Upregulation of CD9 Expression During TPA Treatment of K562 Cells F Le Naour, C Francastel, M Prenant, O Lantz, C Boucheix and E Rubinstein

Upregulation of CD9 expression during TPA treatment of K562 cells F Le Naour, C Francastel, M Prenant, O Lantz, C Boucheix and E Rubinstein

INSERM U268, Hoˆpital Paul Brousse, 94807 Villejuif Cedex, France

The CD9 antigen, a major platelet glycoprotein, is a member of expressed by megakaryocytes and platelets, on which it is a the tetraspan superfamily. We show that treatment of K562 major surface protein with 35 000–60 000 molecules per cell, cells with 12-O-tetradecanoylphorbol-13-acetate (TPA) which a level of expression comparable to that of glycoprotein induces megakaryocytic differentiation, leads to a seven-fold 29–31 increase in CD9 expression, which becomes associated with IIb/IIIa. Because it is recognized by platelet-activating the integrin ␤1, suggesting that it is functionally relevant. The mAbs, the CD9 antigen has been suggested to play a role in upregulation of CD9 expression precedes the appearance of platelet activation. However, platelet activation is triggered the megakaryocytic-specific marker GPIIb (CD41) as well as after recruitment of the platelet Fc receptor, a mechanism also ␤ ␣ integrins 3 (GPIIIa/CD61), v (CD51) and VLA-2 (CD49b). Both found with activating mAbs directed against other target anti- GPIIb/IIIa expression and CD9 upregulation are dependent on 32,33 protein kinase C (PKC) activation since they are blocked by the gens. Another possibility is that CD9 antigen could play specific inhibitor GF109203X. Steady-state levels of CD9 and a role in the differentiation of megakaryocytes. In this paper, GPIIb mRNA were also measured by quantitative RT-PCR. Both we have employed the K562 model for megakaryocytic differ- messengers were detected on resting cells and were shown to entiation and have shown that treatment of these cells with accumulate during TPA treatment. However, the increase of the 12-O-tetradecanoylphorbol-13-acetate (TPA) results in an CD9 mRNA was detected much earlier than the increase of early increase of CD9 expression preceding the acquisition of GPIIb mRNA (1–2 h vs 24–48 h). Using different constructs of the 5′-flanking domain of the CD9 gene cloned ahead of the other megakaryocytic markers. CAT reporter gene, we could demonstrate that a responsive element was located in a 52 bp fragment of the promoter of the CD9 gene. Altogether, these data suggest that CD9 upregul- Materials and methods ation in the megakaryocytic lineage could occur at early stages of differentiation. Cell lines and induction of differentiation Keywords: CD9; tetraspan; K562; megakaryocytic differentiation; TPA K562 is a pluripotent hematopoietic cell line initially derived from a patient with a Philadelphia chromosome-positive chronic myelogenous leukemia.34 HEL is derived from an Introduction erythroleukemia.35 Nalm6 and Reh6 cell lines, respectively CD9 positive and CD9 negative or weakly positive, are The CD9 antigen is a 24 kDa glycoprotein member of the derived from B lineage acute lymphoblastic leukemias. CEM, tetraspan superfamily.1,2 These proteins are characterized by Raji and Daudi are CD9-negative cell lines, respectively four transmembrane domains with intracytoplasmic extremi- derived from a human T cell leukemia and from Burkitt lym- ties and sequence homologies that distinguish them from the phomas. The cells were cultured in RPMI 1640 medium sup- other proteins with four transmembrane domains. Several dif- plemented with 10% FCS, 2 mML-glutamine and antibiotics ferentiation and tumoral antigens are members of the tetras- (all from Gibco, Gaithersburg, MD, USA). 12-O-tetra- pan family, including CD37, CD53, CD63, CD81/TAPA-1, decanoylphorbol-13-acetate (TPA) and hemin were added to CD82, CD151/PETA-3, L6, Co029 and TALLA-1.3–5 The differ- give a final concentration of 16 nM (10 ng/ml) and 100 ␮M, ent tetraspans may derive from the duplication of an ancestral respectively. Erythroid differentiation was evaluated by detec- gene because they are encoded by genes with similar genomic tion of benzidine-stainable hemoglobin after addition of structure. 6–11 Furthermore, two proteins of the tetraspan fam- 100 ␮l of benzidine solution to 100 ␮l of cells suspended in ily were found in the parasite worm Schistosoma12,13 and one culture medium.36 Cells were incubated on ice for 5 min and is expressed by motoneurons in Drosophila14 which strongly examined for benzidine positivity (blue staining). Cyclohexi- suggests an early appearance in evolution. mide (2 and 10 ␮g/ml) and actinomycin D (1 ␮g/ml) (both The exact function of these molecules is still unknown. from Boehringer, Meylan, France), were added 30 min before Recent studies have suggested that CD9 antigen may be TPA treatment. The PKC inhibitor GF109203X (Calbiochem, involved in migration and adhesion processes15–18 functions Meudon, France) was added 45 min before TPA treatment at that may be related to its association with VLA integrins.17,19,20 the concentration of 5 ␮M. The CD9 antigen is also associated with the transmembrane precursor of heparin-binding EGF (HB-EGF) and upregulates the juxtacrine activity of this receptor as well as its activity as Monoclonal antibodies and flow cytometry analysis the receptor for diphtheria toxin.21,22 Certain members of this family have been reported to trigger an activation signal The CD9 mAb SYB-1 has been previously described.17,32 Anti- (CD81, CD82 and CD53).23–26 body Gi9 (VLA-2) was purchased from Immunotech (Luminy, The CD9 antigen is expressed in various tissues. In the France). The anti-VLA␤1 mAb C9 was provided by Dr Zardi hematopoietic tissue it is found at the surface of basophils, (Genoa, Italy). The GPIIb mAb D33C and the GPIIIa mAb B2A eosinophils, PHA-activated T lymphocytes and early B were obtained from Dr Gulino.37 The glycophorin A mAb cells.27,28 It is not found on erythrocytes but is strongly MAS 517P was purchased from Valbiotech (Paris, France) and