DOCSLIB.ORG

Disruption of ST5 Is Associated with Mental Retardation and Multiple

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Disruption of ST5 Is Associated with Mental Retardation and Multiple Downloaded from http://jmg.bmj.com/ on June 26, 2015 - Published by group.bmj.com Original article Disruption of ST5 is associated with mental retardation and multiple congenital anomalies Ina Go¨hring,1 Andreas Tagariello,1 Sabine Endele,1 Claus C Stolt,2 Michella Ghassibe´,3 Malcolm Fisher,4 Christian T Thiel,1 Udo Trautmann,1 Miikka Vikkula,3 Andreas Winterpacht,1 David R FitzPatrick,4 Anita Rauch1,5 1Institute of Human Genetics, ABSTRACT of expression of genes residing at the chromosomal Friedrich-Alexander University Background The authors observed a patient with breakpoints or in close proximity to them. In this Erlangen-Nuremberg, Erlangen, 2 a cryptic subtelomeric de novo balanced translocation 46, study, breakpoint mapping of a balanced de novo Germany Institute of Biochemistry, Emil-Fischer XY.ish t(11;20)(p15.4;q13.2) presenting with severe translocation t(11;20)(p15.4;q13.2) in a patient Centre, Friedrich-Alexander mental retardation, muscular hypotonia, seizures, bilateral with MR, seizures and multiple congenital anoma- University Erlangen-Nuremberg, sensorineural hearing loss, submucous cleft palate, lies led to the identification of ST5 (suppression of 3 Erlangen, Germany de Duve persistent ductus Botalli, unilateral cystic kidney dysplasia tumorigenicity 5; MIM 140750) as a novel gene for Institute, Universite´ catholique de Louvain, Brussels, Belgium and frequent infections. syndromic MR. 4Medical and Developmental Methods and Results Fluorescence in situ hybridisation Genetics Section, MRC Human mapping and sequencing of the translocation breakpoints METHODS Genetics Unit, Western General showed that no known genes are disrupted at 20q13.2 Fluorescence in situ hybridisation (FISH) Hospital, Edinburgh, UK and that ST5 (suppression of tumorigenicity 5; MIM Region-specific bacterial artificial chromosome 5Institute of Medical Genetics, University of Zurich, 140750) is disrupted on 11p15.4. By quantitative PCR (BAC) clones for FISH mapping were selected from Schwerzenbach-Zurich, from different human tissues, the authors found ST5 to be the NCBI and UCSC genome browsers (http:// Switzerland relatively evenly expressed in fetal tissues. ST5 www.ncbi.nlm.nih.gov, http:/genome.ucsc.edu/). expression was more pronounced in adult brain, kidney FISH analyses were performed using metaphase Correspondence to and muscle than in the corresponding fetal tissues, chromosomes prepared from lymphoblastoid cell Professor Anita Rauch, Institute fl of Medical Genetics, University whereas expression in other tissues was generally lower lines. Genomic BAC DNAs were uorescently of Zurich, Schorenstrasse 16, than in the fetal tissue. Using RNA in situ hybridisation in labelled with Cy3-dCTP (Amersham Biosciences, CH-8603 mouse, the authors found that St5 is expressed in the Freiberg, Germany) by standard nick translation Schwerzenbach-Zurich, frontal cortex during embryonic development. In adult with the DIG-Nick-Translation Kit (Roche, Basel, Switzerland; [email protected] mouse brain, expression of St5 was especially high in the Switzerland). The probes were blocked with Cot-1 hippocampal area and cerebellum. DNA to suppress repetitive sequences. Metaphase Received 26 May 2009 Conclusion Hence, the authors suppose that ST5 plays spreads were hybridised at 378C overnight with the Revised 10 September 2009 an important role in central nervous system development Cy3-labelled BAC probes and a specific FluoroX Accepted 10 September 2009 probably due to disturbance of DENN-domain-mediated (Amersham Biosciences)-labelled subtelomeric Published Online First 19 October 2009 vesicle formation and neurotransmitter trafficking. control probe (PAC probes GS-11q770-G7 or GS- Thus, these findings implicate ST5 in the aetiology of 20p1061-L1).2 After post-hybridisation washes, mental retardation, seizures and multiple congenital chromosomes were counterstained with 49,6- anomalies. diamidino-2-phenylindole (DAPI; Serva, Heidelberg, Germany). Images were captured on a Zeiss Axio- plan 2 microscope with a CCD camera and processed with the Isis Software (Metasystems. Altlussheim, Germany). INTRODUCTION Mental retardation (MR) is defined as a significant Long-template PCR and mini-FISH analyses impairment of cognitive and adaptive