DOCSLIB.ORG

Onco-Proteogenomic Exploration of Variant Peptide Detection in Disease Models and Clinical Specimens

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Onco-Proteogenomic Exploration of Variant Peptide Detection in Disease Models and Clinical Specimens Onco-proteogenomic exploration of variant peptide detection in disease models and clinical specimens by Lampros Dimitrakopoulos A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Laboratory Medicine and Pathobiology University of Toronto © Copyright by Lampros Dimitrakopoulos 2017 Onco-proteogenomic exploration of variant peptide detection in disease models and clinical specimens Lampros Dimitrakopoulos Doctor of Philosophy Laboratory Medicine and Pathobiology University of Toronto 2017 Abstract This thesis describes the efforts of integrating nucleotide sequencing results with mass spectrometry-based proteomic results to identify variants predicted from sequencing and being expressed at the proteome level within a proteogenomic framework. Specifically, the study was carried out in three levels. The first was a proof of concept study to demonstrate the feasibility of variant peptide detection in clinical specimens and reveal intrinsic strengths and weaknesses of the onco-proteogenomic pipeline. Subsequently, sequencing-predicted variants were tracked at the proteome level in cancer cell lines and breast cancer tissues. The results from both homogeneous and heterogeneous cell populations reveal the proportion of sequencing-predicted variant peptides detected at the proteome level, how different variant calling filtering criteria from sequencing raw data and alternative ways to search for variant peptides influence this number, a correlation between transcript abundance and variant peptide detection and how the translated mutant versions of the proteins may influence the observed phenotype. Overall, the results of the present dissertation provide promising evidence that the combination of the well-established sequencing technologies and the excellent capabilities of state of the art mass spectrometry instruments can effectively detect variant peptides in clinical specimens and that this approach has the potential to be optimized to harness its full potential and realize precision medicine translational applications. ii Dedication This dissertation is dedicated to my parents, Demosthenes and Paraskevi iii Acknowledgements This thesis is the product of a five-year long arduous effort and would not have been realized if it was not for the critical contribution of many individuals. First of all I would like to thank my supervisor Dr. Eleftherios P. Diamandis for his continuous guidance, support, encouragement and the excellent mentorship he provided me. He gave me the incredible opportunity to join his laboratory that has published world-leading research articles, work in this environment and improve as a scientist and as a person. I am also grateful that I had Dr. George Charames as a co-supervisor all these years. He added his expertise, while his precious advice and insightful comments have been invaluable, thus helping me overcome all difficulties encountered. I would like to extend my appreciation to the members of my advisory committee who provided important counseling and critically assisted in honing the study described in the following pages: Drs. Susan Done and George Yousef. I also desire to extend my acknowledgements to the members of my final oral examination committee, Drs. Thomas Kislinger and James Scholey, as well as the external appraiser of this thesis, Dr. Harriet Feilotter, for their valuable time and feedback. A special thank you goes to my co-author Ioannis Prassas, who as a recent alumni of the Department of Laboratory Medicine and Pathobiology not only was a key contributor of the studies constituting my thesis, but he also gave me vital help to navigate through all the ups and downs that inevitably accompany such a strenuous and demanding journey as a PhD. I would also like to thank all the past and present members of the lab and the lab manager Antoninus Soosaipillai. It was an honor to interact with each and every one of them and have the chance to exchange ideas and opinions spanning across a diverse spectrum of projects. I would like to specially thank Christina, Dimitris, Ilijana and Theano, with whom I spent considerable time outside the lab and had the chance to engage in stimulating discussions and extracurricular activities extremely important to destress from work. As an international student, I soon realized it is double as important to have a circle of friends in order to be able to keep up with the hectic pace of graduate life. I will always feel grateful toward the Department of Laboratory Medicine and Pathobiology and the University of Toronto for accepting me as a graduate student and giving me iv the opportunity to be exposed to top-notch research that forms the basis for the scientific breakthroughs of the upcoming decades and for providing me with the ability to work myself with state-of-the-art instrumentation and in modern facilities, and thus help me grow as a scientist. I owe many thanks to all my overseas friends and especially those from back home that were always available to talk to me in times that I felt nostalgic or needed a familiar person to cheer me up. A very special shout-out to Manos. I would also like to thank every single person not mentioned here, that at any point throughout my graduate studies supported me and made me believe in myself and that I can reach the finish line successfully, no matter the hardships I encountered. The defense of a PhD thesis, being the capstone of post-secondary education, inevitably