Universidade Federal De Pernambuco Centro De Ciências Biológicas Centro De Ciências Biológicas Programa De Pós-Graduação Em Ciências Biológicas

UNIVERSIDADE FEDERAL DE PERNAMBUCO CENTRO DE CIÊNCIAS BIOLÓGICAS CENTRO DE CIÊNCIAS BIOLÓGICAS PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS

TAXONOMIA MOLECULAR DOS NEMATODA MARINHOS

DE REGIÕES NO PACÍFICO E ATLÂNTICO SUL.

NEYVAN RENATO RODRIGUES DA SILVA

RECIFE

DEZEMBRO, 2009

UNIVERSIDADE FEDERAL DE PERNAMBUCO CENTRO DE CIÊNCIAS BIOLÓGICAS PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS

TAXONOMIA MOLECULAR DOS NEMATODA MARINHOS DE REGIÕES NO PACÍFICO E ATLÂNTICO SUL.

NEYVAN RENATO RODRIGUES DA SILVA

RECIFE DEZEMBRO, 2009

Neyvan Renato Rodrigues da Silva

TAXONOMIA MOLECULAR DOS NEMATODA MARINHOS DE REGIÕES NO PACÍFICO E ATLÂNTICO SUL.

Tese apresentada ao Programa de Pós- graduação em Ciências Biológicas da Universidade Federal de Pernambuco, como parte dos requisitos para obtenção do título de Doutor em Ciências Biológicas.

Orientadora: Dra. Maria Tereza dos Santos Correa

Co-orientadora: Dra. Tania Tassinari Rieger

Colaboradores: Dr. Paul de Ley

Dra. Wilfrida Decraemer

Dra. Verônica Fonseca Genevois

Recife Dezembro, 2009

Silva, Neyvan Renato Rodrigues da Taxonomia molecular dos Nematoda marinhos de regiões no Pacífico e Atlântico Sul/ Neyvan Renato Rodrigues da Silva. – Recife: O Autor, 2009.

147 folhas : il., fig., tab.

Orientadora: Maria Tereza dos Santos Correa Co-orientadora: Tania Tassinari Rieger Tese (doutorado) – Universidade Federal de Pernambuco. CCB. Ciências Biológicas, 2009.

Inclui bibliografia e anexos.

1. Nematódeos marinhos Tul 2. DNA -Marcadores 3. Genética I Título.

592.57 CDD (22.ed.) UFPE/CCB–2010–030

"Nematodes are made to fool us" Paul de Ley V Agradecimentos A mamãe Verônica Genevois, pelo carinho sempre demonstrado por mim, por sempre acreditar na minha capacidade e me ter como filho. A professora Tereza por ter aceitado a orientação para o doutorado, sempre disponível e prestativa em vários momentos desse processo acadêmico. A minha co-orientadora e minha grande amiga Tania Rieger que de maneira sempre muito carinhosa e em diversos momentos, sempre acreditou no nosso trabalho e sempre ajudou em tudo no que foi preciso em diversos momentos de dificuldade e finalização do doutorado. A minha comadre Clélia Rocha e família, pelas palavras de incentivo e amizade e nos momentos mais difíceis, nos ajudou de diversas formas, deixo minha eterna gratidão por tudo. Ao meu compadre Chico (Bacana) pelo humor sempre fantástico e, também nos momentos complicados sempre esteve presente como um grande amigo. Aos alunos do laboratório de Genética Animal que sempre foram prestativos para desenvolvimento das atividades no laboratório. Ao Prof. Dr. André Esteves pela nossa amizade e carinho, por acreditar no trabalho, pela ajuda no resgate das amostras no Rio de Janeiro, pelo financiamento através do Nacional Esteves Bank da passagem até a Califórnia e todo apoio dado a execução desse trabalho. À solidariedade e ao carinho que encontrei em alguns amigos do laboratório da meiofauna, que torna este grupo forte na taxonomia dos Nematoda marinhos. A Lídia Maia, Alexandre Lacerda, Betania Guilherme, Rita e todos os que participaram direta ou indiretamente na construção desse trabalho, seja com palavras de incentivo ou algum procedimento prático da tese. Gostaria de agradecer muito pela ajuda de vocês. À Alessandra Prates pela ajuda na confecção das pranchas do gênero novo, amizade e carinho. À Adriane, Danielle Menor e Tita Linda do laboratório de Dinâmica, pelos momentos de descontração e apoio demonstrados. À professora Wilfrida Decraemer que incondicionalmente financiou grande parte molecular da tese de doutorado, que acreditou no nosso trabalho, sendo sempre uma grande colaboradora nessa empreitada. Não tenho palavras para descrever minha gratidão. VI Ao Dude De Ley e Dudette Irma, por terem me recebido afetuosamente no laboratório em Riverside, pela disposição em ajudar nas análises filogenéticas, pelas valiosas contribuições científicas nos papers da tese, auxílio no processamento das amostras e seqüenciamento na Universidade da Califórnia, além da nossa grande amizade, para eles o meu muito obrigado. Ao Andy Vierestraete pelo modo sempre prestativo que me ajudou durante minha passagem pelo laboratório do Dr. Jaques Vanfleteren, pelo seqüenciamento rápido das amostras e pela sua forma sempre gentil e auxílio durante parte do desenvolvimento do trabalho. A minha amiga Michelli Thomas pela ajuda incondicional na triagem dos bichos para captura de imagem durante nossa empreitada na Bélgica, pelos momentos de descontração nos pubs de Gent com a famosa cervejinha Belga e por tudo que fez para o andamento desse trabalho. Ao IF-RN pela concessão da licença para finalização da tese de doutorado em nome do Reitor do Instituto, Prof. Belchior de Oliveira Rocha e, agradeço também a diretora do Campus Zona Norte Profa. Anna Catarina pelo empenho na concessão da licença. Aos meus amigos do IF-RN, Débora Ionara, Juliana Rangel, Frederico Silveira (Fred), além de Allison Araújo (tozinho) e Tales Diogo pelos momentos de descontração, pela nossa grande amizade e por estarem presentes em momentos difíceis em Natal. Aos meus colegas de trabalho do Campus Zona Norte, Antonio Luis (toinho), Sérgio, Diego (Phelps), Tércio Lima, Érika Rocha e todos os professores, do qual aprendi muitas lições importantes de vida e profissional, além de ter admiração por fazer parte desta equipe, no qual considero profissionais competentes e de alto valor científico. Aos meus amigos da biologia da Unidade Central, Ricardo Maciel, Kelvin Barbosa, Francisca Ventura, Mara por nossa amizade, pelo nosso trabalho desenvolvido na criação do livro de práticas de biologia, por toda ajuda dada a mim no início do doutorado e sempre incentivando para finalização dessa etapa na minha vida. À PETROBRAS, representada pela Bióloga Ana Falcão, por ter viabilizado a realização deste trabalho, pelo auxílio à viagem para Bélgica para processamento das amostras e a bolsa concedida no início do doutorado. VII Enfim a minha esposa Cristina (Sossa) e minha lindoca Lara que são a parte mais importante da minha vida. Principalmente a minha esposa por ter abdicado por um tempo de entrar no doutorado em prol da minha formação, pelas palavras de incentivo, pelo seu conhecimento científico profundo taxonômico na descrição do gênero novo e, por me aturado nos momentos de chateação. Simplesmente, são as pessoinhas mais importantes da minha vida. Amo vocês.

VIII

Lista de Figuras Página Capítulo 2 Fig 1. Flowchart illustration of the sequence of steps taken in concept of integrative taxonomy in marine Nematoda. 28 Fig 2. Combinations of nuclear primers used in studies of molecular rDNA genes 31 for molecular taxonomy of nematodes. Fig 3. Combinations of mitochondrial primers used in studies of molecular taxonomy of nematodes. 32 Fig 4. Relation between the numbers of nematodes species sequenced among Enoplea class in comparison with number of nematodes species describe in 35 literature. Fig 5. Relation between the numbers of nematodes species sequenced among Chromadorea class in comparison with number of nematodes species describe in 36 literature. Capítulo 3 Fig 1. Numbers of marine nematodes taxa with sequences deposited in GenBank 76 in relation of molecular markers. Fig 2. Flowchart depicting mainly web databases for Nematoda that can be used for molecular inventory surveys and concept of nematode identification card (NIC). Weblinks: http://www.nematode.net.com (Molecular sequence database Center); http://www.nematol.com (Digital frames and molecular database); 80 http://www.nemys.com (Taxonomic database of marine nematode taxa); http://www.wormbase (Database of behavioral and structural anatomy of C. elegans); http://www.wormimage.org (Databases of electron micrographs and associated data mainly with C. elegans). Capítulo 4 Fig 1. Study area emphasizing the station where Cornurella gen. n. was found. 93 Fig 2. Cornurella verae sp. n. (A) Head region; (B) Male overview; (C) Pharyngeal region; (D) Body Cuticle; (E) Copulatory apparatus, tail and caudal 102 glands. Fig 3. Cornurella verae gen. n. sp. n. (A) Male overview; (B) Pharyngeal region; (C) Anterior emphasizing amphideal fovea and horns; (D) Dorsal tooth; (E) Body 103 cuticle with lateral differentiation; (F) Spicule, (G) Tail region. Fig 4. Cornurella verae sp. n. (A) Female overview; (B) Head region; (C) Pharyngeal region; (D). Body Cuticle; (E) Vulva; (F) Tail region with caudal 104 glands. Fig 5. Cornurella verae sp. n. (A) Female overview; (B) Amphideal fovea, cephalic capsule and horns; (C) Dorsal tooth and subventral teeth; (D) Body 105 Cuticle; (E) Vulva region (F) Tail region; (G) Reproductive system.

Lista de Tabelas Página

Capítulo 2 Table 1. Molecular markers used in marine nematodes for molecular taxonomy 33 Table 2. Reviews of marine nematodes families published. 38 Capítulo 3 Table 1. Molecular inventory of marine nematodes taxon sorted from public 61 databases. Table 2. List of new marine nematode taxa with molecular data reported on from Pacific and South Atlantic. 74

Capítulo 4 Table 1. Comparison of major morphological features among Cornurella gen. n. 98 and other genera within Desmodoridae. Table 2. Measurements of Cornurella verae gen sp n. Measurements in µm 106

X Resumo O filo Nematoda apresenta uma grande diversidade e elevada abundância em ambientes aquáticos (marinhos e água doce) e terrestres. A identificação do grupo usando caracteres morfológicos consome tempo, principalmente devido à alta plasticidade fenotípica entre as populações. Alguns métodos moleculares como “DNA barcoding” oferecem um alternativa eficiente no estudo da biodiversidade das comunidades dos Nematoda marinhos. Os objetivos desse estudo foram: (1) revisão molecular discutindo os conceitos de taxonomia de DNA, código de barras e taxonomia integrativa; (2) aplicação dos marcadores moleculares nucleares e mitocondriais; (3) fazer um inventário molecular através das sequências depositadas em bancos de dados públicos, estimando a porcentagem dos genes mais usados para “DNA barcoding” com os Nematoda marinhos, produzir novas sequências de DNA de Nematodade três regiões: Bacia de Campos (RJ), Baja Califórnia (Mex) e Bolsa Chica (CA/USA) e (4) elaborar uma visão conceitual do Cartão de Identificação dos Nematoda (NIC) integrado com bancos de dados apresentando-se como uma ferramenta útil para estudos ecológico-moleculares. Os resultados apontaram que mais de 600 espécies do filo Nematoda já foi sequenciado, a maioria parcialmente, depositadas em bancos genéticos públicos com respectivos números de acesso e genes. Observou-se que o gene 18S é o mais utilizado na produção de sequências barcode com aproximadamente 72%, enquanto que citocromo oxidase e região intergênica são frequentemente menos sequenciados. A partir das árvores filogenéticas construídas, o marcador “Minibarcode” não se mostrou útil para taxonomia molecular dos Nematoda marinhos. Nesse estudo produziu-se 20 sequências de 18S e 42 de 28S, pertencentes a 36 espécies, correspondendo a 27 gêneros e 15 famílias. Além disso, 14 espécies foram identificadas como novos registros de sequências para Genbank. Em adição, o conceito NIC tem o objetivo de promover ligação entre os diversos tipos de bancos de dados públicos a partir da criação de um “site”. A técnica de “DNA barcoding” nos Nematoda marinhos tem crescido rapidamente nos últimos anos, devido à necessidade de aprimoramento das ferramentas de biodiversidade e ecológicas em programas de monitoramento. Foi feita a descrição de Cornurella gen nv da Bacia de Campos (RJ) apresentando caracteres morfológicos da família Desmodoridae (Nematoda). Estudos futuros usando uma combinação de taxonomia integrativa e NIC são necessários para melhorar a informação disponível, com o intuito de caracterizar melhor a diversidade dos Nematoda marinhos. Palavras-Chave: nematódeos marinhos, marcadores de DNA, taxonomia integrativa, NIC, Cornurella XI Abstract

The phylum Nematoda exhibits great species diversity as well as high abundance in aquatic (marine or freshwater) and terrestrial environments. Nematode identification using morphological features is time-consuming and problematic due to the high phenotypic plasticity among populations. Some molecular methods such as DNA- barcoding offer potentially efficient alternatives to study the biodiversity of marine nematode communities. The objectives of this survey were: (1) to conduct a review of molecular taxonomy discussing concepts of DNA taxonomy, barcoding and integrative taxonomy; (2) to characterize the application of molecular markers such as nuclear and mitochondrial; (3) to make a molecular inventory sequences of marine nematodes species deposited in public databases, estimating the percentage of the most powerful genes used for DNA barcoding with marine nematodes and produce new sequences of marine nematodes from three sites: Campos Basin (RJ), Baja California (Mex) and Bolsa Chica (CA/USA); and finally, (4) to elaborate a conceptual view of the Nematode Identification Card (NIC) integrated to databases as a useful tool for molecular and ecological studies. The results point that more than 600 marine nematode species were, at least partially, sequenced until now and deposited in public databases with the respective accession numbers and genes target. We observed that the 18S gene is the most barcoded one used in molecular studies, with approximately 72% in comparison with COI and ITS which are less frequently sequenced. The Minibarcode marker did not prove itself useful for barcoding in marine nematodes according to phylogenetic trees. In this study were produced 20 sequences of 18S and 42 of 28S belonging to 36 marine nematode species from 27 genera and 15 families. Besides, 14 species have been newly recorded to Genbank. In addition, the NIC concept aims to link main public morphological databases to molecular databases in a website. DNA barcoding in marine nematode taxa has quickly increased in the past few years, due mainly to the necessity to enhance tools for biodiversity, ecological and monitoring programs. Additionally, a new taxon Cornurella gen nv was formally described collected at Campos Basin (RJ), Brazil with main characteristics belonging to the family Desmodoridae (Nematoda). Future studies using a combination of integrative taxonomy and NIC are necessary to improve the information available and better characterize the diversity of marine nematodes. Key-words: marine nematodes, DNA markers, integrative taxonomy, NIC, Cornurella. XII SUMÁRIO

AGRADECIMENTOS LISTA DE FIGURAS LISTA DE TABELAS RESUMO ABSTRACT

1. Capítulo 1: Introdução 14 2. Objetivos Geral e Específicos 20 3. Hipótese 20 4. Capítulo 2: Presente e Futuro da taxonomia molecular dos Nematoda marinhos. 21 Abstract 23 Introduction 24 DNA taxonomy and barcoding for marine nematodes 25 Integrative taxonomy new approach for studies of marine nematodes 27 Molecular markers for taxonomy of marine nematodes 29 (1) Nuclear genes 29 (2) Mitocondrial genes 31 Avaliable sequenced data of marine nematodes 35 Future studies with DNA barcoding in marine nematodes 36 Conclusions 39 References 41 5. Capítulo 3: Inventário Molecular das espécies de Nematoda marinhos presentes em bancos genéticos públicos com adição de novas sequências. 54 Abstract 56 Introduction 57 Material and Methods 58 Data inventory 58 Sampling 58 Nematode extraction and identification 59 DNA extraction, PCR and sequencing 59 Results 60 XIII Molecular Inventory of representative marine nematode taxa 60 Discussion 76 References 81 6. Capítulo 4: Descrição de Cornurella gen nv. (Desmodoridae, Nematoda) utilizando parâmetros morfológicos. 89 Abstract 91 Introduction 92 Material and Methods 93 Study area 93 Sampling and processing 94 Results 95 Discussion 107 References 110 7. Capítulo 5: Discussão 112 5.1. Marcadores moleculares utilizados na taxonomia Molecular dos Nematoda marinhos 113 5.2. Inventário Molecular e integração das informações nos diversos bancos de dados para os Nematoda 115 5.3. Fixação de amostras para estudo molecular 116 5.4. Utilização do Minibarcode e D2D3 (28S) na sistemática molecular dos Nematoda marinhos 118 8. Capítulo 6: Conclusões 120 9. Referências Bibliográficas 122 10. Publicações 142 11. Anexos 143