the anti-integrin ␣v mAb LM609 was purchased from Correspondence: C Boucheix Chemicon (Temecula, CA, USA). Received 19 July 1996; accepted 3 April 1997 Immunofluorescence analysis was carried out on a Profile Upregulation of CD9 expression during TPA treatment F Le Naour et al 1291 II flow cytometer (Coultronics, Margency, France). Cells were dioxetane-3,2′-(5′-chloro)tricyclo[3.3.1.1decan]-4-yl) phenyl incubated with saturating concentrations of primary mAbs, phosphate (CSPD; Perkin-Elmer, Branchburg, NJ, USA) a washed three times with complete medium and incubated substance which emits light after dephosphorylation. with 10 ␮g/ml FITC-GAM. After washing, the cells were fixed Primers and probes were obtained from Genset (Paris, with 1% formaldehyde in PBS. All incubations were perfor- France) and used without further purification. The following med for 30 min at 4°C. Antibodies were biotinylated as primers were used: previously described.17 5′CD9-biotinylated: ATGATGCTGGTGGGCTTCCTG 3′CD9: CGTCCTTCTTGGGGCAGATGTC Quantitative RT-PCR CD9-probe: CATGCACTGGGACTCCTG 5′GAPDH-biotinylated: GGTGAAGGTCGGAGTCAACGGA 3′GAPDH: GAGGGATCTCGCTCCTGGAAGA mRNA levels were quantified by using a reverse transcriptase- GAPDH-probe: AAAGCAGCCCTGGTGACC. mediated PCR assay.38,39 Total RNA was extracted from 5′-GPIIb-biotinylated: ACCTGGACCCAGTGCAGCTCA 4 × 104 cells using TRIsol kit (Gibco BRL, Eragny, France), 3′-GPIIb: GCGTCTTCTCAGCCTCCTCAGTCT ethanol precipitated with the addition of 5 ␮g of glycogen GPIIb-probe: AACTGGCTGCCATTGGGG (Boehringer) and resuspended in 20 ␮l of water. Reverse transcription was performed using 5 ␮l of RNA denatured for 5 min at 65°C, quickly chilled on ice, and incubated in 20 ␮l reverse transcription buffer (10 mM Tris-HCl (pH 9.0 at 25°C), Cell transfection and CAT assays 50 mM KCl, 0.1% Triton X-100, 7 mM MgCl ,2mMdithiotrei- 2 ′ tol, 0.25 mM of each deoxynucleotide triphosphate (dNTP), Different fragments of the 5 -flanking region of CD9 gene were 0.25 U/␮l RNAsin (Promega, Charbonnie`res, France), cloned ahead of the chloramphenicol acetyl transferase (CAT) 0.625 ng/␮l of random hexamer primers (Promega) and gene in the promoterless pCATbasic vector (Promega) as 40 0.2 U/␮l of avian myeloblastosis virus reverse transcriptase described in a previous report. Because the CD9 gene has 11 (Promega). The reaction mixture was incubated at room tem- several transcription initiation sites, all positions are given perature for 10 min and 42°C for 1–2 h and then heated to relative to the translation initiation site. K562, HEL and Daudi 95°C for 5 min. The PCR was then performed uisng 2 ␮lof cells, were transfected by the electroporation method using a cDNA added to 100 ␮l of amplification mixture (50 mM KCl, gene pulser apparatus (Biorad, Hercules, CA, USA). Typically, 7 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl , gelatin 0.01%) con- 10 cells in 0.7 ml PBS, 50 mM Hepes, pH 7.4 were electropo- 2 ° ␮ taining 0.25 ␮M of 5′-biotin labeled and 3′ primers with rated at 4 C with 20 g of each plasmid. The conditions were ␮ ␮ 2.5 U/reaction Taq polymerase (Beckman, Gagny, France). 420 V and 960 F for HEL cells, 400 V and 500 F for K562 Temperature was initially at 94°C for 3 min, followed by and Daudi cells. The efficiency of transfection was controlled 40 cycles at 94°C for 1 min, 65°C for 1 min, and 72°C for 1 as previously described. TPA was added 2 h after transfec- min in a thermal cycler (PCH-3, Techne apparatus (Techne, tion. The determination of CAT activity was performed 2 days 41 Cambridge, UK)). Aliquots of 10 ␮l were removed every three after electroporation as described by Gorman et al. Cells cycles for quantification, starting at cycle 18. The PCR product were washed twice in PBS and lysed in 250 mM Tris-HCl pH 8 was then captured on avidin-coated plates. The second strand by three cycles of freeze–thaw. After centrifugation, the insol- ° was denatured by treatment with NaOH (0.1 M), and the cap- uble material was discarded, the extracts were heated at 65 C tured strand was probed with an oligonucleotide 3′ end lab- to eliminate endogenous acetylases and the protein concen- eled with digoxigenin (Boehringer, Mannheim, Germany). tration in the supernatants was determined by the Bradford After washing, the bound probe was detected by an alkaline assay. CAT activity was assayed in 250 mM Tris-HCl pH 8 ␮ ␮ ␮ 14 phosphatase-labeled anti-digoxigenin mAb (Boehringer) and (200 l reaction) with 20 g of protein extract, 0.2 Ci C- revealed by either a colorimetric method (GAPDH and CD9) chloramphenicol (NEN) and 2 mM acetylcoenzyme A. After ° or by luminometry. Quantification of RNA was performed as incubation at 37 C (3 h for K562 cells and 16 h for HEL and follows: experimental curves (OD or light units vs number of Daudi cells), the chloramphenicol and acetylated products cycles) were matched to a standard curve generated by ampli- were extracted by ethyl acetate and separated by thin-layer fying a serially diluted cDNA in the same experiment. For chromatography in chloroform/5% methanol. Quantification greater accuracy, the comparisons were made by using the was performed with a phosphorimager using the ImageQuant following strategy. The number of cycles necessary to obtain software (Molecular Dynamics, Evry, France). For each con- an OD (or light unit) closed to the half maximum point was struct, several experiments with independent preparations of determined from the experimental curves for each diluted DNA were performed. standard. This new value was then plotted against the corresponding input DNA concentrations (log scale) to generate a line which was fit by the linear least-squares function in Immunoprecipitation and Western blotting Microsoft Excel. The amount of cDNA in each sample was then determined using this equation and the number of cycles 3 × 106 cells were washed three times in HBSS and lysed in necessary to obtain the value previously chosen. To check for 1.5 ml of lysis buffer (1% CHAPS, 10 mM Tris pH 7.4, 150 mM

