Sequence Listings Webinar Suzannah K. Sundby Carl Oppedahl

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Suzannah K. Sundby

Canady + Lortz LLP

Sequence Listings Webinar

January 9, 2018 – Updated Version

Carl Oppedahl

Oppedahl Patent Law Firm LLC

DISCLAIMER

 These materials and views expressed today reflect only the personal views of the author and do not necessarily represent the views of other members and clients of the author’s organizations.

 These materials are public information and have been prepared solely for educational purposes to contribute to the understanding of U.S. intellectual property law. While every attempt was made to ensure that these materials are accurate, errors or omissions may be contained therein, for which any liability is disclaimed. These materials and views are not a source of legal advice and do not establish any form of attorney-client relationship with the authors and their law firms.

Why are some sequence errors not identified by Checker?

Is “SEQ ID NO” required before sequences in Specifications?

Do you recommend using the PatentIn Software?

How do you correct sequence listing errors in PCTs?

What about the new WIPO ST.26 Standard?

Is Checker worthwhile?

How can I easily edit sequence listings generated by others?

Can I use other software to generate sequence listings?

How do I file sequence listings using EFS-Web and ePCT?

How long does it take the USPTO to review and approve?

Any risk TYFNIL of using certain sequence descriptors?

Help! IT locked down my computer… what do I do?

Any sequence listing tips?

Why Practitioners Should Know and Do

 Usually lack of time to send to outside vendors  Last minute changes to applications (apps) containing sequences (seqs)

 Particularly, changes to claims

 Not hostage to staff/vendors, overtime, etc.  Ultimate responsibility/review  More time efficient and less expensive to clients  Will need to understand minimum requirements, and differences when new ST.26 and how such is automatically converted (what is, what isn’t)

 Avoid looking really stupid and incompetent  Text file (SL as text file and CRF) = ASCII format

 ASCII  ANSI = PlainText (*.txt)

4

Agenda

 Sequence Listing (SL) Rules and Requirements  Generating a SL using PatentIn  Checking with Checker  Modifying an existing SL

 Using a PatentIn Project File  Downloading fromWIPO and modifying the text file

 Submitting a SL

 EFS-Web, ePCT, and digital media

 Responding to Notices  Tips andTricks

5

Sequence Listing Rules
37 CFR 1.821-1.825

US Applications – Utility and 371s
PCT Applications

37 CFR 1.821

1.821(b) – Apps that have seqs as defined in (a) must conform with 1.821-1.825

1.821(a) (MPEP 2421.02)

 Unbranched amino acid (aa) seqs of ≥4 aa  Unbranched nucleotide (nt) seqs of ≥10 nt

 Excluded sequences = branched seqs and seqs <4 specifically defined aa or <10 specifically defined nt

 "Specifically defined" means aa other than "Xaa" and nt bases other than "n" as defined in theWIPO Standard ST.25, includingTables 1-6 in Appendix 2 (MPEP 2422)

7

37 CFR 1.821(a)

 Nucleotides = those that can be represented using the symbols set forth inTable 1

 Modified nts may be described as set forthTable 2, but not explicitly shown in the seq itself

 Amino acids = L-amino acids listed inTable 3

 D-amino acids are not intended to be embraced by the aa defn  Seqs containing post-translationally modified aa’s may be described as the aa seq that is initially translated using symbols of Table 3 with the modified positions described (seeTable 4)

 Any peptide or protein (p/p) that can be expressed as a seq using the symbols inTable 3 + description in the Feature section for, e.g., modified linkages, cross links and end caps, non-peptidyl bonds, etc.

8

D-Amino Acids

PPT by BobWax entitled “Sequence Compliance Soup to Nuts” states:

“Amino acid sequences containing even one D- amino acid are excluded from the sequence rules (37

CFR 1.821(a)(2))”. See Slide 17.

 Not according to USPTO’s current unwritten policy

 Save your breath and time

 Include seqs containing D-amino acids in SLs with Feature Data/Name “MISC_FEATURE” indicating the D- amino acid residues

9

37 CFR 1.821(c)

 Such apps must contain, as a separate part of the disclosure, a paper copy or CD copy (aka SL*) in accordance with 1.822-1.823

* Some parts of MPEP are confusing due to the EFS-Web Legal
Framework, so careful of term usage in MPEP and elsewhere. See, e.g., MPEP 2421.01.