Capítulo 1

INTRODUÇÃO

I – Introdução

O Filo Nematoda é considerado um dos mais abundantes grupos de metazoários na Terra, constituindo-se também em um dos grupos mais diversos em termos de riqueza de espécies, abrangendo espécies de vida livre, parasitária, terrestre, marinha e de água doce (Hugot et al., 2001; Coomans 2002; Lambshead, 2004). A identificação taxonômica dos Nematoda é extremamente difícil devido à variação de morfologia dentro das espécies e às discussões sobre espécies válidas que apresentam diversos parâmetros morfológicos na diagnose dos diferentes grupos do filo (De Ley et al.,1999; De Ley et al., 2005). Assim sendo, estudos ecológicos com o grupo normalmente são feitos restringindo as identificações ao nível genérico ou em morfotipos para descrição dos dados ecológicos. Ao nível mundial existem poucos grupos de pesquisa que estudam a taxonomia dos Nematoda marinhos e com especial atenção à distribuição, à biodiversidade e à obtenção das correlações com os parâmetros ambientais em ambientes marinhos. A taxonomia tradicional é amplamente utilizada, apesar de ser dependente da estrutura populacional de machos. Evoca-se, portanto, a taxonomia molecular como ferramenta imprescindível quando as populações são compostas majoritariamente por fêmeas e juvenis. A Biologia Molecular é considerada uma disciplina contemporânea envolvida no estudo da estrutura química em convergência com fenômenos biológicos ao nível molecular. Esta nova maneira de observar e analisar os sistemas vivos tem revolucionado todo o campo das Ciências Biológicas. Os conceitos e ferramentas da biologia molecular surgiram através de uma união entre o trabalho dos geneticistas, físicos e bioquímicos na resolução, inicialmente, de um problema comum: a estrutura e função dos genes (Darden & Tabery, 2005). Além disso, a Biologia Molecular tem sido a ferramenta escolhida para estudos de genética de populações e que tem acumulado avanços importantes, gerando técnicas cada vez mais precisas para o exame de segmentos de DNA. Soma-se a isto a descoberta de variados marcadores moleculares aplicáveis aos mais diversos problemas encontrados no estudo de populações e as análises estatísticas que permitem desde a estimativa do grau de variabilidade genética de uma dada população à construção de

árvores filogenéticas, relacionando espécies próximas e elucidando questões de parentesco (Marques, 2002). As técnicas de biologia molecular e bioinformática permitem a construção de árvores filogenéticas, através da comparação das cadeias de nucleotídeos entre os diferentes grupos (Tenente et al., 2004, Parkinson et al., 2004). Estas metodologias associadas à captura de imagens de organismos são eficazes na identificação e registro dos espécimes, gerando um banco de dados para posterior consulta das estruturas morfológicas, que podem ser associados com sequências de genes relevantes para o entendimento da história evolutiva do grupo (De Ley & Bert, 2002; Abebe et al., 2004). Segundo Blaxter (2004), existem atualmente diversos protocolos para determinação de espécies utilizando sequências de DNA, chamado de código de barras (barcodes). O autor afirma que o genoma dos microorganismos é similar aos códigos de barras que se encontra em qualquer produto à venda no mercado e, que, sendo assim, as espécies apresentam uma identidade genética dentro de um grupo de organismos da população, carregando uma característica genética específica para a sistemática molecular. A adoção dessa tecnologia baseada no DNA oferece uma nova rotina laboratorial, promovendo o aumento na velocidade e custo da identificação de espécies para trabalhos ecológicos e de biomonitoramento, sendo que essa tecnologia é baseada primariamente no conceito de “DNA barcode” (Hebert et al., 2003a, Cook et al., 2005). O primeiro passo nesse processo é a identificação de regiões do genoma que oferecem variação suficiente para resolver o problema das espécies próximas, do ponto de vista morfológico (Tautz et al., 2003). Dados moleculares para taxonomia do grupo podem ser obtidos a partir de poucos espécimes (ambientes com baixa densidade - como é a Bacia de Campos), independentemente do seu estágio de vida ou caráter sexual (Blaxter, 2004; Parkinson et al.,2004). Além disso, segundo Thomas et al (1997), a geração de sequências gênicas do DNA pode ser obtida a partir de espécimes dos holótipos, parátipos e neótipos, de material fixado em formol ou já montado em lâmina. Tautz et al., (2003) apontam que novas tecnologias utilizando seqüências de “DNA barcode” das espécies constituirão na base de um novo sistema de referência taxonômica.

Análises moleculares são consideradas uma forte ferramenta no intuito de esclarecer as relações evolucionárias, baseadas em sequências de DNA que se apresentam de forma taxon específico. O uso de marcadores genéticos em estudos de sistemática de diferentes grupos animais, incluindo o filo Nematoda, tem aumentado significativamente nos últimos anos. Nesse tocante, o gene para subunidade menor ribossomal (SSU rDNA) tem provado ser útil na reconstrução das relações filogenéticas entre os taxa de Nematoda (Aleshin et al., 1998; Blaxter et al., 1998; Litviatis et al., 2000, Rusin et al., 2003; Holterman et al., 2006). Blaxter et al. (1998) apresentaram uma nova classificação para o filo baseada em sequências gênicas da subunidade menor ribossomal (18S). Estes autores analisaram 53 espécies de diferentes hábitos/habitats, incluindo parasitas, de vida livre, e as marinhas. Entretanto, suas análises foram baseadas primariamente em espécies de Nematoda terrestres e parasitas que apresentam importância econômica, tais como Dorylaimida, Mermithida, Mononchida, Rhabditida, Trichinellida e Triplonchida e ausência de dados com um grande número de taxa de ambiente marinho, como Araeolaimida, Chromadorida, Desmodorida, Desmoscolecida, Enoplida e Monhysterida. Outros estudos ao nível do filo Nematoda foram realizados adicionando mais espécies de Nematoda marinhos, porém alguns clados filogenéticos pernaneceram sub- representados (e.g. Enoplida, Chromadorida, Monhysterida, and Desmoscolecida) (Aleshin et al., 1998; Kampfer et al., 1998; Litvaitis et al., 2000). Sob outro panorama, numerosos estudos testaram marcadores moleculares para facilitar a identificação de espécies parasitas. Estes trabalhos utilizaram frequentemente genes mitocondriais e foram capazes de distinguir entre membros do mesmo gênero ou famílias, entretanto, se mostraram indiscriminantes para categorias taxonômicas superiores (Powers et al., 1997; Watts et al., 1999; Nadler et al., 2000). De Ley & Blaxter (2002, 2004) atualizaram a classificação do filo Nematoda usando dados moleculares de espécies, que antes não estavam disponíveis, para assegurar a posição do táxon na árvore filogenética a partir das sequências do marcador de SSU. Desde o trabalho de reconstrução filogenética publicado por Blaxter et al. (1998), o número de sequências completas do gene SSU (18S) depositadas no Genbank vêm aumentado rapidamente. Esse grande conjunto de dados moleculares de marcadores nucleares promove uma grande oportunidade de explorar a filogenia dos

Nematoda e o exame criterioso de estudos anteriores que davam pouca atenção ao efeito do alinhamento múltiplo na construção de árvores filogenética do filo (Smythe et al., 2006) Em relação aos marcadores moleculares nucleares, a subunidade menor ribossomal (SSU rRNA) é bem representada para os Nematoda em banco de dados públicos (Floyd et al., 2002) e, além disso, apresentam variação suficiente, permitindo a diferenciação das espécies próximas (Gasser & Newton, 2000). Atualmente, diversos genes estão sendo utilizados no estudo taxonômico molecular dos Nematoda, principalmente genes das subunidades de rRNA (SSU), além de LSU – 23S e 28S, regiões espaçadoras internas transcritas (ITS1 e ITS2) (Blaxter, 2004). Sequências de DNA mitocondrial têm a característica de evoluir sob taxas mais rápidas quando comparadas aos genes nucleares e por isso são utilizados para discriminação de populações geneticamente muito próximas. Enquanto, a LSU rRNA tem sido muito útil para solucionar análises ao nível específico ou populacional (Blouin et al., 1998, Litvaitis et al., 2000). Além do gene SSU rRNA é reconhecido em análises filogenéticas perfazendo todo o filo Nematoda (Fitch et al., 1995; Aleshin et al., 1998; Blaxter et al., 1998, Kampfer et al., 1998; De Ley et al., 2002, Dorris et al., 2002; Nadler, 2002). A filogenia do grupo é restrita essencialmente ao marcador nuclear SSU, sendo que os dados apresentados inicialmente por Blaxter et al., (1998) foram os pioneiros na análise da história evolutiva do filo Nematoda. Holterman et al. (2008a) afirmam que genes ribossomais de pequena e grande subunidade (SSU e LSU) são marcadamente mais úteis na resolução de relações filogenéticas dentro do filo. Os marcadores mitocondriais têm sido amplamente utilizados em estudos filogenéticos em diversos filos animais (Mindell et al., 1998). As divergências nas sequências são maiores no padrão interespecífico do que intraespecífico. O gene citocromo-c oxidase I (COI) está presente em todos os animais, sendo que as comparações são mais próximas, devidos às inserções e deleções que são raras, por isso o gene COI é definido com DNA barcode (Hebert et al., 2003). No entanto, o estudo genético populacional para o gene COI nos Nematoda marinhos tem sido restrito aos trabalhos de Derycke et al., (2005, 2006, 2007, 2008), os quais obtiveram sucesso na amplificação desse marcador para Pellioditis marina e

Geomonhystera disjuncta, apresentando um padrão de especiação críptica em ambos os taxons. Fonseca et al. (2008) utilizou COI num estudo de taxonomia integrativa com duas espécies que apresentam um complexo de espécies de nematódeos de vida livre. Porém, De Ley et al. (2005) afirmaram que a porcentagem de sucesso de utilização de marcadores mitocondriais na amplificação do DNA é menor que 50%, provavelmente devido à alta taxa de divergência do genes mitocondriais em Nematoda marinhos. Os segmentos D2/D3 da molécula 28S rRNA também estão sendo frequentemente utilizados em estudos filogenéticos, devido à presença de regiões conservadas que permitem amplificar o DNA de diversos táxons, à presença de sítios filogenéticos informativos. Desse modo tem crescido o interesse na utilização dessa região do ribossoma em substituição ao uso do 18S, sendo que também vendo sendo considerado um locus promissor para “barcoding” dos Nematoda (De Ley et al., 2005). Atualmente, têm sido produzidas em larga escala sequências de DNA para diversos grupos de animais metazoários, incluindo Nematoda (Floyd et al., 2005), gastrópodas marinhos (Meyer & Paulay, 2005), tardígradas (Blaxter et al., 2004), quelicerados (Barrett & Hebert, 2005), borboletas (Hajibabaei et al. 2006), pássaros (Hebert et al., 2004b) e peixes (Ward et al., 2005), fungos e algas vermelhas (Saunders, 2005), além de estudos com plantas fanerógamas (Kress et al., 2005), todos com o intuito de utilizar o gene COI como marcador para estudos de “barcoding” (Hebert et al., 2003a). Para os Nematoda marinhos ainda existe uma grande distância entre o número de sequências depositadas em bancos genéticos em relação ao número de espécies descritas para o grupo, mostrando que, como a biodiversidade do grupo é elevada, ainda existe necessidade de aumento do número de sequências “barcode” das espécies marinhas, sendo que o “DNA barcodes” pode ser como ferramenta adicional auxiliando em estudos de posicionamento filogenético dos taxa através da comparação com sequências referências conhecidas, depositadas em bancos genéticos, dando o enfoque, em muitos casos, à utilização da definição de unidades taxonômicas operacionais moleculares (MOTU) (Bhadury et al. 2006b). Além do objetivo de instalar e capacitar os integrantes do projeto em técnicas de obtenção e análise molecular, o presente trabalho relata uma panorâmica do estudo taxonômico molecular com os Nematoda marinhos (Capítulo 2), abordando a utilização

de conceitos de “DNA barcoding” e taxonomia integrativa, além dos principais genes utilizados no estudo molecular do grupo discutindo a utilização de marcadores genéticos como ferramenta adicional no estudo taxonômico dos Nematoda da Bacia de Campos. Apresenta um inventário molecular com adição de novas sequências barcoding de Nematoda de três regiões, uma no Atlântico Sul e uma na América do Norte região de Bolsa Chica também ligada à extração de petróleo e Baja Califórnia (capítulo 3), além da descrição de gênero novo de Nematoda coletados na Bacia de Campos (Capítulo 4).

2. Objetivo Geral - Avaliar a diversidade da nematofauna da Plataforma Continental da Bacia de Campos (Campos, RJ) utilizando técnicas moleculares no estudo taxonômico.

2.1 - Objetivos específicos: 1- Descrever o status do estudo molecular dos Nematoda marinhos, discutindo os marcadores nucleares e mitocondriais usados nos estudos moleculares; 2- Realizar um inventário molecular das espécies de Nematoda marinhos com sequências depositadas no Genbank; 3- Desenvolver o conceito de Nematode Identification Card (NIC), apresentando os principais bancos de dados para estudos do filo; 4- Ampliar a diversidade de sequências de espécies de Nematoda marinhos a partir da inclusão de novos registros no Genbank. 5- Descrever taxonomicamente a presença de novos taxa de Nematoda da Bacia de Campos; 6- Avaliar comparativamente os marcadores nucleares (LSU, SSU) e mitocondriais (COI, Minibarcode) utilizados na determinação das relações filogenéticas da Nematofauna da Bacia de Campos.

3. Hipótese Os marcadores nucleares promovem uma melhor discriminação taxonômica do que os mitocondriais?

Capítulo 2

Presente e futuro da taxonomia molecular dos Nematoda marinhos

Artigo submetido para publicação na Nematology

Silva, N.R.R; Silva, M. C.; Fonseca-Genevois, V.; Esteves, A. M.; De Ley, P.; Decraemer, W.; Rieger, T. T.; Santos, M. T. C. Marine nematodes taxonomy in the DNA age: the presente and future of molecular tools to assess their biodiversity.

Marine nematodes taxonomy in the DNA age: the present and future of molecular tools to assess their biodiversity.

Neyvan Renato Rodrigues da Silva1,4, Maria Cristina da Silva3, Verônica Gomes Fonseca Genevois3, André Morgado Esteves3, Paul De Ley5, Wilfrida Decraemer6,7, Tania Tassinari Rieger2, Maria Tereza Correia dos Santos1. 1- Departamento de Bioquímica; 2- Departamento de Genética; 3- Departmento de Zoologia – Universidade Federal de Pernambuco, Av. Prof. Professor Moraes Rêgo, s/n, Cidade Universitária, Recife, Brazil. 4- Instituto Federal do Rio Grande do Norte, Campus Zona Norte, Rua Brusque 2926, Potengi, Natal – Rio Grande do Norte. 5 - Department of Nematology, University of California, Riverside, CA 92521, USA 6- Department of Biology, Ghent University, Ledeganckstraat 35; B-9000, Ghent, Belgium. 7 – Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussels, Belgium.

Corresponding author: [email protected]; [email protected]

ABSTRACT

Molecular taxonomy is one of the most promising yet challenging fields of biology. Concepts of DNA barcoding and integrative taxonomy are discussed in this review. Molecular markers such as nuclear genes and mitochondrial genes are being used in a variety of studies surveying marine nematode taxa. Sequences from more than 600 species have been deposited to date in online databases. Morphology-based surveys are greatly limited in processing speed, while barcoding approaches for nematodes are hampered by difficulties in matching sequence data with traditional taxonomy. DNA barcoding is a promising approach because some genes have variable regions in the gene that are useful to discriminate species boundaries, discover cryptic species, quantify biodiversity and analyze phylogeny. We advocate a combination of DNA barcoding and conventional taxonomy as a necessary step in the application of a concept of integrative taxonomy. Keywords: barcoding - integrative taxonomy - marine nematodes - molecular markers – morphology.

I- INTRODUCTION The phylum Nematoda exhibits high species diversity as well as high abundances in aquatic (marine or freshwater) and terrestrial environments (Floyd et al., 2002). Nematoda in general are one of the most diverse taxa in the animal kingdom, with estimates ranging from 0.1 to a 100 million species (Lambshead, 1993; Coomans, 2002). However, only a few thousands of these species have been described, although they represent the most abundant component of the meiofauna in several kinds of ecosystems (Lambshead, 2004; Bhadury et al., 2006a). Currently, specific identification of most marine nematodes still largely relies on detailed morphological analysis that requires considerable taxonomic expertise, placing it outside the scope of most routine ecological surveys (De Ley et al., 2005; Bhadury et al., 2006a,b). Nematode identification using morphological characters is not only time- consuming but also problematic mainly due to the high phenotypic plasticity among populations and absence of clear diagnostic characters for cryptic species (Avise & Walker, 1999; Derycke et al., 2008; Fonseca et al., 2008). The advent of molecular techniques has opened new possibilities for taxonomic research, and provided an important tool given that the vast majority of species are not well differentiated morphologically (Godfray, 2002; Seberg et al., 2003; Lorenz et al., 2005; Smith et al., 2006a; Vogler & Monaghan, 2007). These new technique tools improve taxonomical and precision assist in carrying out a critical examination of the accuracy afforded by morphological traits commonly used in traditional taxonomy (Will & Rubinoff, 2004). Indeed, several studies have already illustrated the advances afforded by the interactive process between morphology and DNA barcode for systematics (α-taxonomy and phylogeny) (Hebert et al., 2004; Blaxter, 2004; Lee, 2004; Hebert & Gregory, 2005; Smith et al., 2006b). Molecular techniques and phylogenetic analyses offer the potential to overcome this problem. In this scenario, barcoding appears as a promising tool to assess biodiversity inventory of free-living marine nematodes (Blaxter et al., 2005; Bhadury et al., 2006a; Meldal et al., 2007; Derycke et al., 2008). DNA barcode sequences have proved useful in identifying clades and evolutionary relationships (De Ley & Blaxter 2002, 2004; Savolainen et al., 2005). The concept of an integrative taxonomy is an identification tool using molecular

markers (nuclear DNA and/or mtDNA), ecological and morphology characters to help identify global biodiversity and also to describe and nominate species (Dayrat, 2005; DeSalle, Egan & Sidall, 2005; Rubinnof, 2006). This large-scale application of molecular data is revolutionizing taxonomy, but the validity and relevance of molecular approaches and concepts on which these techniques are based have been subject to a variety of criticisms (Lipscomb, Platnick & Wheeler, 2003; Wheeler, 2004; Rubinoff et al., Kohler, 2007; Valdecasas et al., 2008). This study aims at presenting an overview of molecular approaches for free- living marine nematode taxa, dealing with DNA taxonomy, barcoding and integrative taxonomy. Also, we discuss the application of molecular markers actually used in studies in taxonomy for marine nematodes. Prospects of the future of integrative taxonomy are discussed with emphasis placed on how to apply those combinations of techniques to describe and make phylogenetics relationships in new taxa.

