Peroxisome Proliferator-Activated Receptor ; Is a Zac Target Gene Mediating Zac Antiproliferation

Research Article

Thomas Barz, Anke Hoffmann, Markus Panhuysen, and Dietmar Spengler

Molecular Neuroendocrinology, Max-Planck-Institute of Psychiatry, Munich, Germany

Abstract Zac also potently coactivates or corepresses the hormone- dependent activity of nuclear receptors, including androgen, Zac is a C2H2 zinc finger protein, which regulates apoptosis estrogen, glucocorticoid, and thyroid hormone receptors (13); all and cell cycle arrest through DNA binding and transactivation. of these are key regulators of development, homeostasis, differen- During tumorigenesis and in response to mitogenic activation, tiation, and cell growth. Recent data, showing tightly controlled Zac gene expression is down-regulated in a methylation- spatio-temporal Zac expression during embryogenesis in mesen- sensitive manner. As yet, no target genes have been identified chymal and neural stem/progenitor cells, have suggested additional that could explain the potent antiproliferative function of Zac. roles related to differentiation and development (14, 15). Consis- Here, applying genome-wide expression analysis, we identify tent with this concept, other studies have disclosed that the Zac peroxisome proliferator-activated receptor g (PPARg) as a new gene is maternally imprinted (16, 17) and that defects of its bona fide Zac target gene, which is induced by direct Zac imprinting status underlie the etiology of transient neonatal binding to the proximal PPAR;1 promoter. We show that in diabetes mellitus (TNDM), an uncommon form of childhood human colon carcinoma cells, ZAC activates expression of diabetes (OMIM *601410), which probably results from a delayed PPAR; target genes in a PPAR;-dependent manner. More- maturation of pancreatic h-cells (18, 19). over, we show that treatment of pituitary tumor cells with Our earlier work revealed that Zac can act as a transcription octreotide, a somatostatin analogue, leads to Zac induction factor through its monomeric or dimeric binding to either a GC-rich and subsequent Zac-dependent up-regulation of PPAR;, palindromic DNA element or to GC-rich direct and reverse repeat which thereupon mediates part of the antiproliferative activity elements, respectively (2, 20, 21). Zac confers transactivation in a of Zac. Our work provides a first step toward elucidating a strictly HAT-dependent manner via recruitment of p300 and the functional relationship between Zac and PPAR; that could be coordinated regulation of p300’s substrate affinities and catalytic relevant to the understanding of tumorigenesis and diabetes activity by zinc fingers 6and 7 and its COOH terminus (22). In this as well. (Cancer Res 2006; 66(24): 11975-82) way, Zac DNA binding is directly coupled to p300-HAT regulation, indicating that modification of the chromatin status may play an Introduction important role in target gene recognition and activation. However, it Zac is a zinc finger protein, which potently induces apoptosis is far from clear how Zac exerts its antiproliferative functions and cell cycle arrest and prevents tumor formation in nude mice because only a few potential Zac target genes involved in (1, 2). Expression of Lot1, the rat orthologue of Zac, is lost during differentiation (PAC1 and KRT14) have been proposed until now spontaneous transformation of ovary surface epithelial cells in vitro (21, 23). Therefore, a genome-wide screen for Zac target genes (3), whereas human ZAC, which is widely expressed in normal should reveal the transcriptional activities responsible for biological tissues, is frequently down-regulated in a methylation-sensitive effects of Zac and the gene networks addressed. manner in various tumors (3–7). Additionally, Zac/Lot1 expression The transcription factor peroxisome proliferator-activated is repressed by epidermal growth factor and Ras/jun oncogenes receptor g (PPARg) is a member of the nuclear hormone receptor (8, 9), suggesting that it might be integrated in a negative feedback family. Besides its key role in adipogenesis, PPARg has increasingly loop controlling cell proliferation in response to mitogen been recognized to participate in lipid metabolism, glucose activation. Consistent with the antiproliferative role of Zac, its homeostasis, inflammatory responses, differentiation, anti- down-regulation by small interfering RNA (siRNA) enhances proliferation, and apoptosis (24), raising intense clinical interest pituitary tumor cell proliferation (10). Conversely, octreotide, a on regulation of its expression and pharmacologic control of its somatostatin analogue, inhibits tumor cell growth by inducing Zac activity. PPARg exists as two protein isoforms, expressed from expression via activated glycogen synthase kinase-3h (GSK3h) and different promoters and alternatively spliced at the 5¶-end of the possibly through p53 (10, 11). In addition, Zac coactivates p53 (12), gene, resulting in 30 additional amino acids at the NH2 terminus of for example, to enhance transactivation of the proapoptotic gene PPARg2 compared with PPARg1 (25, 26). Whereas expression of Apaf-1 (11). These findings suggest that Zac and p53 cooperate at PPARg2 is mainly restricted to adipose tissue, PPARg1 has also different levels in antiproliferation. been detected in other tissues, including heart, skeletal muscle, liver, colon, kidney, spleen, pancreas, pituitary, and brain. Studies on regulation of PPARg expression have been focused primarily on the PPARg2 promoter in adipocyte precursor cells in terms of adipogenesis, whereas control of PPARg1 transcription is still Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). poorly understood. Requests for reprints: Dietmar Spengler, Molecular Neuroendocrinology, Max- Here, using genome-wide expression analysis, we identify PPARc Planck-Institute of Psychiatry, Kraepelinstrasse 2-10, 80804 Munich, Germany. Phone: as a new bona fide Zac target gene that mediates antiprolifera- 49-89-30622-559; Fax: 49-89-30622-605; E-mail: [email protected]. I2006American Association for Cancer Research. tion in cancer cells. This functional link between Zac and PPARg doi:10.1158/0008-5472.CAN-06-1529 may also apply to other common diseases, in particular diabetes. www.aacrjournals.org 11975 Cancer Res 2006; 66: (24). December 15, 2006

