Ncounter® Mouse Stem Cell Characterization Panel - Gene and Probe Details
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Correct Setup of the Substantia Nigra Requires Reelin-Mediated Fast, Laterally- Directed Migration of Dopaminergic Neurons
RESEARCH ARTICLE Correct setup of the substantia nigra requires Reelin-mediated fast, laterally- directed migration of dopaminergic neurons Ankita Ravi Vaswani1, Beatrice Weykopf2†, Cathleen Hagemann1, Hans-Ulrich Fried3, Oliver Bru¨ stle2, Sandra Blaess1* 1Neurodevelopmental Genetics, Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 2Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 3Light Microscope Facility, German Center for Neurodegenerative Diseases, Bonn, Germany Abstract Midbrain dopaminergic (mDA) neurons migrate to form the laterally-located substantia nigra pars compacta (SN) and medially-located ventral tegmental area (VTA), but little is known about the underlying cellular and molecular processes. Here we visualize the dynamic cell morphologies of tangentially migrating SN-mDA neurons in 3D and identify two distinct migration modes. Slow migration is the default mode in SN-mDA neurons, while fast, laterally-directed *For correspondence: migration occurs infrequently and is strongly associated with bipolar cell morphology. Tangential [email protected] migration of SN-mDA neurons is altered in absence of Reelin signaling, but it is unclear whether Reelin acts directly on migrating SN-mDA neurons and how it affects their cell morphology and † Present address: Precision migratory behavior. By specifically inactivating Reelin signaling in mDA neurons we demonstrate its Neurology Program & Advanced direct role in SN-mDA tangential migration. Reelin promotes laterally-biased movements in mDA Center for Parkinson’s Disease neurons during their slow migration mode, stabilizes leading process morphology and increases the Research, Harvard Medical School and Brigham & Women’s probability of fast, laterally-directed migration. -
Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins
Technical note Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins: A Study for Peptidyl-Prolyl cis/trans Isomerases (PPIase) Andrzej Galat Retired from: Service d’Ingénierie Moléculaire des Protéines (SIMOPRO), CEA-Université Paris-Saclay, France; [email protected]; Tel.: +33-0164465072 Received: 21 December 2018; Accepted: 21 January 2019; Published: 11 February 2019 Abstract: In this technical note, we describe analyses of more than 15,000 sequences of FK506- binding proteins (FKBP) and cyclophilins, also known as peptidyl-prolyl cis/trans isomerases (PPIases). We have developed a novel way of displaying relative changes of amino acid (AA)- residues at a given sequence position by using heat-maps. This type of representation allows simultaneous estimation of conservation level in a given sequence position in the entire group of functionally-related paralogues (multigene family of proteins). We have also proposed that at least two FKBPs, namely FKBP36, encoded by the Fkbp6 gene and FKBP51, encoded by the Fkbp5 gene, can form dimers bound via a disulfide bridge in the nucleus. This type of dimer may have some crucial function in the regulation of some nuclear complexes at different stages of the cell cycle. Keywords: FKBP; cyclophilin; PPIase; heat-map; immunophilin 1 Introduction About 30 years ago, an exciting adventure began in finding some correlations between pharmacological activities of macrocyclic hydrophobic drugs, namely the cyclic peptide cyclosporine A (CsA), and two macrolides, namely FK506 and rapamycin, which have profound and clinically useful immunosuppressive effects, especially in organ transplantations and in combating some immune disorders. -
Watsonjn2018.Pdf (1.780Mb)
UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support. -
Long Noncoding Rnas in Vascular Smooth Muscle Cells Regulate
www.nature.com/scientificreports OPEN Long noncoding RNAs in vascular smooth muscle cells regulate vascular calcifcation Received: 21 November 2018 Geon Jeong1,2,3, Duk-Hwa Kwon1,4, Sera Shin1,4, Nakwon Choe1,4, Juhee Ryu1,2,3,4, Accepted: 27 March 2019 Yeong-Hwan Lim1,2,3, Jaetaek Kim1,5, Woo Jin Park1,6, Hyun Kook1,3,4 & Young-Kook Kim 1,2,3 Published: xx xx xxxx Vascular calcifcation is characterized by the accumulation of hydroxyapatite crystals, which is a result of aberrant mineral metabolism. Although many clinical studies have reported its adverse efects on cardiovascular morbidity, the molecular mechanism of vascular calcifcation, especially the involvement of long noncoding RNAs (lncRNAs), is not yet reported. From the transcriptomic analysis, we discovered hundreds of lncRNAs diferentially expressed in rat vascular smooth muscle cells (VSMCs) treated with inorganic phosphate, which mimics vascular calcifcation. We focused on Lrrc75a-as1 and elucidated its transcript structure and confrmed its cytoplasmic localization. Our results showed that calcium deposition was elevated after