 MPEP 2422.03(a) states that the text file submitted via EFS-Web may serve as both the “paper copy” and the “CRF”

 For the purposes of this webinar:

 Sequence Listing (SL)

 The “Official” SL, i.e., legally recognized SL, whether a text copy or a paper copy  Assume SL is text copy, unless indicated otherwise

 Paper copy = Actual paper or PDF file of SL  CRF = Computer Readable Form of the paper copy as the SL  Text copy = SL as ASCII text filed via EFS-Web  CD copy = SL submitted on physical media, e.g., CDRom.

 This is NOT a “text copy”.  Difference from “text copy” must submit 3 physical carriers labeled “Copy 1”, “Copy 2”, and “CRF”

10

37 CFR 1.821(d)

 Where spec, claims, or drawings discuss a seq provided in an
SL,“reference must be made to the sequence by use of the

sequence identifier, preceded by "SEQ ID NO:" in the text of

the description or claims, even if the sequence is also embedded in the text of the description or claims of the patent application”

 Sequence identifier = sequence number  “preceded by” refers to placing “SEQ ID NO:” before the seq #, e.g., SEQ ID NO: 2.

 Important to use “NO” instead of “No” and a colon instead of a period, i.e., use “NO:” not “No:”, “No.”, or “NO.”

 If seq is in a figure, can provide SEQ ID in description of the drawings or the figure itself (MPEP 2422.02)

 I put SEQ IDs in parentheticals after the given seq when embedded in the spec and in the description of the drawings when in the figures

11

37 CFR 1.821(e)

 If the SL is a paper copy or a CD copy, then a CRF in

accordance with 1.824 must be submitted

 Again, note difference between “CD copy” and “text copy”

 The CRF will not form a legally recognized part of the

patent application itself
 If the CRF is to be identical to a prior CRF of another app of the applicant on file in the USPTO, one can submit aTransfer Request (more later)

 Recall, if a CRF, then the SL is a paper copy (or CD copy); if
SL is a paper copy (or CD copy), then must submit a CRF

12

37 CFR 1.821(f)

 When submitting a CRF, must submit a Sequence Listing
Statement that "the sequence listing information recorded in computer readable form is identical to the written (paper copy or CD copy) sequence listing“

 I’ve always said:

 In accordance with 37 C.F.R. 1.821, the undersigned hereby states that the content of the paper copy of the Sequence Listing and the Computer Readable Form submitted herewith are the same.

 But don’t use anymore because I submit “text copy” SLs via EFS-Web

 See 1.824 for form and format of submitting CRFs and
SLs as text files on physical data carriers rather than via EFS-Web

13

If 1.821(b)-(f) not satisfied at app filing…

1.821(g) – Provides time to comply upon receipt of a
Notice for US utility apps and US 371 national phase entries

1.821(h) – For PCT apps, where US is the ISA or IPEA, provides time to provide CRF for search purposes

 Usually receive a Notice  If CRF is not provided timely, then search/exam will proceed without to the extent possible

 Note: New Fee for Late Furnishing Fee under PCT Rule
13ter ($300)

14

37 CFR 1.822 – Symbols and Format

1.822(a) – Must use symbols and format set forth in ¶¶ (b)-(e)

1.822(b)

 For nt and aa, must use codes according toTables 1 and 3  Can show modified nt and aa in seqs of SL if provided inTables 2 and 4

 Otherwise, must use “n” or “Xaa” with a description in the
Feature section

 Preferably using feature keys listed in Tables 5 or 6

1.822(e)

 Seqs w gaps must be provided as separate seqs  A seq comprising noncontiguous segments of a larger seq or segments from different seqs shall be presented as a separate seq

15

37 CFR 1.822(c) - Nucleotides

 Lower case letters  One letter code (Table 1)  Bases of a seq (including introns) provided in groups of 10 except designated coding regions, which are then provided as groups of 3 (i.e., codons)