Materials and Methods Cell culture and transfection. Cells were cultivated in DMEM with 10% FCS and penicillin/streptidin. Transfections were carried out by electro- poration or Metafectene (Biontex, Munich, Germany). Inducible Zac clones of the hippocampal cell line HW3-5 (27) were generated as described previously (1) using the pCMVtetr vector (28). Proliferation rate was measured using a Coulter Counter (Beckman, Krefeld, Germany) following seeding of 2 Â 103 cells in 24-well plates and cultivation in the absence or presence of tetracycline (100 ng/mL) for 10 days. 3-(4,5-Dimethylthiazol-2- yl)-2,5-diphenyltetrazolium bromide (MTT) assays were done as described (1). For transfection assays, luciferase values were normalized on h- galactosidase activity by cotransfecting a pRK7-h-Gal vector. All chemicals were purchased from Sigma (Taufkirchen, Germany). PSG5mPPARg1 plasmid was generously provided by L. Michalik (University of Lausanne, Lausanne, Switzerland). See ref. 21 for Zac expression constructs. RNA, Northern blot, microarray analysis, and reverse transcription-PCR. RNA was isolated using Trizol (Invitrogen, Karlsruhe, Germany). For Northern blot, 20 Ag total RNA was separated by denaturating gel electrophoresis, blotted overnight, blocked, and hybridized in Rapid-hyb buffer (Amersham, Piscataway, NJ) to P32- random-primed cDNA. Blot was exposed to phosphoimage plate overnight and plate was scanned using a BAS reader (Fuji, Gru¨nwald, Germany). For microarray analysis, 40 AgtotalRNApersamplewasdye coupled using indirect labeling. To exclude dye bias, one half of each Figure 1. Characterization of inducible Zac clones. A, Northern blot and sample was coupled to Cy3 and to Cy5, respectively. The samples were RT-PCR showing endogenous Zac expression in HW3-5cells. The corticotroph pituitary cell line AtT-20 and the neuroblastoma cell line Neuro-2A (N-2A) hybridized on four 24k mouse cDNA arrays (Max-Planck-Institute of served as positive and negative controls, respectively. BglII digestion confirmed Psychiatry,Munich,Germany;ref.29)foreachdyecouplingcombination specificity of the HW3-5PCR product. M, size marker. B, immunoblot and scanned on a Perkin-Elmer Life Sciences (Rodgau-Ju¨gesheim, [40 Ag whole-cell extract (WCE)] showing increased Zac expression in inducible Germany) ScanArray 4000 laser scanner. Reverse transcription was HW3-5Zac clones 24 hours after tetracycline ( Tc) removal. C, induced Zac expression in HW3-5Zac clones inhibits proliferation. Cells were cultivated in the carried out with Omniscript reverse transcription kit (Qiagen, Hilden, presence or absence of tetracycline and cell numbers were measured daily with Germany). One microliter of reverse transcription reaction was used as a cell counter. Medium was renewed every 3rd day. Points, mean of three template for PCRs of 30 cycles using Taq DNA Polymerase (Fermentas, independent experiments for each clone; bars, SD. D, immunoblot (40 Ag WCE) St. Leon-Rot, Germany). Quantitative PCR was done combining 2Â showing Zac induction at different time points after tetracycline removal in HW3-5Zac clones. QuantiTect SYBR Green PCR Master Mix (Qiagen), 20 pmol primers, 2 AL reverse transcription reaction, and H2Oad20AL. Thermal cycling was done using LightCycler 2.0 (Roche, Penzberg, Germany) with an initial prevent the generation of inducible Zac clones (1). Figure 1A shows activation step of 15 minutes at 95jC and 45 cycles of 15 seconds at moderate Zac expression in the hippocampal cell line HW3-5 (27) 94jC, 30 seconds at 58jC, and 30 seconds at 72jC. PCR primer as determined by Northern blot and reverse transcription-PCR sequences are given in Supplementary List 1. Colon RNA was purchased (RT-PCR). The corticotroph pituitary cell line AtT-20 exhibiting from Clontech (Heidelberg, Germany). high Zac expression (1, 33) and the neuroblastoma cell line Neuro- Immunoblot, chromatin immunoprecipitation assay, and RNA 2A served as positive and negative controls, respectively. Digestion interference. Rabbit PPARg antibody for immunoblot was purchased by BglII using an internal restriction site confirmed the specificity h from Calbiochem (Darmstadt, Germany); mouse a-Flag, -actin, and PTEN of the PCR product. antibodies were from Sigma; and rabbit TSC22 and mouse KER20 We generated a panel of inducible HW3-5 Zac clones using a Tet- antibodies were from Biozol (Eching, Germany). Rabbit POX antibody (30) was generously provided by J. Phang (NIH, Frederick, MD). Zac off system (28). By cultivation in the absence or presence of antibodies were generated in rabbit against fusion proteins of glutathione tetracycline, corresponding to ectopic Zac expression being S-transferase and specific Zac epitopes using the following protocol: switched on and off, respectively, we screened 30 clones for preimmunization i.d. Freund’s complete adjuvant at day 1; three boosts maximal Zac induction, which is shown for two representatives in s.c. Freund’s incomplete adjuvant at days 20, 30, and 40; and bleeding at Fig. 1B. We further analyzed the selected clones for their Zac day 61. Specificity of antibodies was validated by immunoblot (Fig. 4A). responsiveness: typical results showed a dramatic growth inhibi- Chromatin immunoprecipitation (ChIP) assay was done as described (31) tion by Zac from about days 3 to 4 after tetracycline removal using a-Zac-LPR with HW3-5 cells and a-Zac-C with SK-N-MC and GH3 onward, reaching a maximum f20-fold difference in cell number cells for immunoprecipitation (preimmune sera were taken for control). at around day 8 (Fig. 1C). Finally, a time course analysis of PCR amplification of promoter sequences was done with AccuPrime regulated Zac expression by immunoblot revealed significantly GC-Rich DNA Polymerase (Invitrogen) and ChIP primers given in Supplementary List 1. Zac-RNA interference (RNAi) and PPARg-RNAi elevated Zac levels as early as 6hours after tetracycline removal experiments were done using Zac-siRNA (caugggucucuuugaggaauu) and (Fig. 1D), showing a fast and potent response. ; siRNAs described previously in refs. 10 and 32, respectively. Zac induces expression of PPAR . Using cDNA microarrays, we did a comparative, genome-wide expression analysis of two representative inducible Zac clones cultivated for 3, 6, and 9 hours Results with or without tetracycline. Only genes exhibiting a >1.5-fold Generation and characterization of inducible Zac clones. To difference between tetracycline-positive and tetracycline-negative identify Zac target genes by gene expression analysis, we first conditions in both clones were taken into account. Collectively, Zac sought to find a cellular model with endogenous but modest Zac induction differentially affected 127 common genes (Supplemen- expression because high levels as found in pituitary tumor cells tary Table S1), belonging to different functional groups, including

