Notification of Military Service (MV-75)

Total Page:16

File Type:pdf, Size:1020Kb

Notification of Military Service (MV-75) MV-75 (12/15) NOTIFICATION OF MILITARY SERVICE Part 1 For a NYS licensed driver who has entered military service, Section 9196(3) of the Unconsolidated Laws of New York State extends the expiration date of their driver license if it is set to expire prior to their separation from service; the expiration date of the license will be extended to six months after the date of separation from service. Anyone who does not use this form to notify the Department of Motor Vehicles of their entry into service may not be able to renew their license when discharged. INSTRUCTIONS: A. Complete both parts of this form using the information on your New York State driver license. Update your address if it has changed. B. Separate the two parts and mail Part 1 to: NEW YORK STATE DEPARTMENT OF MOTOR VEHICLES LICENSE PRODUCTION BUREAU PO BOX 2895 ALBANY NY 12220-0895 C. Cut out, fold, and keep Part 2 with your NYS driver license. Driver License Number Name (as it appears on driver license) Current Address (number and street) Apt. # City State Zip Code Date of Birth License Expiration Date Date of Entry Into Service / / Male Female // // IF THE ADDRESS WRITTEN ABOVE IS A NEW ADDRESS, PLEASE CHECK THIS BOX. CUT HERE AND MAIL PART 1 TO THE ADDRESS ABOVE Part 2 Cut along dotted line Part 2 Female Zip Code -75 (12/15) - State MV Male NYS DRIVER LICENSE MILITARY EXTENSION OF FOLD LINE FOLD LINE dmv.ny.gov / Cut along dotted line Cut along dotted line / // // ork State extends the expiration date of their Y Keep this form with your NYS Driver License. Date of Birth NYS Driver License Expiration Date Date of Entry Into Service NYS Driver License Number Name (as it appears on driver license) Address (number and street) Current City Please complete all information: For a NYS licensed driver who has entered military service, Section 9196(3) of the Unconsolidated Laws of New driver license if it is set to expire prior their separation from service; the expiration date of license will be extended to six months after the date of separation from service. Cut along dotted line FOLD AND KEEP THIS PART WITH YOUR NEW YORK STATE DRIVER LICENSE. UHVHWFOHDU.
Recommended publications
  • Introduction to Linux – Part 1
    Introduction to Linux – Part 1 Brett Milash and Wim Cardoen Center for High Performance Computing May 22, 2018 ssh Login or Interactive Node kingspeak.chpc.utah.edu Batch queue system … kp001 kp002 …. kpxxx FastX ● https://www.chpc.utah.edu/documentation/software/fastx2.php ● Remote graphical sessions in much more efficient and effective way than simple X forwarding ● Persistence - can be disconnected from without closing the session, allowing users to resume their sessions from other devices. ● Licensed by CHPC ● Desktop clients exist for windows, mac, and linux ● Web based client option ● Server installed on all CHPC interactive nodes and the frisco nodes. Windows – alternatives to FastX ● Need ssh client - PuTTY ● http://www.chiark.greenend.org.uk/~sgtatham/putty/download.html - XShell ● http://www.netsarang.com/download/down_xsh.html ● For X applications also need X-forwarding tool - Xming (use Mesa version as needed for some apps) ● http://www.straightrunning.com/XmingNotes/ - Make sure X forwarding enabled in your ssh client Linux or Mac Desktop ● Just need to open up a terminal or console ● When running applications with graphical interfaces, use ssh –Y or ssh –X Getting Started - Login ● Download and install FastX if you like (required on windows unless you already have PuTTY or Xshell installed) ● If you have a CHPC account: - ssh [email protected] ● If not get a username and password: - ssh [email protected] Shell Basics q A Shell is a program that is the interface between you and the operating system
    [Show full text]
  • Introduction to Unix