 AAs encoded by codons are provided immediately below  Max of 16 codons or 60 bases per line, with a space provided between each codon or group of 10 bases

 Presented, only by a single strand, in the 5’ to 3’ direction, from left to right

 Except for circular seqs, nts are enumerated beginning with the first base of the seq as number 1

 If circular seq, first nt is applicant’s option

16

37 CFR 1.822(d) – Amino Acids

 Three letter abbreviations, with first letter capitalized  Max of 16 aa per line, with a space provided between each aa  N-terminal to C-terminal direction, from left to right, without providing the amino and carboxy groups

 Enumeration may start at the first aa of the first mature protein, with the number 1

 If pre-, pro-, prepro-, or signal seq, provided before the mature protein, then enumerate w negative numbers, counting backwards starting with the aa next to number 1

 Otherwise, enumerate w first aa as number 1 and marking below the seq every 5 aa

 If circular seq, first aa is applicant’s option

 If internal terminator symbols, e.g.,“Ter”,“*”, or “.”, must provide as separate seqs

17

37 CFR 1.823 – Paper Copy as SL

 Must start on a new page and be titled "Sequence Listing"  Pages are numbered independently of the other parts of the app

 No more than 66 lines per page  No more than 72 characters per line  May not include other material that is not part of SL  Should use a fixed-width font, e.g., Courier New, not
Times New Roman, etc., as spacing and numbering will not align

 aatgcctcgt

 aatgcctcgt

 Must submit CFR and identity statement

18

37 CFR 1.823 – CD Copy

 If CD Copy submitted on compact disc (CD), must comply with 1.52(e)

 If utility app, CD can also include table info (not accepted for
PCT apps)

 The MPEP is confusing, so to be on the safe side always submit Copy 1, Copy 2, and a CRF

 Must submit identity statement  See rest of 1.52(e) for more requirements

1.823(b) indicates mandatory and optional info

 Recommend providing only mandatory info

19

37 CFR 1.823 – Text Copy

 As effectively modified by the EFS-Web Legal Framework  If SL is submitted via EFS-Web, then the text file serves as both the paper/CD copy and the CRF (i.e.,“text copy”) –Thus, need only upload one text file

 If the file size too large to submit via EFS-Web, then can submit on physical data carrier on the same day the app is filed under the assigned app number

 Recommend 2 copies in case of damage, i.e., Copy 1 & Copy 2  You MUST submit a third carrier labeled “CRF”

 Note: New fees for large (300-800 MB) and mega (>800 MB)
SLs

 $1k & $10k, respectively

 Specification must include a “sequence listing paragraph”, i.e., an incorporation-by-reference of the text copy (see Sequence Listing Statements below)

 Do not submit a PDF or a paper printout of the SL

20

Recommended publications
  • BEA TUXEDO Reference Manual Section 5 - File Formats and Data Descriptions

    BEA TUXEDO Reference Manual Section 5 - File Formats and Data Descriptions

    BEA TUXEDO Reference Manual Section 5 - File Formats and Data Descriptions BEA TUXEDO Release 6.5 Document Edition 6.5 February 1999 Copyright Copyright © 1999 BEA Systems, Inc. All Rights Reserved. Restricted Rights Legend This software and documentation is subject to and made available only pursuant to the terms of the BEA Systems License Agreement and may be used or copied only in accordance with the terms of that agreement. It is against the law to copy the software except as specifically allowed in the agreement. This document may not, in whole or in part, be copied photocopied, reproduced, translated, or reduced to any electronic medium or machine readable form without prior consent, in writing, from BEA Systems, Inc. Use, duplication or disclosure by the U.S. Government is subject to restrictions set forth in the BEA Systems License Agreement and in subparagraph (c)(1) of the Commercial Computer Software-Restricted Rights Clause at FAR 52.227-19; subparagraph (c)(1)(ii) of the Rights in Technical Data and Computer Software clause at DFARS 252.227-7013, subparagraph (d) of the Commercial Computer Software--Licensing clause at NASA FAR supplement 16-52.227-86; or their equivalent. Information in this document is subject to change without notice and does not represent a commitment on the part of BEA Systems. THE SOFTWARE AND DOCUMENTATION ARE PROVIDED "AS IS" WITHOUT WARRANTY OF ANY KIND INCLUDING WITHOUT LIMITATION, ANY WARRANTY OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. FURTHER, BEA Systems DOES NOT WARRANT, GUARANTEE, OR MAKE ANY REPRESENTATIONS REGARDING THE USE, OR THE RESULTS OF THE USE, OF THE SOFTWARE OR WRITTEN MATERIAL IN TERMS OF CORRECTNESS, ACCURACY, RELIABILITY, OR OTHERWISE.
  • The AWK Programming Language