Cancer Res 2006; 66: (24). December 15, 2006 11976 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2006 American Association for Cancer Research. PPARg Is a Zac Target Gene metabolism, transcription, proliferation, signaling/transport, and cell structure (Fig. 2A). Among the genes showing most prominent Zac-induced expression changes was the PPARc gene, exhibiting a >2-fold activation. We further validated PPARg up-regulation

Figure 3. Zac/ZAC transactivates mouse and human PPARg1 promoters. A, alignment reveals conservation (*) of GC-rich proximal PPARg1 promoter sequences between mouse (m) and human (h). Transcriptional start sites are marked by bold letters and relative bp positions are indicated. For both species, multiple potential Zac/ZAC–binding sites resembling the idealized direct repeat type (G4N1–8G4)2 are present as exemplified in the list. B, transfection assays showing transcriptional activation of mouse and human PPARg1 promoters by Zac/ZAC. Luciferase activity in LLC-PK1 cells, cotransfected with different PPARg1 promoter constructs (2 Ag; left columns) and Zac/ZAC (50 ng), revealed 2- to 4-fold induction (right columns) compared with mock-transfected cells. DNA binding-defective Zac/ZAC mutants ZacZF6mt and ZacZF7mt failed to activate the PPARg1 promoter. Columns, mean of four independent experiments; bars, SD. bp positions of promoters relate to transcriptional start sites. C, PPARg1 induction in human neuroblastoma cell line SK-N-MC by ZAC transfection (1 Ag) as determined by RT-PCR and immunoblot (20 Ag WCE).

following Zac induction: quantitative RT-PCR (qRT-PCR) analysis revealed a >1.5-fold increase in PPARg mRNA as early as 3 hours Figure 2. Zac induces PPARg expression. A, microarray analysis of HW3-5Zac after tetracycline removal in both clones, reaching 3.5- and 2.5-fold clones reveals genes affected by Zac induction, including the PPARc gene (Pparg). B, increase of PPARg expression in two different HW3-5Zac clones at induction after 9 hours, respectively (Fig. 2B). At the protein level, different time points after tetracycline removal, as detected by qRT-PCR and PPARg up-regulation was detectable 6hours after tetracycline immunoblot (10 Ag WCE). qRT-PCR results. Points, mean of four independent experiments done in duplicate; bars, SD. C, Zac-mediated PPARg induction removal (Fig. 2B). depends on an intact DNA-binding domain. Zac or the DNA-binding defective Because these data did not allow to discern between the trans- mutants ZacZF6mt or ZacZF7mt (1 Ag each) were transfected in HW3-5cells and PPARg levels were determined by RT-PCR and immunoblot (10 Ag WCE). Control activator or coactivator functions of Zac, we transfected parent experiments confirmed equal expression of Zac constructs. D, Zac-induced HW3-5 cells with wild-type (WT) Zac or DNA binding-defective PPARg expression is specific for the PPARg1transcript.Top, scheme of PPARc mutant forms (ZacZF6mt and ZacZF7mt; ref. 21). In contrast to gene with alternative promoters and resulting transcripts. Arrows, promoter regions. A1, A2, B, and 1–6, exons. Open arrowheads, positions of transcript- WT Zac, neither Zac mutant induced PPARg but rather reduced its specific primers; closed arrowheads, transcript-unspecific primers (used in C). expression as detected by RT-PCR (amplifying a transcript region Bottom, RT-PCR reveals Zac DNA binding-dependent induction of PPARg1 transcript, whereas no PCR product was detected for PPARg2 in HW3-5cells. 3T3 common to both PPARg isoforms) and immunoblot (Fig. 2C). cells expressing both PPARg isoforms were taken as positive control. These results strongly suggested that PPARg induction by Zac www.aacrjournals.org 11977 Cancer Res 2006; 66: (24). December 15, 2006

