Biomedical Science Letters 2020, 26(4): 288~295 Original Article https://doi.org/10.15616/BSL.2020.26.4.288 eISSN : 2288-7415 Riboflavin Inhibits Growth of Helicobacter pylori by Down-regulation of polA and dnaB Genes Hye Jin Kwon1,§,*, Min Ho Lee2,§,**, Hyun Woo Kim1,*, Ji Yeong Yang1,*, Hyun Jun Woo3,***, Min Park4,***, Cheol Moon3,***, Sa-Hyun Kim3,†,*** and Jong-Bae Kim1,†,*** 1Department of Biomedical Laboratory Science, College of Health Sciences, Yonsei University, Wonju 26493, Korea 2Forensic DNA Division, National Forensic Service, Wonju 26460, Korea 3Department of Clinical Laboratory Science, Semyung University, Jaecheon 27136, Korea 4Department of Biomedical Laboratory Science, Daekyeung University, Gyeongsan 38547, Korea Infection of Helicobacter pylori on gastric mucosa is associated with various gastric diseases. According to the WHO, H. pylori causes gastric cancer and has been classified as a class I carcinogen. Riboflavin is an essential vitamin which presents in a wide variety of foods. Previous studies have shown that riboflavin/UVA was effective against the growth inhibition of Staphylococcus aureus, S. epidermidis and multidrug-resistant Pseudomonas aeruginosa and had the potential for antimicrobial properties. Thus, we hypothesized that riboflavin has a potential role in the growth inhibition of H. pylori. To demonstrate inhibitory concentration of riboflavin against H. pylori, we performed agar and broth dilution methods. As a result, we found that riboflavin inhibited the growth of H. pylori. The MIC was 1 mM in agar and broth dilution test. Furthermore, to explain the inhibitory mechanism, we investigated whether riboflavin has an influence on the replication- associated molecules of the bacteria using RT-PCR to detect mRNA expression level in H. pylori. Riboflavin treatment of H. pylori led to down-regulation of polA and dnaB mRNA expression levels in a dose dependent manner. After then, we also confirmed whether riboflavin has cytotoxicity to human cells. We used AGS, a gastric cancer cell line, and treated with riboflavin did not show statistically significant decrease of cell viability. Thus, these results indicate that riboflavin can suppress the replication machinery of H. pylori. Taken together, these findings demonstrate that riboflavin inhibits growth of H. pylori by inhibiting replication of the bacteria. Key Words: Riboflavin, Helicobacter pylori, PolA, DnaB, Antibacterial H. pylori has been known to primarily colonize on human INTRODUCTION gastric epithelium. Approximately half of the world popula- tion harbor H. pylori and it has been suggested that infection Helicobacter pylori is a gram-negative spiral-shaped bac- of H. pylori generally occurs in childhood and transmitted terium which possess its characteristic helical appearance. from family members (Tharmalingam et al., 2016). Numer- Received: November 3, 2020 / Revised: December 17, 2020 / Accepted: December 20, 2020 * ** *** Graduate student, Resercher, Professor. § These authors contributed equally to this work. † Corresponding author: Jong-Bae Kim. Department of Biomedical Laboratory Science, College of Health Sciences, Yonsei University, Wonju 26493, Korea. Tel: +82-33-760-2423, Fax: +82-33-760-2561, e-mail: [email protected] † Corresponding author: Sa-Hyun Kim. Department of Clinical Laboratory Science, Semyung University, Jaecheon 27136, Korea. Tel: +82-43-649-1624, Fax: +82-43-649-1624, e-mail: [email protected] ○C The Korean Society for Biomedical Laboratory Sciences. All rights reserved. ○CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. - 288 - ous reports suggested that various gastric diseases such as sions of DNA replication genes in H. pylori were investigated gastric inflammation, chronic gastritis, peptic ulcer and gastric after riboflavin treatment. We also evaluated cytotoxicity of adenocarcinoma are associated with H. pylori infection riboflavin on mammalian cells. (Cover and Blaser, 2009). Epidemiologically, over 3 billion people are infected by this bacterium and develop persistent MATERIALS AND METHODS stomach inflammation, which lasts for decades unless treated Bacterial and mammalian cell culture with antibiotics. Moreover, World Health Organization clas- sified H. pylori as a class I carcinogen due to the organism The H. pylori reference strain ATCC 49503 was pur- causes gastric cancer (Peek and Blaser, 2002). chased from the American Type Culture Collection (ATCC, Riboflavin (vitamin B2) is an essential water-soluble sub- Manassas, VA, USA). H. pylori were grown on brucella agar stance present in a wide variety of foods and required for plates (BD