    The AWK Programming Language

    The Programming ~" ·. Language PolyAWK- The Toolbox Language· Auru:o V. AHo BRIAN W.I<ERNIGHAN PETER J. WEINBERGER TheAWK4 Programming~ Language TheAWI(. Programming~ Language ALFRED V. AHo BRIAN w. KERNIGHAN PETER J. WEINBERGER AT& T Bell Laboratories Murray Hill, New Jersey A ADDISON-WESLEY•• PUBLISHING COMPANY Reading, Massachusetts • Menlo Park, California • New York Don Mills, Ontario • Wokingham, England • Amsterdam • Bonn Sydney • Singapore • Tokyo • Madrid • Bogota Santiago • San Juan This book is in the Addison-Wesley Series in Computer Science Michael A. Harrison Consulting Editor Library of Congress Cataloging-in-Publication Data Aho, Alfred V. The AWK programming language. Includes index. I. AWK (Computer program language) I. Kernighan, Brian W. II. Weinberger, Peter J. III. Title. QA76.73.A95A35 1988 005.13'3 87-17566 ISBN 0-201-07981-X This book was typeset in Times Roman and Courier by the authors, using an Autologic APS-5 phototypesetter and a DEC VAX 8550 running the 9th Edition of the UNIX~ operating system. -~- ATs.T Copyright c 1988 by Bell Telephone Laboratories, Incorporated. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopy­ ing, recording, or otherwise, without the prior written permission of the publisher. Printed in the United States of America. Published simultaneously in Canada. UNIX is a registered trademark of AT&T. DEFGHIJ-AL-898 PREFACE Computer users spend a lot of time doing simple, mechanical data manipula­ tion - changing the format of data, checking its validity, finding items with some property, adding up numbers, printing reports, and the like.
  • IBM VM/370 (Ems) Terminal User's Guide for FORTRAN IV Program Product Program Products

    IBM VM/370 (Ems) Terminal User's Guide for FORTRAN IV Program Product Program Products

    SC28-6891-1 IBM VM/370 (eMS) Terminal User's Guide for FORTRAN IV Program Product Program Products Program Numbers 5734-F01 5734-F02 5734-F03 5734-LM1 5734-LM3 Page of SC28-6891-0,-1 Revised May 13, 1977 By TNL SN20-922S Second Edition (April 1975) This edition, as amended by technical newsletters SN20-9201 and SN20-9225, applies to Release 1.0 of the IBM Virtual Machine Facility/370 (VM/370) (CMS). This edition is a reprint of SC28-6891-0 incorporating changes released in Technical Newsletters SN28-0609 (dated March 1, 1973) and SN28-0620 (dated January 3, 1974). Changes are listed in the Summary of Amendments, Number 3, on the facing page. Information in this publication is subject to significant change. Any such changes will be published in new editions or technical newsletters. Before using the publication, consult the latest IBM System/360 Bibliography, GC20-0360, or IBM System/370 Bibliography, GC20-0001, and the technical newsletters that amend the particular bibliography, to learn which editions are applicable and current. Requests for copies of IBM publications shou'ld be made to your IBM representative or to the IBM branch office that serves your locality. Forms for readers' comments are provided at the back of this publication. If the forms have been removed, address comments to IBM Corporation, P. O. Box 50020, Programming Publishing, San Jose, California 95150. Comments and suggesti~ns become the property of IBM. © Copyright International Business Machines Corporation 1972 Summary of Amendments Number 1 Date of Publication: March 1, 1973 Form of Publication: TNL SN28-0609 to SC28-6891-0 CP and CMS Command Abbreviations Maintenance: Documentation Only Valid abbreviations have been added to the summary descriptions of significant CP and CMS commands.
  • Journal Import Requirements and Technical Guidance