functions All long-template PCRs were performed with the with onset before age 18 years and affects about Expand Long Template PCR System (Roche Diag- 2e3% of the population. It occurs as an isolated nostics, Basel, Switzerland) according to the trait or as part of many syndromes, and, despite recommendations of the manufacturer with primer significant improvement in the identification of pairs chosen from the genomic sequence of the underlying causes, the majority of cases currently breakpoint-spanning BAC clones. Annealing remain without definitive diagnosis.1 Since MR is temperatures and elongation times were optimised extremely heterogeneous and occurs sporadically in for each primer pair. Purified long-template PCR most patients, identification of novel causative products (QIAquick PCR Purification Kit, Qiagen, genes by linkage analysis is difficult. In such cases, Hilden, Germany) were labelled with Cy3-dCTPs balanced chromosomal rearrangements, which by standard nick translation as described above, and occur in 0.6% of mentally retarded patients, are one FISH was performed on metaphase spreads. of the most promising sources for targeting partic- Hybridisation time was elongated to 48 h. ular genomic segments or genes responsible for MR or other developmental disorders in humans.1 The Breakpoint sequencing phenotypic effects observed in patients with truly Primer pairs for breakpoint-spanning PCRs were balanced chromosomal rearrangements can be chosen from the genomic sequence of the breakpoint- explained by the disruption of genes or by alteration containing segments on chromosomes 11 and 20. J Med Genet 2010;47:91e98. doi:10.1136/jmg.2009.069799 91 Downloaded from http://jmg.bmj.com/ on June 26, 2015 - Published by group.bmj.com Original article Figure 1 Subtelomeric screening and A cytogenetic analysis in our patient revealed a cryptic subtelomeric translocation with the karyotype 46,XY, t(11;20)(p15.4;q13.2). (A) Partial karyogram and ideogram. In addition, chromosome painting using libraries for chromosome 11 (green) and 20 (red) was performed (B). For mapping of the translocation breakpoints, fluorescence in situ hybridisation was performed with bacterial artificial chromosome (BAC) clones. BAC clones RP11- 152H18 (red) on chromosome 11 (with der(20) 20 11qter probe, green) (C) and RP5- der(11) 906P16 (red) on chromosome 20 (with 20 der(20) 11 20pter probe, green) (D) showed hybridisation signals localised on both derivative chromosomes, demonstrating that they spanned the breakpoint. 11 der(11) B C 11 D der(20) 20 der(11) der(20) der(11) Different combinations of forward and reverse primers were used Genotyping Console 3.0.2 software to call segments of copy- to amplify a breakpoint-spanning PCR product with the Expand number changes. 20 kbPlus (PCR System, dNTPack; Roche Diagnostics) according ST5 to the manufacturer’s recommendations. We amplified the Quantification of expression by real time reverse breakpoint-spanning PCR product from the derivative transcriptase (RT)-PCR chromosome 11 using the following primer pair Chr11-59- cDNAs were taken from the Human Fetal Multiple Tissue cDNA TCTTCTGCCTAATGGTCAGC-39 and Chr20-59-CTGCAAGC- (MTC) Panel and from the Human Adult Multiple Tissue cDNA CAAGAAGAGAGG-39. The breakpoint-spanning PCR product (MTC) Panel (Clontech, Mountain View, CA, USA). RT-PCR ST5 from the derivative chromosome 20 was generated with studies were performed as described previously using the pre- the primer pair Chr11-59-CCATCCATCTCTCCTCATTCCT- designed TaqMan Gene Expression Assay (Applied Biosystems; TAAGTT-39 and Chr20-59-CCAATTAAGATGAGAAGATCCC- Hs00373572_m1), and normalised against the mean of four 9 b b TCTAGGA-3 . Dye terminator cycle sequencing of the purified endogenous controls ( 2-microglobulin, -actin, hypoxanthine 3 PCR products was carried out using the DNA Sequencing Kit phosphoribosyltransferase 1 and RNA polymerase II). Relative ST5 BigDye-Terminator Cycle Sequencing Ready Reaction (Applied expression levels were compared with the mean value of Biosystems, Forster City, CA, USA). Sequencing products were expression in fetal brain. separated on an Applied Biosystems ABI3730 Sequencing System. RNA in situ hybridisation The NCBI BLAST program (http://ncbi.nlm.nih.gov/BLAST) and Murine expression of St5 was investigated on embryonic days the UCSC BLAT program (http://genome.ucsc.edu/cgi-bin/ 8.5, 13.5 and 15 (E8.5, E13.5, E15), in brain and kidneys of hgBlat) were