evokes memories from the past. Therefore, I would like to thank my professor and supervisor of my Master’s and undergraduate theses, Evi Lianidou and all my teachers and professors from primary school until today. Looking back, I realize how amazing it is that every single teacher has contributed in a very distinctive way in shaping my educational background and influencing various aspects of my personality as well. As the Athenian statesman Solon said, “As I grow older, I constantly learn more”. And it is astonishing to consider how many things one can learn in a lifetime… Last but not least, I could never have reached this point if it was not for my beloved parents. I will always be deeply thankful to them for the values that instilled in me, for their endless encouragement and for always believing in me. I will always appreciate all the sacrifices they have made for me and that they have been so supportive to the best possible extent. Therefore, I would like to dedicate this thesis to them. v Table of Contents Dedication ...................................................................................................................................... iii Acknowledgements ........................................................................................................................ iv Table of Contents ........................................................................................................................... vi List of Tables .................................................................................................................................. x List of Figures ............................................................................................................................... xii List of Appendices ....................................................................................................................... xiv List of Abbreviations .................................................................................................................... xv Introduction ................................................................................................................................ 2 1.1 Background ......................................................................................................................... 2 1.2 Cancer -omics ..................................................................................................................... 3 1.2.1 Genomics ................................................................................................................ 3 1.2.2 Transcriptomics ....................................................................................................... 4 1.2.3 Proteomics ............................................................................................................... 5 1.3 Onco-proteogenomics ......................................................................................................... 6 1.3.1 Computational genomics ........................................................................................ 7 1.3.2 Computational proteomics .................................................................................... 11 1.3.3 Computational onco-proteogenomics ................................................................... 12 1.4 Onco-proteogenomics studies and applications ................................................................ 14 1.5 Potential of onco-proteogenomics .................................................................................... 19 1.6 Purpose and aim of the present study ............................................................................... 21 1.6.1 Rationale ............................................................................................................... 21 1.6.2 Hypothesis ............................................................................................................. 21 1.6.3 Objectives ............................................................................................................
Load more

Recommended publications
  • CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With
    + CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • 1.3 the CRAC Channel
    CRAC channel related proteins in the pathogenesis of inborn errors of immunity Laura Jane Rice Submitted in accordance with the requirements for the degree of Doctor of Philosophy The University of Leeds School of Medicine and Health Under the supervision of Rashida Anwar PhD and Sinisa Savic MD, PhD June 2021 Publication statement The candidate confirms that the work submitted is her own, except where work which has formed part of jointly-authored publications has been included. The contribution of the candidate and the other authors to this work has been explicitly indicated. The candidate confirms that appropriate credit has been given within the thesis where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Laura Jane Rice to be identified as Author of this work has been asserted by her in accordance with the Copyright, Designs and Patents Act 1988. © 2021 The University of Leeds and Laura Jane Rice ii Acknowledgements This work was funded by University of Leeds and CSL Behring (West Sussex, UK). I would like to thank my supervisors for their continued support. Rashida Anwar for her scientific knowledge, detail driven questions and help during the writing of this thesis. Sinisa Savic for his encouragement and clinical and immunology expertise. The Anwar group and Level 9 WTBB PhD students made this experience enjoyable with coffee and gin. I was fortunate to have collaborators with experience in CRAC channel research.