    Journal Import Requirements and Technical Guidance

    Journal Import Requirements and Technical Guidance Document Purpose The purpose of this document is to provide technical requirements information regarding the Journal Import process for those involved in the remediation of systems impacted by Workday Release 4 functionality. Prior to Workday Release 4 in July 2017, journal import utilizes the Journal Staging Area (JSA). This document provides information about the design that will be used to replace the JSA process of uploading files into Oracle with the new process for loading files into Workday. The process covers both non-Internal Service Provider (non-ISP) and Internal Service Provider (ISP) Journal Imports. Process Due to the large number of JSA sources, one of the guiding principles for the new Journal Import process has been that the overall process should feel familiar and require minimal training for end-users. In order to accomplish this goal, the design(s) utilizes the existing Managed File Transfer (MFT) source directories; the file formats, while different, utilize a file format that contains a Header (GLH) record and multiple Detail (GLD) records. The formats can be viewed in the template file - ISP and non-ISP journal file layouts. The designers of the process are aware that there are use cases that will require some sources to submit both JSA files to be routed to EBS at the same time that they are submitting Journal Import files to be imported into Workday. This use case is very constrained and will only last for a very short period of time. If you think this may apply to you, the team would like to hear from you.
  • Streampix 5 Tech Support:Support@Norpix.Com

    Streampix 5 Tech Support:[email protected]

    Norpix Inc - www.norpix.com StreamPix 5 Tech Support:[email protected] STREAMPIX 5 Copyright Norpix Inc. (C) 2009-2013 StreamPix5 - Copyright Norpix Inc. (C) 2013 (1/187) Norpix Inc - www.norpix.com StreamPix 5 Tech Support:[email protected] Table of Contents About StreamPix 5...................................................................................................................................8 Minimum system requirements................................................................................................................9 Installing StreamPix...............................................................................................................................10 Authorization codes...............................................................................................................................11 StreamPix 5 Basics................................................................................................................................12 Ribbon Interface overview.................................................................................................................12 Faster !..........................................................................................................................................14 Default list of Keyboard Shortcuts.................................................................................................15 The Sequence slider ....................................................................................................................16
  • The UNIX Time- Sharing System

    The UNIX Time- Sharing System

    1. Introduction There have been three versions of UNIX. The earliest version (circa 1969–70) ran on the Digital Equipment Cor- poration PDP-7 and -9 computers. The second version ran on the unprotected PDP-11/20 computer. This paper describes only the PDP-11/40 and /45 [l] system since it is The UNIX Time- more modern and many of the differences between it and older UNIX systems result from redesign of features found Sharing System to be deficient or lacking. Since PDP-11 UNIX became operational in February Dennis M. Ritchie and Ken Thompson 1971, about 40 installations have been put into service; they Bell Laboratories are generally smaller than the system described here. Most of them are engaged in applications such as the preparation and formatting of patent applications and other textual material, the collection and processing of trouble data from various switching machines within the Bell System, and recording and checking telephone service orders. Our own installation is used mainly for research in operating sys- tems, languages, computer networks, and other topics in computer science, and also for document preparation. UNIX is a general-purpose, multi-user, interactive Perhaps the most important achievement of UNIX is to operating system for the Digital Equipment Corpora- demonstrate that a powerful operating system for interac- tion PDP-11/40 and 11/45 computers. It offers a number tive use need not be expensive either in equipment or in of features seldom found even in larger operating sys- human effort: UNIX can run on hardware costing as little as tems, including: (1) a hierarchical file system incorpo- $40,000, and less than two man years were spent on the rating demountable volumes; (2) compatible file, device, main system software.
  • K-Watch & K-Manager Pro Application Software User