used to analyse the sequencing files. newborn mice on days 6, 10 and 15 (P6, P10, P15) and in brains of 7-week-old mice and adult mice. Tissue was OCT (TissueTek, Copy-number analysis Sakura Finetek, Heppenheim, Germany) embedded and stored at To investigate the presence of the reported ST5 copy-number À808C. Serial cryostat sections at 10e12 mm were fixed in 4% variations in well-characterised control individuals, we paraformaldehyde/phosphate-buffered saline. A 448 bp mouse performed long-range PCR using intronic primers from intron 7 St5 riboprobe was generated by PCR using the primers to intron 10, which generated a 3.4 kb product in 192 healthy ggagactgtgggtcactactcc and aatatggtgaaggcagaagtgg and blood donors. Copy-number changes larger than 100 kb were subcloning of the amplicon into the pCR4-TOPO vector (Invi- investigated
Load more

Recommended publications
  • Meta-Analysis of Nasopharyngeal Carcinoma
    BMC Genomics BioMed Central Research article Open Access Meta-analysis of nasopharyngeal carcinoma microarray data explores mechanism of EBV-regulated neoplastic transformation Xia Chen†1,2, Shuang Liang†1, WenLing Zheng1,3, ZhiJun Liao1, Tao Shang1 and WenLi Ma*1 Address: 1Institute of Genetic Engineering, Southern Medical University, Guangzhou, PR China, 2Xiangya Pingkuang associated hospital, Pingxiang, Jiangxi, PR China and 3Southern Genomics Research Center, Guangzhou, Guangdong, PR China Email: Xia Chen - [email protected]; Shuang Liang - [email protected]; WenLing Zheng - [email protected]; ZhiJun Liao - [email protected]; Tao Shang - [email protected]; WenLi Ma* - [email protected] * Corresponding author †Equal contributors Published: 7 July 2008 Received: 16 February 2008 Accepted: 7 July 2008 BMC Genomics 2008, 9:322 doi:10.1186/1471-2164-9-322 This article is available from: http://www.biomedcentral.com/1471-2164/9/322 © 2008 Chen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Epstein-Barr virus (EBV) presumably plays an important role in the pathogenesis of nasopharyngeal carcinoma (NPC), but the molecular mechanism of EBV-dependent neoplastic transformation is not well understood. The combination of bioinformatics with evidences from biological experiments paved a new way to gain more insights into the molecular mechanism of cancer. Results: We profiled gene expression using a meta-analysis approach. Two sets of meta-genes were obtained. Meta-A genes were identified by finding those commonly activated/deactivated upon EBV infection/reactivation.
    [Show full text]
  • Concerted Genomic and Epigenomic Changes Accompany Stabilization of Arabidopsis Allopolyploids
    ARTICLES https://doi.org/10.1038/s41559-021-01523-y Concerted genomic and epigenomic changes accompany stabilization of Arabidopsis allopolyploids Xinyu Jiang 1, Qingxin Song 1,2, Wenxue Ye 1 and Z. Jeffrey Chen 2 ✉ During evolution successful allopolyploids must overcome ‘genome shock’ between hybridizing species but the underlying pro- cess remains elusive. Here, we report concerted genomic and epigenomic changes in resynthesized and natural Arabidopsis suecica (TTAA) allotetraploids derived from Arabidopsis thaliana (TT) and Arabidopsis arenosa (AA). A. suecica shows con- served gene synteny and content with more gene family gain and loss in the A and T subgenomes than respective progenitors, although A. arenosa-derived subgenome has more structural variation and transposon distributions than A. thaliana-derived subgenome. These balanced genomic variations are accompanied by pervasive convergent and concerted changes in DNA methylation and gene expression among allotetraploids. The A subgenome is hypomethylated rapidly from F1 to resynthesized allotetraploids and convergently to the T-subgenome level in natural A. suecica, despite many other methylated loci being inher- ited from F1 to all allotetraploids. These changes in DNA methylation, including small RNAs, in allotetraploids may affect gene expression and phenotypic variation, including flowering, silencing of self-incompatibility and upregulation of meiosis- and mitosis-related genes. In conclusion, concerted genomic and epigenomic changes may improve stability and adaptation during polyploid evolution. olyploidy or whole-genome duplication (WGD) is a perva- species, including Aly24, Aha25 and Aka26, having been sequenced, sive feature of genome evolution in animals and flowering A. arenosa and A. suecica genomes are unavailable, except for a draft Pplants1–6.
