis in Pseudomonas Species. PLoS One 8.

Kuhle, V., and Hensel, M. (2004). Cellular microbiology of intracellular Salmonella

enterica: functions of the type III secretion system encoded by Salmonella

pathogenicity island 2. Cell. Mol. Life Sci. 61, 2812–2826.

Lafont, F., Nhieu, G. T. Van, Hanada, K., Sansonetti, P., and Goot, F. G. Van Der (2002).

Initial steps of Shigella infection depend on the cholesterol / sphingolipid raft-

mediated CD44 ± IpaB interaction. EMBO J. 21, 4449–4457.

Laird, A. J., Ribbons, D. W., Woodrow, G. C., Young, I. G., and Young, G. (1980).

Bacteriophage Mu-mediated gene transposition and in vitro cloning of the

enterochelin gene cluster of Escherichia coli. Gene 11, 347–357. 158

Lam, O., Wheeler, J., and Tang, C. M. (2015). Thermal control of virulence factors in

bacteria: A hot topic. Virulence 5, 852–862.

Larsen, R. a, Foster-Hartnett, D., McIntosh, M. a, and Postle, K. (1997). Regions of

Escherichia coli TonB and FepA proteins essential for in vivo physical interactions.

J. Bacteriol. 179, 3213–21.

Lau, C. K. Y., Ishida, H., Liu, Z., and Vogel, H. J. (2013). Solution structure of

Escherichia coli feoA and its potential role in bacterial ferrous iron transport. J.

Bacteriol. 195, 46–55.

Lavrrar, J. L., and McIntosh, M. A. (2003). Architecture of a Fur binding site : a

comparative analysis. J. Bacteriol. 185, 2194–2202.

Lawlor, K. M., and Payne, S. M. (1984). Aerobactin genes in Shigella spp. J. Bacteriol.

160, 266–72.

Lee, S., Prochaska, D. J., Fang, F., and Barnum, S. R. (1998). A 16.6-kilodalton protein

in the Cyanobacterium synechocystis sp. PCC 6803 plays a role in the heat shock

response. Curr. Microbiol. 37, 403–407.

Locher, K. P., and Rosenbusch, J. P. (1997). Oligomeric states and siderophore binding

of the ligand-gated FhuA protein that forms channels across Escherichia coli outer

membranes. Eur. J. Biochem. 247, 770–5.

Lodish, H., Berk, A., Matsudaira, P., Kaiser, C. A., Krieger, M., Scott, M. P., Zipursky,

L., and Darnell, J. (2004). Molecular cell biology. fifth. New York: W.H. Freeman

and Company.

Loh, E., Kugelberg, E., Tracy, A., Zhang, Q., Gollan, B., Ewles, H., Chalmers, R., 159

Pelicic, V., and Tang, C. M. (2013). Temperature triggers immune evasion by

Neisseria meningitidis. Nature 502, 237–40.

Lonetto, M. A., Brown, K. L., Rudd, K. E., and Buttner, M. J. (1994). Analysis of the

Streptomyces coelicolor sigE gene reveals the existence of a subfamily of

eubacterial RNA polymerase sigma factors involved in the regulation of

extracytoplasmic functions. Proc. Natl. Acad. Sci. 91, 7573–7577.

Loomis, L. D., and Raymond, K. N. (1991). Solution equilibria of enterobactin and

metal-enterobactin complexes. Inorg. Chem. 30, 906–911. de Lorenzo, V., and Martinez, J. L. (1988). Aerobactin production as a virulence factor: a

reevaluation. Eur. J. Clin. Microbiol. Infect. Dis. 7, 621–9. de Lorenzo, V., Wee, S., Herrero, M., and Neilands, J. B. (1987). Operator sequences of

the aerobactin operon of plasmid ColV-K30 binding the ferric uptake regulation

(Fur) repressor. J. Bacteriol. 169, 2624–30.

Luck, S. N., Turner, S. A., Rajakumar, K., Sakellaris, H., and Adler, B. (2001). Ferric

Dicitrate Transport System (Fec) of Shigella flexneri 2a YSH6000 is encoded on a

novel pathogenicity island carrying multiple antibiotic resistance genes. Infect.

Immun. 69, 6012–6021.

Mark Taylor, C. (2008). Enterohaemorrhagic Escherichia coli and Shigella dysenteriae

type 1-induced haemolytic uraemic syndrome. Pediatr. Nephrol. 23, 1425–1431.