II- DNA TAXONOMY AND BARCODING FOR MARINE NEMATODES The history of Nematode systematics is often surrounded by controversy, not only as a result of the greater development of classification system but also because relatively few nematologists produce detailed classifications (De Ley & Blaxter, 2002). Moreover, nematode identification using morphological characters is often difficult and laborious, because of these same two requirements. To make matters worse, there is no general accepted species concept by which we can define the unit used and further, nematode species can be variable in morphology and differences between valid species can be obscured by absence of clear diagnostic differences (De Ley et al., 1999; Derycke et al., 2006; Derycke et al., 2007). Although nematodes have been studied for over 350 years, objective criteria for assessing the homology of morphological characters used in phylogenetic reconstructions within the phylum are still lacking (Chilton et al., 2003). In contrast, the concept of DNA taxonomy as proposed by Tautz et al. (2003) is essentially based on having the barcoding approach as its practical component. The basic procedure of this approach consists in a tissue sample taken from an individual collected and of which DNA is extracted. This DNA serves as the reference sample from which one or several gene regions are amplified by PCR and sequenced. The

resulting sequence will be an identification tag for the species from which the respective individual was derived (Lipscomb et al., 2003; Mallet & Willmott, 2003; Marshall, 2005). The advocates of taxonomy based mainly on DNA sequences claim that the current practice in morphological taxonomy is not adequate to achieve the aim of a reasonably complete inventory of animal life in a reasonable period of time (Stockle, 2003). Proponents of DNA barcoding have argued that we could use DNA sequences of one or more particular genes to identify nematode species, based on the idea that every species has its own “diagnostic” sequences, i.e., unique sets of base pair mutations (Hollingsworth, 1998; Kohler, 2007). The three main ambitions of DNA barcoding are to: (i) assign unknown specimens to species; (ii) enhance the discovery of new species and facilitate identification, particularly in cryptic microscopic and other organisms with complex or inaccessible morphology and (iii) massively increase speed and processing larger data sets (Hebert & Gregory, 2005; Frézal & Leblois, 2008). DNA barcoding promises fast, accurate species identification or molecular operational taxonomical units by focusing on a short standardized segment of the genome (Hajibabaei et al., 2007). At gene level it provides, in many animal groups, strong species-level resolution, as for example for birds (Hebert et al., 2004), spiders (Barret & Hebert, 2005), fishes (Ward et al., 2005), and moths (Janzen et al., 2004). Building upon the idea of the Universal Product Code, found in commercial products as “barcodes” (Brown, 1997), a few nucleotides may well provide an immediate diagnosis for species (Hebert et al., 2003a; Savolainen et al., 2005, De Salle et al., 2005). One of the main disadvantages or limitations of DNA barcoding occurs in sampling shortfalls across taxa that leads to ‘barcoding gaps’ (Moritz & Cicero, 2004). Many taxa are underrepresented and conclusions based on a restricted data set may be biased. DNA barcodes does not relies a species concept; however barcodes should be combined with other information in an integrated taxonomy approach to show relationships between species (Rubinnof, 2006; Rach et al., 2008). However, molecular methods such as Barcoding have to be carefully understood. Recently, a large number of scientific papers have discussed the nature of the taxonomic problems, potential strategies that can be used to accelerate the pace of the discovery and classification of biodiversity with a balanced response that would

consider the role of morphology in taxonomy (Mallet & Willmont, 2003; Sites & Marshall, 2003). In fact, these methods seem prone to failure, except in cases with extremely well developed background knowledge of the taxa to be sampled and a priori understanding of sequence variation among populations and individuals (Wilson, 2004).

III - INTEGRATIVE TAXONOMY, A NEW APPROACH FOR STUDIES OF MARINE NEMATODES Integrative taxonomy has been successfully introduced for some vertebrate (Wiens & Penkrot, 2002; Malhotra & Thorpe, 2004) and invertebrate taxa (Parmakelis et al., 2003), as well as few cases of marine nematodes (Fonseca et al., 2008). Taxonomical efforts through the integration of various methods for classifying nematodes species have been hitherto mainly focused on parasitic groups (Blaxter et al., 1998; Nadler, 2002) and some terrestrial species (Blouin, 2002; Abebe & Blaxter, 2003; Chilton et al., 2001; Holterman et al., 2008b). Many scientists have pointed out that taxonomy is going through a crisis and that we need to determine what its future will be (Coomnas, 2002; Mallet & Willmot, 2003; Wilson, 2003). The discovery of cryptic species, i.e., genetically divergent but morphologically identical species, has polarized taxonomy between ‘classical’ and molecular biologists (Tautz et al., 2002, 2003). In an attempt to solve this crisis in taxonomy, species boundaries should be diagnosed using different methodologies, as an alternative to consider each method independently (Fonseca et al., 2008). The concept of ‘integrative taxonomy’ studies species boundaries from multiple, complementary perspectives (Wheeler et al., 2004; Will et al., 2005). Traditionally, marine nematodes taxa are recognized from a broad range of characteristics, especially morphological features, ecology, distributions in sediments and so forth. In the process of producing barcode diagnostics, the taxonomic significance of nucleotide characters will still have to be evaluated in the context of pre- existing morphological features (Schander & Willassen, 2005). DNA sequence is an important and powerful tool for taxonomy and systematic, in several animal groups specimens have been assigned to species, cryptic species have been discovered and clusters within species identified using short DNA sequences of standardized gene region (Rach et al., 2008). Molecular data play an indisputable role in the analysis of

biodiversity. However, DNA-based data should not be seen as a substitute for understanding and studying whole organisms when determining identities or systematic relationships (Wheeler, 2004; Page et al., 2005). Dayrat (2005) argues that taxonomy needs to be integrative, employing various types of data (morphological, generic, ecological, biological cycle) in the study of species. A major distinction should be made between species identification, generally associated with the idea of molecular barcodes, versus species circumscription and delineation, broadly referred to as DNA taxonomy or molecular taxonomy (Vogler & Monaghan, 2007). We advocate integration between molecular and morphological analyses in traditional taxonomy, the collection/catalogue objects includes the holotype and these objects are grouped based on morphological traits and given a species name according to the Code of Zoological Nomenclature. Previously established taxonomic groups are identified through the presence of diagnostic characters with combination of short stretches of DNA barcoding that should be combined with other information as morphology, ecology, behavior and phylogeny to discovery species. The integration of those two approaches is an example of integrative taxonomy (Fig 1).

Figure 1. Flowchart illustration of the sequence of steps taken in concept of Integrative taxonomy in marine Nematoda. 28

IV- MOLECULAR MARKERS FOR BARCODING In an effort to standardize the approach to species identification using molecular techniques, it has been proposed that as many species as possible should be characterized for some genetic markers (Sunnucks, 2000; Blaxter, 2004). However, the main difficulty in molecular taxonomy is to find the ideal gene that discriminates a given species in the animal kingdom. The mitochondrial gene, cytochrome c oxidase subunit 1 has been proposed as a candidate locus as a ‘universal’ diagnostic barcodes (Lorenz et al., 2005; Rach et al., 2008). In this scenario, molecular markers have already been proposed, among which the nuclear subunit ribosomal RNA gene is a promising candidate, because of its great abundance in the genome and its relatively conserved flanking regions that can provide classifications into molecular operational taxonomic units (MOTU) as has been show in meiofauna specimens, including nematodes (Floyd et al., 2002; Blaxter et al., 2005). In common with many areas of contemporary biology, developments in molecular genetics had a signiﬁcant impact on the knowledge of taxonomy and systematic, not only in terms of aiding species recognition, but also by elucidating phylogenetic relationships and mechanisms of speciation (Hillis et al., 1991). Nowadays, several methods are useful to address different comparisons among nuclear and mitochondrial DNA genes. Recently, molecular methods have been used in lower taxonomic units of nematodes to delineate the relationships within species. Especially among invertebrates, the small subunit ribosomal DNA is usually present in several copies coding for SSU rRNA. Because of their vital role in the assembly of proteins in the ribosome, there is a strong selection in the ribosomal DNA genes. As a consequence, these genes — or at least parts of them — are much conserved. Among the ribosomal RNA encoding genes, the SSU rDNA is the most conserved (Holterman et al., 2006).

NUCLEAR GENES The SSU rDNA gene has proven to be a very useful gene for exploring the molecular within as well as between many (though not all) groups of nematodes. The semi-conserved areas in the gene allow unraveling the deep phylogenetic relationships within the phylum, yet at the same time the more variable regions in the gene have

afforded to distinguish between families, genera and in quite a few cases even between species (Aleshin et al., 1998, Holterman et al., 2008a). The SSU rDNA gene is well represented for nematodes and is variable enough to permit the differentiation of closely related nematode species (Gasser & Newton, 2000; Fontanilla & Wade, 2008). According to De Ley et al., (2005) small subunit (SSU) rDNA has received the greatest attention as a barcoding locus in recent literature (Cook et al., 2005; Bhadury et al., 2006a). The locus has higher phylogenetic information content with small amounts of polymorphism and often works well for resolving relationships at different levels of classification (e.g. Félix et al. 2000; Rusin et al. 2003; Foucher et al., 2004) (Table 1, Figure 2, 3). The LSU rDNA gene has been used for almost ten years as a diagnostic gene sequence in nematodes, particularly the region D2 and D3 expansion segments (Thomas et al. 1997; De Ley et al., 1999; Zheng et al., 2003; Tenente et al., 2004; Subbotin et al., 2007; Derycke et al., 2008; Fonseca et al., 2008; Kumari et al., 2009). In nematodes it covers about 600–1000 bp. In contrast, the conserved regions alternating with D2 and D3 are highly constant show a very robust primer sites. According to De Ley et al. (2005) the D2/D3 primer pair has the highest success rate when applying PCR amplification to a phylum-wide selection of nematodes, and based on our limited testing it also works well in other phyla of microscopic metazoans. The locus is not present significant levels of intraspecific polymorphism and provides very good separation of cryptic species in some groups (De Ley et al., 1999). Previous studies have included phylogenetic applications of the D2 or D3 alone (Litvaitis et al., 2000). The Internal Transcribed Spacer region (ITS), is another versatile genetic marker located between the repeating array of nuclear 18S and 28S ribosomal DNA genes. Among eukaryotes, it has been used in constructing phylogenetic trees, estimating genetic population structures, evaluating population level evolutionary processes and determining taxonomic identity (Powers et al., 1997). Evolution of the ITS region is influenced by factors such as functional constraint, unequal crossing over and gene conversion, which all reduce intraspecific variation (Hillis & Dixon 1991). Generally, in studies with species complex, ITS in combination with other nuclear genes (SSU, LSU) and mitochondrial markers (COI)

yielded highly concordant tree topologies, indicating events of speciation (Derycke et al., 2007) (Fig 2). In marine nematodes, ITS showed highly divergent phylogenetic lineages caused by a common evolutionary process in complex of Pellioditis marina species and genetic structure of Geomonhystera disjuncta. This molecular marker was not considered a good universal identification tool for two reasons: (1) intra-individual variation was frequently observed, which reduces the sequencing signal and (2) a high amount of indels events are present within closely related cryptic taxa, rendering alignment between divergent taxa problematic (Derycke et al., 2007, 2008).

Figure 2. Combinations of nuclear primers used in studies of rDNA genes for molecular taxonomy of nematodes.

MITOCONDRIAL GENE Another gene that is widely used for the barcoding of animals is the cytochrome- c oxidase subunit 1 (COI) (Figure 3). Current barcoding studies have primarily focused on a single mitochondrial marker as a source of identifying diagnostic barcodes (Rach et al., 2008). Mitochondrial genes such as COI could also provide further information on gene flow patterns and cryptic level diversity within this taxon, but amplification of this gene in marine nematodes is extremely difficult and unreliable (Bhadury et al. 2006b). To date, there are no phylum-wide universal primers for the mitochondrial cytochrome oxidase I gene that works across the Nematoda, and PCR success rates are well below 50% across various taxa within the phylum (De Ley et al., 2005). As observed by De Ley et al., 2005, reasons for these problems may relate to the emerging evidence that nematode mitochondrial genomes are highly diverse, displaying unusual properties such as recombination (Lunt & Hyman, 1997), insertion editing (Vanﬂeteren

& Vierstraete, 1999) and multipartitioning (Armstrong et al., 2000). In addition, mitochondrial genes have higher mutation rates and a fourfold smaller effective size and consequently evolve more rapidly than the nuclear genes (Avise, 2000). Mitochondrial primers are generally used for barcoding studies (Hebert et al., 2003b). Derycke et al. (2005, 2006, 2007, 2008) using a combination of primers were successfully able to amplify the COI gene from two nematode species Pellioditis marina and Geomonhystera disjuncta, and showed cryptic diversity within both taxa (Fig 3, Table 1). Fonseca et al., (2008) also used COI in a survey of integrative taxonomy in two free-living nematode complex species. However, it is clear that current primers are not adequate enough if the COI based DNA barcoding is to work. There is another combination of COI called mini-barcode (short primer for segment of COI with 150 bp) that was used to identify the minimum amount of sequence information required for accurate species identification (Meusnier et al., 2008). Indeed, this primer set was tested in marine nematodes showing high PCR success rates, but those sequences produced showed unreliable for discriminate phylogenetic relationships (Silva et al., unpublish data).

Figure 3. Combinations of mitochondrial primers used in studies of molecular taxonomy of nematodes.

Table 1. Molecular markers used in marine nematodes for molecular taxonomy. Positions or Primer Sequence (5’ →3’) Source amplicons* Nuclear genes 18S Blaxter et al., 1998 Meldal el al., 2007 SSUG18S 30-49 GCT TGT CTC AAA GAT TAA GCC Bhadury et al., 2005 Bert et al., 2008

SSUA 39-57 AAAGATTAAGCCATGCATG Dorris et al., 2002 Blaxter et al., 1998 Meldal et al., 2007 SSU22R 429-411 GCC TGC TGC CTT CCT TGG A Bhadury et al., 2007 Bert et al., 2008

SSU22F 411-428 TCC AAG GAA GGC AGC AGG C Blaxter et al., 1998 Meldal et al., 2007 SSU9FX 530-550 AAG TCT GGT GCC AGC AGC CGC Bert el al, 2008

SSU9F 573-591 CGCGGTAATTCCAGCTCCA Blaxter et al., 1998 Blaxter et al., 1998 SSU9R 584-565 AGC TGG AAT TAC CGC GGC TG Bert et al., 2008 Blaxter et al., 1998 SSU24F 868-887 AGR GGT GAA ATY CGT GGA CC Meldal et al., 2007

SSU 24R 885-868 CCCCRRTCCAAGAATTTCACCTC Meldal et al., 2007

SSU26R 927-907 CATTCTTGGCAAATGCTTTGC Blaxter et al., 1998 Blaxter et al., 1998 SSU23F 1280-1298 ATT CCG ATA ACG AGC GAG A Bert el al., 2008 Blaxter et al., 1998 SSU23R 1298-1280 TCT CGC TCG TTA TCG GAA T Bert et al., 2008

SSU13R 1438-1419 GGG CAT CAC AGA CCT GTT A Blaxter et al., 1998 Blaxter et al., 1998 SSU18P 3’end TGA TCC WMC RGC AGG TTC AC Bert et al., 2008

SSU2FX 1108-1129 GGA AGG GCA CCA CCA GGA GTG G Meldal et al., 2007

SSUDR 1213-1194 CATAAAAGTCTCGCTCGTTA Dorris et al., 2002 Bhadury et al., 2008 NM18F 345 - 925 CGCGAATRGCTCATTACAACAGC Bhadury et al., 2006 Bhadury 2007 Nem 18SF CGCGAATRGCTCATTACAACAGC Floyd et al., 2005

Nem 18SR 998-1015 GGGCGGTATCTGATCGCC Bhadury et al., 2008 33

Bhadury et al., 2006 Floyd et al., 2005 ITS RDNA2 2523-2503 TTG ATT ACG TCC CTG CCC TTT Powers et al., 1997

rDNA1.58S - ACG AGC CGA GTG ATC CAC CG Powers et al., 1997

rDNA 2.144 - GTA GGT GAA CCT GCA GAT GGA T Powers et al., 1997 Derycke et al., 2005 VRAIN 2F 900 CTTTGTACACACCGCCCGTCGCT Derycke et al., 2008 Derycke et al., 2005 VRAIN 2R 900 TTTCACTCGCCGTTACTAAGGGAATC Derycke et al., 2008 28S Fonseca et al., 2008 LSUrDNA - 397 -TTCGACCCGTCTTGAAACACG De Ley et al., 2005 D2A Derycke et al., 2008 Fonseca et al., 2008 LSUrDNA – 397 TCGGAAGGAACCAGCTACTA De Ley et al., 2005 D3B Derycke et al., 2008 Mitochondrial DNA COI – citochromo oxidase 1 Derycke et al., 2005 ATGTT JB2 - Derycke et al., 2006 TTGATTTTACCWGCWTTYGGTGT Derycke et al., 2007 Derycke et al., 2005 JB3 426 TTTTTTGGGCATCCTGAGGTTTAT Derycke et al., 2006 Derycke et al., 2007

JB5 426 TAAAGAAGAACATAATGAAAATG Derycke et al., 2007 AGCACCTAAACTTAAAACATARTGRA JB5GED 422 Derycke et al., 2007 ARTG CCCCTCTAGTCTWCTATTTCTT JB8 363 Derycke et al., 2007 AATAC Uncoming genes Minibarcode – COI Meusnier et al., 2008 GAAAATCATAATGAAGGCATGAGC Uni-MinibarR1 - Meusnier et al., 2008

MinibarF1 - TCCACTAATCACAARGATATTGGTAC Meusnier et al., 2008

V- AVALIABLE SEQUENCED DATA OF MARINE NEMATODES

A total of 600 sequences of marine nematodes were deposited in the NCBI. These sequences are assigned to 150 nominal species from 104 genera. In total, there are 41 species assigned to Enoplea (Fig 4) and 109 species to Chromadorea (Fig 5). Within the second class, the most sequenced family is Chromadoridae (with 18 species), followed by Desmodoridae, Ethmolaimidae and Xyalidae with 9 species.