    [Show full text]
  • On the Role of Chromosomal Rearrangements in Evolution
    On the role of chromosomal rearrangements in evolution: Reconstruction of genome reshuffling in rodents and analysis of Robertsonian fusions in a house mouse chromosomal polymorphism zone by Laia Capilla Pérez A thesis submitted for the degree of Doctor of Philosophy in Animal Biology Supervisors: Dra. Aurora Ruiz-Herrera Moreno and Dr. Jacint Ventura Queija Institut de Biotecnologia i Biomedicina (IBB) Departament de Biologia Cel·lular, Fisiologia i Immunologia Departament de Biologia Animal, Biologia Vegetal i Ecologia Universitat Autònoma de Barcelona Supervisor Supervisor PhD candidate Aurora Ruiz-Herrera Moreno Jacint Ventura Queija Laia Capilla Pérez Bellaterra, 2015 A la mare Al pare Al mano “Visto a la luz de la evolución, la biología es, quizás, la ciencia más satisfactoria e inspiradora. Sin esa luz, se convierte en un montón de hechos varios, algunos de ellos interesantes o curiosos, pero sin formar ninguna visión conjunta.” Theodosius Dobzhansky “La evolución es tan creativa. Por eso tenemos jirafas.” Kurt Vonnegut This thesis was supported by grants from: • Ministerio de Economía y Competitividad (CGL2010-15243 and CGL2010- 20170). • Generalitat de Catalunya, GRQ 1057. • Ministerio de Economía y Competitividad. Beca de Formación de Personal Investigador (FPI) (BES-2011-047722). • Ministerio de Economía y Competitividad. Beca para la realización de estancias breves (EEBB-2011-07350). Covers designed by cintamontserrat.blogspot.com INDEX Abstract 15-17 Acronyms 19-20 1. GENERAL INTRODUCTION 21-60 1.1 Chromosomal rearrangements
    [Show full text]
  • A High Throughput, Functional Screen of Human Body Mass Index GWAS Loci Using Tissue-Specific Rnai Drosophila Melanogaster Crosses Thomas J
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2018 A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses Thomas J. Baranski Washington University School of Medicine in St. Louis Aldi T. Kraja Washington University School of Medicine in St. Louis Jill L. Fink Washington University School of Medicine in St. Louis Mary Feitosa Washington University School of Medicine in St. Louis Petra A. Lenzini Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Baranski, Thomas J.; Kraja, Aldi T.; Fink, Jill L.; Feitosa, Mary; Lenzini, Petra A.; Borecki, Ingrid B.; Liu, Ching-Ti; Cupples, L. Adrienne; North, Kari E.; and Province, Michael A., ,"A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses." PLoS Genetics.14,4. e1007222. (2018). https://digitalcommons.wustl.edu/open_access_pubs/6820 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Thomas J. Baranski, Aldi T. Kraja, Jill L. Fink, Mary Feitosa, Petra A. Lenzini, Ingrid B. Borecki, Ching-Ti Liu, L. Adrienne Cupples, Kari E. North, and Michael A. Province This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/6820 RESEARCH ARTICLE A high throughput, functional screen of human Body Mass Index GWAS loci using tissue-specific RNAi Drosophila melanogaster crosses Thomas J.
