DOCSLIB.ORG

Riboflavin Inhibits Growth of Helicobacter Pylori by Down-Regulation of Pola and Dnab Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Riboflavin Inhibits Growth of Helicobacter Pylori by Down-Regulation of Pola and Dnab Genes Biomedical Science Letters 2020, 26(4): 288~295 Original Article https://doi.org/10.15616/BSL.2020.26.4.288 eISSN : 2288-7415 Riboflavin Inhibits Growth of Helicobacter pylori by Down-regulation of polA and dnaB Genes Hye Jin Kwon1,§,*, Min Ho Lee2,§,**, Hyun Woo Kim1,*, Ji Yeong Yang1,*, Hyun Jun Woo3,***, Min Park4,***, Cheol Moon3,***, Sa-Hyun Kim3,†,*** and Jong-Bae Kim1,†,*** 1Department of Biomedical Laboratory Science, College of Health Sciences, Yonsei University, Wonju 26493, Korea 2Forensic DNA Division, National Forensic Service, Wonju 26460, Korea 3Department of Clinical Laboratory Science, Semyung University, Jaecheon 27136, Korea 4Department of Biomedical Laboratory Science, Daekyeung University, Gyeongsan 38547, Korea Infection of Helicobacter pylori on gastric mucosa is associated with various gastric diseases. According to the WHO, H. pylori causes gastric cancer and has been classified as a class I carcinogen. Riboflavin is an essential vitamin which presents in a wide variety of foods. Previous studies have shown that riboflavin/UVA was effective against the growth inhibition of Staphylococcus aureus, S. epidermidis and multidrug-resistant Pseudomonas aeruginosa and had the potential for antimicrobial properties. Thus, we hypothesized that riboflavin has a potential role in the growth inhibition of H. pylori. To demonstrate inhibitory concentration of riboflavin against H. pylori, we performed agar and broth dilution methods. As a result, we found that riboflavin inhibited the growth of H. pylori. The MIC was 1 mM in agar and broth dilution test. Furthermore, to explain the inhibitory mechanism, we investigated whether riboflavin has an influence on the replication- associated molecules of the bacteria using RT-PCR to detect mRNA expression level in H. pylori. Riboflavin treatment of H. pylori led to down-regulation of polA and dnaB mRNA expression levels in a dose dependent manner. After then, we also confirmed whether riboflavin has cytotoxicity to human cells. We used AGS, a gastric cancer cell line, and treated with riboflavin did not show statistically significant decrease of cell viability. Thus, these results indicate that riboflavin can suppress the replication machinery of H. pylori. Taken together, these findings demonstrate that riboflavin inhibits growth of H. pylori by inhibiting replication of the bacteria. Key Words: Riboflavin, Helicobacter pylori, PolA, DnaB, Antibacterial H. pylori has been known to primarily colonize on human INTRODUCTION gastric epithelium. Approximately half of the world popula- tion harbor H. pylori and it has been suggested that infection Helicobacter pylori is a gram-negative spiral-shaped bac- of H. pylori generally occurs in childhood and transmitted terium which possess its characteristic helical appearance. from family members (Tharmalingam et al., 2016). Numer- Received: November 3, 2020 / Revised: December 17, 2020 / Accepted: December 20, 2020 * ** *** Graduate student, Resercher, Professor. § These authors contributed equally to this work. † Corresponding author: Jong-Bae Kim. Department of Biomedical Laboratory Science, College of Health Sciences, Yonsei University, Wonju 26493, Korea. Tel: +82-33-760-2423, Fax: +82-33-760-2561, e-mail: [email protected] † Corresponding author: Sa-Hyun Kim. Department of Clinical Laboratory Science, Semyung University, Jaecheon 27136, Korea. Tel: +82-43-649-1624, Fax: +82-43-649-1624, e-mail: [email protected] ○C The Korean Society for Biomedical Laboratory Sciences. All rights