    [Show full text]
  • Oma1 (NM 025909) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR208350 Oma1 (NM_025909) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Oma1 (NM_025909) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Oma1 Synonyms: 2010001O09Rik; MPRP-1; ZMPOMA1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Oma1 (NM_025909) Mouse Tagged ORF Clone – MR208350 ORF Nucleotide >MR208350 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCCTCCTTTATGGACTGCAGTCTACCAGGATAAATCGGTTTCTCTCTGGAGTGAATAACCTGGCCA ACAGGAGACAGTGGACCCCCCCAGCAAGCTGTCCACTGGCACCAAAGCTCCGAGCAGTAAATGCATACTG GGGACTGAACACAGTCAGTCATTGTCATTCAGTGACCTTACTGCCTAGAAACTTTCTTTTCTGTAGGACT CTCAATCACAAAAAATCAAGATGCCTCTCAAGTGCCCAAAGCAAGGAATTGGGGGTGCTTACCTACAGAT GTACTGTGCGGGGTGATTCTGTTCTAAGACAAGGAGCAAGGAAAGTGGCTGGCGTTCCTGCTCTCGCGGC CTCCTGTTCTCCAAGCTGTCCTGCCGTAATAGAGGCCCGGAGTTTCCGTACATCTGCAAGGGTTCAGGCT GCCCCAGTCCCTCTCTTGCTGCTCATTCTGAAGCCAGTGCAAAAGCTCCTTGCTATCATCGTGGGCAGGG GCATAAGGAAATGGTGGCAAGCACTTCCCCCTAACAAGAAGGAGCTATTTAAAGACAGCGTGAGGAAGAA CAAGTGGCGGCTGCTTCTTGGTCTGAGTGCATTTGGACTGCTCTTTGTAGTGTTTTATTTCACTCACCTG
    [Show full text]
  • The Hydroxyquinoline Analog YUM70 Inhibits GRP78 to Induce ER Stress- Mediated Apoptosis in Pancreatic Cancer
    Author Manuscript Published OnlineFirst on February 2, 2021; DOI: 10.1158/0008-5472.CAN-20-1540 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. The hydroxyquinoline analog YUM70 inhibits GRP78 to induce ER stress- mediated apoptosis in pancreatic cancer Soma Samanta1, Suhui Yang1, Bikash Debnath1, Ding Xue1, Yuting Kuang1, 2, Kavya Ramkumar1, 2, Amy S. Lee3, Mats Ljungman4, and Nouri Neamati1* 1Department of Medicinal Chemistry, College of Pharmacy, Rogel Cancer Center, University of Michigan, Ann Arbor, MI, 48109, USA. 2Department of Pharmacology and Pharmaceutical Sciences, School of Pharmacy, University of Southern California, Los Angeles, CA, USA. 3Department of Biochemistry and Molecular Medicine, University of Southern California, Keck School of Medicine, USC Norris Comprehensive Cancer Center, Los Angeles 90089, CA, USA. 4Department of Radiation Oncology, Rogel Cancer Center, Center for RNA Biomedicine, University of Michigan Medical School, and Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, Michigan 48109, USA. *Corresponding Author: Nouri Neamati, Ph.D. Department of Medicinal Chemistry, College of Pharmacy, Rogel Cancer Center, University of Michigan, North Campus Research Complex, 1600 Huron Parkway, Bldg 520, Room 1363, Ann Arbor, MI 48109, Phone: 734-647-2732, Email: [email protected] Running title: YUM70 induces ER stress and apoptosis in pancreatic cancer Keywords: GRP78, ER stress, apoptosis, pancreatic cancer, PROTAC Additional information: Corresponding Author: Nouri Neamati, Ph.D. Department of Medicinal Chemistry, College of Pharmacy, Rogel Cancer Center, University of Michigan, North Campus Research Complex, 1600 Huron PKWY, Bldg 520, Room 1363, Ann Arbor, MI 48109, Phone: 734-647-2732, Email: [email protected] DECLARATION OF INTERESTS: The authors declare no competing interests 1 Downloaded from cancerres.aacrjournals.org on September 25, 2021.