    K-Watch & K-Manager Pro Application Software User

    K-Watch & K-Manager Pro Application Software User Manual K-Watch & K-Manager Pro Patent Information This product may be protected by one or more patents. For further information, please visit: www.grassvalley.com/patents/ Copyright and Trademark Notice Grass Valley®, GV® and the Grass Valley logo and/or any of the Grass Valley products listed in this document are trademarks or registered trademarks of GVBB Holdings SARL, Grass Valley USA, LLC, or one of its affiliates or subsidiaries. All other intellectual property rights are owned by GVBB Holdings SARL, Grass Valley USA, LLC, or one of its affiliates or subsidiaries. All third party intellectual property rights (including logos or icons) remain the property of their respective owners. Copyright © 2021 GVBB Holdings SARL and Grass Valley USA, LLC. All rights reserved. Specifications are subject to change without notice. Terms and Conditions Please read the following terms and conditions carefully. By using K-Watch and K- Manager Pro documentation, you agree to the following terms and conditions. Grass Valley hereby grants permission and license to owners of K-Watch and K- Manager Pro to use their product manuals for their own internal business use. Manuals for Grass Valley products may not be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying and recording, for any purpose unless specifically authorized in writing by Grass Valley. A Grass Valley manual may have been revised to reflect changes made to the product during its manufacturing life. Thus, different versions of a manual may exist for any given product.
  • User's Guide to Seqninja™ (Command-Line Edition)

    User's Guide to Seqninja™ (Command-Line Edition)

    User's Guide to SeqNinja™ (Command-Line Edition) DNASTAR, Inc. 2014 Contents Before You Begin ...........................................................................................................................4 Overview .........................................................................................................................................5 Getting Started with SeqNinja ......................................................................................................6 Editing in the SeqNinja Shell ........................................................................................................8 Command-Line Options ................................................................................................................8 Supported File Formats .................................................................................................................9 The SeqNinja Language ..............................................................................................................10 Language Overview .................................................................................................................10 Escape Codes ...........................................................................................................................11 File Patterns .............................................................................................................................12 Settings .....................................................................................................................................13
  • Distributed Metadata Management for Post-Production Environments

    Distributed Metadata Management for Post-Production Environments

    Distributed Metadata Management for Post-production Environments Werner Bailer1, Konstantin Schinas2, Georg Thallinger1, Wolfgang Schmidt2, Werner Haas1 1 JOANNEUM RESEARCH Forschungsgesellschaft mbH Institute of Information Systems & Information Management Steyrergasse 17, 8010 Graz, Austria 2 DVS Digital Video Systems GmbH Krepenstraße 8, 30165 Hannover, Germany Abstract: Efficient and flexible management of digital essence and associated metadata is of critical relevance in post-production. We describe a distributed content management system, which uses a peer-to-peer architecture in order to support the dynamic nature of post-production setups. Each peer indexes content on storage under its control by extracting relevant metadata from the headers of essence files as well as by performing automatic content analysis in a background process. The extracted metadata are indexed in a lightweight database at each peer and stored on disk in MPEG-7 XML format in order to provide a standard compliant interface for metadata exchange. The client tool running on a peer allows to edit the metadata in the data base, in the MPEG-7 file and in the file headers (e.g. to adjust timecodes). Moreover, the software provides tools for essence management (copying, moving, defragmentation). The system allows searching for content across all peers in the network. A visual keyframe-based browsing interface allows exploring the indexed content based on the extracted metadata. 1 Introduction Digital media technology resulted in a lasting change in post-production workflows. In digital post-production physical “storage media” such as film rolls and video tapes recede in importance. Instead, uncompressed image sequences in high resolution (e.g.
  • Guide to Openvms File Applications

