DOCSLIB.ORG

Geneious Prime User Manual

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Geneious Prime User Manual Geneious Prime 2019.2 User Manual Biomatters Ltd September 24, 2019 Contents 1 Getting Started7 1.1 Downloading & Installing Geneious Prime ..................... 7 1.2 Geneious Prime setup ................................. 9 1.3 Upgrading to new versions .............................. 16 1.4 Licensing......................................... 17 1.5 Troubleshooting..................................... 19 2 The Geneious Prime Main Window 21 2.1 The Sources Panel.................................... 22 2.2 The Document Table .................................. 22 2.3 The Document Viewer Panel.............................. 25 2.4 The Toolbar ....................................... 26 2.5 The Help Panel ..................................... 27 2.6 Geneious Prime menu bar options .......................... 29 3 Importing and Exporting Data 35 3.1 Importing data from the hard drive to your Local folders............. 35 3.2 Data input formats ................................... 36 3.3 Importing files from public databases ........................ 44 3.4 Agents .......................................... 47 3.5 Exporting files...................................... 50 3.6 Printing and Saving Images.............................. 52 4 Managing Your Local Documents 55 4.1 Organizing your local documents........................... 55 4.2 Searching and filtering local documents....................... 58 4.3 Find Duplicates..................................... 62 4.4 Batch Rename...................................... 63 4.5 Backing up your local documents........................... 63 4.6 Document History ................................... 65 5 Creating, Viewing and Editing Sequences 67 5.1 Creating new sequences ................................ 67 5.2 The Sequence Viewer.................................. 69 5.3 Customizable text view for sequences ........................ 81 2 CONTENTS 3 5.4 Editing sequences.................................... 82 5.5 Complement and Reverse Complement ....................... 84 5.6 Translating sequences.................................. 85 5.7 Viewing chromatograms................................ 86 5.8 Meta-data ........................................ 88 6 Parent / Descendant Tracking 93 6.1 Editing Linked Documents............................... 94 6.2 The Lineage View.................................... 96 7 RNA, DNA and Protein Structure Viewer 99 7.1 RNA/DNA secondary structure fold viewer .................... 99 7.2 3D protein structure viewer ..............................100 8 Working with Annotations 103 8.1 Viewing, editing and extracting annotations.....................103 8.2 Adding annotations...................................108 8.3 Compare Annotations .................................113 9 Sequence Alignments 117 9.1 Dotplots .........................................117 9.2 Sequence Alignments..................................119 9.3 Alignment viewing and editing............................126 9.4 Alignment masking...................................131 9.5 Consensus sequences..................................132 10 Assembly and Mapping 135 10.1 Supported sequencing platforms ...........................135 10.2 Read processing.....................................136 10.3 De novo assembly....................................146 10.4 Map to reference.....................................149 10.5 Viewing Contigs.....................................156 10.6 Editing Contigs .....................................158 10.7 Extracting the Consensus................................159 11 Analysis of Assemblies and Alignments 161 11.1 Finding polymorphisms ................................161 11.2 Analyzing Expression Levels .............................164 12 Building Phylogenetic Trees 177 12.1 Phylogenetic tree representation ...........................177 12.2 Tree building in Geneious Prime ...........................178 12.3 Tree building methods and models..........................181 12.4 Resampling – Bootstrapping and jackknifing ....................183 12.5 Viewing and formatting trees .............................185 4 CONTENTS 13 Primers 189 13.1 Design New Primers ..................................189 13.2 Manual primer design .................................198 13.3 Importing primers from a spreadsheet........................200 13.4 Primer Database.....................................201 13.5 Test with Saved Primers ................................202 13.6 Add Primers to Sequence................................203 13.7 Characteristics for Selection ..............................204 13.8 Convert to Oligo.....................................204 13.9 Primer Extensions....................................205 13.10 Extract PCR Product ..................................205 13.11 More Information....................................207 14 Cloning 209 14.1 Find Restriction Sites..................................209 14.2 Digest into fragments..................................212 14.3 Creating a custom enzyme set.............................215 14.4 Introduction to the cloning interface .........................216 14.5 Restriction Cloning...................................218 14.6 Golden Gate.......................................219 14.7 Gibson Assembly....................................221 14.8 Gateway® Cloning ...................................223 14.9 TOPO® Cloning.....................................224 14.10 Copy-paste cloning...................................225 14.11 CRISPR site finder....................................225 14.12 Analyze Silent Mutations................................228 14.13 Optimize