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2006 American Association for Cancer Research. Cancer Research requires specific DNA binding. To distinguish between regulation PPARg1 promoter sequences (25, 26) for potential Zac binding via the PPARg1 and/or the PPARg2 promoter, we carried out sites. Indeed, within the extremely GC-rich proximal promoter RT-PCR with primers specific for the respective PPARg isoform region, we identified multiple, partly overlapping Zac DNA transcripts (Fig. 2D, top, open arrowheads). Whereas we detected binding motifs, resembling the consensus direct repeat type no PPARg2-specific transcripts (Fig. 2D, bottom right), levels of (G4N1–8G4)2 or its complement (Fig. 3A; ref. 21). Reporter assays PPARg1 clearly confirmed Zac DNA binding-dependent induction showed that Zac/ZAC increased the activities of mouse (26) and (Fig. 2D, bottom left). These results indicate that Zac regulates human PPARg1 promoters (25) by 2- to 3-fold; when only PPARg expression specifically via the PPARg1 promoter. proximal promoter sequences were used, an f4-fold enhance- Mouse and human PPAR;1 promoters are direct Zac/ZAC ment was detected (Fig. 3B). Consistent with the results described targets. We analyzed the highly conserved mouse and human above, DNA binding-defective Zac/ZAC mutant forms completely failed to activate the PPARg1 promoters. In addition, Zac/ZAC did not affect the activities of PPARg2 promoter plasmids or parent vectors lacking PPARg promoter sequences (data not shown). To examine if Zac-mediated PPARg1 induction is conserved, we transfected ZAC into the human neuroblastoma cell line SK-N-MC, which exhibits endogenous expression of both PPARg1 (34) and ZAC (data not shown). Importantly, ZAC significantly increased PPARg mRNA and protein levels (Fig. 3C), suggesting cross-species conservation. Next, to investigate Zac/ZAC occupancy at the endogenous PPARg1 promoter in vivo, we carried out ChIP assays with antibodies generated against different Zac epitopes (Fig. 4A). The ChIP assays were done with untransfected and Zac/ZAC– transfected HW3-5 and SK-N-MC cells, respectively. PCR revealed the in vivo occupancy of the proximal PPARg1 promoter by endogenous Zac/ZAC in both cell lines (Fig. 4B and C, left, lanes 2) and a further enhancement following Zac/ZAC transfection (Fig. 4B and C, left, lanes 4). In contrast, no Zac/ZAC binding was detected for distal promoter regions lacking Zac consensus motifs (Fig. 4B and C, right). We conclude that PPARg is a direct Zac/ZAC target gene in mouse and human cells and that transactivation is mediated via the Zac/ZAC binding sites in the proximal PPARg1 promoter. PPAR; mediates Zac antiproliferation. Because both Zac and PPARg exert antiproliferation (1, 24), we asked if PPARg mediates Zac activity. First, we tested if an increase in PPARg levels as that induced by Zac causes antiproliferation. Performing colony formation assays, we adjusted cotransfection of PPARg and a selectable marker gene to achieve moderately enhanced PPARg expression (Fig. 5A and B, left, bottom). Indeed, the increased levels of PPARg inhibited cell growth by 20% to 30% (Fig. 5A and B, left). Interestingly, colony formation assays with Zac/ZAC in the presence of PPARg agonists rosiglitazone

Figure 4. Zac/ZAC binds to proximal region of endogenous PPARg1 promoter. A, specificity of a-Zac antibodies used for ChIP analysis in (B) and (C). Top, scheme of mouse Zac protein. The numbers correspond to amino acid residues. Domains missing in human ZAC and epitopes used for a-Zac antibody generation are indicated. ZF, zinc fingers; L, linker; PR, proline repeat; C, COOH terminus. Bottom, immunoblots (20 Ag WCE) show specificity of a-Zac antibodies against Flag-tagged Zac/ZAC constructs transfected into LLC-PK1 cells (50 ng each). Immunoreactivity of a-Zac antibodies was compared with a-Flag antibody (1:1,000 dilution each). No signals were detected using preabsorbed antibodies or preimmune sera (data not shown). Protein marker sizes are given in kDa. B, left, ChIP assay reveals in vivo occupancy of proximal PPARg1 promoter by Zac in mouse HW3-5cells; right, no PCR product was detected after immunoprecipitation for a distal promoter region without Zac binding motifs, which was taken for control. Positions of primers used for PCR amplification are indicated by arrowheads in promoter schemes at the top. Ut, untransfected cells; Zac, cells transfected with Zac (1 Ag); ps, IP with preimmune serum; a-Zac-LPR, IP with a-Zac-LPR antibody. C, in vivo occupancy of proximal PPARg1 promoter by ZAC in human SK-N-MC cells revealed by ChIP assay as in (B).

Cancer Res 2006; 66: (24). December 15, 2006 11978 www.aacrjournals.org

Figure 5. Zac/ZAC antiproliferation is modulated by PPARg effectors in neural cells and ZAC induces PPARg target genes in colon carcinoma cells. A, colony formation assay with mouse HW3-5cells. PPAR g [left; expression levels (bottom)], mock, or Zac vectors (right) were cotransfected with a puromycin resistance plasmid at a 3:1 ratio. Selection (puromycin, 2 Ag/mL) was done in the presence or absence of PPARg effectors rosiglitazone (Rosi; agonist, 5 Amol/L) and GW9662 (antagonist, 100 nmol/L), respectively. Medium was renewed every 3rd day. Colonies were stained with MTT at day 10 and counted. Growth of mock- transfected cells in the absence of PPARg effectors was set to 100%. Columns, mean of three independent experiments; bars, SD. B, colony formation assay with human SK-N-MC cells done as in (A). C, expression of PPARg and ZAC in human colon carcinoma cell lines. For immunoblots, 50 Ag of WCE of each cell line were taken. D, ZAC induces PPARg target genes in colon carcinoma cells in a PPARg-dependent manner. qRT-PCR results as fold gene expression (mean values F SD of four independent experiments done in duplicate) in ZAC-transfected versus mock- transfected colon carcinoma cells with different p53 and PPARg status. P values according to Student’s t test were V0.05in all cases. mut, mutant.

