DOCSLIB.ORG

File Systems and NFS Representing Files on Disk

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
File Systems and NFS Representing Files on Disk Representing Files On Disk: Nachos An OpenFile represents a file in active use, with a seek pointer and OpenFile(sector) read/write primitives for arbitrary OpenFile Seek(offset) byte ranges. Read(char* data, bytes) Write(char* data, bytes) logical once upo n a time File Systems and NFS block 0 /nin a l A file header describes an on-disk logical and far file as an ordered sequence of block 1 far away FileHdr sectors with a length, mapped by ,/nlived t a logical-to-physical block map. logical he wise block 2 and sage wizard. bytes sectors Allocate(..., filesize) OpenFile* ofd = filesys->Open(“tale”); length =FileLength () ofd ->Read(data, 10) gives ‘ once upon ‘ sector = ByteToSector(offset) ofd ->Read(data, 10) gives ‘ a time/nin ‘ File Metadata Representing Large Files On disk, each file is represented by a FileHdr structure. The Nachos FileHdr occupies exactly one inode disk sector, limiting the maximum file size. The FileHdr object is an in-memory copy of this structure. sector size = 128 bytes direct 120 bytes of block map = 30 entries block The FileHdr is a file system “bookeeping” structure each entry maps a 128-byte sector file attributes : may include owner, that supplements the file data itself: these kinds of max file size = 3840 bytes map access control, time of structures are called filesystem metadata . (12 entries) create/modify/access, etc. indirect In Unix, theFileHdr (called an index - bytes block sectors A Nachos FileHdr occupies node or inode) represents large files using etc. exactly one disk sector. a hierarchical block map. logical-physical block map (like a translation table) Each file system block is a clump of sectors (4KB, 8KB, 16KB). To operate on the file (e.g., Inodes are 128 bytes, packed into blocks. to open it), theFileHdr must Each inodehas 68 bytes of attributes and 15 block map entries. be read into memory. double suppose block size = 8KB indirect physical block pointers in the 12 direct block map entries in the inodecan map 96KB of data. block map are sector IDs Any changes to the attributes One indirect block (referenced by theinode) can map 16MB of data. block or block map must be written One double indirect block pointer in inodemaps 2K indirect blocks. FileHdr* hdr = new FileHdr(); back to the disk to make them hdr->FetchFrom(sector) permanent. maximum file size is 96KB + 16MB + (2K*16MB) + ... hdr->WriteBack(sector) Representing Small Files Basics of Directories Internal fragmentation in the file system blocks can waste A directory is a set of file names, supporting lookup by symbolic name. significant space for small files. E.g., 1KB files waste 87% of disk space (and bandwidth) in a naive In Nachos, each directory is a file containing file system with an 8KB block size. a set of mappings from name->FileHdr. Most files are small: one study [Irlam93] shows a median of 22KB. Directory(entries) wind: 18 sector = Find(name) directory fileHdr 0 FFS solution: optimize small files for space efficiency. Add(name, sector) • Subdivide blocks into 2/4/8 fragments (or just frags). Remove(name) snow: 62 0 • Free block maps contain one bit for each fragment. Each directory entry is a fixed -size rain: 32 To determine if a block is free, examine bits for all its fragments. slot with space for a FileNameMaxLen byte name. hail: 48 • The last block of a small file is stored on fragment(s). Entries or slots are found by a linear scan. If multiple fragments they must be contiguous. A directory entry may hold a pointer to another directory, sector 32 forming a hierarchical name space. 1 A Nachos Filesystem On Disk A Typical Unix File Tree An allocation bitmap file maintains A directory maintains the free/allocated state of each physical name->FileHdr mappings for Each volume is a set of directories and files; a host’s file tree is the set of block; its FileHdr is always stored in all existing files; its FileHdr is directories and files visible to processes on a given host. sector 0. sector 0 sector 1 always stored in sector 1. allocation File trees are built by grafting / bitmap file volumes from different volumes directory wind: 18 or from network servers. 11100010 file 0 bin etc tmp usr vmunix 00101101 snow: 62 10111101 In Unix, the graft operation is 0 the privileged mount system call, ls sh project users once upo rain: 32 and each volume is a filesystem. 