    [Show full text]
  • A Systematic Genome-Wide Association Analysis for Inflammatory Bowel Diseases (IBD)
    A systematic genome-wide association analysis for inflammatory bowel diseases (IBD) Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Christian-Albrechts-Universität zu Kiel vorgelegt von Dipl.-Biol. ANDRE FRANKE Kiel, im September 2006 Referent: Prof. Dr. Dr. h.c. Thomas C.G. Bosch Koreferent: Prof. Dr. Stefan Schreiber Tag der mündlichen Prüfung: Zum Druck genehmigt: der Dekan “After great pain a formal feeling comes.” (Emily Dickinson) To my wife and family ii Table of contents Abbreviations, units, symbols, and acronyms . vi List of figures . xiii List of tables . .xv 1 Introduction . .1 1.1 Inflammatory bowel diseases, a complex disorder . 1 1.1.1 Pathogenesis and pathophysiology. .2 1.2 Genetics basis of inflammatory bowel diseases . 6 1.2.1 Genetic evidence from family and twin studies . .6 1.2.2 Single nucleotide polymorphisms (SNPs) . .7 1.2.3 Linkage studies . .8 1.2.4 Association studies . 10 1.2.5 Known susceptibility genes . 12 1.2.5.1 CARD15. .12 1.2.5.2 CARD4. .15 1.2.5.3 TNF-α . .15 1.2.5.4 5q31 haplotype . .16 1.2.5.5 DLG5 . .17 1.2.5.6 TNFSF15 . .18 1.2.5.7 HLA/MHC on chromosome 6 . .19 1.2.5.8 Other proposed IBD susceptibility genes . .20 1.2.6 Animal models. 21 1.3 Aims of this study . 23 2 Methods . .24 2.1 Laboratory information management system (LIMS) . 24 2.2 Recruitment. 25 2.3 Sample preparation. 27 2.3.1 DNA extraction from blood. 27 2.3.2 Plate design .
    [Show full text]
  • Cell Mass in Response to Increased Metabolic Demand Is Dependent on HNF-4␣
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Expansion of adult ␤-cell mass in response to increased metabolic demand is dependent on HNF-4␣ Rana K. Gupta,1,3 Nan Gao,1,3 Regina K. Gorski,1,2 Peter White,1 Olga T. Hardy,1 Kiran Rafiq,1 John E. Brestelli,1 Guang Chen,2 Christian J. Stoeckert Jr.,1,2 and Klaus H. Kaestner1,4 1Department of Genetics and Institute for Diabetes, Obesity, and Metabolism, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, USA; 2Center for Bioinformatics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, USA The failure to expand functional pancreatic ␤-cell mass in response to increased metabolic demand is a hallmark of type 2 diabetes. Lineage tracing studies indicate that replication of existing ␤-cells is the principle mechanism for ␤-cell expansion in adult mice. Here we demonstrate that the proliferative response of ␤-cells is dependent on the orphan nuclear receptor hepatocyte nuclear factor-4␣ (HNF-4␣), the gene that is mutated in Maturity-Onset Diabetes of the Young 1 (MODY1). Computational analysis of microarray expression profiles from isolated islets of mice lacking HNF-4␣ in pancreatic ␤-cells reveals that HNF-4␣ regulates selected genes in the ␤-cell, many of which are involved in proliferation. Using a physiological model of ␤-cell expansion, we show that HNF-4␣ is required for ␤-cell replication and the activation of the Ras/ERK signaling cascade in islets. This phenotype correlates with the down-regulation of suppression of tumorigenicity 5 (ST5) in HNF-4␣ mutants, which we identify as a novel regulator of ERK phosphorylation in ␤-cells and a direct transcriptional target of HNF-4␣ in vivo.