Codons....................................229 15 BLAST 233 15.1 Setting up a BLAST search...............................233 15.2 BLAST results......................................235 15.3 NCBI BLAST.......................................237 15.4 Adding alternative BLAST server locations .....................239 15.5 Custom BLAST .....................................239 16 Workflows 245 16.1 Managing Workflows..................................245 16.2 Creating and editing Workflows............................246 16.3 Custom code in Workflows ..............................250 17 Geneious Education 251 17.1 Creating a tutorial....................................251 17.2 Answering a tutorial ..................................252 18 Saving Operation Settings (Option Profiles) 253 CONTENTS 5 19 Shared Databases 255 19.1 Using a Shared Database................................255 19.2 Direct SQL Connection.................................259 19.3 Geneious Server Database...............................267 20 Geneious Server 275 20.1 Introduction to Geneious Server............................275 20.2 Accessing Geneious Server...............................275 20.3 Running jobs and retrieving results..........................277 20.4 Geneious Server enabled plugins...........................279 21 Advanced Administration 281 21.1 Default data location ..................................281 21.2 Change default preferences ..............................282 21.3 Pre-configuring Shared Database connections....................283 21.4 Pre-configuring license server location........................283 21.5 Deleting built-in plugins................................283 21.6 Max memory.......................................284 21.7 Web Linking to Data in Geneious Prime.......................284 6 CONTENTS Chapter 1 Getting Started The best way to get started with Geneious Prime is to try out some of our tutorials. The Tutorial option under the Help menu provides an inbuilt tutorial with a basic introduction to the major features of Geneious Prime. Additional tutorials on specialized functions can be downloaded from our website https://www.geneious.com/tutorials. For additional information and help with troubleshooting, please visit the Geneious support website at https://support.geneious.com. 1.1 Downloading & Installing Geneious Prime Geneious Prime is free to download from https://www.geneious.com/download. If you are a first-time user you will be offered a free trial. If you have already purchased a license you can enter it when Geneious Prime starts up. To download the latest version of Geneious Prime, click on https://www.geneious.com/ download (or type it in to your internet browser), choose the version you want to download and click Download. If you have a 64-bit Linux or Windows machine, ensure you check the “64-bit” box. Geneious Prime can be run on Windows, Mac, or Linux. The following OS versions are sup- ported: Operating System Version Windows 7/8/10 Mac OS 10.8 - 10.14 Linux CentOS or RHEL 6 or higher/Ubuntu Desktop LTS, last 2 supported versions 7 8 CHAPTER 1. GETTING STARTED We recommend at least the following specifications for running Geneious Prime (note that these are minimum requirements - for working with large datasets such as NGS sequences you will need a higher-spec machine): • Processor: Intel x86/x86 64 • Memory: 2048MB or more • Hard-disk: 2GB or more free space • Video: 1024x768 resolution or higher Geneious Prime comes bundled with the correct version of Java for your OS. If you require a version that does not include Java, please contact Geneious Support. Installing on Windows Download the installer for Windows, then double-click on it to run it and follow the prompts. The default installation location is in Program Files. Installing on macOS Download the installer for macOS. If the disk image does not automatically open, double-click on it to open it. Drag the Geneious icon to Applications
Load more

Recommended publications
  • Sequence Listings Webinar Suzannah K. Sundby Carl Oppedahl
    Suzannah K. Sundby Canady + Lortz LLP Sequence Listings Webinar January 9, 2018 – Updated Version Carl Oppedahl Oppedahl Patent Law Firm LLC DISCLAIMER These materials and views expressed today reflect only the personal views of the author and do not necessarily represent the views of other members and clients of the author’s organizations. These materials are public information and have been prepared solely for educational purposes to contribute to the understanding of U.S. intellectual property law. While every attempt was made to ensure that these materials are accurate, errors or omissions may be contained therein, for which any liability is disclaimed. These materials and views are not a source of legal advice and do not establish any form of attorney-client relationship with the authors and their law firms. Why are some sequence errors not identified by Checker? Is “SEQ ID NO” required before sequences in Specifications? Do you recommend using the PatentIn Software? How do you correct sequence listing errors in PCTs? What about the new WIPO ST.26 Standard? Is Checker worthwhile? How can I easily edit sequence listings generated by others? Can I use other software to generate sequence listings? How do I file sequence listings using EFS-Web and ePCT? How long does it take the USPTO to review and approve? Any risk TYFNIL of using certain sequence descriptors? Help! IT locked down my computer… what do I do? Any sequence listing tips? Why Practitioners Should Know and Do Usually lack of time to send to outside vendors Last minute changes to applications (apps) containing sequences (seqs) Particularly, changes to claims Not hostage to staff/vendors, overtime, etc.