variability in RNA recovery and efficiency of reverse transcrip- NaCl, 1 mM CaCl2,1mMMgCl2, 0.02% NaN3,1mMPMSF, tion, GAPDH cDNA was also amplified from each cDNA 0.5 ␮g/ml leupeptin, 1 ␮g/ml pepstatin A and 10 KIU/ml preparation. aprotinin). After 30 min incubation at 4°C, the insoluble For the colorimetric method, the substrate was p-NPP sub- material was removed by centrifugation at 10 000 r.p.m., and strate (Sigma, St Louis, MO, USA) and the OD was measured the lysate was precleared overnight by incubation with protein at 405 nm. Luminescence was measured by using the EG&G G-sepharose beads. Proteins were then immunoprecipated by Berthold luminometer (Bad-Wildbad, Germany), after incu- adding to the supernatant 25 ␮g/ml mAb (or 1:200 ascite fluid) bation of samples with disodium 3-(4-methoxyspirol[1,2 and 1/10th volume protein G-sepharose beads (Pharmacia, Upregulation of CD9 expression during TPA treatment F Le Naour et al 1292 Saclay, France). After 5 h incubation at 4°C under constant CD9 was increased seven-fold after 24 h TPA treatment agitation, the beads were washed five times in lysis buffer and (Figure 1). This effect was observed with concentrations of the proteins separated by SDS-PAGE in non-reducing con- TPA ranging from 0.16 to 16 mM (10 ng/ml), but not with ditions. The proteins were then transferred to a PDVF mem- 0.016 nM TPA (data not shown). K562 cells were also treated brane (NEN) in a buffer containing 25 mM Tris, 192 mM gly- with hemin (100 ␮M) in order to induce erythroid differen- cine and 20% methanol, and the membrane was blocked tiation. After 3 days, 70% of the cells were benzidine positive overnight in 5% non-fat dry milk in TBS containing 0.05% and expressed glycophorin A. In these conditions, the Tween. The membrane was then incubated 1 h in TBS-tween expression of CD9 remained similar (data not shown). In order containing the biotinylated antibody, and after several wash- to determine the specificity of the TPA effect on CD9 ings, in TBS-tween containing streptavidin-biotinylated hor- expression, and its possible relationship with megakaryocytic seradish peroxidase complex (Amersham, Les Ulis, France). differentiation, other cell lines were tested. No significant The proteins were then revealed by chemiluminescence changes in CD9 expression were observed when the lymph- (NEN, Les Ulis, France). oid cell lines Nalm-6 (CD9+), CEM, Daudi and Raji (CD9−) were treated with TPA indicating that the upregulation or the induction of CD9 by TPA is not a general phenomenon (data Results and discussion not shown). On the other hand, in the pre-B cell line Reh6 which does not or weakly expresses CD9, TPA treatment Increased expression of CD9 antigen in TPA-treated induced a high expression of this molecule, confirming a pre- K562 cells vious report48 (data not shown). Another erythroleukemia cell line with megakaryocytic features, HEL, was also treated with Undifferentiated K562 cells express surface markers or proper- TPA. CD9 expression was poorly modified (less than 1.5-fold ties characteristic of erythroid (expression of glycophorin A), increase, data not shown), which is not surprising considering myeloid (expression of CD15) or megakaryocytic lineages the high level of CD9 in this cell line (comparable to the level (peroxidase activity).42,43 In the presence of phorbol esters, of TPA-treated K562 cells, data not shown). Because HEL, but K562 cells differentiate along the megakaryocytic lineage with not K562, spontaneously expresses megakaryocytic markers an accompanying increase in expression of megakaryocytic such as GPIIb or GPIIIa (Ref. 49 and data not shown), the markers such as GPIIb, GPIIIa and VLA-2, and concomitant higher expression of CD9, and the absence of effect of TPA decrease in expression of markers of the other two lin- in HEL cells may be related to a more advanced commitment eages.42,44–47 Because CD9 is expressed by megakaryocytes in the megakaryocytic lineage. but not erythrocytes, we have examined the effect of TPA on the expression of this antigen. Upon addition of TPA, the rounded nonadherent morphology of K562 cells changed to Increased CD9 expression precedes the appearance of an adherent, highly elongated, and partially spread phenotype megakaryocytic markers as previously described.44 In these conditions, the level of CD29 (VLA␤1 integrin) was not modified (Figure 1), con- We next compared the kinetic of upregulation of CD9 with firming previous reports.46,47 By contrast, the expression of that of the other megakaryocytic markers. The only tissue- specific molecule, GPIIb, could be detected by flow cytometry after 48 h of treatment (Figure 2). VLA-2 and GPIIIa expressions increased from 10 to 72 h of treatment (Figure 2). At any time during the induction, the expression of GPIIIIa was higher than the expression of GPIIb. Because integrins are heterodimers,50 GPIIIa is likely to associate with another partner, probably the integrin ␣v (CD51) which is induced at the same time (Figure 2). Contrasting with these markers, the enhancement of CD9 expression was detectable on most cells after 5 h of treatment with TPA, reached maximum after 16– 20 h and remained stable for several days. Interestingly, in Reh6 cells, the expression of CD9 antigen was only observed after 10 h of treatment (data not shown).