reserved. ○CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. - 288 - ous reports suggested that various gastric diseases such as sions of DNA replication genes in H. pylori were investigated gastric inflammation, chronic gastritis, peptic ulcer and gastric after riboflavin treatment. We also evaluated cytotoxicity of adenocarcinoma are associated with H. pylori infection riboflavin on mammalian cells. (Cover and Blaser, 2009). Epidemiologically, over 3 billion people are infected by this bacterium and develop persistent MATERIALS AND METHODS stomach inflammation, which lasts for decades unless treated Bacterial and mammalian cell culture with antibiotics. Moreover, World Health Organization clas- sified H. pylori as a class I carcinogen due to the organism The H. pylori reference strain ATCC 49503 was pur- causes gastric cancer (Peek and Blaser, 2002). chased from the American Type Culture Collection (ATCC, Riboflavin (vitamin B2) is an essential water-soluble sub- Manassas, VA, USA). H. pylori were grown on brucella agar stance present in a wide variety of foods and required for plates (BD Biosciences, Franklin Lakes, NJ, USA) supple- normal cellular functions, including growth and development mented with 10% bovine serum (BRL Life Technologies, in all aerobic forms of life. Riboflavin is known as cofactors Grand Island, NY, USA) under microaerophilic and 100 for enzymes involved in oxidation-reduction reactions, and percent humidity conditions at 37℃ and inspected after three has a role in the oxidative folding of proteins in the endo- days. plasmic reticulum (Hoppel and Tandler, 1975; Tu et al., 2000). AGS gastric adenocarcinoma cells (ATCC CRL-1739) Its most important biological forms, flavin adenine di- were purchased from the Korean Cell Line Bank (Seoul, nucleotide (FAD) and flavin mononucleotide, participate Korea) and cultured in Dulbecco's modified Eagle's medium in a range of redox reactions, some of which are essential (DMEM, BRL Life Technologies) supplemented with 10% to the function of aerobic cells (Powers, 2003). Previous fetal bovine serum (FBS, BRL Life Technologies) and studies have shown that riboflavin can protect microbial streptomycin-penicillin (100 μg/mL and 100 IU/mL) (BRL keratitis. Riboflavin/UVA was effective against Staphylo- Life Technologies). Cells were incubated at 37℃ in a coccus aureus, Staphylococcus epidermidis, drug-resistant humidified atmosphere with 5% CO2. Streptococcus pneumoniae, methicillin-resistant S. aureus, Agar dilution method to determine MIC multidrug-resistant Pseudomonas aeruginosa, and drug- resistant Streptococcus pneumoniae and had the potential H. pylori colonies grown on brucella agar plates were for antimicrobial properties in vitro (Martins et al., 2008). collected and suspended in saline. The number of bacterial Moreover, riboflavin has been found to increase the survival particles in the H. pylori suspension was set to McFarland rate of mice suffering endotoxin-induced sepsis and Gram- 2.0 (6×108/mL), 10 μL of the bacterial suspension was negative and Gram-positive bacterial infection (Shih et al., placed on the Mueller-Hinton agar (BD Biosciences) sup ple 2010). In addition, riboflavin was also involved in the enhan- mented with 10% bovine serum including indicated con- cement of antitumor activity of many anticancer drugs, as centrations of riboflavin. All solutions were prepared in such well as in the activation of the immune system to kill tumor a manner that the final dimethylsulfoxide (DMSO) concen- cells (Zhu et al., 2006; de Souza Queiroz et al., 2007; Santos tration was the same in all treatments. The bacteria were et al., 2007). incubated for 72 hours and the MIC was determined based Based on the previous reports suggesting anti-microbial