10011010 n a time hail: 48 00110001 /n in a l packages 00010101 mount point mount ( coveredDir, volume) (volume root) Every box in this diagram coveredDir: directory pathname 00101110 and far represents a disk sector. volume: devicespecifier or network volume 00011001 far away volume root contents become visible at pathname coveredDir 01000100 , lived th tex emacs Filesystems VFS: the Filesystem Switch Each file volume (filesystem) has a type, determined by its Sun Microsystems introduced the virtual file system interface disk layout or the network protocol used to access it. in 1985 to accommodate diverse filesystemtypes cleanly. ufs (ffs), lfs, nfs, rfs, cdfs, etc. VFS allows diverse specific file systems to coexist in a file tree, Filesystemsare administered independently. isolating all FS-dependencies in pluggable filesystem modules. Modern systems also include “logical” pseudo-filesystems in user space VFS was an internal kernel restructuring the naming tree, accessible through the file syscalls. with no effect on the syscall interface. syscall layer (file, uio, etc.) procfs: the /proc filesystem allows access to process internals. network protocol Virtual File System (VFS) Incorporates object-oriented concepts: stack a generic procedural interface with mfs: the memory file system is a memory -based scratch store. (TCP/IP) NFS FFS LFS *FS etc. etc. multiple implementations. Processes access filesystems through common system calls. device drivers Based on abstract objects with dynamic Other abstract interfaces in the kernel: device drivers, method binding by type...in C. file objects, executable files, memory objects. Vnodes Vnode Operations and Attributes In the VFS framework, every file or directory in active use is represented by a vnode object in kernel memory. vnodeattributes ( vattr) directories only type (VREG, VDIR, VLNK, etc.) vop_lookup (OUT vpp, name) mode (9+ bits of permissions) vop_create (OUT vpp, name,vattr ) nlink (hard link count) vop_remove ( vp, name) freevnodes owner user ID vop_link ( vp, name) syscall layer owner group ID vop_rename ( vp, name, tdvp, tvp, name) filesystem ID vop_mkdir (OUT vpp, name, vattr ) Each vnodehas a standard unique file ID vop_rmdir (vp, name) file attributes struct. file size (bytes and blocks) vop_symlink (OUT vpp, name, vattr , contents) access time vop_readdir (uio , cookie) Generic vnodepoints at modify time vop_readlink (uio ) filesystem-specific struct generation number (e.g., inode, rnode), seen files only generic operations only by thefilesystem . vop_getpages (page**, count, offset) Each specific file system vop_getattr (vattr ) vop_putpages (page**, count, sync, offset) maintains a cacheof its vop_setattr (vattr ) Vnodeoperations are vop_fsync() resident vnodes. vhold () macros that vector to vholdrele() filesystem-specific NFS UFS procedures. 2 V/ Inode Cache Network File System (NFS) VFS free list head HASH(fsid, fileid) Active vnodesare reference-counted server by the structures that hold pointers to client them. user programs syscall layer VFS - system open file table syscall layer - process current directory NFS VFS - file system mount points server - etc. Each specific file system maintains its own hash of vnodes(BSD). UFS - specific FS handles initialization UFS NFS - free list is maintained by VFS vget(vp): reclaim cached inactivevnodefrom VFS free list client vref (vp): increment reference count on an active vnode vrele(vp): release reference count on avnode vgone(vp):vnodeis no longer valid (file is removed) network NFS Protocol NFS Vnodes NFS is a network protocol layered above TCP/IP. The NFS protocol has an operation type for (almost) every • Original implementations (and most today) use UDP vnode operation, with similar arguments/results. datagram transport for low overhead. struct nfsnode* np = VTONFS(vp); Maximum IP datagram size was increased to match FS block syscall layer size, to allow send/receive of entire file blocks. VFS nfs _vnodeops Some newer implementations use TCP as a transport. NFS • The NFS protocol is a set of message formats and types. NFS client stubs server Client issues a request message for a service operation. nfsnode RPC/UDP Server performs requested operation and returns a reply message with status and (perhaps) requested data. The nfsnode holds information network UFS needed to interact with the server to operate on the file. File Handles Pathname Traversal Question: how does the client tell the server which file or