CD9 upregulation is blocked by the protein kinase C-speciﬁc inhibitor GF109203X

TPA is known to activate the molecules of the PKC family, but also several other molecules such as the guanine nucleotide exchange factor vav and members of the chimaerin family.51,52 ␣PKC has been shown to be speciﬁcally induced during the PMA treatment of K562 cells, suggesting a role for this isotype in the megakaryocytic differentiation of these cells.53 Recently, it was also reported that GF109203X, the most Figure 1 Expression of CD9 and CD29 antigens on K562 cells. selective PKC inhibitor54 reported to date, could block the K562 cells were treated (thick line) or not (thin line) with 16 nM TPA for 24 h. The cells were labeled with mAb SYB-1 (CD9, top panel) or megakaryocytic differentiation of HEL cells triggered by C9 (CD29, lower panel) and analyzed by ﬂow cytometry. Dotted line PMA.55 We now demonstrate that GF109203X prevents the is the control staining. TPA-induced expression of GPIIb and GPIIIa on the surface of Upregulation of CD9 expression during TPA treatment F Le Naour et al 1293 Accumulation of CD9 mRNA precedes the increase of GPIIb mRNA

The levels of CD9 mRNA in K562 cells were then measured by quantitative RT-PCR. An increase of the steady-state levels of CD9 mRNA could be observed as early as 1 h after TPA treatment. This increase was Ϸ15-fold over the control level after 4 to 6 h of treatment (Figure 4). The protein synthesis inhibitor cycloheximide and the transcription inhibitor actinomycin D prevented the accumulation of CD9 mRNA (data not shown). Low levels of GPIIb RNA could be detected in unstimulated K562 cells, confirming a previous report.46 It is possible that the absence of GPIIb at cell surface results from the lack of GPIIIa transcription. Indeed, it has been shown that assembly of GPIIb with GPIIIa is a prerequisite for expression of the complex.56 Contrasting with CD9, no increase of GPIIb mRNA was observed before 24 h of treatment (Figure 5). The increase of CD9 mRNA levels is almost as fast as described for immediate–early genes such as Egr1 (encoding for a zinc finger transcription factor). Egr1 mRNA is induced in K562 cells 30 min after phorbol ester treatment.57 These effects are concomitant with the down-modulation of GATA-1, which occurs within 4 h, during the TPA-induced differentiation of K562 cells.57 Figure 2 Surface expression of CD9 (a), VLA-2, GPIIb, GPIIIa and integrin ␣v (b) on K562 cells. The cells were cultured for the indicated time in the presence of 16 nM TPA. They were then stained by mAbs SYB-1 (CD9), Gi9 (VLA-2), D33C (GPIIb), B2A (GPIIIa) and LM609 (integrin ␣v), and analyzed by flow cytometry. The figure is represen- tative of at least five different experiments. Identification of a TPA-responsive element in the promoter of the CD9 gene