knockdown of Lrrc75a-as1, while its overexpression inhibited calcium accumulation in A10 cells. In addition, Lrrc75a-as1 attenuated VSMCs calcifcation by decreasing the expression of osteoblast-related factors. These fndings suggest that Lrrc75a-as1 acts as a negative regulator of vascular calcifcation, and may serve as a possible therapeutic target in vascular calcifcation. Vascular calcifcation is caused by an imbalance of mineral metabolism, especially calcium phosphate metabo- lism1. It decreases vessel wall tension and increases vascular stifness, thereby increasing the risk of myocardial ischemia, heart failure, arrhythmias, and other cardiovascular diseases2. Vascular calcifcation includes several major types including medial arterial calcifcation, intimal atherosclerosis, and arterial calcifcation of chronic kidney diseases3. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7, -
Table S2.Up Or Down Regulated Genes in Tcof1 Knockdown Neuroblastoma N1E-115 Cells Involved in Differentbiological Process Anal
Table S2.Up or down regulated genes in Tcof1 knockdown neuroblastoma N1E-115 cells involved in differentbiological process analysed by DAVID database Pop Pop Fold Term PValue Genes Bonferroni Benjamini FDR Hits Total Enrichment GO:0044257~cellular protein catabolic 2.77E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 537 13588 1.944851 8.64E-07 8.64E-07 5.02E-07 process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0051603~proteolysis involved in 4.52E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 534 13588 1.93519 1.41E-06 7.04E-07 8.18E-07 cellular protein catabolic process ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, USP17L5, FBXO11, RAD23B, NEDD8, UBE2V2, RFFL, CDC GO:0044265~cellular macromolecule 6.09E-10 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 609 13588 1.859332 1.90E-06 6.32E-07 1.10E-06 catabolic process ISG15, RBM8A, ATG7, LOC100046898, PSENEN, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, ASB8, DCUN1D1, PSMA6, SIAH1A, TRIM32, RNF138, GM12396, RNF20, XRN2, USP17L5, FBXO11, RAD23B, UBE2V2, NED GO:0030163~protein catabolic process 1.81E-09 MKRN1, PPP2R5C, VPRBP, MYLIP, CDC16, ERLEC1, MKRN2, CUL3, 556 13588 1.87839 5.64E-06 1.41E-06 3.27E-06 ISG15, ATG7, PSENEN, LOC100046898, CDCA3, ANAPC1, ANAPC2, ANAPC5, SOCS3, ENC1, SOCS4, -
Bone Morphogenetic Protein-4 Affects Both Trophoblast and Non-Trophoblast Lineage-Associated Gene Expression in Human Embryonic Stem Cells
Vol.2, No.4, 163-175 (2012) Stem Cell Discovery http://dx.doi.org/10.4236/scd.2012.24021 Bone morphogenetic protein-4 affects both trophoblast and non-trophoblast lineage-associated gene expression in human embryonic stem cells Margaret L. Shirley1,2*, Alison Venable1*, Raj R. Rao3, Nolan L. Boyd4, Steven L. Stice1,5,6, David Puett1#, Prema Narayan7# 1Department of Biochemistry and Molecular Biology, University of Georgia, Athens, USA; #Corresponding Author: [email protected] 2Department of Psychiatry, University of California, San Francisco, USA 3Department of Chemical and Life Science Engineering, School of Engineering, Virginia Commonwealth University, Richmond, USA 4Cardiovascular Innovation Institute, University of Louisville, Louisville, USA 5Regenerative Bioscience Center, University of Georgia, Athens, USA 6Department of Animal and Dairy Sciences, University of Georgia, Athens, USA 7Department of Physiology, Southern Illinois University School of Medicine, Carbondale, USA; #Corresponding Author: [email protected] Received 5 May 2012; revised 4 June 2012; accepted 1 July 2012 ABSTRACT cells were obtained. Gene expression by EB was characterized by an up-regulation of a num- Human embryonic stem cells (hESC) can be in- ber of genes associated with trophoblast, ecto- duced to differentiate to trophoblast by bone derm, endoderm, and mesoderm, and the pro- morphogenetic proteins (BMPs) and by aggre- duction of hCG and progesterone confirmed that gation to form embryoid bodies (EB), but there trophoblast-like cells were formed. These re- are many differences and controversies regard- sults suggest that, in the presence of FGF-2, ing the nature of the differentiated cells. Our BG02 cells respond to BMP4 to yield tropho- goals herein were to determine if BG02 cells form trophoblast-like cells (a) in the presence of blast-like cells, which are also obtained upon EB BMP4-plus-basic fibroblast growth factor (FGF-2) formation. -
Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2. -
SPEN Protein Expression and Interactions with Chromatin in Mouse Testicular Cells