Biosciences, Franklin Lakes, NJ, USA) supple- normal cellular functions, including growth and development mented with 10% bovine serum (BRL Life Technologies, in all aerobic forms of life. Riboflavin is known as cofactors Grand Island, NY, USA) under microaerophilic and 100 for enzymes involved in oxidation-reduction reactions, and percent humidity conditions at 37℃ and inspected after three has a role in the oxidative folding of proteins in the endo- days. plasmic reticulum (Hoppel and Tandler, 1975; Tu et al., 2000). AGS gastric adenocarcinoma cells (ATCC CRL-1739) Its most important biological forms, flavin adenine di- were purchased from the Korean Cell Line Bank (Seoul, nucleotide (FAD) and flavin mononucleotide, participate Korea) and cultured in Dulbecco's modified Eagle's medium in a range of redox reactions, some of which are essential (DMEM, BRL Life Technologies) supplemented with 10% to the function of aerobic cells (Powers, 2003). Previous fetal bovine serum (FBS, BRL Life Technologies) and studies have shown that riboflavin can protect microbial streptomycin-penicillin (100 μg/mL and 100 IU/mL) (BRL keratitis. Riboflavin/UVA was effective against Staphylo- Life Technologies). Cells were incubated at 37℃ in a coccus aureus, Staphylococcus epidermidis, drug-resistant humidified atmosphere with 5% CO2. Streptococcus pneumoniae, methicillin-resistant S. aureus, Agar dilution method to determine MIC multidrug-resistant Pseudomonas aeruginosa, and drug- resistant Streptococcus pneumoniae and had the potential H. pylori colonies grown on brucella agar plates were for antimicrobial properties in vitro (Martins et al., 2008). collected and suspended in saline. The number of bacterial Moreover, riboflavin has been found to increase the survival particles in the H. pylori suspension was set to McFarland rate of mice suffering endotoxin-induced sepsis and Gram- 2.0 (6×108/mL), 10 μL of the bacterial suspension was negative and Gram-positive bacterial infection (Shih et al., placed on the Mueller-Hinton agar (BD Biosciences) sup ple 2010). In addition, riboflavin was also involved in the enhan- mented with 10% bovine serum including indicated con- cement of antitumor activity of many anticancer drugs, as centrations of riboflavin. All solutions were prepared in such well as in the activation of the immune system to kill tumor a manner that the final dimethylsulfoxide (DMSO) concen- cells (Zhu et al., 2006; de Souza Queiroz et al., 2007; Santos tration was the same in all treatments. The bacteria were et al., 2007). incubated for 72 hours and the MIC was determined based Based on the previous reports suggesting anti-microbial on the lowest concentration at which inhibition of growth activity of riboflavin, we hypothesized that riboflavin has a was observed in a previous report (Yang et al., 2019). potential role in the growth inhibition of H. pylori. To prove Broth dilution method to determine MIC this hypothesis, we investigated the effect of riboflavin against H. pylori growth. We determined minimal inhibitory H. pylori suspension set to McFarland 0.33 was prepared concentration (MIC) of riboflavin against H. pylori using in Mueller-Hinton broth (BD Biosciences) supplemented agar dilution method and broth dilution method. Then expres- with 10% bovine serum. Various concentrations of riboflavin - 289 - Table 1. List of primer sequences and PCR conditions for RT-PCR Sequences (5'-3') Product Anncaling Primers length temperature Cycles Reference* Forward Reverse (bp) (℃) DnaA GGGCATGACTTAGCGGTTA TTAACGAATTGCACGCCAAC 128 55 27 DnaB AATGGGCCGTTTATCGTCTC CAAATCCGCTTGCAACTACG 231 55 27 DnaE AATCCACCGGCTCCAAATAC GCCAAACAAGTGTGGGAGTA 184 55 27 DnaN GTTAGCGGTGGTTGAAAACG CGGTTTCGCTATGCTCAGAA 233 55 27 DnaQ CGCATGAAGCTTTGCAAGAA GCATAGGCTCTATGGCTGAC 244 55 27 * PloA TCATCATCATTGCCGACTGG GTCATGCGCAAACACATTCA 134 55 24 HolB GCCCTTGAAATCGTGCTTAC ATGATGAGAGCTACCCGACA 196 55 25 RpoB TTTAGGTAAGCGCGTGGATT AATCAGCTTTGGATGGAACG 301 59 24 POLA1 GCCAGTTTTGGGCTGGTTG GTTCGGTTTTGTCACTGCGA 458 57 29 MCM2 GGCGGAATCATCGGAATCCT ATCATCCAGAGCCAGTCCCT 295 57 29 (Lee et al., GAPDH CGGGAAGCTTGTCATCAATGG GGCAGTGATGGCATGGACTG 349 55 24 2015a) *The primers without reference are designed in this study were added and the bacteria were grown at 37℃ for 72 h and destained in distilled water for 20 minutes. Gel images TM in a humidified atmosphere with 10% CO2. All solutions were taken using Molecular Image Gel Doc XR+ system were prepared in such a manner that the final DMSO con- (Bio-Rad, Hercules, CA, USA). The band intensity of PCR centration was the same in all treatments. The final optical product was analyzed with the ImageLab