    [Show full text]
  • BEA TUXEDO Reference Manual Section 5 - File Formats and Data Descriptions
    BEA TUXEDO Reference Manual Section 5 - File Formats and Data Descriptions BEA TUXEDO Release 6.5 Document Edition 6.5 February 1999 Copyright Copyright © 1999 BEA Systems, Inc. All Rights Reserved. Restricted Rights Legend This software and documentation is subject to and made available only pursuant to the terms of the BEA Systems License Agreement and may be used or copied only in accordance with the terms of that agreement. It is against the law to copy the software except as specifically allowed in the agreement. This document may not, in whole or in part, be copied photocopied, reproduced, translated, or reduced to any electronic medium or machine readable form without prior consent, in writing, from BEA Systems, Inc. Use, duplication or disclosure by the U.S. Government is subject to restrictions set forth in the BEA Systems License Agreement and in subparagraph (c)(1) of the Commercial Computer Software-Restricted Rights Clause at FAR 52.227-19; subparagraph (c)(1)(ii) of the Rights in Technical Data and Computer Software clause at DFARS 252.227-7013, subparagraph (d) of the Commercial Computer Software--Licensing clause at NASA FAR supplement 16-52.227-86; or their equivalent. Information in this document is subject to change without notice and does not represent a commitment on the part of BEA Systems. THE SOFTWARE AND DOCUMENTATION ARE PROVIDED "AS IS" WITHOUT WARRANTY OF ANY KIND INCLUDING WITHOUT LIMITATION, ANY WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. FURTHER, BEA Systems DOES NOT WARRANT, GUARANTEE, OR MAKE ANY REPRESENTATIONS REGARDING THE USE, OR THE RESULTS OF THE USE, OF THE SOFTWARE OR WRITTEN MATERIAL IN TERMS OF CORRECTNESS, ACCURACY, RELIABILITY, OR OTHERWISE.
    [Show full text]
  • The AWK Programming Language
    The Programming ~" ·. Language PolyAWK- The Toolbox Language· Auru:o V. AHo BRIAN W.I<ERNIGHAN PETER J. WEINBERGER TheAWK4 Programming~ Language TheAWI(. Programming~ Language ALFRED V. AHo BRIAN w. KERNIGHAN PETER J. WEINBERGER AT& T Bell Laboratories Murray Hill, New Jersey A ADDISON-WESLEY•• PUBLISHING COMPANY Reading, Massachusetts • Menlo Park, California • New York Don Mills, Ontario • Wokingham, England • Amsterdam • Bonn Sydney • Singapore • Tokyo • Madrid • Bogota Santiago • San Juan This book is in the Addison-Wesley Series in Computer Science Michael A. Harrison Consulting Editor Library of Congress Cataloging-in-Publication Data Aho, Alfred V. The AWK programming language. Includes index. I. AWK (Computer program language) I. Kernighan, Brian W. II. Weinberger, Peter J. III. Title. QA76.73.A95A35 1988 005.13'3 87-17566 ISBN 0-201-07981-X This book was typeset in Times Roman and Courier by the authors, using an Autologic APS-5 phototypesetter and a DEC VAX 8550 running the 9th Edition of the UNIX~ operating system. -~- ATs.T Copyright c 1988 by Bell Telephone Laboratories, Incorporated. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopy­ ing, recording, or otherwise, without the prior written permission of the publisher. Printed in the United States of America. Published simultaneously in Canada. UNIX is a registered trademark of AT&T. DEFGHIJ-AL-898 PREFACE Computer users spend a lot of time doing simple, mechanical data manipula­ tion - changing the format of data, checking its validity, finding items with some property, adding up numbers, printing reports, and the like.