Marlovits, T. C., Haase, W., Herrmann, C., Aller, S. G., and Unger, V. M. (2002). The

membrane protein FeoB contains an intramolecular G protein essential for Fe(II)

uptake in bacteria. Proc. Natl. Acad. Sci. U. S. A. 99, 16243–16248. 160

Massé, E., and Gottesman, S. (2002). A small RNA regulates the expression of genes

involved in iron metabolism in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 99,

4620–5.

Matsunaga, J., Schlax, P. J., and Haake, D. a. (2013). Role for cis-acting RNA sequences

in the temperature-dependent expression of the multiadhesive Lig proteins in

Leptospira interrogans. J. Bacteriol. 195, 5092–5101.

Maurelli, A. T., Baudry, B., D’Hauteville, H., Hale, T. L., and Sansonetti, P. J. (1985).

Cloning of plasmid DNA sequences involved in invasion of HeLa cells by Shigella

flexneri. Infect. Immun. 49, 164–171.

Miethke, M., and Marahiel, M. A. (2007). Siderophore-Based Iron Acquisition and

Pathogen Control. Microbiol. Mol. Biol. Rev. 71, 413–451.

Mills, M., and Payne, S. M. (1995). Genetics and regulation of heme iron transport in

Shigella dysenteriae and detection of an analogous system in Escherichia coli

O157 : H7. J. Bacteriol. 177, 3004.

Mills, M., and Payne, S. M. (1997). Identification of shuA, the gene encoding the heme

receptor of Shigella dysenteriae, and analysis of invasion and intracellular

multiplication of a shuA mutant. Infect. Immun. 65, 5358–5363.

Morita, M. T., Tanaka, Y., Kodama, T. S., Kyogoku, Y., Yanagi, H., and Yura, T. (1999).

Translational induction of heat shock transcription factor sigma32: evidence for a

built-in RNA thermosensor. Genes Dev. 13, 655–665.

Müller, S. I., Valdebenito, M., and Hantke, K. (2009). Salmochelin, the long-overlooked

catecholate siderophore of Salmonella. BioMetals 22, 691–695. 161

Münch, R., Hiller, K., Grote, A., Scheer, M., Klein, J., Schobert, M., and Jahn, D. (2005).

Virtual Footprint and PRODORIC: an integrative framework for regulon prediction

in prokaryotes. Bioinformatics 21, 4187–4189.

Münchbach, M., Nocker, a, and Narberhaus, F. (1999). Multiple small heat shock

proteins in rhizobia. J. Bacteriol. 181, 83–90.

Murphy, E. R., and Payne, S. M. (2007). RyhB, an iron-responsive small RNA molecule,

regulates Shigella dysenteriae virulence. Infect. Immun. 75, 3470–7.

Murphy, E. R., Sacco, R. E., Dickenson, A., Metzger, D. J., Hu, Y., Orndorff, P. E., and

Connell, T. D. (2002). BhuR, a virulence-associated outer membrane protein of

Bordetella avium, is required for the acquisition of iron from heme and

hemoproteins. Infect Immun 70, 5390–5403.

Nagai, H., Yuzawa, H., and Yura, T. (1991). Interplay of two cis-acting mRNA regions

in translational control of sigma 32 synthesis during the heat shock response of

Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 88, 10515–10519.

Nakayama, S., and Watanabe, H. (1995). Involvement of cpxA, a sensor of a two-

component regulatory system, in the pH-dependent regulation of expression of

Shigella sonnei virF gene. J. Bacteriol. 177, 5062–5069.

Narberhaus, F., Käser, R., Nocker, A., and Hennecke, H. (1998). A novel DNA element

that controls bacterial heat shock gene expression. Mol. Microbiol. 28, 315–323.

Neupert, J., Karcher, D., and Bock, R. (2008). Design of simple synthetic RNA

thermometers for temperature-controlled gene expression in Escherichia coli.

Nucleic Acids Res. 36, 1–9. 162

Nocker, A., Krstulovic, N. P., Perret, X., and Narberhaus, F. (2001a). ROSE elements

occur in disparate rhizobia and are functionally interchangeable between species.

Arch. Microbiol. 176, 44–51.

Nocker, a, Hausherr, T., Balsiger, S., Krstulovic, N. P., Hennecke, H., and Narberhaus,

F. (2001b). A mRNA-based thermosensor controls expression of rhizobial heat

shock genes. Nucleic Acids Res. 29, 4800–4807.

O’Brien, I, G., Cox, G. B., and Gibson, F. (1970). Biologically active compounds

containing 2,3-dihydroxybenzoic acid and serine formed by Escherichia coli.

Biochim. Biophys. Acta 201, 453–60.

Ono, S., Goldberg, M. D., Olsson, T., Esposito, D., Hinton, J. C. D. J. C. D., Ladbury, J.