on the lowest concentration at which inhibition of growth activity of riboflavin, we hypothesized that riboflavin has a was observed in a previous report (Yang et al., 2019). potential role in the growth inhibition of H. pylori. To prove Broth dilution method to determine MIC this hypothesis, we investigated the effect of riboflavin against H. pylori growth. We determined minimal inhibitory H. pylori suspension set to McFarland 0.33 was prepared concentration (MIC) of riboflavin against H. pylori using in Mueller-Hinton broth (BD Biosciences) supplemented agar dilution method and broth dilution method. Then expres- with 10% bovine serum. Various concentrations of riboflavin - 289 - Table 1. List of primer sequences and PCR conditions for RT-PCR Sequences (5'-3') Product Anncaling Primers length temperature Cycles Reference* Forward Reverse (bp) (℃) DnaA GGGCATGACTTAGCGGTTA TTAACGAATTGCACGCCAAC 128 55 27 DnaB AATGGGCCGTTTATCGTCTC CAAATCCGCTTGCAACTACG 231 55 27 DnaE AATCCACCGGCTCCAAATAC GCCAAACAAGTGTGGGAGTA 184 55 27 DnaN GTTAGCGGTGGTTGAAAACG CGGTTTCGCTATGCTCAGAA 233 55 27 DnaQ CGCATGAAGCTTTGCAAGAA GCATAGGCTCTATGGCTGAC 244 55 27 * PloA TCATCATCATTGCCGACTGG GTCATGCGCAAACACATTCA 134 55 24 HolB GCCCTTGAAATCGTGCTTAC ATGATGAGAGCTACCCGACA 196 55 25 RpoB TTTAGGTAAGCGCGTGGATT AATCAGCTTTGGATGGAACG 301 59 24 POLA1 GCCAGTTTTGGGCTGGTTG GTTCGGTTTTGTCACTGCGA 458 57 29 MCM2 GGCGGAATCATCGGAATCCT ATCATCCAGAGCCAGTCCCT 295 57 29 (Lee et al., GAPDH CGGGAAGCTTGTCATCAATGG GGCAGTGATGGCATGGACTG 349 55 24 2015a) *The primers without reference are designed in this study were added and the bacteria were grown at 37℃ for 72 h and destained in distilled water for 20 minutes. Gel images TM in a humidified atmosphere with 10% CO2. All solutions were taken using Molecular Image Gel Doc XR+ system were prepared in such a manner that the final DMSO con- (Bio-Rad, Hercules, CA, USA). The band intensity of PCR centration was the same in all treatments. The final optical product was analyzed with the ImageLab
Load more

Recommended publications
  • 1 Mechanistic Studies of DNA Replication, Lesion Bypass, And
    Mechanistic Studies of DNA Replication, Lesion Bypass, and Editing Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Austin Tyler Raper, B.S. The Ohio State University Biochemistry Graduate Program The Ohio State University 2018 Dissertation Committee Dr. Zucai Suo, Advisor Dr. Ross Dalbey Dr. Michael Poirier Dr. Richard Swenson 1 Copyrighted by Austin Tyler Raper 2018 2 Abstract DNA acts as a molecular blueprint for life. Adenosine, cytidine, guanosine, and thymidine nucleotides serve as the building blocks of DNA and can be arranged in near- endless combinations. These unique sequences of DNA may encode genes that when expressed produce RNA, proteins, and enzymes responsible for executing diverse tasks necessary for biological existence. Accordingly, careful maintenance of the molecular integrity of DNA is paramount for the growth, development, and functioning of organisms. However, DNA is damaged upon reaction with pervasive chemicals generated by normal cellular metabolism or encountered through the environment. The resulting DNA lesions act as roadblocks to high-fidelity A- and B-family DNA polymerases responsible for replicating DNA in preparation for cell division which may lead to programmed cell death. Additionally, these lesions may fool the polymerase into making errors during DNA replication, leading to genetic mutations and cancer. Fortunately, the cell has evolved DNA damage tolerance as an emergency response to such lesions. During DNA damage tolerance, a damage-stalled high-fidelity polymerase is substituted for a specialized Y-family polymerase, capable of bypassing the offending DNA lesion, for replication to continue.