(Fig. 5A and B, right) or 15-D-PGJ2 (data not shown) revealed a To examine if our results also apply to non-neural cell types, synergistic effect, whereas PPARg antagonist GW9662 counter- we extended our study to human colon carcinoma cells, in which acted Zac/ZAC–induced growth inhibition (Fig. 5A and B, right activation of PPARg induces differentiation and growth arrest. compare column 2 and 6). Together, these data suggest that Zac/ As shown in Fig. 5C (top), we detected modest to high levels of ZAC antiproliferation is mediated in part through the induction PPARg in all eight cell lines tested. Only half of them expressed of PPARg expression. ZAC mRNA (Fig. 5C, bottom left), and for two of the mRNA-positive www.aacrjournals.org 11979 Cancer Res 2006; 66: (24). December 15, 2006

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2006 American Association for Cancer Research. Cancer Research cell lines, we were not able to detect any ZAC protein (Fig. 5C, bottom right), indicating ZAC inactivation at different levels. Interestingly, the two cell lines expressing ZAC protein are among those exhibiting highest PPARg levels. Therefore, we asked if ZAC induces PPARg expression also in colon carcinoma cells and, if so, whether this regulation leads to activation of PPARg downstream pathways. Indeed, ZAC induced the expression of PPARg in all cell lines tested, including Caco-2, Hct-15, Hct116, HT-29, Isreco-1, and SW480 (Fig. 5D; data not shown). More- over, classic PPARg target genes controlling lipid metabolism, such as ADRP or L-FABP, became up-regulated in Hct116and SW480 cells, both of which express WT PPARg. Notably, Hct-15 cells expressing mutant PPARg showed a weaker ZAC-induced up-regulation of these genes (Fig. 5D). Similarly, cotransfection of PPARg-siRNA with ZAC into Hct116cells largely suppressed induction of PPARg target genes, indicating a PPARg-dependent ZAC effect. Several genes mediating differentiation and growth arrest in colon carcinoma have been identified as PPARg targets (30, 35–37). Among these, KER20, POX, and PTEN, were induced by ZAC in Hct116cells at the transcript and the protein level, whereas expression of TSC22 was unchanged (Fig. 5D; Supplementary Figure S1). Importantly, ZAC-induced up-regulation of POX and PTEN was preserved in p53-defective SW480, Isreco-1, and HT-29 cells (Fig. 5D; ref. 38; data not shown), indicating that the induction by ZAC is not mediated via coactivation of p53. Moreover, in agreement with above results, neither Hct-15 cells expressing mutant PPARg (39) nor Hct116cells treated with PPAR g-siRNA exhibited any ZAC-induced up-regulation of these PPARg targets (Fig. 5D). In summary, these data conclusively show the activation of PPARg downstream pathways by ZAC via induction of a functional PPARg protein. To investigate if this concept also applies to endogenous Zac expression, we treated the rat pituitary tumor cell line GH3 (40, 41) with the somatostatin analogue octreotide, which potently induces Zac expression through activated GSK3h-dependent pathways (10). We detected progressively increasing Zac mRNA levels following 6, 12, and 24 hours of treatment, which was accompanied by simultaneous elevation of Zac protein levels (Fig. 6A). Importantly, PPARg mRNA and protein were increased after 12 and 24 hours (i.e., induction was time shifted to that of Zac; Fig. 6A). To confirm that PPARg induction was Zac dependent, we treated GH3 cells with octreotide 24 hours after their transfection with Figure 6. PPARg mediates Zac antiproliferation in response to octreotide Zac-siRNA. As shown in Fig. 6B, Zac-siRNA largely prevented treatment. A, PPARg expression is enhanced in response to octreotide. RT-PCR and immunoblot showing Zac and PPARg induction in GH3 cells at different octreotide-dependent Zac induction at mRNA and protein levels. time points of octreotide (Oct) treatment (1 Amol/L). B, octreotide-induced Moreover, in contrast to cells transfected with scrambled siRNA, PPARg expression is Zac dependent. RT-PCR and immunoblot of Zac-siRNA- transfected (100 nmol/L) GH3 cells treated with octreotide (24 hours, 1 Amol/L) octreotide-induced PPARg expression was strongly impaired, 24 hours after transfection. Cells transfected with scrambled siRNA (scra) indicating that Zac function was necessary for the induction of were taken for control. C, antiproliferative Zac effects are partly dependent on PPARg. PPARg. GH3 cells were treated for 48 hours with octreotide (1 Amol/L) in the presence or absence of PPARg effectors rosiglitazone (5 Amol/L) and GW9662 To further examine if PPARg mediates Zac-dependent growth (100 nmol/L), respectively. Cell viability was determined by MTT assay. inhibition in response to octreotide (10), we treated GH3 cells with Columns, mean of four independent experiments; bars, SD. *, P < 0.05; octreotide in the presence or absence of PPARg agonist **, P < 0.01, Student’s t test. D, transfection of GH3 cells with PPARg-siRNA (100 nmol/L) partly reverses the Zac-mediated antiproliferative effect of rosiglitazone and antagonist GW9662, respectively. ChIP assays octreotide. PPARg levels are shown by RT-PCR and immunoblot. revealed an increased in vivo occupancy of the proximal PPARg1 promoter by Zac in response to octreotide, which was unaffected Finally, to show that PPARg mediates Zac antiproliferation, we by the PPARg effectors (Supplementary Figure S2). Importantly, treated GH3 cells with octreotide after transfection with PPARg- however, whereas rosiglitazone treatment synergistically enhanced siRNA. Similarly to the effect of PPARg antagonist GW9662 (Fig. 6C) the antiproliferative octreotide effect (Fig. 6C, columns 1–4), it was and in contrast to scrambled siRNA, PPARg-siRNA partly reversed partly antagonized by GW9662 (Fig. 6C, column 5). Thus, the octreotide-induced growth inhibition (Fig. 6D). Collectively, we synergistic response to octreotide and rosiglitazone reflects conclude that Zac induces PPARg in response to octreotide, which increased levels of activated PPARg following Zac induction. thereupon mediates part of the antiproliferative activity of Zac.