We have previously described the 5′-flanking region of the K562 cells. Moreover, this compound also blocks the upregul- CD9 gene, and reported that this region supports a promoter ation of CD9 (Figure 3). This shows that in K562 cells, both activity in HEL cells when cloned ahead of a CAT reporter CD9 upregulation and GPIIb/IIIa expression are induced by a gene.40 This construct had a poor activity when transfected in PKC-dependent pathway. K562 cells. We tested the effect of TPA on the promoting activity of several constructs of the CD9 promoter cloned ahead of the CAT reporter gene (Figure 6). TPA induced a strong increase (up to 24 times) in the production of CAT when the reporter gene was under the control of several fragments of the CD9 promoter ([−1125, −26][−237, −26], [−205, −26], [−577, −154]). The fact that no significant increase of activity could be observed with the two constructions [−154, −26] and [−577, −205] that lack the [−205, −154] fragment, together with the increase observed with this domain, suggests the involvement of this 52 bp domain in the TPA responsiveness of the CD9 promoter. The mechanism which mediates phorbol ester responsiveness in this model is not completely determined, since the CD9 promoter, like the GPIIb promoter,58 does not contain a perfect AP-1 consensus sequence. However, an AP2 site (5′-(C/T)C(G/C)CC(A/C)N(G/C) (G/C)(G/C)-3′)59 was found in the 5′ extremity of the −205, −154 region.11 Interestingly, the 52 bp region has previously been shown to be responsible for most of the promoting activity of the 5′-flanking region of the CD9 gene in HEL cells.40 Moreover, this region supports the cell specificity since TPA did not induce any increase of activity above control when the constructions were transfected in Daudi or in HEL cell lines, which are not responsive to TPA in terms of Figure 3 TPA induction of CD9, GPIIb and GPIIIa is blocked by CD9 expression (Figure 7). No detectable CAT signal could be a specific inhibitor of PKC. K562 cells were treated with TPA with or without preincubation with GF109203X. The expression of CD9, detected in Reh6 cells using either the control plasmid or the GPIIb and GPIIIa was then analyzed by flow cytometry 72 h after CD9 constructs, suggesting that this cell line cannot be induction. efficiently transfected. Upregulation of CD9 expression during TPA treatment F Le Naour et al 1294

Figure 5 Induction of GPIIb mRNA in TPA-treated K562 cells. K562 cells were cultured in the presence of 16 nM TPA for the indicated time and then analyzed by quantitative RT-PCR for the expression of GPIIb mRNA as in Figure 4 except that revelation was performed by luminescence.

CD9 associates with VLA␤1 upon TPA stimulation

The function of CD9 and other tetraspans is not clearly under- stood. It may, however, be linked to associated surface molecules. Indeed, CD9 is associated with VLA integrins in a var- iety of cell lines, including the megakaryocytic-like cell line HEL.17,19,20 The presence of VLA␤1 in CD9 immunoprecipi- tates was investigated by Western blot (Figure 8). In this tech- nique, the VLA␤1 mAb recognizes two bands corresponding to the mature (Ϸ135 kDa) and immature (Ϸ125 kDa) forms of the protein (Ref. 60 and Rubinstein et al, submitted for publication). We could not detect any coprecipitation of VLA␤1 with CD9 in K562 cells. However, after TPA treatment, the VLA␤1 molecule could be clearly detected in the CD9 immunoprecipitate, suggesting that the induction of CD9 by TPA is functionally relevant.

Concluding remarks

The CD9 antigen has long been described as a target for mAbs that activate platelets. However, these mAbs activate platelets by recruitment and oligomerization of the Fc receptor, as do activating mAbs directed against other platelet antigens.33 When interaction with the Fc receptor is impaired, by using ′ F(ab )2 fragments or blocking this receptor by specific mAbs, there is no evidence of activation or signal transduction (including calcium mobilization and tyrosine protein phosphorylation), suggesting that the CD9 antigen is not a transduction molecule in platelets. Recent studies have suggested that CD9 may be involved in the migration and the aggregation of different cell lines,15–17 including the HEL cell line. Because both aggregation and inhibition of migration are also triggered by CD29 (VLA␤1) mAbs, and CD9 antigen is Figure 4 Quantification of CD9 mRNA levels in K562 cells. RNA associated with this molecule, we have suggested that some from K562 cells cultured in the presence or not of TPA was extracted of the effects triggered by CD9 mAbs could reflect the modi- at different times and subjected to quantitative RT-PCR with either 17 GAPDH or CD9 primers. Samples were taken every three cycles of fication of the function of VLA integrins. To our knowledge, the PCR and the amount of amplified cDNA was estimated by a the role of VLA integrins in the maturation process of megakar- colorimetric method as described in Materials and methods. (a) yocytes has not been investigated. However, in the B lymph- Experimental data obtained after amplification of GAPDH and CD9. oid lineage, antibodies to ␤1 integrins have been shown to Note that the GAPDH amplification curves were identical for each block production of B cells in murine long-term bone marrow sample. In (b), the amount of CD9 mRNA, relative to the non-induced cultures as well as the migration of acute lymphoblastic leuke- cells, is plotted as a function of the time of treatment with TPA. The 61 data are the mean of at least three different experiments. mia cells into human bone marrow stroma. Moreover, Upregulation of CD9 expression during TPA treatment F Le Naour et al 1295

Figure 6 Presence of a TPA-responsive element in the 5′-ﬂanking region of the CD9 gene. K562 cells were transfected with several constructs of the CD9 promoter (left) and then treated with TPA. The activity of the different constructions was then analyzed by extracting the proteins and testing the presence of a CAT activity in the extract. Data are expressed as a percentage of acetylated chloramphenicol (right). Open bars: untreated cells; solid bars: TPA-treated cells.