    [Show full text]
  • DNA POLYMERASE III HOLOENZYME: Structure and Function of a Chromosomal Replicating Machine
    Annu. Rev. Biochem. 1995.64:171-200 Copyright Ii) 1995 byAnnual Reviews Inc. All rights reserved DNA POLYMERASE III HOLOENZYME: Structure and Function of a Chromosomal Replicating Machine Zvi Kelman and Mike O'Donnell} Microbiology Department and Hearst Research Foundation. Cornell University Medical College. 1300York Avenue. New York. NY }0021 KEY WORDS: DNA replication. multis ubuni t complexes. protein-DNA interaction. DNA-de penden t ATPase . DNA sliding clamps CONTENTS INTRODUCTION........................................................ 172 THE HOLO EN ZYM E PARTICL E. .......................................... 173 THE CORE POLYMERASE ............................................... 175 THE � DNA SLIDING CLAM P............... ... ......... .................. 176 THE yC OMPLEX MATCHMAKER......................................... 179 Role of ATP . .... .............. ...... ......... ..... ............ ... 179 Interaction of y Complex with SSB Protein .................. ............... 181 Meclwnism of the yComplex Clamp Loader ................................ 181 Access provided by Rockefeller University on 08/07/15. For personal use only. THE 't SUBUNIT . .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 182 Annu. Rev. Biochem. 1995.64:171-200. Downloaded from www.annualreviews.org AS YMMETRIC STRUC TURE OF HOLO EN ZYM E . 182 DNA PO LYM ER AS E III HOLO ENZ YME AS A REPLIC ATING MACHINE ....... 186 Exclwnge of � from yComplex to Core .................................... 186 Cycling of Holoenzyme on the LaggingStrand
    [Show full text]
  • Glycolytic Pyruvate Kinase Moonlighting Activities in DNA Replication
    Glycolytic pyruvate kinase moonlighting activities in DNA replication initiation and elongation Steff Horemans, Matthaios Pitoulias, Alexandria Holland, Panos Soultanas, Laurent Janniere To cite this version: Steff Horemans, Matthaios Pitoulias, Alexandria Holland, Panos Soultanas, Laurent Janniere. Gly- colytic pyruvate kinase moonlighting activities in DNA replication initiation and elongation. 2020. hal-02992157 HAL Id: hal-02992157 https://hal.archives-ouvertes.fr/hal-02992157 Preprint submitted on 10 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Glycolytic pyruvate kinase moonlighting activities in DNA replication initiation and elongation Steff Horemans1, Matthaios Pitoulias2, Alexandria Holland2, Panos Soultanas2¶ and Laurent Janniere1¶ 1 : Génomique Métabolique, Genoscope, Institut François Jacob, CEA, CNRS, Univ Evry, Université Paris-Saclay, 91057 Evry, France 2 : Biodiscovery Institute, School of Chemistry, University of Nottingham, University Park, Nottingham NG7 2RD, UK Short title: PykA moonlighting activity in DNA replication Key Words: DNA replication; replication control; central carbon metabolism; glycolytic enzymes; replication enzymes; cell cycle; allosteric regulation. ¶ : Corresponding authors Laurent Janniere: [email protected] Panos Soultanas : [email protected] 1 SUMMARY Cells have evolved a metabolic control of DNA replication to respond to a wide range of nutritional conditions.