400

350

300 Enoplea

250

200

150

100

0 Ironidae Enoplidae Anticomidae Tripyloididae Enchelidiidae Oncholaimidae Leptosomatidae Phanodermatidae Anoplostomatidae Rhabdodemaniidae Thoracostomopsidae number of species barcoded number of species described literature Figure 4. Relation between the numbers of nematode species sequenced among Enoplea class in comparison with number of nematode species described in literature. Source: Nemys

500

450 400 Chromadorea 350

300

250

200

150

100

0 Xyalidae Leptolaimidae Linhomoeidae Desmodoridae Microlaimidae Monhysteridae Axonolaimidae Chromadoridae Cyatholaimidae Comesomatidae Monoposthiidae Sphaerolaimidae Selachinematidae Desmoscolecidae Ceramonematidae

number of species barcoded number of species described literature

Figure 5. Relation between the number of nematode species sequenced among Chromadorea class in comparison with number of nematode species described in literature. Source: Nemys

According to our analysis, genera of the families Chromadoridae and Oncholaimidae have the largest number of species sequences in the Genbank. However, this number is still less than 20 species, whereas in the literature the genus Oncholaimus alone has more than 30 valid species described. The number of marine nematode species with sequences in databases is very scarce, when compared with the phylum diversity. Moreover, there are other nematode groups, like plant-parasites, which show taxa that are well represented in genetic databases. This corroborates the necessity to produce more sequences in those studies, in order to increase the number of molecular tags in nematodes. A larger number of 18S rRNA, COI and 28S sequences from different marine nematode taxa are required for the barcoding approach to be more accurate and useful.

VI - FUTURE STUDIES WITH DNA BARCODING IN MARINE NEMATODES Two principal elements are proposed in DNA barcoding: (1) the ability to assign an unknown sample to a known species, and (2) the ability to detect previously sampled species as distinct. The prospect of assigning an unknown sample to a known one is

promising especially for well-known, comprehensively sampled groups that have been extensively studied by genetic and morphological taxonomy (Meyer & Paulay, 2005). Nevertheless, it is clear that a comprehensive comparative molecular database is necessary, against which unknown samples can be compared (Ekrem et al., 2007). Nowadays, the study of marine nematodes has focused on molecular tools to describe diversity in ecosystems and methods of integration of morphological approaches with molecular analyses have to be developing to cover the diversity of the group. Innovations in DNA extraction methodologies now allow exploitation of archived plant and macrofaunal specimens that have been stored in museums and herbaria for decades (Bhadury et al., 2008). Formalin fixation has historically been used to preserve specimens for morphological analysis (Thomas et al., 1997). Numerous archived formalin-fixed marine nematode specimens are available in museums and research labs and these could be used for molecular phylogenetics and genetic diversity studies. There are some steps that have been followed to create a DNA-based species identification system. First, we have to define a comprehensive barcode sequence library of marine nematodes. Second, it is necessary to develop an effective approach for the comparison and matching of sequences from new specimens to the barcode library (Frézal & Leblois, 2008). There is an obvious contribution that molecular analysis is making to taxonomy in helping to discover cryptic species (Lee, 2004). However, it is necessary to know the whole diversity of this group in nature to understand differences cryptic nematodes species before applying the molecular techniques to try to solve problems in ecological issues. It seems that traditional marine nematode taxonomy, based on the analysis of morphological characters, may be insufficient if we are to fully understand the species- level biodiversity of this meiobenthic group (Bhadury et al., 2008). In this scenario, no taxonomy review was published using the following nematodes families: Anoplostomatidae, Anticomidae, Leptosomatidae, Rhabdonemanidae, Tobriliidae, Actinolaimidae, Plectidae, Monoposthidae, Cyartonematidae, Siphonolaimidae, Axonolaimidae and Diplopeltidae (Table 2).

Table 2. Reviews of Marine Nematodes families published.

Family studied Authors Thoracostomopsidae Greenslade & Nicholas, 1991 Ironidae Platonova & Morievsky1994 Verschelde et al., 1998. Desmodoridae Verschelde et al., 2006. Vincx & Gourbault, 1989. Epsilonematidae Gourbault & Decraemer, 1996

Jensen, 1978 Microlaimidae Muthumbi & Vincx, 1999

Timm, 1970 Desmoscolecidae Decraemer, 1985 Draconematidae Decraemer et al., 1997 Platt, 1982 Ethmolaimidae Jensen, 1994 Monhysteridae Fonseca & Decraemer, 2008 Linhomoeidae Armenteros et al., 2009 Lorenzen (Daptonema), 1977 Nicholas &. Trueman, 2002 Xyalidae Tchesunov & Mokievsky (Amphimonhystera), 2005 Chromadoridae Muthumbi & Vincx, 1998 Comesomatidae Platt (Sabatieria review), 1985 Linhomoeidae R. W. Tim, 1962 De Coninck, 1942, Ceramonematidae Haspegslagh, 1973, 1979 Tchsunov & Mijutina, 2002 Rhabdtididae Sudhaus & Fitch, 2002

At this point, it has been develop new technologies such as ‘massively parallel sequencers’ using SOLEXA technology that is generated with highlight genome analyzer to enable researches to dramatically improve the efficiency and speed of current applications of sequencing for taxonomy purposes. This seems to be the time of development of new systems capable of simultaneously monitoring thousands of individual polymerase enzymes that enable accurate, multiplex DNA sequencing in real time (Shendure et al., 2004; Eisenstein, 2009, see: www.illumina.com). Genomics labs have to make a decision on what ‘next generation’ sequencing technology they will use is quickly approaching. Each technology has its benefits and shortcomings mainly when now we need to improve our understanding and increase the number of sequences that have to be deposited in public databases. There are also other technologies available, including metagenomics, that is method of sequencing DNA from natural samples is the ability to access a much wider

range of genomes to capture the genomic diversity within a natural population (Tringe & Rubin, 2005). Nevertheless, microarrays method has been applied in some parasitic nematodes and provides a promising alternative for high-throughput genotype-based diagnostics combining powerful DNA amplification strategies with subsequent hybridization to oligonucleotide probes specific for multiple target sequences allowing parallel study of expression of thousands of genes (François et al., 2006). This technology has been used to generate whole-genome characterizations of aging, wild- type and long-lived model system C. elegans (Golden & Melov, 2004). Therefore, an integration methodology for studies in biodiversity is one of the most important challenges in taxonomy of marine Nematoda.

VII - CONCLUSIONS We believe in an integration of molecular techniques and morphological data for the description of new species and generate an overview of biodiversity in marine sediments. Marine environments present challenges to estimate biodiversity assessment of nematodes that impose some limitations on traditional species identification that grossly underestimate the number of species in those habitats and when we compare the number of nematodes with sequences deposited in public databases is also poorly represented. Yet, molecular analyses of a much greater diversity of nematode species are urgently needed to improve representation of molecular and phylogenetic diversity within this wide range group of organisms. The evaluation might be needed for selection of different markers for molecular studies, since a highly conserved gene such as the 18S rRNA may also have some level of variation within some marine nematode populations (Floyd et al., 2005; Bhadury et al., 2008). Hyperdiverse samples of marine nematodes are especially difficult because they can contain very few individuals of each of the many species in the samples, leaving little or no room for assessing whether slightly divergent sequences from similar individuals are more likely to represent cryptic species versus being attributable to intraspecific sequence variation. Therefore, the integrative taxonomy should involve the analysis of multiple specimens using the combination of molecular method with a morphological approach. An approach based on multiple molecular markers, preferably

nuclear as well as mitochondrial genes as suggested by Derycke et al., (2006) may prove to be more informative in different studies such as phylogeny, biogeography, taxonomy, population genetics and barcoding of marine nematodes. Methods for rapid sequence acquisition are already in existence at genome sequencing centers, and easily adapted for taxonomic sampling (Blaxter, 2004; Bhadury et al., 2006a, b; Bhadury et al., 2008). At the same time, traditional taxonomic methods should continue to be used in order to develop identification keys for new species of marine nematodes. De Ley & Bert (2002) developed a technique based on video capture editing (VCE) that produces a number of multifocal vouchers of barcoding nematode species. Nevertheless, voucher species can be deposited in open website access database supporting the nematode branch of three of life (see: http://nematol.unh.edu). Hence, it is important that model studies on integrative taxonomy highlight the limitations to choose the best strategy for future identifications. It seems that traditional marine nematode taxonomy, based on the analysis of observable morphological characters, may be insufficient if we are to fully understand the species-level biodiversity of this meiobenthic group (Bhadury et al., 2008). An expanding nuclear and mitochondrial sequence of nematodes species database will need to be developed to enable and speed up routine identification of nematodes. Moreover, the development of high throughput systems may prove to be more time-efficient than traditional microscopy for faunal samples. However, considering a combination of those procedures, it seems that molecular data — based on two or more markers — as used to code the morphological dataset for multivariate analysis, and, ultimately, for pinpointing morphological diagnostic characters, can prove to be very effective (Fonseca et al., 2008), although success in some specific cases is very different from applicability on the scale of ecological surveys and taxonomy. Various novel sequencing technologies are being developed, each aspiring to reduce costs to the point at producing more sequences of nematode species to be deposit in public databases. Although integrative taxonomy requires substantial expertise and time, the method is, at present, the best way to accurately delimit species in taxa with unknown biodiversity (Will et al., 2005). Hence, taxonomical reviews are urgently required in the phylum Nematoda to understand the diversity and make a compilation of taxonomic descriptions of nematode species (Fonseca et al., 2008).

VIII- ACKNOWLEDGMENTS The authors are indebted Prof. João Batista and Luciana Tosta for making the diagrams that illustrate this paper.

IX- REFERENCES ABEBE, E. & BLAXTER, M. (2003). Comparison of biological, molecular and morphological methods of species identification in a set of cultured Panagrolaimus isolates, Journal of Nematology 35, 119–128. ALESHIN, V.V., KEDROVA, O.S., MILYUTINA, I.A., VLADYCHENSKAYA, N.S., PETROV, N.B. (1998). Relationships among nematodes based on the analysis of 18S rRNA gene sequences: molecular evidence for monophyly of chromadorian and secernentian nematodes. Russian Journal of Nematology 6, 175-184. ARMENTEROS, M., RUIZ-ABIERNO, R., VINCX, M., DECRAEMER, W. (2009). A morphometric analysis of the genus Terschellingia (Nematoda: Linhomoeidae) with redefinition of the genus and key to the species. Journal of the Marine Biological Association of the United Kingdom, 1-11. ARMSTRONG, M.R., BLOK, V.C., PHILLIPS, M.S. (2000). A multipartite mitochondrial genome in the potato cyst nematode Globodera pallida. Genetics 154, 181–192. AVISE, J.C.& WALKER, D. (1999). Species realities and number in sexual vertebrates: Perspectives from an asexually transmitted genome. Proceedings of National Academy Society United States 96, 992–995. AVISE, J.C (2000). Phylogeography: the history and formation of species. Harvard University Press, Cambridge. BARRETT, R.D.H.& HEBERT, P.D.N. (2005). Identifying spiders through DNA barcodes. Canadian Journal of Zoology. 83, 481–491. BERT, W., LELIAERT, F., VIERSTRAETE, A.R., VANFLETEREN, J.R., BORGONIE, G. (2008). Molecular phylogeny of the Tylenchina and evolution of the female gonoduct (Nematoda: Rhabditida). Molecular Phylogenetics and Evolution 48, 728-744. BHADURY, P. (2005) Molecular resolution of marine nematodes for improved assessment of biodiversity. PhD Thesis, University of Plymouth.

BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS A.D., SMERDON, G.R (2006a) Molecular detection of marine nematodes from environmental samples: overcoming eukaryotic interference. Aquatic Microbial Ecology 44, 97–103. BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS, A.D., SMERDON, G.R. (2006b). Development and evaluation of a DNA-barcoding approach for the rapid identification of nematodes. Marine Ecology Progress Series 320, 1–9. BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS A.D., SMERDON, G.R. (2007). Exploitation of archived marine nematodes— a hot lysis DNA extraction protocol for molecular studies. Zoologica Scripta 36, 93–98. BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS, A.D., SMERDON, G.R. (2008). Evaluation of combined morphological and molecular techniques for marine nematode (Terschellingia spp.) identification. Marine Biology 154, 509–518. BLAXTER, M.L., DE LEY, P., GAREY, J.R., LIU, L.X., SCHELDEMANN, P., VIERSTRAETE, A., VANFLETEREN, J.R., MACKEY, L.Y., DORRIS, M., FRISSE, L.M., VIDA, J.T., THOMAS, W.K. (1998). A molecular evolutionary framework for the phylum Nematoda. Nature 392, 71–75. BLAXTER, M.L. (2004). The promise of DNA taxonomy. Philosophical Transactions Royal Society London B 359, 669-679. BLAXTER, M., MANN, J., CHAPMAN, T., THOMAS, F., WHITTON, C., FLOYD, R., ABEBE, E. (2005). Deﬁning operational taxonomic units using DNA barcode data. Philosophical Transactions Royal Society B. 360, 1935-1943. BLOUIN, M.S (2002). Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. International Journal of Parasitology 32, 527–531 BROWN, S.A. (1997). Revolution at the checkout counter. Cambridge, MA: Harvard University Press. CHILTON, N.B., NEWTON, L.A., BEVERIDGE, I., GASSER, R.B. (2001) Evolutionary relationships of trichostrongyloid nematodes (Strongylida) inferred from ribosomal DNA sequence data. Molecular Phylogenetics Evolution. 19, 367–

386, CHILTON, N.B., HUBY-CHILTON, F. & GASSER, R.B. (2003). First complete large subunit ribosomal RNA sequence and secondary structure for a parasitic nematode: phylogenetic and diagnostic implications. Molecular and Cellular Probes 17, 33-39. COOK, A.A., BHADURY, P., DEBENHAM, N.J., MELDAL, B.H.M., BLAXTER, M.L., SMERDON, G.R., AUSTEN, M.C., LAMBSHEAD, P.J.D., ROGERS, A.D. (2005). Denaturing gradient gel electrophoresis (DGGE) as a tool for identification of marine nematodes. Marine Ecology Progress Series 291, 103–113. COOMANS, A. (2002). Present status and future of nematode systematics. Nematology 4, 573–582. DAYRAT, B. (2005). Towards integrative taxonomy. Biological Journal of the Linnean Society 85, 407–415. DE CONINCK, L.A. (1942). Sur quelques espèces nouvelles de nematodes libres (Ceramonematinae Cobb, 1933), avec quelques remarques de systematique. Bulletin Museum Royale d'Histoire Naturelle Belgique 18, 1-37. DE LEY P., FÉLIX M.A., FRISSE, L.M., NADLER, S.A., STERNBER, P.W, THOMAS, W.K. (1999). Molecular and morphological characterization of two reproductively isolated species with mirror-image anatomy (Nematoda: Cephalobidae). Nematology 1, 591–612. DE LEY, P., BERT, W. (2002). Video capture and editing as a tool for the storage, distribution and illustration of morphological characters of nematodes. Journal of Nematology 34, 296–302. DE LEY, P., BLAXTER, M. (2002). Systematic position and phylogeny. The biology of nematodes. Chapter 1, edited. Donald L. Lee, 1-30. DE LEY, P., BLAXTER, M. (2004). A new system for Nematoda: combining morphological characters with molecular trees, and translating clades into ranks and taxa. Nematology Monographs and Perspectives 2: 633–653. DE LEY, P., DE LEY, I.M., MORRIS, K, ABEBE, E, MUNDO OCAMPO, M., YODER, M., HERAS, J., WAUMANN, D., ROCHA-OLIVARES, A., BURR, A. H. J., BALDWIN, J.G., THOMAS, W.K. (2005) An integrated approach to fast and informative morphological vouchering of nematodes for applications in molecular barcoding. Philosophical Transition of the Royal Society 360: 1945–1958.