Figure 8 Association of CD9 and integrin ␤1 in TPA-treated K562 Figure 7 Specificity of the TPA-responsive element of the CD9 cells. Extracts of K562 cells treated or not with TPA for 24 h were gene. K562, HEL and Daudi cells were transfected with the [−237, immunoprecipated with the VLA␤1 mAb C9, the CD9 mAb SYB-1 or −26] fragment of the CD9 promoter and then cultured in the presence a control antibody. The precipitated material was revealed by Western of TPA. The activity of the construction was tested after 2 days of blot using a combination of biotin-labeled C9 and streptavidin- culture by measuring the CAT activity as described in Materials and peroxidase. methods. immature B cells bind more avidly to bone marrow fibroblasts associated molecules. The precise regulation of CD9 and it has been suggested that not only expression, but also expression may therefore be crucial for the differentiation regulation of integrin activity may be important factor modul- process. ating this activity.62 A molecule like CD9 may participate in this process. Indeed, mAbs to CD9 have recently been shown to increase the adhesion of pre-B cells to bone marrow fibro- Acknowledgements blasts by a mechanism which involves the interaction of both VLA-4 and VLA-5 to cellular fibronectin.16 Because the CD9 We are grateful to Dr Breárd, Dr Zardi and Dr Gulino for the antigen is upregulated at an early time during TPA treatment generous gift of antibodies. We also thank Dr M Castagna and of K562 cells, before the induction of other megakaryocytic Dr RC Carroll for useful suggestions and critical review of the markers, and then becomes associated with VLA integrins, manuscript. This work was supported by the association Nou- one may speculate that it plays a role in megakaryocytic differ- velles Recherches Biome´dicales, by the Association pour la entiation by modulating the activity of such integrins or other Recherche sur le Cancer, by the Association Française contre Upregulation of CD9 expression during TPA treatment F Le Naour et al 1296 les Myopathies and by the Institut de Cance´rologie et d’Immu- 4 transmembrane domains (TM4 proteins). Mol Biol Cell 1996; 7: nogeńe´tique. 193–207. 21 Iwamoto R, Higashiyama S, Mitamura T, Taniguchi N, Klagsbrun M, Mekada E. Heparin-binding EGF-like growth factor, which acts as the diphtheria toxin receptor, forms a complex with membrane References protein DRAP27/CD9, which up-regulates functional receptors and diphtheria toxin sensitivity. EMBO J 1994; 13: 2322–2330. 22 Higashiyama S, Iwamoto R, Goishi K, Raab G, Taniguchi N, Klags- 1 Boucheix C, Benoit P, Frachet P, Billard M, Worthington RE, Gag- brun M, Mekada E. The membrane protein CD9/DRAP27 non J, Uzan G. Molecular cloning of the CD9 antigen: a new fam- potentiates the juxtacrine growth factor activity of the membrane- ily of cell surface proteins. J Biol Chem 1991; 266: 117–122. anchored heparin-binding EGF-like growth factor. J Cell Biol 2 Lanza F, Wolf D, Fox CF, Kieffer N, Seyer JM, Fried VA, Coughlin 1995; 128: 929–938. SR, Phillips DR, Jennings IK. cDNA cloning and expression of 23 Bradbury LE, Goldmacher VS, Tedder TF. The CD19 signal trans- platelet p24/CD9 – evidence for a new family of multiple mem- duction complex of B lymphocytes deletion of the CD19 cytoplas- brane-spanning proteins. J Biol Chem 1991; 266: 10638–10645. mic domains alters signal transduction but not complex formation 3 Wright MD, Tomlinson MG. The ins and outs of the transmem- with TAPA-1 and Leu 13. J Immunol 1993; 151: 2915–2927. brane 4 superfamily. Immunol Today 1994; 15: 588–594. 24 Lebel-Binay S, Lagaudrie`re C, Fradelizi D, Conjeaud H. CD82, 4 Takagi S, Fujikawa K, Imai T, Fukuhara N, Fukudome K, Minegishi member of the tetra-span-transmembrane protein family, is a M, Tsuchiya S, Konno T, Hinuma Y, Yoshie O. Identification of a costimulatory protein for T cell activation. J Immunol 1995; 155: highly specific surface marker of T-cell acute lymphoblastic leuke- 1010–110. mia and neuroblastoma as a new member of the transmembrane 25 Schick MR, Levy S. The TAPA-1 molecule is associated on the 4 superfamily. Int J Cancer 1995; 61: 706–715. surface of B cells with HLA-DR molecules. J Immunol 1993; 151: 5 Fitter S, Tetaz TJ, Berndt MC, Ashman LK. Molecular cloning of 4090–4097. cDNA encoding a novel platelet-endothelial cell tetra-span anti- 26 Rasussen AM, Blomhoff HK, Stokke T, Horejsi V, Smeland EB. gen, PETA-3. Blood 1995; 86: 1348–1355. Cross-linking of CD53 promotes activation of resting human B 6 Andria ML, Hsieh CL, Oren R, Francke U, Levy S. Genomic lymphocytes. J Immunol 1994; 153: 4997–5007. organization and chromosomal localization of the tapa-1 gene. J 27 Boucheix C, Perrot JY, Mirshashi M, Giannoni F, Billard M, Berna- Immunol 1991; 147: 