    [Show full text]
  • The Role of Metabolites in the Link Between DNA Replication and Central Carbon Metabolism in Escherichia Coli
    G C A T T A C G G C A T genes Article The Role of Metabolites in the Link between DNA Replication and Central Carbon Metabolism in Escherichia coli Klaudyna Krause 1, Monika Maci ˛ag-Dorszy´nska 2 , Anna Wosinski 3, Lidia Gaffke 3 , Joanna Morcinek-Orłowska 1,3, Estera Rintz 3, Patrycja Biela´nska 3, Agnieszka Szalewska-Pałasz 1, Georgi Muskhelishvili 4 and Grzegorz W˛egrzyn 3,* 1 Department of Bacterial Molecular Genetics, University of Gdansk, 80-308 Gdansk, Poland; [email protected] (K.K.); [email protected] (J.M.-O.); [email protected] (A.S.-P.) 2 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, 80-822 Gdansk, Poland; [email protected] 3 Department of Molecular Biology, University of Gdansk, 80-308 Gdansk, Poland; [email protected] (A.W.); lidia.gaff[email protected] (L.G.); [email protected] (E.R.); [email protected] (P.B.) 4 School of Natural Sciences, Agricultural University of Georgia, 0131 Tbilisi, Georgia; [email protected] * Correspondence: [email protected]; Tel.: +48-58-5236024 Received: 31 March 2020; Accepted: 16 April 2020; Published: 19 April 2020 Abstract: A direct link between DNA replication regulation and central carbon metabolism (CCM) has been previously demonstrated in Bacillus subtilis and Escherichia coli, as effects of certain mutations in genes coding for replication proteins could be specifically suppressed by particular mutations in genes encoding CCM enzymes. However, specific molecular mechanism(s) of this link remained unknown.
    [Show full text]
  • Coordination Between Nucleotide Excision Repair And
    RESEARCH ARTICLE Coordination between nucleotide excision repair and specialized polymerase DnaE2 action enables DNA damage survival in non-replicating bacteria Asha Mary Joseph1, Saheli Daw1, Ismath Sadhir1,2, Anjana Badrinarayanan1* 1National Centre for Biological Sciences - Tata Institute of Fundamental Research, Bangalore, India; 2Max Planck Institute for Terrestrial Microbiology, LOEWE Centre for Synthetic Microbiology (SYNMIKRO), Marburg, Germany Abstract Translesion synthesis (TLS) is a highly conserved mutagenic DNA lesion tolerance pathway, which employs specialized, low-fidelity DNA polymerases to synthesize across lesions. Current models suggest that activity of these polymerases is predominantly associated with ongoing replication, functioning either at or behind the replication fork. Here we provide evidence for DNA damage-dependent function of a specialized polymerase, DnaE2, in replication- independent conditions. We develop an assay to follow lesion repair in non-replicating Caulobacter and observe that components of the replication machinery localize on DNA in response to damage. These localizations persist in the absence of DnaE2 or if catalytic activity of this polymerase is mutated. Single-stranded DNA gaps for SSB binding and low-fidelity polymerase-mediated synthesis are generated by nucleotide excision repair (NER), as replisome components fail to localize in the absence of NER. This mechanism of gap-filling facilitates cell cycle restoration when cells are released into replication-permissive conditions. Thus, such cross-talk (between activity of NER and specialized polymerases in subsequent gap-filling) helps preserve genome integrity and enhances survival in a replication-independent manner. *For correspondence: [email protected] Introduction Competing interests: The DNA damage is a threat to genome integrity and can lead to perturbations to processes of replica- authors declare that no tion and transcription.
    [Show full text]
  • Coordination Between Nucleotide Excision Repair and Specialized Polymerase Dnae2 Action 2 Enables DNA Damage Survival in Non-Replicating Bacteria
    bioRxiv preprint doi: https://doi.org/10.1101/2021.02.15.431208; this version posted February 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Coordination between nucleotide excision repair and specialized polymerase DnaE2 action 2 enables DNA damage survival in non-replicating bacteria 3 4 5 6 7 Asha Mary Joseph, Saheli Daw, Ismath Sadhir and Anjana Badrinarayanan* 8 9 National Centre for Biological Sciences - Tata Institute of Fundamental Research, Bellary Road, 10 Bangalore 560065, Karnataka, India, Phone: 91 80 23666547 11 *Correspondence to: [email protected] 12 13 Keywords 14 Caulobacter crescentus, DnaE2, DNA repair, error-prone polymerases, non-replicating cells, 15 nucleotide excision repair, single-cell imaging, fluorescence microscopy 16 17 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.02.15.431208; this version posted February 15, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 18 Abstract 19 Translesion synthesis (TLS) is a highly conserved mutagenic DNA lesion tolerance pathway, which 20 employs specialized, low-fidelity DNA polymerases to synthesize across lesions. Current models 21 suggest that activity of these polymerases is predominantly associated with ongoing replication, 22 functioning either at or behind the replication fork.