When a pathname is passed as an argument to a system call, directory the operation applies to? the syscall layer must “convert it to a vnode”. • Similarly, how does the server return the result of a lookup? Pathname traversal is a sequence ofvop_lookup calls to descend More generally, how to pass a pointer or an object reference as the tree to the named file or directory. an argument/result of an RPC call? Issues: In NFS, the reference is a file handle or fhandle, a 32-byte open(“/tmp/zot”) 1. crossing mount points vp = get vnode for / (rootdir) token/ticket whose value is determined by the server. vp->vop_lookup(&cvp, “tmp”); 2. obtaining root vnode (or current dir) 3. finding resident vnodes in memory • Includes all information needed to identify the file/object on vp = cvp; vp->vop_lookup(&cvp, “zot”); 4. caching name->vnode translations the server, and get a pointer to it quickly. 5. symbolic (soft) links 6. disk implementation of directories 7. locking/referencing to handle races volume ID inode # generation # with name create and delete operations 3 From Servers to Services NFS: From Concept to Implementation Are Web servers and RPC servers scalable? Available? Now that we understand the basics, how do we make it work A single server process can only use one machine.
Load more

Recommended publications
  • Dealing with Document Size Limits
    Dealing with Document Size Limits Introduction The Electronic Case Filing system will not accept PDF documents larger than ten megabytes (MB). If the document size is less than 10 MB, it can be filed electronically just as it is. If it is larger than 10 MB, it will need to be divided into two or more documents, with each document being less than 10 MB. Word Processing Documents Documents created with a word processing program (such as WordPerfect or Microsoft Word) and correctly converted to PDF will generally be smaller than a scanned document. Because of variances in software, usage, and content, it is difficult to estimate the number of pages that would constitute 10 MB. (Note: See “Verifying File Size” below and for larger documents, see “Splitting PDF Documents into Multiple Documents” below.) Scanned Documents Although the judges’ Filing Preferences indicate a preference for conversion of documents rather than scanning, it will be necessary to scan some documents for filing, e.g., evidentiary attachments must be scanned. Here are some things to remember: • Documents scanned to PDF are generally much larger than those converted through a word processor. • While embedded fonts may be necessary for special situations, e.g., trademark, they will increase the file size. • If graphs or color photos are included, just a few pages can easily exceed the 10 MB limit. Here are some guidelines: • The court’s standard scanner resolution is 300 dots per inch (DPI). Avoid using higher resolutions as this will create much larger file sizes. • Normally, the output should be set to black and white.
    [Show full text]
  • If You Have Attempted to Upload Your Files and You Receive an Error Or
    If you have attempted to upload your files and you receive an error or they simply will not upload to EDJOIN, your files are probably either in an inappropriate format, or too large. Please ensure that your document meets the appropriate format and size requirements below. Acceptable format: .PDF Size limit: Each file must not exceed 1 MB (megabyte) or 1024 KB File Name: The file name must contain less than 50 characters including spaces. If the file name contains more than 50 characters or any special characters, you may have trouble attaching your documents and/or the district you are applying to may have trouble viewing them. Please make sure your document title only contains letters and numbers. If the document is multiple pages, you may need to scan multiple sections of the document to maintain the 1MB file size allowance. Saving Your Documents to .PDF Format: If Using A PC: Microsoft Word 2007 or later allows you to save a document as .PDF on a PC 1. Open the document from where you have it saved in your computer. 2. Once the document opens in Microsoft Word, go to the File menu at the top left of your Microsoft Word window and click on Save as. 3. Note where you will be saving the document, go to the bottom of the window and select PDF (*.pdf) in the Save as type box. 4. Save and close. If Using A Mac: Using the print dialog box allows you to save just about any document to .PDF format from a Mac 1.