1030–1036. dou A, Rosenfeld C. A new set of monoclonal antibodies against 7 Hotta H, Miyamoto H, Hara I, Takashi N, Homma M. Genomic acute lymphoblastic leukemia. Leukemia Res 1985; 9: 597–604. structure of the ME491/CD63 antigen gene and function analysis 28 Shaw S. Antibodies and molecules of the 5th International Work- of the 5′-flanking regulatory sequences. Biochem Biophys Res shop of Leukocyte Differentiation antigens. In: Schlossman S, Commun 1992; 185: 436–442. Boumsell L, Gilks W, Harlan J, Tedder T, Todd R (eds). Oxford 8 Wright MD, Rochelle JM, Tomlinson MG, Seldin MF, Williams University Press: Oxford Leukocyte Typing V: White Cell Differen- AF. Gene structure, chromosomal localization, and protein tiation Antigens. 1994. sequence of mouse CD53 (Cd53): evidence that the transmem- 29 Hato T, Ikeda K, Yasukawa M, Watanabe A, Kobayashi Y. brane 4 superfamily arose by gene duplication. Int Immunol 1993; Exposure of platelet fibrinogen receptors by a monoclonal anti- 5: 209–216. 9 Korinek V, Horejsi V. Genomic structure of the human CD53 body to CD9 antigen. Blood 1988; 72: 224–229. gene. Immunogenetics 1993; 38: 272–279. 30 Rubinstein E, Kouns WC, Jennings LK, Boucheix C, Carroll RC. 10 Nagira M, Imai T, Ishikawa I, Uwabe KI, Yoshie O. Mouse homo- Interaction of two GPIIb/IIIa monoclonal antibodies with platelet logue of C33 antigen (CD82), a member of the transmembrane 4 Fc receptor (FcgammaRII). Br J Haematol 1991; 77: 80–86. superfamily: complementary DNA, genomic structure, and 31 Newman PJ, Allen RW, Kahn RA, Kunicki TJ. Quantitation of expression. Cell Immunol 1994; 157: 144–157. membrane glycoprotein IIIa on intact human platelets using the 11 Rubinstein E, Benoit P, Billard M, Prenant M, Plaisance S, Uzan monoclonal antibody, AP-3. Blood 1985; 65: 227–232. 32 Worthington RE, Carroll RC, Boucheix C. Platelet activation by G, Boucheix C. Organization of the human CD9 gene. Genomics ␥ 1993; 16: 132–138. CD9 monoclonal antibodies and mediated by the Fc RII receptor. 12 Wright MD, Henkle KJ, Mitchell GF. An immunogenic Mr 23,000 Br J Haematol 1990; 74: 216–222. integral membrane protein of Schistosoma mansoni worms that 33 Rubinstein E, Boucheix C, Worthington RE, Carroll RC. Anti-plate- closely resembles a human tumor-associated antigen. J Immunol let antibody interactions with Fcgamma receptor. Sem Thromb 1990; 144: 3195–3200. Hemost 1995; 21: 10–22. 13 Davern KM, Wright MD, Hermann VR, Mitchell GF. Further 34 Lozzio CB, Lozzio BB. Human chronic myelogenous leukemia characterization of the Schistozoma japonicum protein Sj23 that cell-line with positive Philadelphia chromosome. Blood 1975; 45: is a target antigen of an immunodiagnostic monoclonal antibody. 321–334. Mol Chem Parasitol 1991; 48: 67–76. 35 Martin P, Papayannopoulou T. HEL cells: a new human erythro- 14 Kopczynski CC, Davis GW, Goodman CS. A neural tetraspanin, leukemia cell line with spontaneous and induced globin encoded by late bloomer, that facilitates synapse formation. expression. Science 1982; 216: 1233–1235. Science 1996; 271: 1867–1870. 36 Francastel C, Mazouzi Z. Robert-Le´ze`ne`s J. Co-induction of c-fos 15 Ikeyama S, Koyama M, Yamaoko M, Sasada R, Miyake M. Sup- and junB during the latent period preceding commitment of Friend pression of cell motility and metastasis by transfection with human erythroleukemia cells to differentiation. Leukemia 1992; 6: 935– motility-related protein (MRP-1/CD9) DNA. J Exp Med 1993; 177: 939. 1231–1237. 37 Gulino D, Ryckewaert JJ, Andrieux A, Rabiet MJ, Marguerie G. 16 Masellis-Smith A, Shaw ARE. CD9-regulated adhesion. J Immunol Identification of a monoclonal antibody against platelet GPIIb that 1994; 152: 2768–1777. interacts with a calcium-binding site and induces aggregation. J 17 Rubinstein E, Le Naour F, Billard M, Prenant M, Boucheix C. CD9 Biol Chem 1990; 265: 9575–9581. antigen is an accessory subunit of the VLA integrin complexes. 38 Alard P, Lantz O, Sebagh M, Calvo CF, Weill D, Chavanel G, Eur J Immunol 1994; 24: 3005–3013. Senik A, Charpentier B. A versatile ELISA-PCR assay for mRNA 18 Letarte M, Seehafer J, Greaves A, Masellis-Smith A, Shaw A. quantitation from a few cells. BioTechniques 1993; 15: 730–737. Homotypic aggregation of pre-B leukemic cell lines by antibodies 39 Umlauf SW, Beverly B, Lantz O, Schwartz RH. Regulation of to VLA integrins correlates with their expression of CD9. Leukemia interleukin 2 gene expression by CD28 costimulation in mouse T- 1993; 7: 93–103. cell clones: Both nuclear and cytoplasmic RNAs are regulated 19 Rubinstein E, Le Naour F, Lagaudrie`re C, Billard M, Conjeaud H, with complex kinetics. Mol Cell Biol 1995; 15: 3197–3205. Boucheix C. CD9, CD63, CD81 and CD82 are components of a 40 Le Naour F, Prenant M, Francastel C, Rubinstein E, Uzan