E. J. E., Dorman, C. J., Eriksson, S., Hurme, R., Rhen, M., et al. (2005). H-NS is a

part of a thermally controlled mechanism for bacterial gene regulation. Biochem. J

391, 203–213.

Otto, B. R., Verweij-van Vught, A. M., and MacLaren, D. M. (1992). Transferrins and

heme-compounds as iron sources for pathogenic bacteria. Crit. Rev. Microbiol. 18,

217–233.

Ouellet, Y. H., Ndiaye, C. T., Gagné, S. M., Sebilo, A., Suits, M. D. L., Jubinville, É.,

Jia, Z., Ivancich, A., and Couture, M. (2016). An alternative reaction for heme

degradation catalyzed by the Escherichia coli O157:H7 ChuS protein: Release of

hematinic acid, tripyrrole and Fe(III). J. Inorg. Biochem. 154, 103–113.

Ozenberger, B. A., Schrodt Nahlik, M., and McIntosh, M. A. (1987). Genetic

organization of multiple fep genes encoding ferric enterobactin transport functions in 163

Escherichia coli. J. Bacteriol. 169, 3638–3646.

Parrow, N. L., Abbott, J., Lockwood, A. R., Battisti, J. M., and Minnick, M. F. (2009).

Function, regulation, and transcriptional organization of the hemin utilization locus

of Bartonella quintana. Infect. Immun. 77, 307–316.

Payne, S. M. (1980). Synthesis and utilization of siderophores by Shigella flexneri. J.

Bacteriol. 143, 1420–4.

Payne, S. M., and Alexandra, M. R. (2010). “Iron uptake in Shigella and Escherichia

coli,” in Iron Uptake and Homeostasis in Microorganisms, eds. P. Cornelis and S.

C. Andrews (Norfolk, UK, UK: Caister Academic Press), 87–100.

Payne, S. M., Niesel, D. W., Peixotto, S. S., and Lawlor, K. M. (1983). Expression of

hydroxamate and phenolate siderophores by Shigella flexneri. J. Bacteriol. 155,

949–55.

Payne, S. M., Wyckoff, E. E., Murphy, E. R., Oglesby, A. G., Boulette, M. L., and

Davies, N. M. L. (2006). Iron and pathogenesis of Shigella: iron acquisition in the

intracellular environment. Biometals 19, 173–80.

Pollack, J. R., and Neilands, J. B. (1970). Enterobactin, an iron transport compound from

Salmonella typhimurium. Biochem. Biophys. Res. Commun. 38, 989–992.

Porcheron, G., Habib, R., Houle, S., Caza, M., Lépine, F., Daigle, F., Massé, E., and

Dozois, C. M. (2014). The small RNA RyhB contributes to siderophore production

and virulence of uropathogenic Escherichia coli. Infect. Immun. 82, 5056–68.

Portaliou, A. G., Tsolis, K. C., Loos, M. S., Zorzini, V., and Economou, A. (2016). Type

III secretion: building and operating a remarkable nanomachine. Trends Biochem. 164

Sci. 41, 175–189.

Prosseda, G., Falconi, M., Giangrossi, M., Gualerzi, C. O., Micheli, G., and Colonna, B.

(2004). The virF promoter in Shigella: More than just a curved DNA stretch. Mol.

Microbiol. 51, 523–537.

Raymond, K. N., Dertz, E. a, and Kim, S. S. (2003). Enterobactin: an archetype for

microbial iron transport. Proc. Natl. Acad. Sci. U. S. A. 100, 3584–3588.

Righetti, F., Nuss, A. M., Twittenhoff, C., Beele, S., Urban, K., and Will, S. (2016).

Temperature-responsive in vitro RNA structurome of Yersinia pseudotuberculosis.

113, 1–6.

Rinnenthal, J., Klinkert, B., Narberhaus, F., and Schwalbe, H. (2011). Modulation of the

stability of the Salmonella fourU-type RNA thermometer. Nucleic Acids Res. 39,

8258–8270.

Rohrbach, M. R., Braun, V., and Koster, W. (1995). Ferrichrome transport in Escherichia

coli K-12: Altered substrate specificity of mutated periplasmic FhuD and interaction

of FhuD with the integral membrane protein FhuB. J. Bacteriol. 177, 7186–7193.

Runyen-Janecky, L. J., Reeves, S. a, Gonzales, E. G., Payne, M., and Payne, S. M.

(2003). Contribution of the Shigella flexneri Sit , Iuc , and Feo iron acquisition

systems to iron acquisition in vitro and in cultured cells. Infect. Immun. 71, 1919–

1928.