    Introduction to Unix Rob Funk <[email protected]> University Technology Services Workstation Support http://wks.uts.ohio-state.edu/ University Technology Services Course Objectives • basic background in Unix structure • knowledge of getting started • directory navigation and control • file maintenance and display commands • shells • Unix features • text processing University Technology Services Course Objectives Useful commands • working with files • system resources • printing • vi editor University Technology Services In the Introduction to UNIX document 3 • shell programming • Unix command summary tables • short Unix bibliography (also see web site) We will not, however, be covering these topics in the lecture. Numbers on slides indicate page number in book. University Technology Services History of Unix 7–8 1960s multics project (MIT, GE, AT&T) 1970s AT&T Bell Labs 1970s/80s UC Berkeley 1980s DOS imitated many Unix ideas Commercial Unix fragmentation GNU Project 1990s Linux now Unix is widespread and available from many sources, both free and commercial University Technology Services Unix Systems 7–8 SunOS/Solaris Sun Microsystems Digital Unix (Tru64) Digital/Compaq HP-UX Hewlett Packard Irix SGI UNICOS Cray NetBSD, FreeBSD UC Berkeley / the Net Linux Linus Torvalds / the Net University Technology Services Unix Philosophy • Multiuser / Multitasking • Toolbox approach • Flexibility / Freedom • Conciseness • Everything is a file • File system has places, processes have life • Designed by programmers for programmers University Technology Services
    [Show full text]
  • Unix: Beyond the Basics
    Unix: Beyond the Basics BaRC Hot Topics – September, 2018 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Logging in to our Unix server • Our main server is called tak4 • Request a tak4 account: http://iona.wi.mit.edu/bio/software/unix/bioinfoaccount.php • Logging in from Windows Ø PuTTY for ssh Ø Xming for graphical display [optional] • Logging in from Mac ØAccess the Terminal: Go è Utilities è Terminal ØXQuartz needed for X-windows for newer OS X. 2 Log in using secure shell ssh –Y user@tak4 PuTTY on Windows Terminal on Macs Command prompt user@tak4 ~$ 3 Hot Topics website: http://barc.wi.mit.edu/education/hot_topics/ • Create a directory for the exercises and use it as your working directory $ cd /nfs/BaRC_training $ mkdir john_doe $ cd john_doe • Copy all files into your working directory $ cp -r /nfs/BaRC_training/UnixII/* . • You should have the files below in your working directory: – foo.txt, sample1.txt, exercise.txt, datasets folder – You can check they’re there with the ‘ls’ command 4 Unix Review: Commands Ø command [arg1 arg2 … ] [input1 input2 … ] $ sort -k2,3nr foo.tab -n or -g: -n is recommended, except for scientific notation or start end a leading '+' -r: reverse order $ cut -f1,5 foo.tab $ cut -f1-5 foo.tab -f: select only these fields -f1,5: select 1st and 5th fields -f1-5: select 1st, 2nd, 3rd, 4th, and 5th fields $ wc -l foo.txt How many lines are in this file? 5 Unix Review: Common Mistakes • Case sensitive cd /nfs/Barc_Public vs cd /nfs/BaRC_Public -bash: cd: /nfs/Barc_Public:
    [Show full text]
  • LAB MANUAL for Computer Network
    LAB MANUAL for Computer Network CSE-310 F Computer Network Lab L T P - - 3 Class Work : 25 Marks Exam : 25 MARKS Total : 50 Marks This course provides students with hands on training regarding the design, troubleshooting, modeling and evaluation of computer networks. In this course, students are going to experiment in a real test-bed networking environment, and learn about network design and troubleshooting topics and tools such as: network addressing, Address Resolution Protocol (ARP), basic troubleshooting tools (e.g. ping, ICMP), IP routing (e,g, RIP), route discovery (e.g. traceroute), TCP and UDP, IP fragmentation and many others. Student will also be introduced to the network modeling and simulation, and they will have the opportunity to build some simple networking models using the tool and perform simulations that will help them evaluate their design approaches and expected network performance. S.No Experiment 1 Study of different types of Network cables and Practically implement the cross-wired cable and straight through cable using clamping tool. 2 Study of Network Devices in Detail. 3 Study of network IP. 4 Connect the computers in Local Area Network. 5 Study of basic network command and Network configuration commands. 6 Configure a Network topology using packet tracer software. 7 Configure a Network topology using packet tracer software. 8 Configure a Network using Distance Vector Routing protocol. 9 Configure Network using Link State Vector Routing protocol. Hardware and Software Requirement Hardware Requirement RJ-45 connector, Climping Tool, Twisted pair Cable Software Requirement Command Prompt And Packet Tracer. EXPERIMENT-1 Aim: Study of different types of Network cables and Practically implement the cross-wired cable and straight through cable using clamping tool.