    [Show full text]
  • IBM VM/370 (Ems) Terminal User's Guide for FORTRAN IV Program Product Program Products
    SC28-6891-1 IBM VM/370 (eMS) Terminal User's Guide for FORTRAN IV Program Product Program Products Program Numbers 5734-F01 5734-F02 5734-F03 5734-LM1 5734-LM3 Page of SC28-6891-0,-1 Revised May 13, 1977 By TNL SN20-922S Second Edition (April 1975) This edition, as amended by technical newsletters SN20-9201 and SN20-9225, applies to Release 1.0 of the IBM Virtual Machine Facility/370 (VM/370) (CMS). This edition is a reprint of SC28-6891-0 incorporating changes released in Technical Newsletters SN28-0609 (dated March 1, 1973) and SN28-0620 (dated January 3, 1974). Changes are listed in the Summary of Amendments, Number 3, on the facing page. Information in this publication is subject to significant change. Any such changes will be published in new editions or technical newsletters. Before using the publication, consult the latest IBM System/360 Bibliography, GC20-0360, or IBM System/370 Bibliography, GC20-0001, and the technical newsletters that amend the particular bibliography, to learn which editions are applicable and current. Requests for copies of IBM publications shou'ld be made to your IBM representative or to the IBM branch office that serves your locality. Forms for readers' comments are provided at the back of this publication. If the forms have been removed, address comments to IBM Corporation, P. O. Box 50020, Programming Publishing, San Jose, California 95150. Comments and suggesti~ns become the property of IBM. © Copyright International Business Machines Corporation 1972 Summary of Amendments Number 1 Date of Publication: March 1, 1973 Form of Publication: TNL SN28-0609 to SC28-6891-0 CP and CMS Command Abbreviations Maintenance: Documentation Only Valid abbreviations have been added to the summary descriptions of significant CP and CMS commands.
    [Show full text]
  • Journal Import Requirements and Technical Guidance
    Journal Import Requirements and Technical Guidance Document Purpose The purpose of this document is to provide technical requirements information regarding the Journal Import process for those involved in the remediation of systems impacted by Workday Release 4 functionality. Prior to Workday Release 4 in July 2017, journal import utilizes the Journal Staging Area (JSA). This document provides information about the design that will be used to replace the JSA process of uploading files into Oracle with the new process for loading files into Workday. The process covers both non-Internal Service Provider (non-ISP) and Internal Service Provider (ISP) Journal Imports. Process Due to the large number of JSA sources, one of the guiding principles for the new Journal Import process has been that the overall process should feel familiar and require minimal training for end-users. In order to accomplish this goal, the design(s) utilizes the existing Managed File Transfer (MFT) source directories; the file formats, while different, utilize a file format that contains a Header (GLH) record and multiple Detail (GLD) records. The formats can be viewed in the template file - ISP and non-ISP journal file layouts. The designers of the process are aware that there are use cases that will require some sources to submit both JSA files to be routed to EBS at the same time that they are submitting Journal Import files to be imported into Workday. This use case is very constrained and will only last for a very short period of time. If you think this may apply to you, the team would like to hear from you.