    [Show full text]
  • ST5 Positively Regulates Osteoclastogenesis Via Src/Syk/Calcium Signaling Pathways
    Molecules and Cells ST5 Positively Regulates Osteoclastogenesis via Src/Syk/Calcium Signaling Pathways Min Kyung Kim, Bongjun Kim, Jun-Oh Kwon, Min-Kyoung Song, Suhan Jung, Zang Hee Lee, and Hong- Hee Kim* Department of Cell and Developmental Biology, BK21 Program and Dental Research Institute (DRI), School of Dentistry, Seoul National University, Seoul 03080, Korea *Correspondence: [email protected] https://doi.org/10.14348/molcells.2019.0189 www.molcells.org For physiological or pathological understanding of bone INTRODUCTION disease caused by abnormal behavior of osteoclasts (OCs), functional studies of molecules that regulate the generation Bone is a dynamic organ that is constantly being disrupted and action of OCs are required. In a microarray approach, and restructured for maintenance of homeostasis (Zaidi, we found the suppression of tumorigenicity 5 (ST5) gene 2007). The process of bone resorption is controlled by ac- is upregulated by receptor activator of nuclear factor-κB tion of osteoclasts (OCs), which are multinucleated cells ligand (RANKL), the OC differentiation factor. Although the (MNCs) generated from a monocyte/macrophage lineage of roles of ST5 in cancer and β-cells have been reported, the hemopoietic cells (Boyle et al., 2003; Rho et al., 2004). The function of ST5 in bone cells has not yet been investigated. action of excessive OCs induces an imbalance in homeostasis, Knockdown of ST5 by siRNA reduced OC differentiation triggering pathological bone diseases, such as osteoporosis from primary precursors. Moreover, ST5 downregulation (Zaidi, 2007). decreased expression of NFATc1, a key transcription factor Osteoclastogenesis is a multi-step process including com- for osteoclastogenesis. In contrast, overexpression of ST5 mitment of OC precursor cells to mononucleated preosteo- resulted in the opposite phenotype of ST5 knockdown.
    [Show full text]
  • Simplified Method for Predicting a Functional Class of Proteins in Transcription Factor Complexes
    Simplified Method for Predicting a Functional Class of Proteins in Transcription Factor Complexes Marek J. Piatek1., Michael C. Schramm1., Dharani D. Burra1, Abdulaziz binShbreen1, Boris R. Jankovic1, Rajesh Chowdhary2, John A.C. Archer1, Vladimir B. Bajic1* 1 King Abdullah University of Science and Technology (KAUST), Computer, Electrical and Mathematical Sciences and Engineering Division, Computational Bioscience Research Center, Thuwal, Kingdom of Saudi Arabia, 2 Biomedical Informatics Research Center, MCRF, Marshfield Clinic, Marshfield, Wisconsin, United States of America Abstract Background: Initiation of transcription is essential for most of the cellular responses to environmental conditions and for cell and tissue specificity. This process is regulated through numerous proteins, their ligands and mutual interactions, as well as interactions with DNA. The key such regulatory proteins are transcription factors (TFs) and transcription co-factors (TcoFs). TcoFs are important since they modulate the transcription initiation process through interaction with TFs. In eukaryotes, transcription requires that TFs form different protein complexes with various nuclear proteins. To better understand transcription regulation, it is important to know the functional class of proteins interacting with TFs during transcription initiation. Such information is not fully available, since not all proteins that act as TFs or TcoFs are yet annotated as such, due to generally partial functional annotation of proteins. In this study we have developed a method to predict, using only sequence composition of the interacting proteins, the functional class of human TF binding partners to be (i) TF, (ii) TcoF, or (iii) other nuclear protein. This allows for complementing the annotation of the currently known pool of nuclear proteins. Since only the knowledge of protein sequences is required in addition to protein interaction, the method should be easily applicable to many species.
    [Show full text]
  • A Network Inference Approach to Understanding Musculoskeletal
    A NETWORK INFERENCE APPROACH TO UNDERSTANDING MUSCULOSKELETAL DISORDERS by NIL TURAN A thesis submitted to The University of Birmingham for the degree of Doctor of Philosophy College of Life and Environmental Sciences School of Biosciences The University of Birmingham June 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Musculoskeletal disorders are among the most important health problem affecting the quality of life and contributing to a high burden on healthcare systems worldwide. Understanding the molecular mechanisms underlying these disorders is crucial for the development of efficient treatments. In this thesis, musculoskeletal disorders including muscle wasting, bone loss and cartilage deformation have been studied using systems biology approaches. Muscle wasting occurring as a systemic effect in COPD patients has been investigated with an integrative network inference approach. This work has lead to a model describing the relationship between muscle molecular and physiological response to training and systemic inflammatory mediators. This model has shown for the first time that oxygen dependent changes in the expression of epigenetic modifiers and not chronic inflammation may be causally linked to muscle dysfunction.