    [Show full text]
  • Abstracts from the 51St European Society of Human Genetics Conference: Electronic Posters
    European Journal of Human Genetics (2019) 27:870–1041 https://doi.org/10.1038/s41431-019-0408-3 MEETING ABSTRACTS Abstracts from the 51st European Society of Human Genetics Conference: Electronic Posters © European Society of Human Genetics 2019 June 16–19, 2018, Fiera Milano Congressi, Milan Italy Sponsorship: Publication of this supplement was sponsored by the European Society of Human Genetics. All content was reviewed and approved by the ESHG Scientific Programme Committee, which held full responsibility for the abstract selections. Disclosure Information: In order to help readers form their own judgments of potential bias in published abstracts, authors are asked to declare any competing financial interests. Contributions of up to EUR 10 000.- (Ten thousand Euros, or equivalent value in kind) per year per company are considered "Modest". Contributions above EUR 10 000.- per year are considered "Significant". 1234567890();,: 1234567890();,: E-P01 Reproductive Genetics/Prenatal Genetics then compared this data to de novo cases where research based PO studies were completed (N=57) in NY. E-P01.01 Results: MFSIQ (66.4) for familial deletions was Parent of origin in familial 22q11.2 deletions impacts full statistically lower (p = .01) than for de novo deletions scale intelligence quotient scores (N=399, MFSIQ=76.2). MFSIQ for children with mater- nally inherited deletions (63.7) was statistically lower D. E. McGinn1,2, M. Unolt3,4, T. B. Crowley1, B. S. Emanuel1,5, (p = .03) than for paternally inherited deletions (72.0). As E. H. Zackai1,5, E. Moss1, B. Morrow6, B. Nowakowska7,J. compared with the NY cohort where the MFSIQ for Vermeesch8, A.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Large Rab Gtpases: Novel Membrane Trafficking Regulators with a Calcium Sensor and Functional Domains
    International Journal of Molecular Sciences Review Large Rab GTPases: Novel Membrane Trafficking Regulators with a Calcium Sensor and Functional Domains Takayuki Tsukuba 1,* , Yu Yamaguchi 1 and Tomoko Kadowaki 2 1 Department of Dental Pharmacology, Graduate School of Biomedical Sciences, Nagasaki University, Sakamoto 1-7-1, Nagasaki 852-8588, Japan; [email protected] 2 Department of Frontier Oral Science, Graduate School of Biomedical Sciences, Nagasaki University, Sakamoto 1-7-1, Nagasaki 852-8588, Japan; [email protected] * Correspondence: [email protected] Abstract: Rab GTPases are major coordinators of intracellular membrane trafficking, including vesicle transport, membrane fission, tethering, docking, and fusion events. Rab GTPases are roughly divided into two groups: conventional “small” Rab GTPases and atypical “large” Rab GTPases that have been recently reported. Some members of large Rab GTPases in mammals include Rab44, Rab45/RASEF, and Rab46. The genes of these large Rab GTPases commonly encode an amino- terminal EF-hand domain, coiled-coil domain, and the carboxyl-terminal Rab GTPase domain. A common feature of large Rab GTPases is that they express several isoforms in cells. For instance, Rab44’s two isoforms have similar functions, but exhibit differential localization. The long form of Rab45 (Rab45-L) is abundantly distributed in epithelial cells. The short form of Rab45 (Rab45-S) is predominantly present in the testes. Both Rab46 (CRACR2A-L) and the short isoform lacking the Rab domain (CRACR2A-S) are expressed in T cells, whereas Rab46 is only distributed in endothelial cells. Although evidence regarding the function of large Rab GTPases has been accumulating recently, there Citation: Tsukuba, T.; Yamaguchi, Y.; are only a limited number of studies.