    [Show full text]
  • Install and Run External Command Line Softwares
    job monitor and control top: similar to windows task manager (space to refresh, q to exit) w: who is there ps: all running processes, PID, status, type ps -ef | grep yyin bg: move current process to background fg: move current process to foreground jobs: list running and suspended processes kill: kill processes kill pid (could find out using top or ps) 1 sort, cut, uniq, join, paste, sed, grep, awk, wc, diff, comm, cat All types of bioinformatics sequence analyses are essentially text processing. Unix Shell has the above commands that are very useful for processing texts and also allows the output from one command to be passed to another command as input using pipe (“|”). less cosmicRaw.txt | cut -f2,3,4,5,8,13 | awk '$5==22' | cut -f1 | sort -u | wc This makes the processing of files using Shell very convenient and very powerful: you do not need to write output to intermediate files or load all data into the memory. For example, combining different Unix commands for text processing is like passing an item through a manufacturing pipeline when you only care about the final product 2 Hands on example 1: cosmic mutation data - Go to UCSC genome browser website: http://genome.ucsc.edu/ - On the left, find the Downloads link - Click on Human - Click on Annotation database - Ctrl+f and then search “cosmic” - On “cosmic.txt.gz” right-click -> copy link address - Go to the terminal and wget the above link (middle click or Shift+Insert to paste what you copied) - Similarly, download the “cosmicRaw.txt.gz” file - Under your home, create a folder
    [Show full text]
  • ANSWERS ΤΟ EVEN-Numbered
    8 Answers to Even-numbered Exercises 2.1. WhatExplain the following unexpected are result: two ways you can execute a shell script when you do not have execute permission for the file containing the script? Can you execute a shell script if you do not have read permission for the file containing the script? You can give the name of the file containing the script as an argument to the shell (for example, bash scriptfile or tcsh scriptfile, where scriptfile is the name of the file containing the script). Under bash you can give the following command: $ . scriptfile Under both bash and tcsh you can use this command: $ source scriptfile Because the shell must read the commands from the file containing a shell script before it can execute the commands, you must have read permission for the file to execute a shell script. 4.3. AssumeWhat is the purpose ble? you have made the following assignment: $ person=zach Give the output of each of the following commands. a. echo $person zach b. echo '$person' $person c. echo "$person" zach 1 2 6.5. Assumengs. the /home/zach/grants/biblios and /home/zach/biblios directories exist. Specify Zach’s working directory after he executes each sequence of commands. Explain what happens in each case. a. $ pwd /home/zach/grants $ CDPATH=$(pwd) $ cd $ cd biblios After executing the preceding commands, Zach’s working directory is /home/zach/grants/biblios. When CDPATH is set and the working directory is not specified in CDPATH, cd searches the working directory only after it searches the directories specified by CDPATH.
    [Show full text]
  • Solarwinds Engineer's Toolset Fast Fixes to Network Issues
    DATASHEET SolarWinds Engineer’s Toolset Fast Fixes to Network Issues SolarWinds® Engineer’s Toolset (ETS) helps you monitor and troubleshoot your network with TRY IT FREE the most trusted tools in network management. Version 11.0 now comes with an intuitive web console for 5 of the most popular tools - Response Time Monitor, Interface Monitor, CPU 14 days, full version Monitor, Memory Monitor, and TraceRoute. WHY CHOOSE ENGINEER’S TOOLSET? » Monitor and alert in real time on network availability and health. » Perform robust network diagnostics for faster troubleshooting and quick resolution of complex network issues. » Easily deploy an array of network discovery tools including Port Scanner, Switch Port Mapper, and Advanced Subnet Calculator. » Manage Cisco® devices with specialized tools including Real-time NetFlow Analyzer, Config Downloader, and Config Compare. » Cut troubleshooting time in half and put frequently used tools at your fingertips. SolarWinds Orion integration makes easier and faster troubleshooting allowing you to start tools contextually from any monitored element in Orion. page 1 DATASHEET: SOLARWINDS ENGINEER’S TOOLSET INTUITIVE WEB INTERFACE Response Time Monitor Web access for Response Time Monitor allows you to monitor availability of multiple devices TRY IT FREE in real time and obtain latency and availability information in tabular form. 14 days, full version Memory Monitor Web-based Memory Monitor allows you to monitor memory utilization in real time and enables you to view current memory utilization alongside the total memory available. CPU Monitor Monitor CPU load for multiple devices in real time and set warning and alarm thresholds for each device independently. Interface Monitor The Interface Monitor allows you to view real-time interface statistics for routers and switches simultaneously.