DECRAEMER, W. (1985). Revision and phylogenetic systematic of the Desmoscolecidae (Nematoda). Hydrobiologia 120, 259-283. DECRAEMER, W., GOURBALT, N. & BACKELJAU, T. (1997). Marine nematodes of the family Draconematidae (Nemata): a synthesis with phylogenetics relationships. Hydrobiologia, 357, 185-202. DERYCKE, S., REMERIE, T., VIERSTRAETE, A., BACKELJAU, T., VANFLETEREN, J., VINCX, M., MOENS, T. (2005). Mitochondrial DNA variation and cryptic speciation within the free-living marine nematode Pellioditis marina. Marine Ecology Progress Series 300, 91–103. DERYCKE, S., BACKELJAU, T., VLAEMINCK, C., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS, T. (2006). Seasonal dynamics of population genetic structure in cryptic taxa of the Pellioditis marina complex (Nematoda: Rhabditida). Genetica 128, 307–321. DERYCKE, S., BACKELJAU, T., VLAEMINCK, C., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS, T. (2007). Spatiotemporal analysis of population genetic structure in Geomonhystera disjuncta (Nematoda, Monhysteridae) reveals high levels of molecular diversity. Marine Biology 151: 1799–1812. DERYCKE S., FONSECA, G., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS T. (2008). Disentangling taxonomy within the Rhabditis (Pellioditis) marina (Nematoda, Rhabditidae) species complex using molecular and morphological tools. Zoological Journal of the Linnean Society 152, 1-15. DeSALLE, R., EGAN, M.G. & SIDDALL, M. (2005). The unholy trinity: taxonomy, species delimitation and DNA barcoding. Philosophical Transactions Royal Society B. 360, 1905-1916. DORRIS, M., VINEY, M.E. & BLAXTER, M.L. (2002). Molecular phylogenetics analysis of the genus Strongyloides and related nematodes. International Journal of Parasitology 32, 1507-1517. EISENSTEIN, M. (2009). Sequencing in a flash. Nature Methods. 6(2), 114-115. EKREM, T., WILLASSEN, E. & STUR, E. (2007). A comprehensive DNA sequences library is essential for identification with DNA barcodes. Molecular Phylogenetics and Evolution, 43, 530-542.

FÉLIX, M.A., DE LEY, P., SOMMER, R.J., FRISSE, L.M., NADLER, S.A., THOMAS, W.K., VANFLETEREN, J.R., STERNBERG, P.W. (2000). Evolution of vulva development in the Cephalobina (Nematoda). Developmental Biology 221, 68–86. FLOYD, R., ABEBE, E., PAPERT, A. & BLAXTER, M.L. (2002) Molecular barcodes for soil nematode identification. Molecular Ecology 11, 839–850. FLOYD, R. M., ROGERS, A.D., LAMBSHEAD, P.J., SMITH, C.R. (2005). Nematode-specific PCR primers for the 18S small subunit rRNA. Molecular Ecology Notes 5, 611–612. FRANÇOIS, C., KEBDANI, N., BARKER, I., TOMLINSON, J., BOONHAM, N., CASTAGNONE-SERENO, P. (2006). Towards specific diagnosis of plant-parasitic nematodes using DNA oligonucleotide microarray technology: A case study with the quarantine species Meloidogyne chitwoodi. Molecular and Cellular Probes 20, 64– 69. FONSECA, G., DERYCKE, S. & MOENS, T. (2008). Integrative taxonomy in two free-living nematode species complexes. Biological Journal of Linnean Society 94, 737-753. FONSECA, G. & DECRAEMER, W. (2008). State of the art of the free-living marine Monhysteridae (Nematoda) Journal of the Marine Biological Association of the United Kingdom, 1-20. FONTANILLA, I.K.C. & WADE, C.M. (2008). The small subunit (SSU) ribosomal (r) RNA gene as a genetic marker for identifying infective 3rd juvenile stage Angiostrongylus cantonensis. Acta Tropica 105, 181–186. FOUCHER, A.L.J.L., BONGERS, T., NOBLE, L.R., WILSON, M.J. (2004). Assessment of nematode biodiversity using DGGE of 18S rDNA following extraction of nematodes from soil. Soil & Biochemistry 36, 2027-2032. FRÉZAL, L. & LEBLOIS, R. (2008). Four years of DNA barcoding: Current advances and prospects. Infection, Genetics and Evolution 8, 727–736. GASSER, R. B. & NEWTON, S.E. (2000). Genomic and genetic research on bursate nematodes: significance, implications and prospects. International Journal for Parasitology 30, 509-534. GODFRAY, H.C.J. (2002). Challenges for taxonomy—the discipline will have to

reinvent itself if it is to survive and ﬂourish. Nature 417, 17–19. GOLDEN, T. R. & MELOV, S. (2004). Microarray analysis of gene expression with age in individual nematodes. Aging Cell. 3, 111–124 GOURBAULT, N. & DECRAEMER, W. (1996). Marine nematodes of the family Epsilonematidae: A synthesis with phylogenetic relationships. Nematologica 42, 133-158. GREENSLADE, P. & NICHOLAS, W.L. (1991). Some Thoracostomopsidae (Nematoda: Enoplida) from Australia, including Descriptions of Two New Genera and Diagnostic Keys. Invertebrate Taxonomy 4, 1031-1052. HAJIBABAEI, M., SINGER, G.A.C., HEBERT, P.D.N., HICKEY, D.A. (2007). DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends Genetics 23, 167–172. HASPEGSLAGH, G. (1973). Superfamilie Ceramonematoidea De Coninck, 1965: een monografische studie, 1-359. HASPEGSLAGH, G. (1979). Superfamily Ceramonematoidea (Cobb, 1933) General morphology. Annales Society Royal Zoolology Belgique. - T. 108 (1978) - fasc. 1-2, 65-74. HEBERT, P.D.N., CYWINSKA, A., BALL, S.L., DEWAARD, J.R. (2003a). Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B 270, 313–321. HEBERT, P.D.N., RATNASINGHAM, S. & DEWAARD, J.R. (2003b) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Philosophical Transactions Royal Society London B 270, 96–99. HEBERT, P.D.N, PENTON, E.H., BURNS, J.M., JANZEN, D.H., HALLWACHS, W. (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Procedings of the Nacional Academy of Sciences. USA 101, 14812–14817. HEBERT, P.D.N. & GREGORY, T.R. (2005). The promise of DNA barcoding for taxonomy. Systematic Biology 54, 852–859. HILLIS, D.M. & DIXON, M.T. (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. Quartely Review of Biology 66, 411–437. HILLIS, D.M., MORITZ, C., PORTER, C.A., BAKER, R.J. (1991). Evidence for

biased gene conversion in concerted evolution of ribosomal DNA. Science 251, 308–310. HOLLINGSWORTH, B. D. (1998). The systematics of chuckwallas (Sauromalus) with a phylogenetic analysis of other iguanid lizards. Herpetolology Monography. 12, 38–191. HOLTERMAN, M., VAN DER WURV, A., VAN DEN ELSEN, S., VAN MEGEN, H., BONGERS, T., HOLOVACHOV, O., BAKKER, J., HELDER, J., (2006). Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution towards crown clades. Molecular Biology and Evolution 23, 1792–1800. HOLTERMAN, M., HOLOVACHOV, O., VAN DEN ELSEN, S., VAN MEGEN, H, BONGERS, T., BAKKER, J., HELDER, J. (2008a). Small subunit ribosomal DNA- based phylogeny of basal Chromadoria (Nematoda) suggests that transitions from marine to terrestrial habitats (and vice versa) require relatively simple adaptations. Molecular Phylogenetics and Evolution 48, 758-763. HOLTERMAN, M., RYBARCZYK, K., VAN DEN ELSEN, S., VAN MEGEN, H., MOOYMAN, P., PENA SANTIAGO, R., BONGERS, T., BAKKER, J. HELDER, J. (2008b). A ribosoma DNA-based framework for the detection and quantification of stress-sensitive nematode families in terrestrial habitats. Molecular Ecology Resources 8, 23-34. JANZEN, D.H. (2004). Now is the time. Philosophical Transactions Royal Society London B 359, 731–732. JENSEN, P. (1978). Revision of Microlimidae, Erection of Molgolaimidae fam. n., and remarks on the systematic position of Paramicrolaimus (Nematoda, Desmodorida). Zoologica Scripta 7, 159-173. JENSEN, P. (1994). Revision of Ethmolaiminae Filipjev & Stekhoven, 1941 (Nematoda, Chromadorida), with descriptions of one new genus and three new species. Hydrobiologia 286, 1-15 KOHLER, F. (2007). From DNA taxonomy to barcoding — how a vague idea evolved into a biosystematic tool. Museum für Naturkunde der Humboldt-Universität Zu Berlin 83, 44–51. KUMARI, S., DECRAEMER, W., TRAVERSA, D., LIŠKOVÁ, M. (2009). Molecular

and morphological delineation of Longidorus poessneckensis Altherr, 1974 (Nematoda: Dorylaimida). European Journal of Plant Pathology. 123, 125-137. LAMBSHEAD, P.J.D. (1993). Recent developments in marine benthic biodiversity research. Oceanis 19, 5-24. LAMBSHEAD, P.J.D. (2004). Marine nematode biodiversity. In: Chen ZX, Chen WY, Chen SY, Dickson DW (eds) Nematology: advances and perspectives, vol 1: nematode morphology, physiology and ecology. CABI Publishing, Wallingford, pp 436-467. LEE, M.S.Y. (2004). The molecularisation of taxonomy. Invertebrate Systematic 18, 1– 6. LIPSCOMB, D., PLATNICK, N., WHEELER, Q. (2003). The intellectual content of taxonomy: a comment on DNA taxonomy. Trends Ecology and Evolution. 18, 65– 68. LITVAITIS, M.K., BATES, J.W., HOPE, W.D., MOENS, T. (2000). Inferring a classification of the Adenophorea (Nematoda) from nucleotide sequences of the D3 expansion segment (26/28S rDNA). Canadian Journal of Zoology 78, 911–922. LORENZ, J.G., JACKSON, W.E., BECK, J.C., HANNER, R. (2005) “The problems and promise of DNA barcodes for species diagnosis of primate biomaterials,” Philosophical Transactions of Royal Society B. 360: 1869–1877. LORENZEN, S. (1977). Revision der Xyalidae (freilebende Nematoden) aufder Grundlage einer kritischen Analyse von 56 Arten aus Nord- und Ostsee. VeröVentlichungen des Institutes für Meeresforschung in Bremerhaven 16, 197–261. LUNT, D.H. & HYMAN, B.C. (1997). Animal mitochondrial DNA recombination. Nature 387, 247. MALHOTRA, A. & THORPE, R.S. (2004). A phylogeny of four mitochondrial gene regions suggests a revised taxonomy for Asian pitvipers (Trimeresurus and Ovophis). Molecular Phylogenetics and Evolution 32, 83–100. MALLET, J. & WILLMOTT, K. (2003). Taxonomy: renaissance or Tower of Babel? Trends in Ecology and Evolution 18, 57 – 59. MARSHALL, E. (2005). Taxonomy. Will DNA barcodes breathe life into classification? Science, 307, 1037. MELDAL, B.H.M., DEBENHAM, N.J., DE LEY, P., DE LEY, I.T., VANFLETEREN,

J.R., VIERSTRAETE, A.R., BERT, W., BORGONIE, G., MOENS, T., TYLER, P.A., AUSTEN, M.C., BLAXTER, M.L., ROGERS, A.D., LAMBSHEAD, P.J.D. (2007). An improved molecular phylogeny of the Nematoda with special emphasis on marine taxa. Molecular Phylogenetic and Evolution 42, 622–636. MEUSNIER, I., SINGER, G.A.C., LANDRY, J.F., HICKEY, D.A., HEBERT, P.D.N., HAJIBABAEI, M. (2008). A universal DNA mini-barcode for biodiversity analysis. B. M. C Genomics 9, 214 MEYER, C.P. & PAULAY, G. (2005). DNA Barcoding: Error Rates Based on Comprehensive Sampling. Plos Biology. 3, 2229-2238. MORITZ, C. & CICERO, C. (2004). DNA barcoding: promise and pitfalls. Plos Biology 2, 1529–1531. MUTHUMBI, A.W. & VINCX, M. (1998). Chromadoridae (Chromadorida: Nematoda) from the Indian Ocean: Description of new and known species. Hydrobiologia 364, 119–153. MUTHUMBI, A.W. & VINCX, M. (1999). Microlaimidae (Microlaimoidea: Nematoda) from the Indian Ocean: description of nine new and known species Hydrobiologia 397, 39-58. NADLER, S. A. (2002). Species delimitation and nematode biodiversity: phylogenies rule. Nematology 4, 615–625. NICHOLAS, W.L. & TRUEMAN, J.W.H. (2002). The taxonomy of the family Xyalidae Chitwood, 1951 (Monhysterida: Nematoda): a cladistic analysis. Nematology 4, 453-470. PAGE, T.J., CHOY, S.C. & HUGHES, J.M. (2005). The taxonomic feedback loop: symbiosis of morphology and molecules. Biological Letters 1, 139-142. PARMAKELIS, A., SPANOS, E., PAPAGIANNAKIS, G., LOUIS, C., MYLONAS, M. (2003). Mitochondrial DNA phylogeny and morphological diversity in the genus Mastus (Beck, 1837): a study in a recent (Holocene) island group (Koufonisi, southeast Crete). Biological Journal of the Linnean Society 78, 383–399. PLATONOVA, T.A. & MOKIEVSKY, V.O. (1994). Revision of the marine nematodes of the family Ironidae (Nematoda, Enoplida). Zoological Rossica 3, 5-17. PLATT, H.M. (1982). Revision of the Ethmolaimidae (Nematoda: Chromadorida). Bulletin of the British Museum (Natural History). Zoology Series 43, 4.

PLATT, H.M. (1985). The free-living marine nematode genus Sabatieria (Nematoda: Comesomatidae). Taxonomic revision and pictorial keys. Zoological Journal of the Linnean Society 83, 27–78. POWERS, T.O., TODD, T.C., BURNELL, A.M., MURRAY, P.C.B., FLEMING, C.C., SZALANSKI, A.L., ADAMS, B.A., HARRIS, T.S. (1997). The rDNA internal transcribed spacer region as a taxonomic marker for nematodes. Journal of Nematology. 29, 441-450. RACH, J., DeSALLE, R., SARKAR, I.N., SCHIERWATER, B., HADRYS, H. (2008). Character-based DNA barcoding allows discrimination of genera, species and populations in Odonata. Proceedings Royal Society B 275, 237-247. RUBINOFF, D. (2006). DNA barcoding evolves into the familiar. Conservation Biology 20, 1548, 1549. RUBINOFF, D., CAMERON, S. & WILL, K. (2006). A genomic perspective on the shortcomings of mitochondrial DNA for “barcoding” identification. Journal of Heredity 29, 1-14. RUSIN, L. Y., ALESHIN, V. V., TCHESUNOV, A. V., ATRASHKEVICH, G. I. (2003). The 18S ribosomal RNA gene of Soboliphyme baturini Petrow, 1930 (Nematoda: Dioctophymida) and its implications for phylogenetic relationships within Dorylaimia. Nematology 5: 615–628. SAVOLAINEN, V., COWAN, R.S., VOGLER, A.P., RODERICK, G.K., LANE. R. (2005). Towards writing the encyclopedia of life: an introduction to DNA barcoding. Philosophical Transactions Royal Society B 360, 1805-1811. SCHANDER, C. & WILLASSEN, E. (2005). What can biological barcoding do for marine biology? Marine Biology Research 1, 79-83. SEBERG O., HUMPHRIES C.J., KNAPP S., STEVENSON D.W., PETERSEN G., SCHARFF, N., ANDERSEN, N.M. (2003). Shortcuts in systematics? A commentary on DNA-based taxonomy. Trends in Ecology and Evolution 18: 63–65. SHENDURE, J., MITRA R.D., VARMA C., CHURCH, G.M. (2004). Advanced sequencing technologies: Methods and goals. Nature Reviews Genetics 5, 335-344. SITES, J.W., MARSHALL, J.C. (2003). Delimiting species: a renaissance issue in systematic biology. Trends in Ecology and Evolution 18, 462–470. SMITH, M.A., WOODLEY, N.E., JANZEN, D.H., HALLWACHS, W., HEBERT,

P.D.N. (2006a). DNA barcode reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Sciences United States 103, 3657–3662. SMITH, G.F., ROUX, J.P., TOLLEY, K., CONRAD, F. (2006b). Taxonomy and barcoding: conflict or companions. South Journal of Science 102, 517-518. STOECKLE, M. (2003). Taxonomy, DNA, and the barcode of life. Bioscience 53, 796– 797. SUBBOTIN, S.A., STURHAN D., VOVLAS N., CASTILLO P., TAMBE J.T., MOENS, M., BALDWIN, J.G. (2007). Application of the secondary structure model of rRNA for phylogeny: D2–D3 expansion segments of the LSU gene of plant- parasitic nematodes from the family Hoplolaimidae Filipjev, 1934. Molecular

Phylogenetics and Evolution 43, 881–890. SUDHAUS, W. & FITCH, D. (2001). Comparative Studies on the Phylogeny and Systematics of the Rhabditidae (Nematoda). Journal of Nematology 33, 1–70. SUNNUCKS, P. (2000). Efficient genetic markers for population biology. Tree. 5, 199- 203. TAUTZ, D., ARCTANDER, P., MINELLI, A., THOMAS, R.H., VOGLER, A.P. (2002). DNA points the way ahead in taxonomy. Nature. 418, 479. TAUTZ, D., ARCTANDER, P., MINELLI, A., THOMAS, R.H., VOGLER, A.P. (2003). A plea for DNA taxonomy. Trends Ecology and Evolution 18, 71–74. TCHESUNOV, A.V. & MILIJUTINA, M.A. (2002). A review of the family Ceramonematidae (marine free-living nematodes), with descriptions of nine species from the White Sea. Zoological Institute, 11, 1-39. TCHESUNOV, A.V. & MOKIEVSKY, V.O. (2005). A review of the genus Amphimonhystera Allgén, 1929 (Monhysterida: Xyalidae, Marine Freeliving Nematodes) with description of three new species. Zootaxa 1052, 1–20. TENENTE, G., DE LEY, P., DE LEY, I.T., KARSSEN, G. (2004). Sequence analysis of the D2/D3 region of the large subunit rDNA from different Meloidogyne isolates. Nematropica. 34,1-12. THOMAS, W.K., VIDA, J.T., FRISSE, L.M., MUNDO OCAMPO, M., BALDWIN J.G. (1997). DNA sequences from formalin-fixed nematodes: integrating molecular and morphological approaches to taxonomy. Journal of Nematology 29, 250–254.