    [Show full text]
  • Sequence Alignment/Map Format Specification
    Sequence Alignment/Map Format Specification The SAM/BAM Format Specification Working Group 3 Jun 2021 The master version of this document can be found at https://github.com/samtools/hts-specs. This printing is version 53752fa from that repository, last modified on the date shown above. 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with `@', while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAMfilemay optionally specify the version being used via the @HD VN tag. For full version history see Appendix B. Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII 1 in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax. 1.1 An example Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment. Coor 12345678901234 5678901234567890123456789012345 ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT +r001/1 TTAGATAAAGGATA*CTG +r002 aaaAGATAA*GGATA +r003 gcctaAGCTAA +r004 ATAGCT..............TCAGC -r003 ttagctTAGGC -r001/2 CAGCGGCAT The corresponding SAM format is:2 1Charset ANSI X3.4-1968 as defined in RFC1345.
    [Show full text]
  • Mac OS X Server
    Mac OS X Server Version 10.4 Technology Overview August 2006 Technology Overview 2 Mac OS X Server Contents Page 3 Introduction Page 5 New in Version 10.4 Page 7 Operating System Fundamentals UNIX-Based Foundation 64-Bit Computing Advanced BSD Networking Architecture Robust Security Directory Integration High Availability Page 10 Integrated Management Tools Server Admin Workgroup Manager Page 14 Service Deployment and Administration Open Directory Server File and Print Services Mail Services Web Hosting Enterprise Applications Media Streaming iChat Server Software Update Server NetBoot and NetInstall Networking and VPN Distributed Computing Page 29 Product Details Page 31 Open Source Projects Page 35 Additional Resources Technology Overview 3 Mac OS X Server Introduction Mac OS X Server version 10.4 Tiger gives you everything you need to manage servers in a mixed-platform environment and to con gure, deploy, and manage powerful network services. Featuring the renowned Mac OS X interface, Mac OS X Server streamlines your management tasks with applications and utilities that are robust yet easy to use. Apple’s award-winning server software brings people and data together in innovative ways. Whether you want to empower users with instant messaging and blogging, gain greater control over email, reduce the cost and hassle of updating software, or build your own distributed supercomputer, Mac OS X Server v10.4 has the tools you need. The Universal release of Mac OS X Server runs on both Intel- and PowerPC-based The power and simplicity of Mac OS X Server are a re ection of Apple’s operating sys- Mac desktop and Xserve systems.
    [Show full text]
  • Converting Audio – Audio File Size
    Converting Audio – Audio File Size By the end of this worksheet you should: • know how to calculate the possible file size of an audio recording You should now be very familiar with the following concepts: • BIT: a single zero (0) or (1), short for Binary digIT • BYTE: 8 bits • Analogue: a continuously varying signal • Digital: a pulse that alternates between OFF (0) and ON (1) • ADC: Analogue to Digital Converter • Sample Rate: how many times per second the ADC tests the incoming analogue signal • Sample Resolution: the number of bits allocate to each sample taken We only need to add 1 more snippet of knowledge to calculate the possible file size of an audio recording, and that is the duration of the recording. Imagine that you record 10 seconds of audio, setting the sample rate to 44.1kHz and using 16 bits per sample. What does this all mean? Page 1 of 5 Converting Audio – Audio File Size Well, we know that… • each sample uses 16 bits • there are 44 100 samples per second • this means that we are using 44 100 samples per second x 16 bits = 705 600 bits per second • Since we recorded for 10 seconds we have 705 600 bits per second x 10 seconds = 7 056 000 bits in total • There are 8 bits to a byte so 7 056 000 ÷ 8 = 882 000 bytes • 1 000 is a kilo so 882 000 bytes = 882 kilobytes or 882KB So, a 10 second recording that is set at 16 bits/44.1kHz might result in a file of 882KB.