156 3 REPRODUCTIONRESEARCH SPEN protein expression and interactions with chromatin in mouse testicular cells Joanna Korfanty1, Tomasz Stokowy2, Marek Chadalski1, Agnieszka Toma-Jonik1, Natalia Vydra1, Piotr Widłak1, Bartosz Wojtaś3, Bartłomiej Gielniewski3 and Wieslawa Widlak1 1Maria Sklodowska-Curie Institute – Oncology Center, Gliwice Branch, Gliwice, Poland, 2Department of Clinical Science, University of Bergen, Bergen, Norway and 3Laboratory of Molecular Neurobiology, Neurobiology Center, Nencki Institute of Experimental Biology, PAS, Warsaw, Poland Correspondence should be addressed to W Widlak; Email: [email protected] Abstract SPEN (spen family transcription repressor) is a nucleic acid-binding protein putatively involved in repression of gene expression. We hypothesized that SPEN could be involved in general downregulation of the transcription during the heat shock response in mouse spermatogenic cells through its interactions with chromatin. We documented predominant nuclear localization of the SPEN protein in spermatocytes and round spermatids, which was retained after heat shock. Moreover, the protein was excluded from the highly condensed chromatin. Chromatin immunoprecipitation experiments clearly indicated interactions of SPEN with chromatin in vivo. However, ChIP-Seq analyses did not reveal any strong specific peaks both in untreated and heat shocked cells, which might suggest dispersed localization of SPEN and/or its indirect binding to DNA. Using in situ proximity ligation assay we found close in vivo associations of SPEN with MTA1 (metastasis-associated 1), a member of the nucleosome remodeling complex with histone deacetylase activity, which might contribute to interactions of SPEN with chromatin. Reproduction (2018) 156 195–206 Introduction However, regulation of osteocalcin expression by SPEN depends on its interactions with other proteins. -
An OTX2-PAX3 Signaling Axis Regulates Group 3 Medulloblastoma Cell Fate
ARTICLE https://doi.org/10.1038/s41467-020-17357-4 OPEN An OTX2-PAX3 signaling axis regulates Group 3 medulloblastoma cell fate Jamie Zagozewski1, Ghazaleh M. Shahriary 1, Ludivine Coudière Morrison1, Olivier Saulnier 2,3, Margaret Stromecki1, Agnes Fresnoza4, Gareth Palidwor5, Christopher J. Porter 5, Antoine Forget6,7, Olivier Ayrault 6,7, Cynthia Hawkins2,8,9, Jennifer A. Chan10, Maria C. Vladoiu2,3,9, Lakshmikirupa Sundaresan2,3, Janilyn Arsenio11,12, Michael D. Taylor 2,3,9,13, Vijay Ramaswamy 2,3,14,15 & ✉ Tamra E. Werbowetski-Ogilvie 1 1234567890():,; OTX2 is a potent oncogene that promotes tumor growth in Group 3 medulloblastoma. However, the mechanisms by which OTX2 represses neural differentiation are not well characterized. Here, we perform extensive multiomic analyses to identify an OTX2 regulatory network that controls Group 3 medulloblastoma cell fate. OTX2 silencing modulates the repressive chromatin landscape, decreases levels of PRC2 complex genes and increases the expression of neurodevelopmental transcription factors including PAX3 and PAX6. Expression of PAX3 and PAX6 is significantly lower in Group 3 medulloblastoma patients and is cor- related with reduced survival, yet only PAX3 inhibits self-renewal in vitro and increases survival in vivo. Single cell RNA sequencing of Group 3 medulloblastoma tumorspheres demonstrates expression of an undifferentiated progenitor program observed in primary tumors and characterized by translation/elongation factor genes. Identification of mTORC1 signaling as a downstream effector of OTX2-PAX3 reveals roles for protein synthesis pathways in regulating Group 3 medulloblastoma pathogenesis. 1 Regenerative Medicine Program, Department of Biochemistry and Medical Genetics, University of Manitoba, Winnipeg, MB, Canada. 2 The Arthur and Sonia Labatt Brain Tumour Research Center, The Hospital for Sick Children, Toronto, ON, Canada. -
TP53 9606.ENSP00000269305 Tumor Protein P53; Acts As a Tumor
TP53 9606.ENSP00000269305 tumor protein p53; Acts as a tumor suppressor in many tumor types; induces growth arrest or apoptosis depending on the physiological circumstances and cell type. Involved in cell cycle regulation as a trans-activator that acts to negatively regulate cell division by controlling a set of genes required for this process. One of the activated genes is an inhibitor of cyclin-dependent kinases. Apoptosis induction seems to be mediated either by stimulation of BAX and FAS antigen expression, or by repression of Bcl-2 expression. Implicated in Notch signaling cross-over TAF1 9606.ENSP00000276072 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa; Largest component and core scaffold of the TFIID basal transcription factor complex. Contains novel N- and C-terminal Ser/Thr kinase domains which can autophosphorylate or transphosphorylate other transcription factors. Phosphorylates TP53 on 'Thr-55' which leads to MDM2-mediated degradation of TP53. Phosphorylates GTF2A1 and GTF2F1 on Ser residues. Possesses DNA- binding activity. Essential for progression of the G1 phase of the cell cycle SUMO2 9606.ENSP00000405965 SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae); Ubiquitin-like protein which can be covalently attached to target lysines either as a monomer or as a lysine-linked polymer. Does not seem to be involved in protein degradation and may function as an antagonist of ubiquitin in the degradation process. Plays a role in a number of cellular processes such as nuclear transport, DNA