    [Show full text]
  • New Approach for Untangling the Role of Uncommon Calcium-Binding Proteins in the Central Nervous System
    brain sciences Review New Approach for Untangling the Role of Uncommon Calcium-Binding Proteins in the Central Nervous System Krisztina Kelemen * and Tibor Szilágyi Department of Physiology, Doctoral School, Faculty of Medicine, George Emil Palade University of Medicine, Pharmacy, Science, and Technology of Targu Mures, 540142 Târgu Mures, , Romania; [email protected] * Correspondence: [email protected]; Tel.: +40-746-248064 Abstract: Although Ca2+ ion plays an essential role in cellular physiology, calcium-binding proteins (CaBPs) were long used for mainly as immunohistochemical markers of specific cell types in different regions of the central nervous system. They are a heterogeneous and wide-ranging group of proteins. Their function was studied intensively in the last two decades and a tremendous amount of informa- tion was gathered about them. Girard et al. compiled a comprehensive list of the gene-expression profiles of the entire EF-hand gene superfamily in the murine brain. We selected from this database those CaBPs which are related to information processing and/or neuronal signalling, have a Ca2+- buffer activity, Ca2+-sensor activity, modulator of Ca2+-channel activity, or a yet unknown function. In this way we created a gene function-based selection of the CaBPs. We cross-referenced these findings with publicly available, high-quality RNA-sequencing and in situ hybridization databases (Human Protein Atlas (HPA), Brain RNA-seq database and Allen Brain Atlas integrated into the HPA) and created gene expression heat maps of the regional and cell type-specific expression levels of the selected CaBPs. This represents a useful tool to predict and investigate different expression patterns and functions of the less-known CaBPs of the central nervous system.
    [Show full text]
  • C11orf83 (UQCC3) (NM 001085372) Human Tagged ORF Clone Lentiviral Particle Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC213079L3V C11orf83 (UQCC3) (NM_001085372) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: C11orf83 (UQCC3) (NM_001085372) Human Tagged ORF Clone Lentiviral Particle Symbol: UQCC3 Synonyms: C11orf83; CCDS41658.1; MC3DN9; UNQ655 Vector: pLenti-C-Myc-DDK-P2A-Puro (PS100092) ACCN: NM_001085372 ORF Size: 279 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC213079). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_001085372.2 RefSeq Size: 1959 bp RefSeq ORF: 282 bp Locus ID: 790955 UniProt ID: Q6UW78 Protein Families: Transmembrane MW: 10.5 kDa Gene Summary: Complex III is a mitochondrial inner membrane protein complex that transfers electrons from ubiquinol to cytochrome c. This gene encodes a protein that functions in complex III assembly. Mutations in this gene result in Mitochondrial complex III deficiency, nuclear type 9. [provided by RefSeq, Dec 2014] This product is to be used for laboratory only.
    [Show full text]
  • Supplementary Information – Postema Et Al., the Genetics of Situs Inversus Totalis Without Primary Ciliary Dyskinesia
    1 Supplementary information – Postema et al., The genetics of situs inversus totalis without primary ciliary dyskinesia Table of Contents: Supplementary Methods 2 Supplementary Results 5 Supplementary References 6 Supplementary Tables and Figures Table S1. Subject characteristics 9 Table S2. Inbreeding coefficients per subject 10 Figure S1. Multidimensional scaling to capture overall genomic diversity 11 among the 30 study samples Table S3. Significantly enriched gene-sets under a recessive mutation model 12 Table S4. Broader list of candidate genes, and the sources that led to their 13 inclusion Table S5. Potential recessive and X-linked mutations in the unsolved cases 15 Table S6. Potential mutations in the unsolved cases, dominant model 22 2 1.0 Supplementary Methods 1.1 Participants Fifteen people with radiologically documented SIT, including nine without PCD and six with Kartagener syndrome, and 15 healthy controls matched for age, sex, education and handedness, were recruited from Ghent University Hospital and Middelheim Hospital Antwerp. Details about the recruitment and selection procedure have been described elsewhere (1). Briefly, among the 15 people with radiologically documented SIT, those who had symptoms reminiscent of PCD, or who were formally diagnosed with PCD according to their medical record, were categorized as having Kartagener syndrome. Those who had no reported symptoms or formal diagnosis of PCD were assigned to the non-PCD SIT group. Handedness was assessed using the Edinburgh Handedness Inventory (EHI) (2). Tables 1 and S1 give overviews of the participants and their characteristics. Note that one non-PCD SIT subject reported being forced to switch from left- to right-handedness in childhood, in which case five out of nine of the non-PCD SIT cases are naturally left-handed (Table 1, Table S1).
    [Show full text]