    [Show full text]
  • Streampix 5 Tech Support:[email protected]
    Norpix Inc - www.norpix.com StreamPix 5 Tech Support:[email protected] STREAMPIX 5 Copyright Norpix Inc. (C) 2009-2013 StreamPix5 - Copyright Norpix Inc. (C) 2013 (1/187) Norpix Inc - www.norpix.com StreamPix 5 Tech Support:[email protected] Table of Contents About StreamPix 5...................................................................................................................................8 Minimum system requirements................................................................................................................9 Installing StreamPix...............................................................................................................................10 Authorization codes...............................................................................................................................11 StreamPix 5 Basics................................................................................................................................12 Ribbon Interface overview.................................................................................................................12 Faster !..........................................................................................................................................14 Default list of Keyboard Shortcuts.................................................................................................15 The Sequence slider ....................................................................................................................16
    [Show full text]
  • The UNIX Time- Sharing System
    1. Introduction There have been three versions of UNIX. The earliest version (circa 1969–70) ran on the Digital Equipment Cor- poration PDP-7 and -9 computers. The second version ran on the unprotected PDP-11/20 computer. This paper describes only the PDP-11/40 and /45 [l] system since it is The UNIX Time- more modern and many of the differences between it and older UNIX systems result from redesign of features found Sharing System to be deficient or lacking. Since PDP-11 UNIX became operational in February Dennis M. Ritchie and Ken Thompson 1971, about 40 installations have been put into service; they Bell Laboratories are generally smaller than the system described here. Most of them are engaged in applications such as the preparation and formatting of patent applications and other textual material, the collection and processing of trouble data from various switching machines within the Bell System, and recording and checking telephone service orders. Our own installation is used mainly for research in operating sys- tems, languages, computer networks, and other topics in computer science, and also for document preparation. UNIX is a general-purpose, multi-user, interactive Perhaps the most important achievement of UNIX is to operating system for the Digital Equipment Corpora- demonstrate that a powerful operating system for interac- tion PDP-11/40 and 11/45 computers. It offers a number tive use need not be expensive either in equipment or in of features seldom found even in larger operating sys- human effort: UNIX can run on hardware costing as little as tems, including: (1) a hierarchical file system incorpo- $40,000, and less than two man years were spent on the rating demountable volumes; (2) compatible file, device, main system software.
    [Show full text]
  • K-Watch & K-Manager Pro Application Software User
    K-Watch & K-Manager Pro Application Software User Manual K-Watch & K-Manager Pro Patent Information This product may be protected by one or more patents. For further information, please visit: www.grassvalley.com/patents/ Copyright and Trademark Notice Grass Valley®, GV® and the Grass Valley logo and/or any of the Grass Valley products listed in this document are trademarks or registered trademarks of GVBB Holdings SARL, Grass Valley USA, LLC, or one of its affiliates or subsidiaries. All other intellectual property rights are owned by GVBB Holdings SARL, Grass Valley USA, LLC, or one of its affiliates or subsidiaries. All third party intellectual property rights (including logos or icons) remain the property of their respective owners. Copyright © 2021 GVBB Holdings SARL and Grass Valley USA, LLC. All rights reserved. Specifications are subject to change without notice. Terms and Conditions Please read the following terms and conditions carefully. By using K-Watch and K- Manager Pro documentation, you agree to the following terms and conditions. Grass Valley hereby grants permission and license to owners of K-Watch and K- Manager Pro to use their product manuals for their own internal business use. Manuals for Grass Valley products may not be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying and recording, for any purpose unless specifically authorized in writing by Grass Valley. A Grass Valley manual may have been revised to reflect changes made to the product during its manufacturing life. Thus, different versions of a manual may exist for any given product.
    [Show full text]
  • User's Guide to Seqninja™ (Command-Line Edition)
    User's Guide to SeqNinja™ (Command-Line Edition) DNASTAR, Inc. 2014 Contents Before You Begin ...........................................................................................................................4 Overview .........................................................................................................................................5 Getting Started with SeqNinja ......................................................................................................6 Editing in the SeqNinja Shell ........................................................................................................8 Command-Line Options ................................................................................................................8 Supported File Formats .................................................................................................................9 The SeqNinja Language ..............................................................................................................10 Language Overview .................................................................................................................10 Escape Codes ...........................................................................................................................11 File Patterns .............................................................................................................................12 Settings .....................................................................................................................................13
    [Show full text]
  • Distributed Metadata Management for Post-Production Environments
    Distributed Metadata Management for Post-production Environments Werner Bailer1, Konstantin Schinas2, Georg Thallinger1, Wolfgang Schmidt2, Werner Haas1 1 JOANNEUM RESEARCH Forschungsgesellschaft mbH Institute of Information Systems & Information Management Steyrergasse 17, 8010 Graz, Austria 2 DVS Digital Video Systems GmbH Krepenstraße 8, 30165 Hannover, Germany Abstract: Efficient and flexible management of digital essence and associated metadata is of critical relevance in post-production. We describe a distributed content management system, which uses a peer-to-peer architecture in order to support the dynamic nature of post-production setups. Each peer indexes content on storage under its control by extracting relevant metadata from the headers of essence files as well as by performing automatic content analysis in a background process. The extracted metadata are indexed in a lightweight database at each peer and stored on disk in MPEG-7 XML format in order to provide a standard compliant interface for metadata exchange. The client tool running on a peer allows to edit the metadata in the data base, in the MPEG-7 file and in the file headers (e.g. to adjust timecodes). Moreover, the software provides tools for essence management (copying, moving, defragmentation). The system allows searching for content across all peers in the network. A visual keyframe-based browsing interface allows exploring the indexed content based on the extracted metadata. 1 Introduction Digital media technology resulted in a lasting change in post-production workflows. In digital post-production physical “storage media” such as film rolls and video tapes recede in importance. Instead, uncompressed image sequences in high resolution (e.g.