Cancer Res 2006; 66: (24). December 15, 2006 11980 www.aacrjournals.org

Discussion fact, we show here that ZAC-mediated PPARg induction activates The seven-zinc finger protein Zac is a transcriptional regulator client metabolic target genes. Zac overexpression due to imprint- controlling apoptosis and cell cycle arrest (1). However, until now, ing defects causes TNDM, which is characterized by a temporary no Zac-regulated genes have been identified providing insight insulin insufficiency at around birth and a strongly increased risk into Zac-dependent pathways in antiproliferation. Here, using for type 2 diabetes in later life. A recent study using a transgenic genome-wide expression analysis, we identify PPARg as the first mouse model of TNDM indicates that this form of diabetes involves h bona fide Zac target gene with antiproliferative properties. We impaired pancreatic development (i.e., a decreased -cell number show that Zac binds to the proximal PPARg1 promoter in vivo and and an impaired glucose-stimulated insulin secretion in neonates induces PPARg expression in several cell types (neural cells, colon and adults; ref. 19). Interestingly, PPARg function is also critical h carcinoma cells, and pituitary tumor cells) of different species for -cell proliferation and physiology: activation of PPARg is h (mouse, human, and rat). In human colon carcinoma cells, ZAC sufficient to inhibit -cell proliferation and PPARg overexpression activates PPARg downstream pathways: We detect a PPARg- significantly compromises glucose-stimulated insulin secretion h dependent, ZAC-induced up-regulation of PPAR target genes that (48–50). Conversely, elimination of PPARg in -cells leads to are linked to differentiation (KER20 and TSC22; refs. 35, 36) or pancreatic hyperplasia in mice, even if normal glucose homeostasis h growth inhibition, such as the tumor suppressor gene PTEN (37) in these animals indicates compensatory mechanisms in -cell and the proapoptotic gene POX (30). Moreover, we show that function (48). In view of the similar functions of Zac and PPARg in h PPARg mediates Zac antiproliferation in pituitary tumor cells in pancreatic -cells, we speculate that Zac-induced PPARg expres- response to octreotide. Thus, our study provides the first direct sion might also play a role in diabetic conditions, which might functional link between Zac and PPARg and additionally assigns open new possibilities for clinical treatment. them a role in somatostatin receptor-dependent pathways. In summary, there are several fields where the functions of Zac Consistent with our results, showing that Zac antiproliferation is and PPARg overlap, although future work is necessary to clarify the mediated by PPARg, both proteins play a role in tumor suppression extent of their interactions in these contexts under normal and c of breast cancer (4, 42–44) and pituitary adenomas (40, 41, 45, 46). disease conditions. By identifying PPAR as a new Zac target gene Acromegalic patients suffering from growth hormone (GH)– and showing that PPARg mediates Zac antiproliferation, we producing pituitary tumors are routinely treated with somatostatin present here the first direct functional link between these two analogues, such as octreotide. Although improvement in the signs factors, which might be particularly important for the understand- and symptoms of acromegaly due to normalization of GH secretion ing of their implications in cancer and diabetes. is achieved in most cases (64–74%), only f30% of patients show tumor shrinkage (47). Interestingly, it has been shown that PPARg Acknowledgments ligands suppress not only GH secretion but also proliferation of pituitary tumor cells in vivo (41, 45, 46). We show here that Received 4/29/2006; revised 9/19/2006; accepted 10/17/2006. Grant support: Deutsche Forschungsgemeinschaft grant (T. Barz and D. Spengler) octreotide induces PPARg via Zac and, moreover, observe a and European Integrated Project CRESCENDO (D. Spengler). synergistic growth inhibition by simultaneous treatment of The costs of publication of this article were defrayed in part by the payment of page pituitary tumor cells with octreotide and PPARg ligands (rosigli- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. tazone, 15-D-PGJ2). Thus, we suggest that a combined application We thank A. Toniolo (University of Insubria, Varese, Italy) for the HW3-5 cell line; of octreotide (to provide high PPARg levels via Zac) and PPARg J.K. Reddy (Feinberg School of Medicine, Chicago, IL) and J. Auwerx (CNRS/INSERM/ g ULP, Illkirch, France) for the PPARg1 promoter plasmids of mouse and human, agonists (to achieve full PPAR activation) might be more efficient respectively; G. Aust (Universita¨tLeipzig, Leipzig, Germany), S. Brand (Klinikum der in acromegaly therapy than either treatment alone. Universita¨tMu¨nchen-GroBhadern, Munich, Germany), D. Diehl (Ludwig-Maximilian Besides the interconnected role in antiproliferation of Zac and Universita¨t, Munich, Germany), and U. Wenzel (Technische Universita¨t Mu¨nchen, Freising, Germany) for colon carcinoma cell lines; and J. Deussing and B. Puetz (Max- PPARg, both proteins additionally operate in controlling metabolic Planck-Institute of Psychiatry) for microarray development and data normalization, functions (see Introduction), which might be similarly linked. In respectively.