    [Show full text]
  • A Multi-Disciplinary Investigation of Essential DNA Replication Proteins
    A Multi-Disciplinary Investigation of Essential DNA Replication Proteins DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Varun V. Gadkari Graduate Program in Biochemistry The Ohio State University 2017 Dissertation Committee: Dr. Zucai Suo, Advisor Dr. Jane Jackman Dr. Comert Kural Dr. Richard Swenson Copyrighted by Varun V. Gadkari 2017 Abstract An organism’s DNA is constantly under attack from various exogenous and endogenous DNA damaging agents. Thus, to assure survival, all living cells have evolved to maintain the genetic integrity of their DNA by various pathways. If left unrepaired, DNA damage sites, or “lesions” can block DNA replication by stalling DNA polymerases, the enzymes responsible for DNA replication. Ultimately, if a stalled replication fork is not rescued, the cell will undergo apoptosis. To bypass DNA lesions, organisms in all domains of life initiate a process known as Translesion DNA Synthesis (TLS). During TLS, the stalled replicative DNA polymerase is displaced by specialized Y-family DNA polymerases that are capable of efficiently bypassing various forms of DNA damage. While Y-family DNA polymerases are proficient in TLS, the fidelity of the process is a notable cause for concern. TLS mechanisms of the different Y-family DNA polymerases vary greatly, and often introduce mutations in the DNA which can lead to carcinogenesis. Thus, the activity of Y-family DNA polymerases must be strictly regulated. To this end all living organisms depend on evolutionarily conserved sliding DNA clamps which bind the DNA in a toroidal fashion, and slide along DNA during replication, serving as a scaffold for the DNA replication and repair machinery.
    [Show full text]
  • A Model for DNA Polymerase Switching Involving a Single Cleft and the Rim of the Sliding Clamp
    A model for DNA polymerase switching involving a single cleft and the rim of the sliding clamp Justin M. H. Heltzel1, Robert W. Maul1,2, Sarah K. Scouten Ponticelli, and Mark D. Sutton3 Department of Biochemistry, School of Medicine and Biomedical Sciences, University at Buffalo, State University of New York, 3435 Main Street, 140 Farber Hall, Buffalo, NY 14214 Edited by Sue Hengren Wickner, National Institutes of Health, Bethesda, MD, and approved June 2, 2009 (received for review March 30, 2009) The actions of Escherichia coli DNA Polymerase IV (Pol IV) in mutagen- proteins involved in DNA replication, DNA repair, and cell cycle esis are managed by its interaction with the ␤ sliding clamp. In the progression (9). A similar situation is true for many eukaryotic Pols structure reported by Bunting et al. [EMBO J (2003) 22:5883–5892], the (10). Taken together, these findings suggest that sliding clamps act C-tail of Pol IV contacts a hydrophobic cleft on the clamp, while like traffic cops to coordinate the actions of different partners on residues V303–P305 reach over the dimer interface to contact the rim DNA. of the adjacent clamp protomer. Using mutant forms of these proteins One contact site between these partners and the clamp involves impaired for either the rim or the cleft contacts, we determined that a clamp-binding motif (CBM) present in the partners and a the rim contact was dispensable for Pol IV replication in vitro, while hydrophobic cleft located near the C-terminal tail of each clamp the cleft contact was absolutely required. Using an in vitro assay to protomer (11, 12).