    [Show full text]
  • Command $Line; Done
    http://xkcd.com/208/ >0 TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa PIPE grep ACGT TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTGGTTGGGTACATTATTTTAAGTGTATTTGACAAG >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “>0” grep ACGT contain “ACGT”? Yes? No? Output NULL >1 TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA >4 TGCAGGGGTCAAATACAGCTGTCAAAGCCAGACTTTGAGCACTGCTAGCTGGCTGCAACACCTGCACTTAACCTC cat seqs.fa Does PIPE “TGCAGGTATATCTATTAGCAGGTTTAATTTTGCCTGCACTTG...G” grep ACGT contain “ACGT”? Yes? No? Output NULL TGCAGGTTGTTGTTACTCAGGTCCAGTTCTCTGAGACTGGAGGACTGGGAGCTGAGAACTGAGGACAGAGCTTCA >2 TGCAGGGCCGGTCCAAGGCTGCATGAGGCCTGGGGCAGAATCTGACCTAGGGGCCCCTCTTGCTGCTAAAACCAT >3 TGCAGGATCTGCTGCACCATTAACCAGACAGAAATGGCAGTTTTATACAAGTTATTATTCTAATTCAATAGCTGA
    [Show full text]
  • Bedtools Documentation Release 2.30.0
    Bedtools Documentation Release 2.30.0 Quinlan lab @ Univ. of Utah Jan 23, 2021 Contents 1 Tutorial 3 2 Important notes 5 3 Interesting Usage Examples 7 4 Table of contents 9 5 Performance 169 6 Brief example 173 7 License 175 8 Acknowledgments 177 9 Mailing list 179 i ii Bedtools Documentation, Release 2.30.0 Collectively, the bedtools utilities are a swiss-army knife of tools for a wide-range of genomics analysis tasks. The most widely-used tools enable genome arithmetic: that is, set theory on the genome. For example, bedtools allows one to intersect, merge, count, complement, and shuffle genomic intervals from multiple files in widely-used genomic file formats such as BAM, BED, GFF/GTF, VCF. While each individual tool is designed to do a relatively simple task (e.g., intersect two interval files), quite sophisticated analyses can be conducted by combining multiple bedtools operations on the UNIX command line. bedtools is developed in the Quinlan laboratory at the University of Utah and benefits from fantastic contributions made by scientists worldwide. Contents 1 Bedtools Documentation, Release 2.30.0 2 Contents CHAPTER 1 Tutorial We have developed a fairly comprehensive tutorial that demonstrates both the basics, as well as some more advanced examples of how bedtools can help you in your research. Please have a look. 3 Bedtools Documentation, Release 2.30.0 4 Chapter 1. Tutorial CHAPTER 2 Important notes • As of version 2.28.0, bedtools now supports the CRAM format via the use of htslib. Specify the reference genome associated with your CRAM file via the CRAM_REFERENCE environment variable.