TIMM. R. W. (1962). Marine Nematodes of family Linhomoeidae from the Arabian Sea at Karachi. Canadian Journal of Zoology 4, 165-178. TIMM, R.W. (1970). A revision of the nematode order Desmoscolecida Filipjev, 1929. University of California publication in Zoology. 93, 1-113. TRINGE, S.G. & RUBIN, E.M. (2005). Metagenomics: DNA sequencing of environmental samples. Nature Reviews Genetics. 6, 805-814. VALDECASAS, A.G., WILLIAMS, D., WHEELER, Q.D (2008). ‘Integrative taxonomy’ then and now: a response to Dayrat (2005)’ Biological Journal of the Linnean Society 93, 211–216. VANFLETEREN, J.R & VIERSTRAETE, A.R. (1999). Insertional RNA editing in metazoan mitochondria: The cytochrome b gene in the nematode Teratocephalus lirellus Cambridge University Press Society RNA 5, 622-624. VERSCHELDE, D., GOURBAULT, N. & VINCX, M. (1998). Revision of Desmodora with Descriptions of new Desmodorids (Nematoda) from hydrothermal vents of the pacific. Journal Marine Biology Association U. K 78, 75-112. VINCX, M. & GOURBAULT, N. (1989). Desmodoridae from the Bay of Morlaix (Brittany) and the Southern Bight of the North Sea. Les Cahiers de Biologie Marine. 30, 103-114. VOGLER, A.P. & MONAGHAN, M.T. (2007). Recent advances in DNA taxonomy. Journal Zoological Systematics Evolution Research 45, 1-10. WAKE, M.H. (2003). What is ‘Integrative Biology’? Journal of Integrative and Comparative Biology 43, 239–241. WARD, R.D., ZEMLAK, T.S., INNES, B.H., LAST, P.R., HEBERT, P.D.N. (2005). DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B 360, 1847––1857. WHEELER, Q.D. (2004). Taxonomic triage and the poverty of identiﬁcation and classiﬁcation. Cladistics 20, 47–55. WHEELER, Q.D., RAVEN, P.H. & WILSON, E.O. (2004). Taxonomy: impediment or expedient? Science 303, 285. WIENS, J.J.P & ENKROT, T.A. (2002). Delimiting species using DNA and morphological variation and discordant species limits in spiny lizards (Sceloporus). Systematic Biology 51, 69–91.

WILL, K.W. & RUBINOFF, D. (2004). Myth of the molecule: DNA barcodes for species cannot replace morphology for identification and classification. Cladistics 20, 47-55. WILL, K.W., MISHLER, B.D. & WHEELER, Q.D. (2005). The perils of DNA barcoding and the need for integrative taxonomy. Systematic Biology 54, 844–851. WILSON, E.O. (2003). The encyclopedia of Life. Trends in Ecology and Evolution 18, 77–80. WILSON, E.O. (2004). Taxonomy as a fundamental discipline. Philosophical Transactions of the Royal Society of London B 359, 739. ZHENG, J., SUBBOTIN, S.A., HE, S., GU, J., MOENS, M. (2003). Molecular characterisation of some Asian isolates of Bursaphelenchus xylophilus and B. mucronatus using PCR-RFLPs and sequences of ribosomal DNA. Russian Journal of Nematology 11, 17-22.

Capítulo 3

Inventário molecular das espécies de

Nematoda marinhos presentes em bancos genéticos públicos, com adição

de novas sequências

Silva, N.R.R; De Ley, P.; King, I.; Robinson, C.; Decraemer, W.; Pereira, T. J.; Rocha- Olivares, A.; Silva, M. C.; Thomas, M. C.; Larrazabal, A.L.; Genevois, V.; Santos, M. T. C.; Rieger, T. Inventorying the diversity of free living marine nematodes: using DNA barcoding and integrative approach.

Artigo submetido para publicação na Nematology

Inventorying the diversity of free living marine nematodes: using DNA barcoding and integrative approach.

Neyvan Renato Rodrigues da Silva1,2, Paul De Ley5, Ian King5, Cymphonee Robinson5, Wilfrida Decraemer6,7, Tiago J. Pereira5, Axayácatl Rocha-Olivares9, Maria Cristina da Silva1, Micheli Cristina Thomas8, Alexandre Lacerda Larrazabal1, Verônica Gomes Genevois1, Maria Tereza Correia dos Santos3, Tania Tassinari Rieger4. 1- Departamento de Zoologia, Universidade Federal de Pernambuco, Av. Prof. Professor Moraes Rêgo, s/n, Cidade Universitária, Recife, Brazil. 2 - Instituto Federal do Rio Grande do Norte, Campus Zona Norte, Rua Brusque 2926, Potengi, Natal – Rio Grande do Norte. 3 – Departamento de Bioquímica; 4- Departamento de Genética, CCB/UFPE. 5 - Department of Nematology, University of California, Riverside, CA 92521, USA 6- Department of Biology, Ghent University, Ledeganckstraat 35; B-9000, Ghent, Belgium. 7 – Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussels, Belgium. 8 - Centro de Estudos do Mar Universidade Federal do Paraná. Av. Beira-Mar, 50.002; Pontal do Paraná, PR. 9 - Molecular Ecology Laboratory, Deparment of Biological Oceanography, Centro de Investigación Científica y Educación Superior de Ensenada, Carretera Tijuana- Ensenada, Km. 107, Baja California, México.

Corresponding author: [email protected]

Abstract

A complete DNA-based inventory of the marine nematode taxa deposited in molecular public databases is presented. This paper evaluates the amount of DNA sequences regarding for molecular taxonomy, ecological and biodiversity issues. Molecular methods such as DNA-barcoding offer potentially efficient alternatives to study the biodiversity of marine nematode communities, which could increase the use of these organisms in ecological surveys and environmental assessments. Sequencing is being developed to catalogue nematode species and then to increase the information available for this group on a global scale. European countries and North America are the main contributors to the latest submissions of sequences to the molecular databases. In this survey, we report 62 sequences belonging to 36 marine nematode species collected in Campos Basin, Rio de Janeiro, Brazil; in Bolsa Chica, California, USA; and in Gulf of California and Pacific Ocean coasts of Baja California, Mexico. Furthermore, the concept idea of “Nematode Identification Card” (NIC), which would link main public morphological and molecular databases, is presented. DNA barcoding in marine nematode taxa has increased quickly in the last few years, mainly due to the necessity to enhance tools for taxonomic purposes in animal life biodiversity programs. A combination of the DNA-barcoding approach and NIC are strongly needed to the molecular taxonomy of marine nematodes, mainly from tropical areas. This will increase the knowledge of the marine nematode biodiversity and taxonomy worldwide.

Keywords: molecular inventory, nematode identification card, biodiversity, databases.

INTRODUCTION The initiative of inventorying all marine nematode DNA sequences deposited in public databases results from the necessity to evaluate some aspects of the current DNA sequence data available, such as nematode taxonomic coverage, geographic areas contributor and which genes have been used so far (Blaxter, 2003; Wilson 2003). It is widely accepted that nematode taxonomy based on morphology is time-consuming and laborious, and in this sense new approaches such as DNA-barcoding are required to estimate the real biodiversity of marine nematode taxa. There is a lack of objective criteria for assessing homology of morphological characters of nematodes, and this scarcity has hampered the reconstruction of their phylogeny (De Ley & Blaxter, 2004). Nevertheless, nematodes are highly conserved in terms of gross morphology, and even the higher-level of taxonomy in the phylum has been made difficult by a lack of easily scored characters (Blaxter et al., 1998). Despite this, there is currently a serious crisis in taxonomic expertise throughout the scientific community, which leaves unaddressed many highly diverse groups of organisms (Godfray, 2002, Fonseca et al. 2008). Marine nematode species richness has been estimated to possibly exceed 1 million, however only a few thousand are described and therefore much of the nematode diversity in soils and marine sediments remains essentially unknown (Grassle & Maciolek, 1992). Molecular techniques and phylogenetic analyses can potentially overcome this problem, and DNA-barcoding appears to be a promising initiative to assess biodiversity of free-living marine nematodes (Floyd et al. 2002; Blaxter et al. 2005; Bhadury et al. 2006a). This technique, based on the analysis of a small segment of the genome, is a potential way to simplify and speed up the evaluation and identification of taxa such as nematodes in ecological or biomonitoring studies (Rogers & Lambshead 2004). Some regions in an individual’s genome can be viewed as genetic “barcodes”, since they hold the necessary information for their identification. In addition, the genetic variation that they contain traces back to the evolutionary history of their lineage. Therefore a DNA barcode in the form of a specific sequence carries both species-specific and phylogenetic information regarding an organism (Hebert et al. 2003a). In common with many areas of contemporary biology, developments in molecular genetics have a significant impact on the fields of taxonomy and systematics,

not only in terms of aiding in species recognition, but also through elucidating phylogenetic relationships and mechanisms of speciation (Hillis et al. 1996). In this scenario, DNA-barcoding employs standardized genomic fragments to facilitate species identification and discovery (Hebert et al. 2003b; Kress et al. 2005; Savolainen et al. 2005). Currently, increasing availability of nucleotide sequences provides a universally applicable and objective approach for the comparative analysis of population and species identity (Park & Moran, 1994; Carvalho & Hauser, 1999). The aims of the present study were: (1) to inventory the molecular sequences of marine nematode species from those deposited in public databases; (2) to estimate the percentage of the most useful genes as DNA barcodes for marine nematodes (3) to report new barcoding sequences of marine nematodes from Campos Basin (Rio de Janeiro, Brazil), Bolsa Chica (California, USA) and Baja California (Mexico); (4) to present a discussion about the existing bias in DNA-barcoding sequences production: (5) to elaborate a conceptual view of the Nematode Identification Card integrated to databases as a useful tool for molecular and ecological studies.

Material and Methods DNA INVENTORY All DNA sequences from marine nematode species available on 30/09/2009 were retrieved from the public genetic databases GenBank (USA), European Molecular Biology Laboratory (EMBL-Bank) and DNA databases of Japan (DDBJ) (Table 1).

SAMPLING Sediments were collected, using box corer USNEL SPADE Corer type-ocean Instruments with 0.25m2 of surface area, from Campos Basin in Rio de Janeiro, southeast of Brazil, at three stations: A (22º55'03S, 42'00'55”W), station E (22º01'41S, 040º44'59”W) and station I (21º10’57”S, 40º28’33”W). This area has an average depth of 25m. Samples from Bolsa Chica, California, USA, as well as those from Gulf of California and Pacific coast of Baja California, Mexico, were collected in the intertidal zone using a transparent corer (2cm Ø x 10cm) and were immediately fixed in the field with DESS solution (DMSO 20%, 0.25M and disodium EDTA satured with NaCl, pH 8.0) (Yoder et al. 2006) (see Table 2).

NEMATODE ISOLATION AND IDENTIFICATION In order to maximize taxonomic diversity and optimize our methods, we sought to include as wide a range of nematode species as possible. Specimens were picked randomly from samples, mounted on slides and then inspected using an Olympus BX- 51 microscope equipped with differential interference contrast optics. The diagnostically most important body parts were captured at various magnifications using a digital camera before the molecular procedure. Based on morphological characters, each specimen was identified to the genus and, where possible, the species level using pictorial keys and current literature descriptions of marine nematodes (Platt & Warwick, 1988; Warwick et al. 1998). Whenever possible, male specimens were included for taxonomic confirmation (Table 2).

DNA EXTRACTION, PCR AND SEQUENCING Nematode specimens previously identified were cut into pieces and transferred to a 0.5-ml tube containing 25µl Worm Lysis Buffer (50 µM KCl; 10 µM Tris, pH 8.3;

2.5 µM MgCl2; 0.45% NP 40 (Tergitol Sigma) and 0.45% Tween 20) (Williams et al. 1992). Specimens were digested with 2 µl Proteinase K (60 µg/ml) and frozen at -80ºC. The tubes were incubated at -80ºC (10 min), 65ºC (1 h) and 95ºC (10 min), consecutively. After centrifugation (1 min; 16 000g), 5 µl of the DNA suspension was added to the PCR mixture (Taq DNA Polymerase, Qiagen, Germany). A 5-µl aliquot of each PCR product was loaded onto 1% agarose gels to check the size of the amplified product. PCR amplification and sequencing targeted the small ribosomal subunit (SSU or 18S) using the primers MN18F CGCGAATRGCTCATTACAACAGC and d22R GCCTGCTGCCTTCCTTRGA) (Blaxter et al. 1998), and the large ribosomal subunit (LSU or 28S) with primers D2A ACAAGTACCGTGAGGGAAAGT and D3B GCGAAGGAACCAGCTACTA) (De Ley et al. 2005). Further evaluation of nematode species from Campos Basin with 18S rRNA was abandoned as a result of poor PCR amplification results. Sequencing reactions were performed using Core Instrumentation Facility BigDye V3.1 Terminator Cycle Sequencing kit following the manufacturer’s protocol

prior to running on POP7 polymer on 50 cm capillaries using an ABI 3130XL automated sequencer.

Results MOLECULAR INVENTORY OF REPRESENTATIVE MARINE NEMATODE TAXA A molecular inventory of marine nematodes was carried out to highlight the available sequences from DNA-barcoding, phylogenetics and population genetics studies in those molecular databases. More than 200 species of marine nematodes were barcode sequenced and the data deposited in public databases during this decade (Table 1). This is a very small fraction of species considering the vast potential and realized taxonomic richness of the group. This survey presents 20 and 42 sequences were produced for 18S and 28S genes, respectively; 14 of them are new records of marine nematodes species deposited in GenBank (Table 2). In this survey were sequenced nematodes belonging to the following families: Thoracostomopsidae (5 species), Xyalidae (3 species), Oncholaimidae (2 species), Enchelidiidae (1 species), Chromadoridae (1 species), Desmodoridae (1 species) and Axonolaimidae (1 species) (Table 2). Baja California was the most represented locality with 40 barcoded sequences submitted to GenBank.

Table 1. Molecular inventory of marine nematodes taxon sorted from public databases. (Update at 09/2009) GenBank Number of sequences Family Genus/Species Acession Gene target in GenBank within Source number families AY854193 Enoploides brunettii 18S Cook et al., 2005 DQ394731 FJ040490 DQ394791 DQ394787 Bhadury et al., 2006b; AM234621 Enoploides sp. 18S; 28S De Ley et al., 2005. DQ077759 Litvaitis et al., 2000 Thoracostomopsidae DQ077760 (18 sequences) DQ077764 AF210405 18 Enoploides longispiculosus AF210404 28S Litvaitis et al., 2000 Enoplus comunis AY854192 18S Cook et al., 2005 Enoplus brevis U88336 18S Aleshin et al., 1998 Enoplus meridionalis Y16914 18S Kampfer et al., 1998 AF210406 Litvaitis et al., 2000 Enoplolaimus sp 28S DQ077750 De Ley et al., 2005 Mesacanthion sp. AF210409 28S Litvaitis et al., 2000 Epacanthion sp. AF210407 28S Litvaitis et al., 2000 Anoplostoma rectospiculatum AY590149 18S Pegova et al., 2004 AY854194 DQ394752 Cook et al., 2005; Anoplostomatidae DQ394766 Anoplostoma sp. 18S Bhadury et al., 2006a,b (8 sequences) FJ040492 8 Holterman et al., unpublished FJ040491 AM235215 Anoplostoma viviparum AF317083 28S Lange, M. unpublished Anticomidae Anticoma sp. AY692344 18S 1 Parent et al., unpublished (1 sequence) AY854198 Cook et al., 2005; Oncholaimidae Viscosia viscosia 18S DQ394740 29 Bhadury et al., 2006 (29 sequences) Viscosia sp. FJ040494 18S; 28S Holterman et al., unpublished 61

AY854197 De Ley et al., 2005 DQ077779 Cook et al., 2005 DQ077751 Litvaitis et al., 2000 AF210427 AY866479; Shen et al., unpublished. Oncholaimidae sp. FJ040493 18S; 28S De Ley et al., 2005 DQ077753 Holterman et al., unpublished DQ077771 De Ley et al., 2005 Pontonema sp. 28S DQ077768 Pontonema vulgare AF04890 18S Aleshin et al., 1998 AF317080 Adoncholaimus thalassophygas AF317081 28S Lange, unpublished AF317082 DQ394725 AM236232 Bhadury et al., 2006b Adoncholaimus fuscus AM261963 18S; 28S Cook et al., 2005 AY854195 Litviatis et al., 2000 AF210398 DQ394790 DQ394788 Bhadury et al., 2007 Adoncholaimus sp. DQ394751 18S Bhadury et al., 2006 AF036642 AM236077 AY854196 Cook et al., 2005; Oncholaimus sp. AM234625 18S; 28S Bhadury et al., 2006a; AF210413 Litviatis et al., 2000.