Sasakawa, C., Kamata, K., Sakai, T., Makino, S., Yamada, M., Okada, N., and

Yoshikawa, M. (1988). Virulence-associated genetic regions comprising 31

kilobases of the 230-kilobase plasmid in Shigella flexneri 2a. J. Bacteriol. 170, 165

2480–2484.

Schroeder, G. N., and Hilbi, H. (2008). Molecular pathogenesis of Shigella spp.:

controlling host cell signaling, invasion, and death by type III secretion. Clin.

Microbiol. Rev. 21, 134–56.

Schuck, A., Diwa, A., and Belasco, J. G. (2009). RNase E autoregulates its synthesis in

Escherichia coli by binding directly to a stem-loop in the rne 5′ untranslated region.

Mol Microbiol 72, 470–478.

Shiga, K. (1897). Sekiri Byogen Kenkyo Hokoku Dai-Ichi (First report on etiologic

research on dysentery). Saikingaku Zasshi 25, 790–810.

Solovyev, V., and Salamov, A. (2011). “Automatic annotation of microbial genomes and

metagenomic sequences,” in Metagenomics and its Applications in Agriculture,

Biomedicine and Environmental Studies, ed. R. W. Li (Nova Science Publishers),

61–78.

Stella, S., Falconi, M., Lammi, M., Gualerzi, C. O., and Pon, C. L. (2006). Environmental

control of the in vivo oligomerization of nucleoid protein H-NS. J. Mol. Biol. 355,

169–174.

Stephens, D. L., Choe, M. D., and Earhart, C. F. (1995). Escherichia coli periplasmic

protein FepB binds ferrienterobactin. Microbiology 141 ( Pt 7, 1647–1654.

Suits, M. D. L., Lang, J., Pal, G. P., Couture, M., and Jia, Z. (2009). Structure and heme

binding properties of Escherichia coli O157:H7 ChuX. Protein Sci. 18, 845–849.

Tatano, Y., Kanehiro, Y., Sano, C., Shimizu, T., and Tomioka, H. (2015). ATP exhibits

antimicrobial action by inhibiting bacterial utilization of ferric ions. Sci. Rep. 5, 166

8610.

Tesh, V. L., and O’Brien, a D. (1991). The pathogenic mechanisms of Shiga toxin and

the Shiga-like toxins. Mol. Microbiol. 5, 1817–22.

The, H. C., Thanh, D. P., Holt, K. E., Thomson, N. R., and Baker, S. (2016). The

genomic signatures of Shigella evolution, adaptation and geographical spread. Nat.

Rev. Microbiol. 14, 235–250.

Tobe, T., Nagai, S., Okada, N., Adler, B., Yoshikawa, M., and Sasakawa, C. (1991).

Temperature-regulated expression of invasion genes in Shigella flexneri is

controlled through the transcriptional activation of the virB gene on the large

plasmid. Mol. Microbiol. 5, 887–893.

Tobe, T., Yoshikawa, M., Mizuno, T., and Sasakawa, C. (1993). Transcriptional control

of the invasion regulatory gene virB of Shigella flexneri: activation by virF and

repression by H-NS. J. Bacteriol. 175, 6142–6149.

Török, Z., Goloubinoff, P., Horváth, I., Tsvetkova, N. M., Glatz, a, Balogh, G.,

Varvasovszki, V., Los, D. a, Vierling, E., Crowe, J. H., et al. (2001). Synechocystis

HSP17 is an amphitropic protein that stabilizes heat-stressed membranes and binds

denatured proteins for subsequent chaperone-mediated refolding. Proc. Natl. Acad.

Sci. U. S. A. 98, 3098–3103.

Torres, A. G., Redford, P., Welch, R. A., and Payne, S. M. (2001). TonB-dependent

systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB

are required for virulence in the mouse. Infect. Immun. 69, 6179–6185.

Troxell, B., and Hassan, H. M. (2013). Transcriptional regulation by Ferric Uptake 167

Regulator (Fur) in pathogenic bacteria. Front. Cell. Infect. Microbiol. 3, 59.

Urban, J. H., and Vogel, J. (2007). Translational control and target recognition by

Escherichia coli small RNAs in vivo. Nucleic Acids Res. 35, 1018–1037.

Vanderpool, C. K., and Armstrong, S. K. (2003). Heme-responsive transcriptional

activation of Bordetella bhu genes. J. Bacteriol. 185, 909–917.

Vanderpool, C. K., and Armstrong, S. K. (2001). The Bordetella bhu locus is required for

heme iron utilization. J. Bacteriol. 183, 4278–4287.