G, Bou- surface tetraspan network connected to HLA-DR and VLA inte- cheix C. Transcriptional regulation of the human CD9 gene: grins. Eur J Immunol 1996; 26: 2657–2665. characterization of the 5′-flanking region. Oncogene 1996; 13: 20 Berditchevski F, Zutter MM, Hemler ME. Characterization of novel 481–486. complexes on the cell surface between integrins and proteins with 41 Gorman CM, Moffat LF, Howard BH. Recombinant genomes Upregulation of CD9 expression during TPA treatment F Le Naour et al 1297 which express chloramphenicol acetyltransferase in mammalian functional target for tumor-promoting phorbol esters and lysophos- cells. Mol Cell Biol 1982; 2: 1044–1051. phatidic acid. J Biol Chem 1993; 268: 10709–10712. 42 Andersson LC, Nilsson K, Gahmberg CG. K562 – a human erythro- 53 Murray NR, Baumgardner GP, Burns DJ, Fields AP. Protein kinase leukemic cell line. Int J Cancer 1979; 23: 143–147. C isotypes in human erythroleukemia (K562) cell proliferation and 43 Tabilio A, Pelicci PG, Vinc G, Mannoni P, Civin CI, Vainchenker differentiation. J Biol Chem 1993; 268: 15847–15853. W, Testa U, Lipinski M, Rochant H, Breton-Gorius J. Myeloid and 54 Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-Perret T, megakaryocytic properties of K562 cell lines. Cancer Res 1983; Ajanake M, Baudet V, Boissin P, Boursier E, Loriolle F, Duhamel 43: 4569–4574. L, Charon D, Kirilovsky J. The bisindolylmaleimide GF 109203X 44 Tetteroo PAT, Massaro F, Mulder A, Schreuder-van Gelder R, von is a potent and selective inhibitor of protein kinase C. J Biol Chem dem Borne AEGK. Megakaryoblastic differentiation of proerythro- 1991; 266: 15771–15781. blastic K562 cell-line cells. Leukemia Res 1984; 8: 197–206. 55 Hong Y, Martin J, Vainchenker W, Erusalimsky J. Inhibition of pro- 45 Alitalo R. Induced differentiation of K562 leukemia cells: a model tein kinase C suppresses megakaryocytic differentiation and stimu- for studies of gene expression in early megakaryoblasts. Leukemia lates erythroid differentiation in HEL cells. Blood 1996; 87: Res 1990; 14: 501–514. 123–131. 46 Zutter MM, Fong AM, Krigman HR, Santoro SA. Differential regu- 56 Duperray A, Troesch A, Berthier R, Chagnon E, Frachet P, Uzan ␣ ␤ ␣ ␤ lation of the 2 1 and IIb 3 integrin genes during megakaryocytic G, Marguerie G. Biosynthesis and assembly of platelet GPIIb-IIIa differentiation of pluripotential K562 cells. J Biol Chem 1992; 267: in human megakaryocytes: evidence that assembly between pro- 20233–20238. GPIIb and GPIIIa is a prerequisite for expression of the complex 47 Burger SR, Zutter MM, Sturgill-Koszycki S, Santoro SA. Induced on the cell surface. Blood 1989; 74: 1603–1611. cell surface expression of functional ␣2␤1 integrin during megaka- 57 Cheng T, Wang Y, Dai W. Transcription factor egr-1 is involved ryocytic differentiation of K562 leukemic cells. Exp Cell Res 1992; in phorbol 12-myristate 13-acetate-induced megakaryocytic dif- 202: 28–35. ferentiation of K562 cells. J Biol Chem 1994; 269: 30848–30853. 48 LeBien TW, Bollum FJ, Yasmineh WG, Kersey JH. Phorbol ester- 58 Uzan G, Prenant M, Prandini MH, Martin F, Marguerie G. Tissue- induced differentiation of a non-T, non-B leukemic cell line: specific expression of platelet GPIIb gene. J Biol Chem 1991; 266: model for human lymphoid progenitor cell development. J Immu- 8932–8937. nol 1982; 128: 1316–1320. 59 Faisst S, Meyer L. Compilation of vertebrate-encoded transcription 49 Tabilio A, Rosa JP, Testa U, Kieffer N, Nurden AT, Del Canizo MC, factors. Nucleic Acids Res 1992; 20: 3–26. Breton-Gorius J, Vainchenker W. Expression of platelet membrane 60 Heino J, Ignotz RA, Hemler ME, Crouse C, Massague´ J. Regulation glycoproteins and ␣-granule proteins by a human erythroleukemia of cell adhesion receptors by transforming growth factor-␤. Con- cell line (HEL). EMBL J 1984; 3: 453–459. comitant regulation of integrins that share a common ␤1 subunit. 50 Hynes RO. Integrins: versatility, modulation, and signaling in cell J Biol Chem 1989; 264: 380–388. adhesion. Cell 1992; 69: 11–25. 61 Makrynikola V, Bianchi A, Bradstock K, Gottlieb D, Hewson J. 51 Gulbins E, Coggeshall M, Baier G, Telford D, Langlet C, Baier- Migration of acute lymphoblastic leukemia cells into human bone Bitterlich G, Bonnefoy-Berard N, Burn P, Wittinghofer A, Altman marrow stroma. Leukemia 1994; 8: 1734–1743. A. Direct stimulation of vav guanine nucleotide exchange activity 62 Ryan D, Nuccie B, Abboud Camille N, Winslow J. Vascular cell for ras by phorbol esters and diglycerides. Mol Cell Biol 1994; 14: adhesion molecule-1 and the integrin VLA-4 mediate adhesion of 4749–4758. human B cell precursors to cultured bone marrow adherent cells. 52 Ahmed S, Lee J, Kozma R, Best A, Monfries C, Lim L. A novel J Clin Invest 1991; 88: 995–1004.