Calyptronema sp FJ040503 18S 4 Holterman et al., unpublished Enchelidiidae AY854199 Cook et al., 2005; (4 sequences) Calyptronema maxweberi 18S; 28S AF210399 Litvaitis et al., 2000 Symplocostoma FJ040502 18S Holterman et al., unpublished Syringolaimus striatocaudatus AY854200 18S Cook et al., 2005 Ironidae Syringolaimus sp FJ040497 18S 8 Holterman et al., unpublished (8 sequences) Ironus sp FJ040496 18S Holterman et al., unpublished 62

AY146467 Mullin & Powers, unpublished. AY552970 AY919141 Ironus longicaudatus FJ40495 18S Holterman et al., unpublished Ironus dentifurcatus AJ966487 18S Meldal et al., 2007 Phanodermatidae DQ077781 Phanoderma sp. 28S 2 De Ley et al., 2005 (2 sequences) DQ077769 Halalaimus sp FJ040501 18S Holterman et al., unpublished Thalassoalaimus pirum FJ040500 18S Holterman et al., unpublished FJ040498 Oxystomina sp 18S Holterman et al., unpublished FJ040499 DQ080569 Oxystominidae Bastiania sp. 18S Powers et al., unpublished DQ080568 10 (10 sequences) AY284726 Bastiania gracilis 18S Holterman et al., 2006 AY284725 Odontolaimus chlorurus AY284723 18S Holterman et al., 2006 Mullin & Powers, unpublished. Odontolaimus sp AY146464 18S

DQ394804 Bhadury et al., 2006a; Tripyloides sp. 18S AY854202 Cook et al., 2005. Tripyloididae FJ040504 Holterman et al., unpublished 6 (6 sequences) Bathylaimus sp. AY854201 18S Cook et al., 2005; AM234519 Bhadury et al., 2006a Bathylaimus assimilis AJ966476 18S Meldal et al., 2007 Meldal et al., 2007 AJ966514 Holterman et al., unpublished Alaimus sp. FJ040489 18S; 28S Holterman et al., unpublished DQ077791 De Ley et al., 2005 Alaimidae AY146469 Holterman et al., unpublished Alaimus parvus 18S 12 (12 sequences) AY284738 Mullin & Powers, unpublished Alaimus cf. acutus AY146468 18S Mullin & Powers, unpublished Alaimus cf. arcuatus AY911879 18S Powers, et al., unpublished. AJ284742 Holterman et al., unpublished Paramphidelus sp 18S AJ284741

AJ284740 Holterman et al., unpublished Paramphidelus hortensis AJ284739 18S

Mullin, et al., unpublished Amphidelus cf. pusillus AY146470 18S

Rhabdonemanidae Rhabdodemania sp. AF210418 28S 1 Litvaitis et al., 2000 (1 sequence) Tobrilidae Tobrilus hopei DQ394886 18S 2 Sharma et al., 2006 (3 sequences) Tobrilus gracilis AJ966506 18S 1 Meldal et al., 2007

Actinolaimidae Neoactinolaimus sp AY146496 28S 1 Mullin and Powers, unpublished (1 sequence) AF317084 Lange unpubl.; AY854209 Cook et al., 2005; AM261975 Dichromadora sp. 28S; 18S Bhadury et al., 2006b; Bhadury AM261970 et al., 2007. Holterman et al., DQ394728 unpublished FJ040506 Atrochromadora microlaima AY854204 18S Cook et al., 2005 Atrochromadora sp. AM261973 18S Bhadury et al., 2007 Hypodontolaimus balticus AF318085 28S Lange, unpublished. Chromadora sp. AY854206 18S Cook et al., 2005 Chromadoridae AF210401 Litvaitis et al., 2000 Chromadora nudicapitata 28S; 18S 31 (31 sequences) AY854205 Cook et al., 2005 Chromadorina germanica AY854207 18S Cook et al., 2005 DQ077776 De Ley et al., 2005; Chromadorina sp. FJ040470 28S; 18S Holterman et al., unpublished FJ040471 Chromadorita cf. leuckarti FJ040473 18S Holterman et al., unpublished Chromadorita pharetra DQ394882 18S Sharma et al., 2006 Chromadorita tentabundum AY854208 18S Cook et al., 2005 Chromadoropsis vivipara AF047891 18S Aleshin et al., 1998 DQ394797 Bhadury et al., 2006 Neochromadora sp. 18S DQ394756 Cook et al., 2005

AY854210 Spilophorella sp DQ077766 28S De Ley et al., 2005. Spilophorella paradoxa AY854211 18S Cook et al., 2005 Ptycholaimellus sp. FJ040472 18S Holterman et al., unpublished Prochromadora sp EF591341 18S Holterman et al., 2008 AY854212 Cook et al., 2005 Cyatholaimidae sp. 18S; 28S AF210400 De Ley et al., 2005. DQ086657 Markmann & Tautz, 2005. Ethmolaimus pratensis FJ040475 28S; 18S Holterman et al., Unpublished AY593942 DQ394793 Bhadury et al., 2006a Cyatholaimidae sp. 18S; 28S DQ077782 De Ley et al., 2005 AY854219 Cook et al., 2005; Cyatholaimus sp DQ394758 18S Bhadury et al., 2006a AM234618 Paracyatholaimus intermedius AJ966495 18S Meldal et al., 2007 Cyatholaimidae DQ394767 27 Bhadury et al., 2006a; (27 sequences) DQ394755 Paracanthonchus sp 18S; 28S De Ley et al., 2005; DQ077754 Litvaitis et al., 2000; AF210414 Paracanthonchus caecus AF047888 18S Aleshin et al., 1998 DQ394730 DQ394763 Blaxter et al., 1998. Praeacanthonchus sp. DQ394765 18S Bhadury et al., 2006a. AF036612 AM234046 AF210416 Litvaitis et al 2000; Praeacanthonchus punctatus 28S; 18S AY854214 Cook et al., 2005; Pomponema sp. DQ077763 28S De Ley et al., 2005 Halichoanolaimus sp. EF591338 18S Holterman et al., unpublished. DQ394749 Selachinematidae Halichoanolaimus dolichurus 18S Bhadury et al., 2006 AM234629 13 (13 sequences) DQ077784 Latronema sp 28S De Ley et al., 2005 DQ077780

DQ077770 Richtersia sp 28S De Ley et al., 2005 DQ077762 De Ley et al., 2005 DQ077777 Choanolaimus sp. 28S; 18S Litvaitis et al., 2000 AF210400

FJ040467 AY284716 Holterman et al., 2008 Choanolaimus psammophilus 18S AY284715 AY284714 Holterman et al., unpublished Synonchiella sp. FJ040468 18S

Acantopharynx micans Y16911 18S Kampfer et al., 1998 Y16912 Catanema sp 18S Kampfer et al., 1998

Desmodora comunis AY854215 18S Cook et al., 2005 AM234628 Desmodora pontica 18S Bhadury et al., 2006a,b DQ394748 Desmodora ovigera Y16913 18S Kampfer et al., 1998 Desmodora sp. AF210403 28S Litvaitis et al., 2000 FJ040469 EF591339 AF210410 Holterman et al., 2008; Desmodoridae DQ394769 45 Litvaitis et al., 2000; (45 sequences) DQ394774 18S Metachromadora sp. Blaxter et al., 1998 DQ394762 28S Bhadury et al., 2006a DQ394757 De Ley et al., 2005 DQ077783 DQ077752 AF036595 AY854216 DQ394732 Cook et al., 2005 Metachromadora remanei DQ394796 18S Bhadury et al., 2006 DQ394795 AM234620 Metachromadora suecica DQ394781 18S Bhadury et al., 2006 66

AY927370 566bp Kampfer et al., 1998 Laxus oneistus AY927369 Mitochondrial

Y16919 18S Kampfer et al., 1998 Laxus cosmopolitus Y16918 18S

AY854217 Cook et al., 2005 Spirinia parasitifera DQ394726 18S Bhadury et al., 2006a AM236044 FJ429257 Spirinia elongata 18S Cavalcanti et al., unpublished EF527426 Kampfer et al., 1998 Eubostrichus topiarius Y16917 18S

Kampfer et al., 1998 Eubostrichus parasitiferus Y16916 18S

Kampfer et al., 1998 Eubostrichus dianae Y16915 18S

AY854210 Cook et al., 2005 Neochromadora sp. 18S DQ394797 Bhadury et al., 2006b AY927373 679bp Bulgheresi et al., 2006 AY927372 Stilbonema majum Mitochondrial Kampfer et al., 1998 AY927371 18S Y16922 Xyzzors sp. Y16923 18S Kampfer et al., 1998 EU768870; Robbea sp EU768871 18S Bayer et al., unpublished EU784735 Robbea hypermnestra Y16921 18S Kampfer et al., 1998 Leptonemella sp. Y16920 18S Kampfer et al., 1998 Epsilonematidae Epsilonematidae sp. EF591340 18S 1 Holterman et al., 2008, (1 sequence) AY854220 Cook et al., 2005 Molgolaimus demani 18S Microlaimidae AM261968 Bhadury et al., 2006a 10 (10 sequences) Calomicrolaimus sp. AY854219 18S Cook et al., 2005 Calomicrolaimus parahonestus AY854218 18S Cook et al., 2005

Monoposthia costata AY854221 18S Cook et al., 2005 AF210412 Monoposthidae Litvaitis et al., 2000. Monoposthia sp AF210411 28S; 18S (5 sequences) 5 Holterman et al., unpublished FJ040505 Nudora bipapillata AY854222 18S Cook et al., 2005 Desmoscolex sp. EF591342 18S Holterman et al., 2008, Desmoscolecidae DQ077785 3 De Ley et al., 2005 (3 sequencias) Tricoma sp 28S AF210426 Litvaitis et al., 2000. Cyartonematidae Cyartonema elegans AY854203 18S 1 Cook et al., 2005 (1 sequence) DQ086657 Ethmolaimidae Markmann & Tautz, 2005 Ethmolaimus pratensis FJ040475 28S; 18S 3 (3 sequences) Holterman et al., unpublished AY593942 AJ966482 AM748759 Meldal et al., 2007; Dos Santos Diplolaimella dievengatensis 18S, COI AM748763 et al., 2008 AM748760 AM748757; Diplolaimelloides oschei COI; 18S Dos Santos et al., 2008 AM748761 AM748758 Diplolaimelloides delyi COI, 18S Dos Santos et al., 2008 AM748762 AM748756 Dos Santos et al., 2008 Monhysteridae Diplolaimelloides meyli AF036644 COI; 18S Blaxter et al., 1998 (132 sequences) AF036611 132 Diplolaimelloides sp EU551671 18S Guilherme et al., unpublished. Tridentulus sp. AJ966507 18S Meldal et al., 2007 AY593936 Holterman et al., unpublished Eumonhystera filiformes AY593937 18S; 28S Markmann and Tautz, 2005 DQ086658 Eumonhystera cf. simplex AY284692 18S Holterman et al, 2006 Eumonhystera cf. similis AY284691 18S Holterman et al, 2006 Monhystera riemani AY593938 18S Holterman et al., unpublished Sphaerolaimidae Sphaerolaimus gracilis AY854227 18S Cook et al., 2005 (13 sequences) Sphaerolaimidae hirsutus DQ394798 18S 13 Cook et al., 2005

DQ394792 Bhadury, et al., unpublished DQ394889 DQ394778 DQ394772 DQ394773 AY854228 AM234622 DQ394779; Bhadury et al., 2006; DQ394887 Sphaerolaimus sp. 18S; 28S Sharma et al., 2006 DQ394800 Litvaitis et al., 2000 AF210423 DQ408759 Siphonolaimidae Astomonema sp DQ408760 18S 3 Musat et al., 2007 (3 sequences) DQ408761 AY854223 DQ394801 Cook et al., 2005 Daptonema hirsutum 18S DQ394784 Bhadury et al., 2006b AM236231 AY854225 Cook et al., 2005 Daptonema oxycerca 18S DQ394760 Bhadury et al., 2006a,b AY854226; DQ394744 Cook et al., 2005 Daptonema setosum 18S DQ394768 Bhadury et al., 2006b. AM234045 Xyalidae AY854224 30 Cook et al., 2005 (30 sequences) Daptonema normandicum 18S DQ394759 Bhadury et al., 2006 Daptonema procerus AF047889 18S Aleshin et al., 1998 Daptonema matrona EF436228 18S Neres et al., in press DQ394782 Bhadury et al., 2006. Daptonema sp. AM234624 18S Holterman et al., unpublished FJ040463 DQ394754 Bhadury et al., 2006; DQ394794 Theristus acer 18S; 28S Meldal et al., 2007 AJ966505 Litvaitis et al., 2000 AF210425 69

AM234627 AY284695 Theristus agilis AY284694 18S Holterman et al., 2006 AY284693 DQ394773 Bhadury et al., 2006 Theristus sp. AF210424 18S; 28S Litvaitis et al., 2000 FJ040464 Holterman et al., unpublished Metadesmolaimus sp. AJ966491 18S Meldal et al., 2007 Xyala sp. DQ077761 28S De Ley et al., 2005 EF591336 Linhomoeidae sp. 18S Holterman et al., 2008. EF591337 Linhomoeus sp DQ077772 28S De Ley et al., 2005 Desmolaimus zeelandicus AY854229 18S Cook et al., 2005 EF591332 Desmolaimus sp. 18S Holterman et al., 2008. EF591333 AM235216 Paralinhomoeus sp. 18S Bhadury et al., 2006 DQ394745 DQ394739 DQ394803 Terschellingia sp. 18S Bhadury et al., 2006 DQ394771 DQ394775 AY854230 105 Linhomoeidae AM941279 (105 sequences) AM941225 DQ394776 DQ394764 DQ394761 Terschellingia longicaudata DQ394753 Cook et al., 2005 18S (94 sequences) DQ394747 Bhadury et al., 2006 DQ394741 DQ394737 DQ394736 DQ394729 DQ394885 AM261974 70

AM234716 AY854230

AY854232 DQ394780 Cook et al., 2005 Axonolaimus helgolandicus 18S DQ394750 Bhadury et al., 2006 AM236598 EF591331 Holterman et al., 2008, Axonolaimus sp. FJ040462 18S

FJ040461 Ascolaimus sp DQ077749 28S De Ley et al., 2005 Cook et al., 2005. AY854231 Axonolaimidae Ascolaimus elongatus Holterman et al., 2008, DQ394738 18S 21 (21 sequences) Bhadury et al., 2006 AM234617

EF591330 Ascolaimus cf. elongatus 18S Holterman et al., unpublished FJ040460 Parodontophora sp. AM234630 18S Bhadury et al., 2006 Diplopeltula sp. EF591329 18S Holterman et al., unpublished FJ040459 De Ley et al., 2005 Odontophora sp DQ077756 28S; 18S Holterman et al., unpublished DQ077758 Odontophora rectangula AY854233 18S Cook et al., 2005 AM261962; DQ394727; Bhadury et al., 2006b; DQ394883 Sharma et al., 2006; DQ394786 Sabatieria sp. 18S, 28S Cook et al., 2005 DQ394785 Litvaitis et al., 2000 Comesomatidae AY854238 32 (32 sequences) AY854239 AF210420 EF591335; AM234623 Holterman et al., 2008; Sabatieria pulchra 18S DQ394746 Bhadury et al., 2006 FJ040466 71

DQ394770 AY854237 Sabatieria punctata AY854236 18S Cook et al., 2005 AY854235 AY854234 DQ394742 Cook et al., 2005 Sabatieria celtica 18S DQ394734 Bhadury et al., 2006 AM234626 AF210421 Setosabatieria sp. 28S Litvaitis et al., 2000. AF210422 AY854240 Bhadury et al., 2006 Setosabatieria hilarula AM236043 18S Cook et al., 2005 DQ394743 Dorylaimopsis metatypicus DQ394884 18S Sharma et al., 2006 Dorylaimopsis punctata AM234047 18S Bhadury et al., 2006 Comesoma sp. AF210402 28S Litvaitis et al., 2000 Diplopeltidae Diplopeltula sp. EF591329 18S 1 Holterman et al., 2008 (1 sequence) FJ040458 Leptolaimus sp EF591324 18S Holterman et al., unpublished

EF591323 Aphanonchus cf. europeus EF591319 18S Holterman et al., 2008 FJ040457 Leptolaimidae Deontolaimus papillatus 18S Holterman et al., 2008 EF591322 10 (10 sequences) EF591325 Camacolaimus sp. 18S Holterman et al., 2008 EF591327 Procamacolaimus sp. EF591326 18S Holterman et al., 2008 Onchium sp. EF591328 18S Holterman et al., 2008 Paraplectonema pedunculatum EF591320 18S Holterman et al., 2008 Ceramonematidae Ceramonematidae sp. DQ077773 28S De Ley et al., 2005 2 (2 sequences) Pselionema sp. AF210417 28S Litvaitis et al., 2000 Odontopharyngidae Odontopharynx sp. AB189984 28S 1 De Ley et al., 2005 (1 sequence) Rhabditidae Pellioditis marina* AJ867447; COI, ITS, 28S 273 Derycke et al., 2005

(273 sequences) (263 sequences) AJ867057 AM399037 Pellioditis mediterranea* AM399068 28S; COI Derycke et al., 2008 (7 sequences) AM398833 Pellioditis ehrenbaumi* AJ867056 COI, 18S Derycke et al., 2007 AJ867073 Rhabditis nidrosiensis AM399067 28S Derycke et al., 2008

Table 2. List of new marine nematode taxa with molecular data reported on from Pacific and South Atlantic produced in this survey.