References 6. Midorikawa Y, Yamamoto S, Ishikawa S, et al. et al. A positive feedback mechanism in the trans- Molecular karyotyping of human hepatocellular carci- criptional activation of Apaf-1 by p53 and the coacti- 1. Spengler D, Villalba M, Hoffmann A, et al. Regulation noma using single-nucleotide polymorphism arrays. vator Zac-1. Oncogene 2002;21:1469–76. of apoptosis and cell cycle arrest by Zac1, a novel zinc Oncogene 2006;25:5581–90. 12. Huang SM, Schonthal AH, Stallcup MR. Enhance- finger protein expressed in the pituitary gland and the 7. Murillo H, Schmidt LJ, Karter M, et al. Prostate cancer ment of p53-dependent gene activation by the tran- brain. EMBO J 1997;16:2814–25. cells use genetic and epigenetic mechanisms for scriptional coactivator Zac1. Oncogene 2001;20:2134–43. 2. Varrault A, Ciani E, Apiou F, et al. hZAC encodes a zinc progression to androgen independence. Genes Chromo- 13. Huang SM, Stallcup MR. Mouse Zac1, a transcrip- finger protein with antiproliferative properties and somes Cancer 2006;45:702–16. tional coactivator and repressor for nuclear receptors. maps to a chromosomal region frequently lost in 8. Abdollahi A, Bao R, Hamilton TC. LOT1 is a growth Mol Cell Biol 2000;20:1855–67. cancer. Proc Natl Acad Sci USA 1998;95:8835–40. suppressor gene down-regulated by the epidermal 14. Valente T, Auladell C. Expression pattern of Zac1 3. Abdollahi A, Godwin AK, Miller PD, et al. Identifica- growth factor receptor ligands and encodes a nuclear mouse gene, a new zinc-finger protein that regulates tion of a gene containing zinc-finger motifs based on zinc-finger protein. Oncogene 1999;18:6477–87. apoptosis and cellular cycle arrest, in both adult brain lost expression in malignantly transformed rat ovarian 9. Ordway JM, Williams K, Curran T. Transcription and along development. Mech Dev 2001;108:207–11. surface epithelial cells. Cancer Res 1997;57:2029–34. repression in oncogenic transformation: common tar- 15. Valente T, Junyent F, Auladell C. Zac1 is expressed in 4. Bilanges B, Varrault A, Basyuk E, et al. Loss of gets of epigenetic repression in cells transformed by Fos, progenitor/stem cells of the neuroectoderm and meso- expression of the candidate tumor suppressor gene ZAC Ras, or Dnmt1. Oncogene 2004;23:3737–48. derm during embryogenesis: differential phenotype of in breast cancer cell lines and primary tumors. 10. Theodoropoulou M, Zhang J, Laupheimer S, et al. the Zac1-expressing cells during development. Dev Dyn Oncogene 1999;18:3979–88. Octreotide, a somatostatin analogue, mediates its 2005;233:667–79. 5. Kamikihara T, Arima T, Kato K, et al. Epigenetic antiproliferative action in pituitary tumor cells by 16. Arima T, Drewell RA, Arney KL, et al. A conserved silencing of the imprinted gene ZAC by DNA methyl- altering phosphatidylinositol 3-kinase signaling and imprinting control region at the HYMAI/ZAC domain is ation is an early event in the progression of human inducing Zac1 expression. Cancer Res 2006;66:1576–82. implicated in transient neonatal diabetes mellitus. Hum ovarian cancer. Int J Cancer 2005;115:690–700. 11. Rozenfeld-Granot G, Krishnamurthy J, Kannan K, Mol Genet 2001;10:1475–83. www.aacrjournals.org 11981 Cancer Res 2006; 66: (24). December 15, 2006