Wagner, D., Rinnenthal, J., Narberhaus, F., and Schwalbe, H. (2015). Mechanistic

insights into temperature-dependent regulation of the simple cyanobacterial hsp17

RNA thermometer at base-pair resolution. Nucleic Acids Res., 1–14.

Waldminghaus, T., Fippinger, A., Alfsmann, J., and Narberhaus, F. (2005). RNA

thermometers are common in alpha- and gamma-proteobacteria. Biol. Chem. 386,

1279–1286.

Waldminghaus, T., Gaubig, L. C., Klinkert, B., and Narberhaus, F. (2009). The

Escherichia coli ibpA thermometer is comprised of stable and unstable structural

elements. RNA Biol. 6, 455–463.

Waldminghaus, T., Heidrich, N., Brantl, S., and Narberhaus, F. (2007). FourU: A novel

type of RNA thermometer in Salmonella. Mol. Microbiol. 65, 413–424.

Watarai, M., Tobe, T., Yoshikawa, M., and Sasakawa, C. (1995). Contact of Shigella

with host cells triggers release of Ipa invasins and is an essential function of

invasiveness. EMBO J. 14, 2461–2470.

Weber, G. G., Kortmann, J., Narberhaus, F., and Klose, K. E. (2014). RNA thermometer 168

controls temperature-dependent virulence factor expression in Vibrio cholerae.

Proc. Natl. Acad. Sci. U. S. A. 111, 1–6.

Wei, Y., and Murphy, E. R. (2016a). Iron acquisition systems and their regulation. Front.

Cell. Infect. Microbiol. 6, 18.

Wei, Y., and Murphy, E. R. (2016b). “Temperature-dependent regulation of bacterial

gene expression by RNA thermometers,” in Nucleic Acid - From Basic Aspects to

Laboratory Tools, eds. M. L. Larramendy and S. Soloneski (InTech), 157–181.

Westhof, E., and Romby, P. (2010). The RNA structurome: high-throughput probing.

Nat. Methods 7, 965–967.

Whitby, P. W., Seale, T. W., VanWagoner, T. M., Morton, D. J., and Stull, T. L. (2009).

The iron/heme regulated genes of Haemophilus influenzae: comparative

transcriptional profiling as a tool to define the species core modulon. BMC

Genomics 10, 6.

Wilks, A. (2001). The ShuS protein of Shigella dysenteriae is a heme-sequestering

protein that also binds DNA. Arch Biochem Biophys 387, 137–142.

Wyckoff, E. E., Boulette, M. L., and Payne, S. M. (2009). Genetics and environmental

regulation of Shigella iron transport systems. Biometals 22, 43–51.

Wyckoff, E. E., Duncan, D., Torres, A. G., Mills, M., Maase, K., and Payne, S. M.

(1998). Structure of the Shigella dysenteriae haem transport locus and its

phylogenetic distribution in enteric bacteria. Mol. Microbiol. 28, 1139–52.

Wyckoff, E. E., Lopreato, G. F., Tipton, K. A., and Payne, S. M. (2005). Shigella

dysenteriae ShuS promotes utilization of heme as an iron source and protects against 169

heme toxicity. J. Bacteriol. 187, 5658–5664.

Yang, F., Yang, J., Zhang, X., Chen, L., Jiang, Y., Yan, Y., Tang, X., Wang, J., Xiong,

Z., Dong, J., et al. (2005). Genome dynamics and diversity of Shigella species, the

etiologic agents of bacillary dysentery. Nucleic Acids Res. 33, 6445–6458.

Zahrl, D., Wagner, M., Bischof, K., Bayer, M., Zavecz, B., Beranek, A., Ruckenstuhl, C.,

Zarfel, G. E., and Koraimann, G. (2005). Peptidoglycan degradation by specialized

lytic transglycosylases associated with type III and type IV secretion systems.

Microbiology 151, 3455–3467.

Zhang, Y., and Lin, K. (2012). A phylogenomic analysis of Escherichia coli / Shigella

group: implications of genomic features associated with pathogenicity and

ecological adaptation. BMC Evol. Biol. 12, 174.

Zhou, D., Hardt, W. D., and Galán, J. E. (1999). Salmonella typhimurium encodes a

putative iron transport system within the centisome 63 pathogenicity island. Infect.

Immun. 67, 1974–81.

Zimmerhackl, L. B. (2000). E. coli, antibiotics, and the hemolytic-uremic syndrome. N.

Engl. J. Med. 342, 1990–1991.

Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction.

Nucleic Acids Res. 31, 3406–3415.

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

Thesis and Dissertation Services ! !