    [Show full text]
  • 2-Sliding Clamp Accumulation in Live Escherichia Coli Cells
    ARTICLE Received 8 Jul 2014 | Accepted 11 Nov 2014 | Published 18 Dec 2014 DOI: 10.1038/ncomms6820 OPEN Slow unloading leads to DNA-bound b2-sliding clamp accumulation in live Escherichia coli cells M. Charl Moolman1, Sriram Tiruvadi Krishnan1, Jacob W.J. Kerssemakers1, Aafke van den Berg1, Pawel Tulinski1, Martin Depken1, Rodrigo Reyes-Lamothe2, David J. Sherratt3 & Nynke H. Dekker1 The ubiquitous sliding clamp facilitates processivity of the replicative polymerase and acts as a platform to recruit proteins involved in replication, recombination and repair. While the dynamics of the E. coli b2-sliding clamp have been characterized in vitro, its in vivo stoichiometry and dynamics remain unclear. To probe both b2-clamp dynamics and stoichiometry in live E. coli cells, we use custom-built microfluidics in combination with single- molecule fluorescence microscopy and photoactivated fluorescence microscopy. We quantify the recruitment, binding and turnover of b2-sliding clamps on DNA during replication. These quantitative in vivo results demonstrate that numerous b2-clamps in E. coli remain on the DNA behind the replication fork for a protracted period of time, allowing them to form a docking platform for other enzymes involved in DNA metabolism. 1 Department of Bionanoscience, Kavli Institute of Nanoscience, Faculty of Applied Sciences, Delft University of Technology, Lorentzweg 1, 2628 CJ Delft, The Netherlands. 2 Department of Biology, McGill University, Montreal, Quebec, Canada H3G 0B1. 3 Department of Biochemistry, University of Oxford, Oxford OX1 3QU, UK. Correspondence and requests for materials should be addressed to N.H.D. (email: [email protected]). NATURE COMMUNICATIONS | 5:5820 | DOI: 10.1038/ncomms6820 | www.nature.com/naturecommunications 1 & 2014 Macmillan Publishers Limited.
    [Show full text]
  • DNA Replication
    DNA Replication Abhi Nath MEDCH 570 [email protected] MedChem 570 ~ Medicinal Biochemistry: DNA Replication I. The Flow of Genetic Information The function of DNA is the storage of genetic information. DNA sequences known as genes specify the kinds of proteins that are made by cells. •DNA Replication refers to the synthesis of new DNA using the existing DNA as a template. •Transcription refers to the synthesis of RNA using a gene sequence (DNA) as a template. •Translation refers to the synthesis of a protein using an mRNA transcript as the template.The Flow of Genetic Information DNA Replication refers to the synthesis of new DNA using the existing DNA as a template. Nucleus Nucleus Cytosol Transcription refers to the synthesis of RNA using a gene sequence (DNA) as a template. Translation refers to the synthesis of a protein using an mRNA transcript as the template. Note that: Note that: • most human DNA is never transcribed. • not all RNA molecules are translated (e.g., rRNA, tRNA, others). • RNA is sometimes reverse transcribed back to DNA. •most human DNA is never transcribed •not all RNA molecules are translated (e.g., rRNA, tRNA, others) •RNA is sometimes reverse transcribed back to DNA. 1 The Structure of DNA is Fundamental to its Function The function of DNA is the storage of genetic information. DNA sequences known as genes specify the kinds of proteins that are made by cells. Complementary base-pairing ensures redundancy and allows for genetic information to be copied. Wikimedia Commons II. DNA Polymerases and DNA Replication The replication of DNA is effected by enzymes known as DNA polymerases.