17. Piras G, El KA, Kozlov S, et al. Zac1 (Lot1), a potential various mammalian cell lines. Nucleic Acids Res 1997;25: and cell type-specific mechanisms. J Biol Chem 2003; tumor suppressor gene, and the gene for e-sarcoglycan 1078–9. 278:22669–77. are maternally imprinted genes: identification by a 29. Landgrebe J, Welzl G, Metz T, et al. Molecular 40. Pagotto U, Arzberger T, Theodoropoulou M, et al. The subtractive screen of novel uniparental fibroblast lines. characterisation of antidepressant effects in the mouse expression of the antiproliferative gene ZAC is lost or Mol Cell Biol 2000;20:3308–15. brain using gene expression profiling. J Psychiatr Res highly reduced in nonfunctioning pituitary adenomas. 18. Varrault A, Bilanges B, Mackay DJ, et al. Character- 2002;36:119–29. Cancer Res 2000;60:6794–9. ization of the methylation-sensitive promoter of the 30. Pandhare J, Cooper SK, Phang JM. Proline oxidase, a 41. Bogazzi F, Ultimieri F, Raggi F, et al. PPARg inhibits imprinted ZAC gene supports its role in transient neo- proapoptotic gene, is induced by troglitazone: evidence GH synthesis and secretion and increases apoptosis of natal diabetes mellitus. J Biol Chem 2001;276:18653–6. for both peroxisome proliferator-activated receptor g- pituitary GH-secreting adenomas. Eur J Endocrinol 19. Ma D, Shield JP, Dean W, et al. Impaired glucose dependent and -independent mechanisms. J Biol Chem 2004;150:863–75. homeostasis in transgenic mice expressing the human 2006;281:2044–52. 42. Mueller E, Sarraf P, Tontonoz P, et al. Terminal transient neonatal diabetes mellitus locus, TNDM. J Clin 31. Hsu MC, Chang HC, Hung WC. HER-2/neu represses differentiation of human breast cancer through PPARg. Invest 2004;114:339–48. the metastasis suppressor RECK via ERK and Sp Mol Cell 1998;1:465–70. 20. Bilanges B, Varrault A, Mazumdar A, et al. Alternative transcription factors to promote cell invasion. J Biol 43. Elstner E, Muller C, Koshizuka K, et al. Ligands for splicing of the imprinted candidate tumor suppressor Chem 2006;281:4718–25. peroxisome proliferator-activated receptorg and reti- gene ZAC regulates its antiproliferative and DNA 32. Wada K, Nakajima A, Katayama K, et al. Peroxisome noic acid receptor inhibit growth and induce apoptosis binding activities. Oncogene 2001;20:1246–53. proliferator-activated receptor g-mediated regulation of of human breast cancer cells in vitro and in BNX mice. 21. Hoffmann A, Ciani E, Boeckardt J, Holsboer F, neural stem cell proliferation and differentiation. J Biol Proc Natl Acad Sci USA 1998;95:8806–11. Journot L, Spengler D. Transcriptional activities of the Chem 2006;281:12673–81. 44. Suzuki T, Hayashi S, Miki Y, et al. Peroxisome zinc finger protein Zac are differentially controlled by 33. Pagotto U, Arzberger T, Ciani E, et al. Inhibition of proliferator-activated receptor g in human breast DNA binding. Mol Cell Biol 2003;23:988–1003. Zac1, a new gene differentially expressed in the anterior carcinoma: a modulator of estrogenic actions. Endocr 22. Hoffmann A, Barz T, Spengler D. Multitasking C2H2 pituitary, increases cell proliferation. Endocrinology Relat Cancer 2006;13:233–50. Zinc fingers link Zac DNA binding to coordinated 1999;140:987–96. 45. Heaney AP, Fernando M, Melmed S. PPAR-g receptor regulation of p300-histone acetyltransferase activity. Mol 34. Bakopanos E, Silva JE. Thiazolidinediones inhibit the ligands: novel therapy for pituitary adenomas. J Clin Cell Biol 2006;26:5544–57. expression of h3-adrenergic receptors at a transcrip- Invest 2003;111:1381–8. 23. Hoffmann A, Ciani E, Houssami S, Brabet P, Journot tional level. Diabetes 2000;49:2108–15. 46. Heaney AP, Fernando M, Yong WH, Melmed S. L, Spengler D. Induction of type I PACAP receptor 35. Gupta RA, Brockman JA, Sarraf P, Willson TM, Functional PPAR-g receptor is a novel therapeutic expression by the new zinc finger protein Zac1 and p53. DuBois RN. Target genes of peroxisome proliferator- target for ACTH-secreting pituitary adenomas. Nat Ann N Y Acad Sci 1998;865:49–58. activated receptor g in colorectal cancer cells. J Biol Med 2002;8:1281–7. 24. Rosen ED, Spiegelman BM. PPARg: a nuclear Chem 2001;276:29681–7. 47. Freda PU. Somatostatin analogs in acromegaly. J Clin regulator of metabolism, differentiation, and cell 36. Gupta RA, Sarraf P, Brockman JA, et al. Peroxisome Endocrinol Metab 2002;87:3013–8. growth. J Biol Chem 2001;276:37731–4. proliferator-activated receptor g and transforming 48. Rosen ED, Kulkarni RN, Sarraf P, et al. Targeted 25. Fajas L, Auboeuf D, Raspe E, et al. The organization, growth factor-h pathways inhibit intestinal epithelial elimination of peroxisome proliferator-activated recep- promoter analysis, and expression of the human PPARg cell growth by regulating levels of TSC-22. J Biol Chem tor g in h cells leads to abnormalities in islet mass gene. J Biol Chem 1997;272:18779–89. 2003;278:7431–8. without compromising glucose homeostasis. Mol Cell 26. ZhuY,QiC,KorenbergJR,etal.Structural 37. Patel L, Pass I, Coxon P, Downes CP, Smith SA, Biol 2003;23:7222–9. organization of mouse peroxisome proliferator-activat- Macphee CH. Tumor suppressor and anti-inflammatory 49. Ito E, Ozawa S, Takahashi K, et al. PPAR-g overex- ed receptor g (mPPARg) gene: alternative promoter use actions of PPARg agonists are mediated via upregula- pression selectively suppresses insulin secretory capacity and different splicing yield two mPPARg isoforms. Proc tion of PTEN. Curr Biol 2001;11:764–8. in isolated pancreatic islets through induction of UCP-2 Natl Acad Sci USA 1995;92:7921–5. 38. Rodrigues NR, Rowan A, Smith ME, et al. p53 protein. Biochem Biophys Res Commun 2004;324:810–4. 27. Kuwahara C, Takeuchi AM, Nishimura T, et al. Prions mutations in colorectal cancer. Proc Natl Acad Sci 50. Ravnskjaer K, Boergesen M, Rubi B, et al. Peroxisome prevent neuronal cell-line death. Nature 1999;400:225–6. USA 1990;87:7555–9. proliferator-activated receptor a (PPARa) potentiates, 28. Hoffmann A, Villalba M, Journot L, Spengler D. A 39. Gupta RA, Sarraf P, Mueller E, et al. Peroxisome whereas PPARg attenuates, glucose-stimulated insulin novel tetracycline-dependent expression vector with low proliferator-activated receptor g-mediated differentia- secretion in pancreatic h-cells. Endocrinology 2005;146: basal expression and potent regulatory properties in tion: a mutation in colon cancer cells reveals divergent 3266–76.

Cancer Res 2006; 66: (24). December 15, 2006 11982 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2006 American Association for Cancer Research. Peroxisome Proliferator-Activated Receptor γ Is a Zac Target Gene Mediating Zac Antiproliferation

Thomas Barz, Anke Hoffmann, Markus Panhuysen, et al.

Cancer Res 2006;66:11975-11982.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/66/24/11975

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2006/12/14/66.24.11975.DC1

Cited articles This article cites 50 articles, 25 of which you can access for free at: http://cancerres.aacrjournals.org/content/66/24/11975.full#ref-list-1

Citing articles This article has been cited by 8 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/66/24/11975.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/66/24/11975. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.