    [Show full text]
  • Array-Based Profiling of the Differential Methylation Status of Cpg Islands in Hepatocellular Carcinoma Cell Lines
    ONCOLOGY LETTERS 1: 815-820, 2010 Array-based profiling of the differential methylation status of CpG islands in hepatocellular carcinoma cell lines BIN-BIN LIU, DAN ZHENG, YIN-KUN LIU, XIAO-NAN KANG, LU SUN, KUN GUO, RUI-XIA SUN, JIE CHEN and YAN ZHAO Liver Cancer Institute, Zhongshan Hospital of Fudan University, Shanghai 200032, P.R. China Received February 8, 2010; Accepted June 26, 2010 DOI: 10.3892/ol_00000143 Abstract. Alterations in the DNA methylation status particularly genes was linked to the pathogenesis of various types of in CpG islands are involved in the initiation and progression of cancer, and tumor-specific methylation changes were estab- many types of human cancer. A number of DNA methylation lished as prognostic markers in numerous tumor entities (3). alterations have been reported in hepatocellular carcinoma Unlike genetic modifications, such as mutations or genomic (HCC). However, a systematic analysis is required to elucidate imbalances, epigenetic changes are potentially reversible, the relationship between differential DNA methylation status making these changes particularly important therapeutic targets and the characteristics and progression of HCC. In the present in cancer and other diseases (4). study, a global analysis of DNA methylation using a human In recent years, different techniques have been developed CpG-island 12K array was performed on a number of HCC for the genome-wide screening of CGI methylation status. cell lines of different origin and metastatic potential. Based on Included is differential methylation hybridization (DMH) a standard methylation alteration ratio of ≥2 or ≤0.5, 58 CpG which is a high-throughput DNA methylation screening tool island sites and 66 tumor-related genes upstream, downstream that utilizes methylation-sensitive restriction enzymes to or within were identified.
    [Show full text]
  • Studies of a Site-Specific Recombination System and Analysis of New Modulators of Notch Signaling in Caenorhabditis Elegans
    Studies of a site-specific recombination system and analysis of new modulators of Notch signaling in Caenorhabditis elegans. Marcus L. Vargas Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2012 © 2012 Marcus L. Vargas All Rights Reserved Abstract Studies of a site-specific recombination system and analysis of new modulators of Notch signaling in C. elegans. Marcus L. Vargas The ability to make transgenic animals has been a great tool for biologists to study living organisms. In C. elegans, the way transgenes are generated makes them problematic in many circumstances, and there is no single, simple, reliable approach that circumvents all of the problems with current methods of introducing transgenes into C. elegans. In Chapter 2, I discuss my attempt to develop a transgenic system in C. elegans using the bacteriophage φC31 integrase system. I show evidence that φC31 integrase is active in C. elegans somatic tissue. I have successfully integrated a transgene into the C. elegans genome in single-copy using φC31 dependent recombination-mediated cassette exchange. However, attempts to repeat φC31-mediated integration has been unsuccessful. In Chapter 3, I use genetic analysis to test many genes that were reported to be associated with the γ-secretase complex in a mammalian tissue culture system. The γ- secretase complex is an important component in the Notch signaling pathway. Not only is the γ-secretase complex essential in the Notch pathway, it is also implicated in the pathology of familial Alzeheimer’s disease (FAD).
    [Show full text]
  • INTRODUCING a NOVEL METHOD for GENETIC ANALYSIS of AUTISM SPECTRUM DISORDER Sepideh Nouri
    The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2013 INTRODUCING A NOVEL METHOD FOR GENETIC ANALYSIS OF AUTISM SPECTRUM DISORDER sepideh nouri Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Bioinformatics Commons, Computational Biology Commons, and the Genomics Commons Recommended Citation nouri, sepideh, "INTRODUCING A NOVEL METHOD FOR GENETIC ANALYSIS OF AUTISM SPECTRUM DISORDER" (2013). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 417. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/417 This Thesis (MS) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. INTRODUCING A NOVEL METHOD FOR GENETIC ANALYSIS OF AUTISM SPECTRUM DISORDER by Sepideh Nouri, M.S. APPROVED: Eric Boerwinkle, Ph.D., Supervisor Kim-Anh Do, Ph.D. Alanna Morrison, Ph.D. James Hixson, Ph.D. Paul Scheet, Ph.D. APPROVED: Dean, The University of Texas Graduate School of Biomedical Sciences at Houston INTRODUCING A NOVEL METHOD FOR GENETIC ANALYSIS OF AUTISM SPECTRUM DISORDER A THESIS Presented to the Faculty of The University of Texas Health Science Center at Houston and The University of Texas M.
    [Show full text]