    [Show full text]
  • Supplementary Materials: Modular Diversity of the BLUF Proteins and Their Potential for the Development of Diverse Optogenetic Tools
    Appl. Sci. 2019, 9, x FOR PEER REVIEW 1 of 10 Supplementary Materials: Modular Diversity of the BLUF Proteins and Their Potential for the Development of Diverse Optogenetic Tools Manish Singh Kaushik, Ramandeep Sharma, Sindhu KandothVeetil, Sandeep Kumar Srivastava and Suneel Kateriya Table S1. String analysis [1] output showing the details of query proteins, domains, interacting proteins and annotated functions. S. No. Query protein Domain Interacting Partner Annotation JD73_03740 C-di-GMP phosphodiesterase YeaP Diguanylate cyclase JD73_23680 Diguanylate cyclase JD73_23675 Diguanylate cyclase YdaM Diguanylate cyclase EAL (Diguanylate 1. JD73_24940 AriR Regulator of acid resistance cyclase) YcgZ Two-component-system connector protein HTH-type transcriptional regulator, MerR YcgE domain protein JD73_25605 Regulatory protein MerR GJ12_01945 Transcriptional regulator AMSG_00147 Phosphodiesterase AMSG_00905 Phosphodiesterase AMSG_01576 Uncharacterized protein Adenylyl cyclase-associated protein belongs to AMSG_01591 the CAP family AMSG_04591 DNA-directed RNA polymerase subunit beta CHD (class III AMSG_08774 Uncharacterized protein 2. AMSG_04679 nucleotydyl cGMP-dependent 3',5'-cGMP cyclase) AMSG_08967 phosphodiesterase A Adenylate/guanylate cyclase with GAF and AMSG_09378 PAS/PAC sensor 3,4-dihydroxy-2-butanone 4-phosphate AMSG_10048 synthase AMSG_11978 DNA helicase Hhal_0366 Multi-sensor hybrid histidine kinase Hhal_0474 CheA signal transduction histidine kinase Hhal_0522 Putative CheW protein Hhal_0934 CheA signal transduction histidine
    [Show full text]
  • Single-Molecule Studies Contrast Ordered DNA Replication With
    12/6/17 1 2 Single-molecule studies contrast ordered DNA replication with 3 stochastic translesion synthesis 4 5 6 7 Gengjing Zhao1, Emma S. Gleave1 & Meindert H. Lamers1,2* 8 9 10 11 1MRC laboratory of Molecular Biology, Francis Crick Avenue, Cambridge 12 Biomedical Campus, Cambridge, CB2 0QH, United Kingdom. 13 2Current address: Leiden University Medical Center, Einthovenweg 20, 2300 RC 14 Leiden, The Netherlands 15 *For Correspondence: [email protected] 16 17 1 12/6/17 18 ABSTRACT 19 High fidelity replicative DNA polymerases are unable to synthesize past DNA 20 adducts that result from diverse chemicals, reactive oxygen species or UV light. To 21 bypass these replication blocks, cells utilize specialized translesion DNA polymerases 22 that are intrinsically error prone and associated with mutagenesis, drug resistance, and 23 cancer. How untimely access of translesion polymerases to DNA is prevented is 24 poorly understood. Here we use co-localization single-molecule spectroscopy 25 (CoSMoS) to follow the exchange of the E. coli replicative DNA polymerase Pol 26 IIIcore with the translesion polymerases Pol II and Pol IV. We find that in contrast to 27 the toolbelt model, the replicative and translesion polymerases do not form a stable 28 complex on one clamp but alternate their binding. Furthermore, while the loading of 29 clamp and Pol IIIcore is highly organized, the exchange with the translesion 30 polymerases is stochastic and is not determined by lesion-recognition but instead a 31 concentration-dependent competition between the polymerases. 32 2 12/6/17 33 INTRODUCTION 34 To ensure faithful replication of the genomic DNA, replicative DNA polymerases 35 have a narrow active site that limits the incorporation of incorrect nucleotides.
    [Show full text]