    [Show full text]
  • 07 07 Unixintropart2 Lucio Week 3
    Unix Basics Command line tools Daniel Lucio Overview • Where to use it? • Command syntax • What are commands? • Where to get help? • Standard streams(stdin, stdout, stderr) • Pipelines (Power of combining commands) • Redirection • More Information Introduction to Unix Where to use it? • Login to a Unix system like ’kraken’ or any other NICS/ UT/XSEDE resource. • Download and boot from a Linux LiveCD either from a CD/DVD or USB drive. • http://www.puppylinux.com/ • http://www.knopper.net/knoppix/index-en.html • http://www.ubuntu.com/ Introduction to Unix Where to use it? • Install Cygwin: a collection of tools which provide a Linux look and feel environment for Windows. • http://cygwin.com/index.html • https://newton.utk.edu/bin/view/Main/Workshop0InstallingCygwin • Online terminal emulator • http://bellard.org/jslinux/ • http://cb.vu/ • http://simpleshell.com/ Introduction to Unix Command syntax $ command [<options>] [<file> | <argument> ...] Example: cp [-R [-H | -L | -P]] [-fi | -n] [-apvX] source_file target_file Introduction to Unix What are commands? • An executable program (date) • A command built into the shell itself (cd) • A shell program/function • An alias Introduction to Unix Bash commands (Linux) alias! crontab! false! if! mknod! ram! strace! unshar! apropos! csplit! fdformat! ifconfig! more! rcp! su! until! apt-get! cut! fdisk! ifdown! mount! read! sudo! uptime! aptitude! date! fg! ifup! mtools! readarray! sum! useradd! aspell! dc! fgrep! import! mtr! readonly! suspend! userdel! awk! dd! file! install! mv! reboot! symlink!
    [Show full text]
  • Roof Rail Airbag Folding Technique in LS-Prepost ® Using Dynfold Option
    14th International LS-DYNA Users Conference Session: Modeling Roof Rail Airbag Folding Technique in LS-PrePost® Using DynFold Option Vijay Chidamber Deshpande GM India – Tech Center Wenyu Lian General Motors Company, Warren Tech Center Amit Nair Livermore Software Technology Corporation Abstract A requirement to reduce vehicle development timelines is making engineers strive to limit lead times in analytical simulations. Airbags play a crucial role in the passive safety crash analysis. Hence they need to be designed, developed and folded for CAE applications within a short span of time. Therefore a method/procedure to fold the airbag efficiently is of utmost importance. In this study the RRAB (Roof Rail AirBag) folding is carried out in LS-PrePost® by DynFold option. It is purely a simulation based folding technique, which can be solved in LS-DYNA®. In this paper we discuss in detail the RRAB folding process and tools/methods to make this effective. The objective here is to fold the RRAB to include modifications in the RRAB, efficiently and realistically using common analysis tools ( LS-DYNA & LS-PrePost), without exploring a third party tool , thus reducing the turnaround time. Introduction To meet the regulatory and consumer metrics requirements, multiple design iterations are required using advanced CAE simulation models for the various safety load cases. One of the components that requires frequent changes is the roof rail airbag (RRAB). After any changes to the geometry or pattern in the airbag have been made, the airbag needs to be folded back to its design position. Airbag folding is available in a few pre-processors; however, there are some folding patterns that are difficult to be folded using the pre-processor folding modules.
    [Show full text]
  • Unix Programmer's Manual
    There is no warranty of merchantability nor any warranty of fitness for a particu!ar purpose nor any other warranty, either expressed or imp!ied, a’s to the accuracy of the enclosed m~=:crials or a~ Io ~helr ,~.ui~::~::.j!it’/ for ~ny p~rficu~ar pur~.~o~e. ~".-~--, ....-.re: " n~ I T~ ~hone Laaorator es 8ssumg$ no rO, p::::nS,-,,.:~:y ~or their use by the recipient. Furln=,, [: ’ La:::.c:,:e?o:,os ~:’urnes no ob~ja~tjon ~o furnish 6ny a~o,~,,..n~e at ~ny k:nd v,,hetsoever, or to furnish any additional jnformstjcn or documenta’tjon. UNIX PROGRAMMER’S MANUAL F~ifth ~ K. Thompson D. M. Ritchie June, 1974 Copyright:.©d972, 1973, 1974 Bell Telephone:Laboratories, Incorporated Copyright © 1972, 1973, 1974 Bell Telephone Laboratories, Incorporated This manual was set by a Graphic Systems photo- typesetter driven by the troff formatting program operating under the UNIX system. The text of the manual was prepared using the ed text editor. PREFACE to the Fifth Edition . The number of UNIX installations is now above 50, and many more are expected. None of these has exactly the same complement of hardware or software. Therefore, at any particular installa- tion, it is quite possible that this manual will give inappropriate information. The authors are grateful to L. L. Cherry, L. A. Dimino, R. C. Haight, S. C. Johnson, B. W. Ker- nighan, M. E. Lesk, and E. N. Pinson for their contributions to the system software, and to L. E. McMahon for software and for his contributions to this manual.
    [Show full text]