    [Show full text]
  • Lecture 03: Layering, Naming, and Filesystem Design
    Lecture 03: Layering, Naming, and Filesystem Design Principles of Computer Systems Spring 2019 Stanford University Computer Science Department Lecturer: Chris Gregg PDF of this presentation 1 Lecture 03: Layering, Naming, and Filesystem Design Just like RAM, hard drives provide us with a contiguous stretch of memory where we can store information. Information in RAM is byte-addressable: even if you’re only trying to store a boolean (1 bit), you need to read an entire byte (8 bits) to retrieve that boolean from memory, and if you want to flip the boolean, you need to write the entire byte back to memory. A similar concept exists in the world of hard drives. Hard drives are divided into sectors (we'll assume 512 bytes), and are sector-addressable: you must read or write entire sectors, even if you’re only interested in a portion of each. Sectors are often 512 bytes in size, but not always. The size is determined by the physical drive and might be 1024 or 2048 bytes, or even some larger power of two if the drive is optimized to store a small number of large files (e.g. high definition videos for youtube.com) Conceptually, a hard drive might be viewed like this: Thanks to Ryan Eberhardt for the illustrations and the text used in these slides, and to Ryan and Jerry Cain for the content. 2 Lecture 03: Layering, Naming, and Filesystem Design The drive itself exports an API—a hardware API—that allows us to read a sector into main memory, or update an entire sector with a new payload.
    [Show full text]
  • Tinkertool System 6 Reference Manual Ii
    Documentation 0632-1969/2 TinkerTool System 6 Reference Manual ii Version 6.99, July 21, 2021. US-English edition. MBS Documentation 0632-1969/2 © Copyright 2003 – 2021 by Marcel Bresink Software-Systeme Marcel Bresink Software-Systeme Ringstr. 21 56630 Kretz Germany All rights reserved. No part of this publication may be redistributed, translated in other languages, or transmitted, in any form or by any means, electronic, mechanical, recording, or otherwise, without the prior written permission of the publisher. This publication may contain examples of data used in daily business operations. To illustrate them as completely as possible, the examples include the names of individuals, companies, brands, and products. All of these names are fictitious and any similarity to the names and addresses used by an actual business enterprise is entirely coincidental. This publication could include technical inaccuracies or typographical errors. Changes are periodically made to the information herein; these changes will be incorporated in new editions of the publication. The publisher may make improvements and/or changes in the product(s) and/or the program(s) described in this publication at any time without notice. Make sure that you are using the correct edition of the publication for the level of the product. The version number can be found at the top of this page. Apple, macOS, iCloud, and FireWire are registered trademarks of Apple Inc. Intel is a registered trademark of Intel Corporation. UNIX is a registered trademark of The Open Group. Broadcom is a registered trademark of Broadcom, Inc. Trademarks or service marks are used for identification purposes only.