    [Show full text]
  • Guide to Openvms File Applications
    Guide to OpenVMS File Applications Order Number: AA-PV6PD-TK April 2001 This document is intended for application programmers and designers who write programs that use OpenVMS RMS files. Revision/Update Information: This manual supersedes the Guide to OpenVMS File Applications, OpenVMS Alpha Version 7.2 and OpenVMS VAX Version 7.2 Software Version: OpenVMS Alpha Version 7.3 OpenVMS VAX Version 7.3 Compaq Computer Corporation Houston, Texas © 2001 Compaq Computer Corporation Compaq, AlphaServer, VAX, VMS, the Compaq logo Registered in U.S. and Patent and Trademark Office. Alpha, OpenVMS, PATHWORKS, DECnet, and DEC are trademarks of Compaq Information Technologies Group, L.P. in the United States and other countries. UNIX and X/Open are trademarks of The Open Group in the United States and other countries. All other product names mentioned herein may be the trademarks of their respective companies. Confidential computer software. Valid license from Compaq required for possession, use, or copying. Consistent with FAR 12.211 and 12.212, Commercial Computer Software, Computer Software Documentation, and Technical Data for Commercial Items are licensed to the U.S. Government under vendor’s standard commercial license. Compaq shall not be liable for technical or editorial errors or omissions contained herein. The information in this document is provided "as is" without warranty of any kind and is subject to change without notice. The warranties for Compaq products are set forth in the express limited warranty statements accompanying such products. Nothing herein should be construed as constituting an additional warranty. ZK4506 The Compaq OpenVMS documentation set is available on CD-ROM.
    [Show full text]
  • Introduction to NGS
    Introduction to NGS Dr Torsten Seemann Peter MacCallum Cancer Centre - Fri 27 July 2012 What we will cover today ● High throughput sequencing ● Read sequences ● Base quality values ● FASTQ and FASTA files ● Sequence alignment ● BAM files ● Visualising alignments Sequencing In an ideal world... ● Collect a human genomic DNA sample ● Run it through the lab sequencing machine ● Get back 46 files ○ phased, haplotype chromosomes ○ each one a single contiguous sequence of AGTC ○ maybe some extra files if cancer sample Reality bites ● Unfortunately, no such instrument exists ○ can't read long stretches of DNA (yet) ● But we can read short pieces of DNA ○ shred DNA into ~500 bp fragments ○ we can read these reliably ● High-throughput sequencing ○ sequence millions of different fragments in parallel ○ various technologies to do this Technologies Instrument Method Read Length Yield Quality Value synthesis + Illumina fluorescence 250 ++++ +++++ ++++ ligation + SOLiD fluorescence 75 ++++ +++ +++ non-term NTP + Ion Torrent pH wells 300 ++ +++ +++ non-term NTP + Roche 454 luminescence 600 + ++++ ++ PacBio synthesis + ZMW 12000 +++ + ++ Illumina ● HiSeq 2000 ○ 1 week run ○ 300 Gb ○ 3 billion reads (100bp) ○ "big jobs" ● MiSeq ○ 1 day run ○ 1.5 Gb ○ 5 million reads (150bp) ○ "benchtop sequencer" What you get back Millions to billions of reads (big files): ATGCTTCTCCGCCTTTAATTAAAATTCCATTTCGTGCACCAACACCCGTTCCTACCATAATAGCTGTTGGAGTCGCTAAACCTAATGCACATGGACACGC <- 1st read CTAAGATACTGCCATCTTCTTCCAACGTAAATTGTACGTGATTTTCGATCCATTTTCTTCGAGGTTCTACTTTGTCACCCATTAGTGTGGTTACTCGACG
    [Show full text]