    Guide to Openvms File Applications

    Guide to OpenVMS File Applications Order Number: AA-PV6PD-TK April 2001 This document is intended for application programmers and designers who write programs that use OpenVMS RMS files. Revision/Update Information: This manual supersedes the Guide to OpenVMS File Applications, OpenVMS Alpha Version 7.2 and OpenVMS VAX Version 7.2 Software Version: OpenVMS Alpha Version 7.3 OpenVMS VAX Version 7.3 Compaq Computer Corporation Houston, Texas © 2001 Compaq Computer Corporation Compaq, AlphaServer, VAX, VMS, the Compaq logo Registered in U.S. and Patent and Trademark Office. Alpha, OpenVMS, PATHWORKS, DECnet, and DEC are trademarks of Compaq Information Technologies Group, L.P. in the United States and other countries. UNIX and X/Open are trademarks of The Open Group in the United States and other countries. All other product names mentioned herein may be the trademarks of their respective companies. Confidential computer software. Valid license from Compaq required for possession, use, or copying. Consistent with FAR 12.211 and 12.212, Commercial Computer Software, Computer Software Documentation, and Technical Data for Commercial Items are licensed to the U.S. Government under vendor’s standard commercial license. Compaq shall not be liable for technical or editorial errors or omissions contained herein. The information in this document is provided "as is" without warranty of any kind and is subject to change without notice. The warranties for Compaq products are set forth in the express limited warranty statements accompanying such products. Nothing herein should be construed as constituting an additional warranty. ZK4506 The Compaq OpenVMS documentation set is available on CD-ROM.
  • Introduction to NGS

    Introduction to NGS

    Introduction to NGS Dr Torsten Seemann Peter MacCallum Cancer Centre - Fri 27 July 2012 What we will cover today ● High throughput sequencing ● Read sequences ● Base quality values ● FASTQ and FASTA files ● Sequence alignment ● BAM files ● Visualising alignments Sequencing In an ideal world... ● Collect a human genomic DNA sample ● Run it through the lab sequencing machine ● Get back 46 files ○ phased, haplotype chromosomes ○ each one a single contiguous sequence of AGTC ○ maybe some extra files if cancer sample Reality bites ● Unfortunately, no such instrument exists ○ can't read long stretches of DNA (yet) ● But we can read short pieces of DNA ○ shred DNA into ~500 bp fragments ○ we can read these reliably ● High-throughput sequencing ○ sequence millions of different fragments in parallel ○ various technologies to do this Technologies Instrument Method Read Length Yield Quality Value synthesis + Illumina fluorescence 250 ++++ +++++ ++++ ligation + SOLiD fluorescence 75 ++++ +++ +++ non-term NTP + Ion Torrent pH wells 300 ++ +++ +++ non-term NTP + Roche 454 luminescence 600 + ++++ ++ PacBio synthesis + ZMW 12000 +++ + ++ Illumina ● HiSeq 2000 ○ 1 week run ○ 300 Gb ○ 3 billion reads (100bp) ○ "big jobs" ● MiSeq ○ 1 day run ○ 1.5 Gb ○ 5 million reads (150bp) ○ "benchtop sequencer" What you get back Millions to billions of reads (big files): ATGCTTCTCCGCCTTTAATTAAAATTCCATTTCGTGCACCAACACCCGTTCCTACCATAATAGCTGTTGGAGTCGCTAAACCTAATGCACATGGACACGC <- 1st read CTAAGATACTGCCATCTTCTTCCAACGTAAATTGTACGTGATTTTCGATCCATTTTCTTCGAGGTTCTACTTTGTCACCCATTAGTGTGGTTACTCGACG
  • Huffman Coding

    Huffman Coding

    Compsci 201, Spring 2014, Huffman Coding Snarf the huff project via Eclipse. You are urged to work in groups of two. Each group should submit ONE program per group. Be sure to include name and NetID of each person in your group in each of the TWO README files that are submitted with the submission. This is new! We haven’t done assignments in pairs before in this class. (And, as this is the last assignment, we won’t be doing them later, either.) Working in a pair comes with a special set of responsibilities to maintain academic honesty. The most basic is this: the project must be the joint work of both members of the pair. One person doing the great majority of the work doesn’t count. Luckily, getting this right is easy: only work on the assignment when both people are there! If both members of the pair are working in front of the same computer, you’re in the clear. Plus, doing it this way keeps you from having to deal with transferring files back and forth between people, which is a huge source of pain and suffering. If you have questions about working in pairs, let us know! What to Know in Doing the Huffman Assignment • One submission will contain the code and both READMEs (named README_netID.txt) • See below for a complete description of Huffman coding for use in a Compsci 201 assignment developed in the mid 90s. • Understand what you have to do before starting to code. Read through the howto document and this document.