    [Show full text]
  • File System Structure Kevin Webb Swarthmore College March 29, 2018 Today’S Goals
    File System Structure Kevin Webb Swarthmore College March 29, 2018 Today’s Goals • Characterizing disks and storage media • File system: adding order and structure to storage • FS abstractions (files, directories, paths) and their implementation with data structures (inodes, block pointers, directory entries) Motivation for File Systems • Long-term storage is needed for • user data: text, graphics, images, audio, video • user programs • system programs (including OS kernel) and data • Persistent: remains “forever” • Large: “unlimited” size • Sharing: controlled access • Security: protecting information Using Disks for Storage • Why disks: persistent, random access, cheap Source: http://www.mkomo.com/cost-per-gigabyte Source: https://www.backblaze.com/blog/hard-drive-cost-per-gigabyte/ Using Disks for Storage • Why disks: persistent, random access, cheap • Biggest hurdle to OS: disks are slow Disk Geometry • Disk components • Platters • Surfaces • Tracks • Sectors • Cylinders • Arm • Heads disk r/w Disk Geometry head(s) disk arm sector platters track cylinder • Moving parts: spinning platters, disk actuator arm • seek time: moving the arm to the desired track • rotational latency: turning the platter so that the desired data is under the head Implications of moving parts… • https://www.youtube.com/watch?v=tDacjrSCeq4 • Disks have a MUCH higher failure rate than most other components • PSA: back up your data! Should the OS take these disk parameters into account when using a disk? Why or why not? • Disk components • Platters • Surfaces • Tracks • Sectors • Cylinders • Arm • Heads A. Yes B. No C. It depends (on?) Disk Interaction • In the old days: specifying disk requests required a lot of info: • Cylinder #, head #, sector # (CHS) • Disks did not have controller hardware built-in • Very early OSes needed to know this info to make requests, but didn’t attempt to optimize data storage for it.
    [Show full text]
  • Bit Nibble Byte Kilobyte (KB) Megabyte (MB) Gigabyte
    Bit A bit is a value of either a 1 or 0 (on or off). Nibble A Nibble is 4 bits. Byte Today, a Byte is 8 bits. 1 character, e.g. "a", is one byte. Kilobyte (KB) A Kilobyte is 1,024 bytes. 2 or 3 paragraphs of text. Megabyte (MB) A Megabyte is 1,048,576 bytes or 1,024 Kilobytes 873 pages of plaintext (1,200 characters) 4 books (200 pages or 240,000 characters) Gigabyte (GB) A Gigabyte is 1,073,741,824 (230) bytes. 1,024 Megabytes, or 1,048,576 Kilobytes. 894,784 pages of plaintext (1,200 characters) 4,473 books (200 pages or 240,000 characters) 640 web pages (with 1.6MB average file size) 341 digital pictures (with 3MB average file size) 256 MP3 audio files (with 4MB average file size) 1 650MB CD Terabyte (TB) A Terabyte is 1,099,511,627,776 (240) bytes, 1,024 Gigabytes, or 1,048,576 Megabytes. 916,259,689 pages of plaintext (1,200 characters) 4,581,298 books (200 pages or 240,000 characters) 655,360 web pages (with 1.6MB average file size) 349,525 digital pictures (with 3MB average file size) 262,144 MP3 audio files (with 4MB average file size) 1,613 650MB CD's 233 4.38GB DVD's 40 25GB Blu-ray discs Petabyte (PB) A Petabyte is 1,125,899,906,842,624 (250) bytes, 1,024 Terabytes, 1,048,576 Gigabytes, or 1,073,741,824 Megabytes. 938,249,922,368 pages of plaintext (1,200 characters) 4,691,249,611 books (200 pages or 240,000 characters) 671,088,640 web pages (with 1.6MB average file size) 357,913,941 digital pictures (with 3MB average file size) 268,435,456 MP3 audio files (with 4MB average file size) 1,651,910 650MB CD's 239,400 4.38GB DVD's 41,943 25GB Blu-ray discs Exabyte (EB) An Exabyte is 1,152,921,504,606,846,976 (260) bytes, 1,024 Petabytes, 1,048,576 Terabytes, 1,073,741,824 Gigabytes, or 1,099,511,627,776 Megabytes.
    [Show full text]
  • What Is Digital Forensics (Aka Forensic Computing)?
    Digital Forensics for Archivists: Fundamentals Instructor: Christopher (Cal) Lee University of North Carolina at Chapel Hill September 22, 2016 Greeley, CO 1 Digital Archives Specialist (DAS) Curriculum and Certification Program offered by SAA: . Foundational Courses—must pass 4 . Tactical and Strategic Courses—must pass 3 . Tools and Services Courses—must pass 1 . Transformational Courses—must pass 1 . Course examinations are administered online. 2 1 Agenda . Welcome and introductions . Motivation and scope . Technical background . Representation Information . File systems and file management . Extracting data from media . Tools and methods . Conclusions, questions, discussion 3 Welcome and Introductions 4 2 Motivation and Scope Applying Digital Forensics to Archival Work 5 Many archivists know how to process this stuff: Source: The Processing Table: Reflections on a manuscripts internship at the Lilly Library. https://processingtable.wordpress.com/tag/archival-processing/ 6 3 How about processing this stuff? Source: “Digital Forensics and creation of a narrative.” Da Blog: ULCC Digital Archives Blog. http://dablog.ulcc.ac.uk/2011/07/04/forensics/ 7 Same Goals as When Acquiring Analog Materials Ensure integrity of materials Allow users to make sense of materials and understand their context Prevent inadvertent disclosure of sensitive data 8 4 Same Fundamental Archival Principles Apply Provenance • Reflect “life history” of records • Records from a common origin or source should be managed together as an aggregate unit Original Order Organize and manage records in ways that reflect their arrangement within the creation/use environment Chain of • “Succession of offices or persons who have held Custody materials from the moment they were created”1 • Ideal recordkeeping system would provide “an unblemished line of responsible custody”2 1.
    [Show full text]
  • Pro Tools 11.0.1 Read Me
    Read Me Pro Tools 11.0.1 and Pro Tools HD 11.0.1 on Mac OS X 10.8.x This Read Me documents important compatibility information, resolved and known issues for Pro Tools® 11.0.1 and Pro Tools® HD 11.0.1 software on computers running Mac OS X 10.8.x (“Mountain Lion”). Issues Resolved in Pro Tools 11.0.1 The ReVibe II plug-in is now available with support for Pro Tools 11.0.1 (and higher) and Pro Tools 10.3.6 (PTSW-184681, PTSW-183157) Certain third-party plug-ins no longer cause your computer to hang when quitting Pro Tools (PTSW-185005) Compatibility Avid can only assure compatibility and provide support for qualified hardware and software configurations. For the latest compatibility information—including qualified computers, operating systems, and third-party products—visit the Avid website (www.avid.com/compatibility). iLok USB Key (2nd Generation) and Pro Tools Authorization An iLok (2nd generation) must be connected at all times while running Pro Tools Pro Tools requires that an iLok (2nd generation) with the appropriate authorizations be connected to the computer at all times. Do not remove the iLok while running Pro Tools. If the iLok is removed while Pro Tools is running, one of the following will occur: Pro Tools displays a dialog giving you the following choices: • Reinsert the iLok and click Save. Pro Tools saves the session and then quits. • Click Quit. Pro Tools closes the session without saving and then quits. –or– Pro Tools displays a dialog giving you the following choices: • Reinsert the iLok and click OK to continue working in Pro Tools.
    [Show full text]
  • The Second Extended File System Internal Layout
    The Second Extended File System Internal Layout Dave Poirier <[email protected]> The Second Extended File System: Internal Layout by Dave Poirier Copyright © 2001-2019 Dave Poirier Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.1 or any later version published by the Free Software Foundation; with no Invariant Sections, with no Front-Cover Texts, and with no Back-Cover Texts. A copy of the license can be acquired electronically from http://www.fsf.org/licenses/fdl.html or by writing to 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA Table of Contents About this book ............................................................................................................... viii 1. Historical Background ...................................................................................................... 1 2. Definitions ..................................................................................................................... 2 Blocks ....................................................................................................................... 2 Block Groups ............................................................................................................. 3 Directories ................................................................................................................. 3 Inodes ....................................................................................................................... 3
    [Show full text]