Family Genus/Species Site Genes Acession Number Coordinates 18S 28S GU139748 (18S) 28°14'21" Metoncholaimus sp PF X X GU139767 (28S) 114° 6' 62" GU139747 (18S) 24° 9' 62" Oncholaimus sp LP X X GU139766 (28S) 110°18' 00" ONCHOLAIMIDAE GU139749 (18S) 29°37' 72" Viscosia sp1 SCA X X GU139768 (28S) 115°29' 62" 21º10’ 57” Viscosia sp2 CB - X GQ871207(28S) 40º 28’ 33”

33°42′62″ Oncholaimus aff. problematicus BC - X GU003901(28S) 118°02′76″ GU139750 (18S) 31°41' 8" RHABDODEMANIIDAE Rhabdodemania sp SC X X GU139769 (28S) 114°30' 31" GU003893 (28S) GU003906 (28S) 33°42′62″ Enoploides sp1 BC - X GU003908 (28S) 118°02′76″ GU003912 (28S) GU139765 (18S) 31°13' 41" Enoploides sp2 SF X X GU139784 (28S) 114°52' 48" GU139765 (18S) 31°41' 8" Epacanthion sp1 SC X X GU139784 (28S) 114°30'32” 21º10’57” Epacanthion sp2 CB - X GQ871202(28S) 40º,28’33” GU139757 (18S) 28°58'4" Mesacanthion sp1 BLA X X GU139776 (28S) 113°32'27" GU139756 (18S) 31°13'41.58" Mesacanthion sp2 SF X X GU139775 (28) 114°52'49" GU139758 (18S) 23°19'44" Mesacanthion sp3 CE X X GU139777 (28S) 110°10'33" THORACOSTOMOPSIDAE GU139754 (18S) 28°14'21" Mesacanthion sp4 PF X X GU139773 (28S) 114°6'14" GU139755 (18S) 29°37'22" Mesacanthion sp5 SCA X X GU139774 (28S) 115°29'2" 33°42′62″ Mesacanthion sp6 BC - X GU003905(28S) 118°02′76″ GU139761 (18S) 31°41'7.98" Mesacanthoides sp SC X X GU139780 (28S) 114°30'32" GU139764 (18S) 31°41'8" Oxyonchus sp SC X X GU139783 (28S) 114°30'32" GU139760 (18S) 31°41'8" Thoracostomopsidae SC X X GU139779 (28S) 114°30'32" GU139763 (18S) 31°41'8" Trileptium sp1 SC X X GU139782 (28S) 114°30'32" GU139762 (18S) 31°41' 8" Trileptium sp2 SC X X GU139781 (28S) 114°30'32" GU139753 (18S) 28°14'21" Trileptium sp3 PF X X GU139772 (28S) 114° 6'14" 31°41'8" ENCHELIDIDAE Pareurystomina sp SC X X GU139785 (28S) 114°30'32" GU139751 (18S) 31°41'8" TRIPYLOIDIDAE Bathylaimus sp SC X X GU139770 (28S) 114°30'32" 74

GU139752 (18S) 29°37'22" ENOPLIDA Enoplida SCA X X GU139771 (28S) 115°29' 2" 22º01'41” ANTICOMIDAE Anticoma sp CB - X GQ871205 (28S) 40º44'59” 22º01'41” Sabatieria sp1 CB - X GQ871204 (28S) 40º44'59” COMESOMATIDAE 33°42′62″ Sabatieria sp2 BC - X - 118°02′76″ 22º55'03” Daptonema sp CB - X GQ871203(28S) 42º00'55” 33°42′62″ Daptonema paraistopiculoides BC - X GU003897(28S) 118°02′76″ XYALIDAE 33°42′62″ Rhynchonema sp BC - X - 118°02′76″ GU003909(28S) 33°42′62″ Gonionchus sensibilis BC - X GU003910(28S) 118°02′76″ 21º10’57” Monoposthia sp CB - X GQ903379(28S) 40º28’33” MONOPHOSTHIIDAE 21º10’57” Nudora sp CB - X GQ871206(28S) 40º28’33” Spilophorella sp BC - X GU003892 (28S) CHROMADORIDAE 33°42′62″ Dichromadora cucullata BC - X GU003894(28S) 118°02′76″ Spirinnia parasitifera BC - X GU003895(28S) DESMODORIDAE GU003899(28S) 33°42′62″ Sigmophoranema sp BC - X GU003911(28S) 118°02′76″ GU003896(28S) 33°42′62″ AXONOLAIMIDAE Odontophora variabilis BC - X GU003897(28S) 118°02′76″ GU003900(28S) 33°42′62″ Terschellingia sp BC - X - 118°02′76″ LINHOMOEIDAE 33°42′62″ Paralinhomoeus sp. BC - X GU003904(28S) 118°02′76″ 33°42′62″ LEPTOLAIMIDAE Onchium sp. BC - X GU003908(28S) 118°02′76″ * New marine nematode barcode sequences produced in this survey submitted to GenBank. Gulf of California, Mexico: La Paz (LP), Bahia Los Angeles (BLA), San Felipe (SF), Santa Clara (SC); Pacific Coast, Mexico: Playa del Faro (PF), San Carlos (SCA) and Cerritos (CE); Bolsa Chica, California USA (BC); Campos Basin, Brazil (CB).

For the 28S gene, we produced almost the same number of barcode sequences as those present in GenBank. The 18S gene is the most barcoded gene used in molecular studies, with approximately 72% of sequences available in the public databases, whereas cytochromo oxidase I and internal transcribe spacer are less frequently used and sequenced within marine nematodes (Fig. 1).

200 180 160 140 Genbank

120 100 species 80 of 60 40

Number 20 0 18S 28S COI ITS

Markers

Number of species barcoded Number of species barcoded in this study

Fig 1. Numbers of marine nematodes taxa with sequences deposited in GenBank in relation of molecular markers.

DISCUSSION The main objectives of this study were to review and discuss the current status of molecular information of marine nematode taxa as well as report new DNA sequences providing tags for DNA barcoding, which could help the identification of unknown nematode species and used in phylogenetic and systematic studies. Recent studies addressing these issues by targeting species-rich groups in tropical environments and by conducting a comprehensive analysis based on DNA have the potential to facilitate both the identification of known species and the discovery of new ones (Hajibabaei et al., 2006). The DNA-based inventory was used to estimate where nematodes sequences were produced in a global scale and which genes (gene diversity) have been used for marine nematodes. Despite the availability of sequences deposited in databases, this number of sequences appears to be far from that required to cover the whole diversity of nematode marine fauna in a global scale. Some families of marine nematodes as Rhabditidae and Monhysteridae have a high number of barcoded sequences available with 273 and 132, respectively. This is due largely to the haplotypes of Pellioditis marina and Diplolaimelloides sp. included from population genetic surveys using mainly COI marker (Derycke et al. 2005; Dos Santos et al. 2008) (Table 1). In contrast, several families, such as Rhabdodemaniidae, Epsilonematidae, Diplopeltidae and 76

others, are represented in some cases by just one sequence in GenBank. This does not reflect the large number of species in these families as described in the literature, and shows that it is necessary to increase DNA barcoding studies on marine nematodes species/families that are represented by few barcode sequences in GenBank. In general, DNA-barcoding sequences for marine nematodes have been produced mainly in temperate regions restricted to Europe, Asia and North America. On the other hand, tropical marine diversity is increasingly being described using traditional morphological methods. However, efforts in applying novel molecular approaches, such DNA-barcoding, are lagging behind. This study reports new 28S sequences of seven marine nematodes species from a tropical region in an important petroleum basin in the Brazilian coastal area, whereas from temperate regions are present fiftheen new records (Table 2). Perhaps, the most important point to address regarding to this issue is in answering the question: “Who will use these new nematode sequences?” Fortunately, the breadth of interests of the community of nematologists suggests that each sequence might be of interest to multiple researchers. For example, the sequence of a human- parasitic species would obviously be of interest to those laboratories that work on the nematode species in question and also to clinicians interested in the pathology (Bird et al., 2005) whereas our new records of marine nematodes can be useful for molecular taxonomy and biodiversity programs. New molecular tools can generate millions of reports of the occurrence of organisms in a matter of hours (Margulies et al., 2005). Additionally, routine methods will be required ultimately to develop screening methods such as massively parallel sequencing, speeding up the barcoding process to increase the amount of sequences available in public databases (Shendure et al., 2004; Patterson et al., 2006). Similar to the spectacular diversity currently being discovered in prokaryotes (see e.g. Torsvik et al. 2002) and protists (Countway et al. 2005), MOTU (molecular operational taxonomic units) surveys of nematodes can play a very useful role in generating first-line data on “operational” biodiversity in different sites and habitats, thereby providing an objective basis for selecting samples that need to be prioritized for identification and description of species.

Recent developments in high-throughput sequencing, combined with new ancient-DNA technologies suggest that a DNA-based inventory, side by side with the ‘‘Tree of Life’’ approach, seems destined to lead to a new era in the study of past and present biodiversity (Lambert et al. 2005). One major drawback of the COI gene is its difficult amplification within the phylum Nematoda. Previous studies (Derycke et al. 2005, Derycke et al. 2006) illustrate that more than one set of primers will be required for COI barcoding in this phylum. A generation of new markers of shorter fragments of COI, i.e., minibarcode (UP primers set) could also be effective tools for the identification of a wide number of animal taxa (Meusnier et al. 2008), however, this primer set was tested in marine nematodes showing high PCR success rates, but those sequences produced showed unreliable for discriminate phylogenetic relationships (Silva et al., unpublished data). A promising alternative for DNA-barcoding purposes in nematode groups for which COI has not worked seems to be the SSU and LSU rDNA genes (Blaxter, 2004). Other researchers have suggested that alternative loci for mitochondrial genes might also serve as a basis for identification and taxonomy. In this study, we developed new DNA tags that can be used for phylogeny, taxonomy and biodiversity purposes, and also increased the number of DNA sequences available for marine nematode, mainly for the 28S gene. We strongly advocate approaches that combine barcoding and traditional taxonomy (Integrative taxonomy), due to the necessity to produce more sequences and complement the information available in public databases for molecular, biodiversity and ecological surveys. In addition, barcoding can be applied in natural museum archival specimens increasing the knowledge of marine nematodes taxonomy throughout the world (Wandeler et al. 2007). Recent advances in DNA biotechnology offer a platform in a DNA-based taxonomy inventory for marine nematode taxa. Those technologies can drastically change our concept of what is feasible and practical (one analysis generates millions of sequence fragments in one week or even one day). It seems that generating DNA barcode sequences from almost any kind of soil/sediment sample will become much more efficient (Kahvejian et al. 2008).

Several academic and commercial efforts are developing new ultra-low-cost sequencing (ULCS) technologies that aim to reduce the cost of DNA sequencing. In this scenario, it is probable that these technologies might be used in developing countries where the main goal could be to enhance the available sequences in public databases, making possible a comprehensive identification system for marine nematode taxa (Shendure et al. 2004). An integration effort in combining taxonomic, molecular and biology approaches in marine nematodes is necessary to develop an identification system that uses a series of aspects of nematode life to create a molecular taxonomic large-scale inventory. Bird et al. (2005) suggested a concept of “Nematode vitae” that promote the sequencing of the most informative set of nematodes genomes as basic approach to address questions in biology and supply a database to document features that support their use in comparative genomics across the phylum. We propose a concept idea named “Nematode Identification Card” (NIC) which would include a general description of the most important aspects of nematode life history, integrating aspects such as biology, ecology and taxonomy with molecular sequences deposited in public databases (Fig. 2). Public databases of nematodes were established to provide access of information-mining tools for genomic-scale data mainly for parasitic nematodes. However, marine nematode surveys might involve the integration of various data sources to solve biological problems. In contrast, different types of data such as taxonomy, molecular ecology, behavior and biochemical parameters will give us more information than a single one. Currently, it is hard to find, understand, reconcile and analyze data because as a user, one needs to visit all data sources related to the problem and select the relevant data. Hence, integration approaches can lead to the preparation of a single website based on marine nematode database that provides effective access to a consistent view of data from many sources through an intuitive and useful interface for nematological studies (Stein, 2003; Martin et al. 2008).

Fig 2. Flowchart depicting mainly web databases for Nematoda that can be used for molecular inventory surveys and concept of nematode identification card (NIC). Weblinks: http://www.nematode.net (Molecular sequence database Center); http://nematol.unh.edu/ (Digital frames and molecular database); http://nemys.ugent.be/ (Taxonomic database of marine nematode taxa); http://www.wormbase.org/ (Database of behavioral and structural anatomy of C. elegans); http://www.wormimage.org (Databases of electron micrographs and associated data mainly with C. elegans).

At the same time, traditional methods for new species descriptions should continue to be combined with DNA barcoding approaches to generate data to improve the information available on marine nematodes. A major impediment to advancing our 80

biodiversity knowledge is the paucity of digital species-occurrence data available online (Guralnick et al. 2007). A combination of DNA-barcoding, traditional taxonomy and the NIC concept are strongly needed to increase the knowledge of marine nematode biodiversity. The NIC website could be built with the advent of molecular tools and video capture editing system (De Ley & Bert, 2002). Integration between diverse sources of digital information as public databases and ecological aspects of mainly marine nematodes taxa is needed to resolve environmental problems and to help understand the complexity of life.

ACKNOWLEDGMENTS

The authors are indebted to Luciana Tosta for making the diagrams that illustrate this paper. Mr. Félix Nonnemacher for revision of English.

REFERENCES

ALESHIN, V.V., KEDROVA, O.S., MILYUTINA, I.A., VLADYCHENSKAYA, N.S., PETROV, N.B. (1998). Relationships among nematodes based on the analysis of 18S rRNA gene sequences: molecular evidence for monophyly of chromadorian and secernentian nematodes. Russian Journal of Nematology 6, 175-184. BIRD, D.M., BLAXTER, M.L., MCCARTER, J.P., MITREVA, M., STERNBERG, P. W., THOMAS, W. K. (2005). A White Paper on Nematode Comparative Genomics. Journal of Nematology. 37, 408–416. BHADURY, P., AUSTEN, M. C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS A.D., SMERDON, G.R (2006a) Molecular detection of marine nematodes from environmental samples: overcoming eukaryotic interference. Aquatic Microbial Ecology 44, 97–103. BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS, A.D., SMERDON, G.R. (2006b). Development and evaluation of a DNA-barcoding approach for the rapid identification of nematodes. Marine Ecology Progress Series 320, 1–9.

BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS, A.D., SMERDON, G.R. (2007). Exploitation of archived marine nematodes— a hot lysis DNA extraction protocol for molecular studies. Zoologica Scripta 36, 93–98. BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD, P.J.D., ROGERS, A.D., SMERDON, G.R. (2008). Evaluation of combined morphological and molecular techniques for marine nematode (Terschellingia spp.) identification. Marine Biology 154, 509–518. BLAXTER, M.L., DE LEY, P., GAREY, J.R., LIU, L. X., SCHELDEMANN, P., VIERSTRAETE, A., VANFLETEREN, J.R., MACKEY, L.Y., DORRIS, M., FRISSE, L.M., VIDA, J.T., THOMAS, W.K. (1998). A molecular evolutionary framework for the phylum Nematoda. Nature 392, 71–75. BLAXTER, M. (2003). Molecular systematics: Counting angels with DNA. Nature 421, 122-124. BLAXTER, M.L. (2004). The promise of DNA taxonomy. Philosophical Transactions Royal Society London B 359, 669-679. BLAXTER, M., MANN, J., CHAPMAN, T., THOMAS, F., WHITTON, C., FLOYD, R., ABEBE, E. (2005). Deﬁning operational taxonomic units using DNA barcode data. Philosophical Transactions Royal Society B. 360, 1935-1943. CARVALHO, G. R. & HAUSER, L. (1994). Molecular genetics and the stock concept in fisheries. Reviews in Fisheries and Fish Biology, 4, 326-350. CLARK, B.R., GODFRAY, H.C.J., KITCHING, I.J., MAYO, S.J., SCOBLE, M.J. (2009). Taxonomy as an eScience. Philosophical Transactions Royal Society A 367, 953-966. COOK, A.A., BHADURY, P., DEBENHAM, N.J., MELDAL, B.H.M., BLAXTER, M.L., SMERDON, G.R., AUSTEN, M.C., LAMBSHEAD, P.J.D., ROGERS, A.D. (2005). Denaturing gradient gel electrophoresis (DGGE) as a tool for identification of marine nematodes. Marine Ecology Progress Series 291, 103–113. COOMANS, A. (2002). Present status and future of nematode Systematics. Nematology 4, 573–582. COUNTWAY, P.D., GAST, R.J., SAVAI, P., CARON, D.A. (2005). Protistan Diversity Estimates Based on 18S rDNA from Seawater Incubations in the Western North Atlantic. Journal of Eukaryotic Microbiology 52, 95–106.

DE LEY, P. & BERT, W. (2002). Video capture and editing as a tool for the storage, distribution and illustration of morphological characters of nematodes. Journal of Nematology 34, 296–302. DE LEY P. & BLAXTER M. (2004). A new system for Nematoda: combining morphological characters with molecular trees, and translating clades into ranks and taxa. Nematology Monographs and Perspectives 2, 633–653. DE LEY, P., DE LEY, I.M., MORRIS, K., ABEBE, E., MUNDO OCAMPO M., YODER, M., HERAS, J., WAUMANN, D., ROCHA-OLIVARES, A., BURR, A. H.J., BALDWIN, J.G., THOMAS, W.K. (2005). An integrated approach to fast and informative morphological vouchering of nematodes for applications in molecular barcoding. Philosophical Transition of the Royal Society 360, 1945–1958. DERYCKE, S., REMERIE, T., VIERSTRAETE, A., BACKELJAU, T., VANFLETEREN, J., VINCX, M., MOENS, T. (2005). Mitochondrial DNA variation and cryptic speciation within the free-living marine nematode Pellioditis marina. Marine Ecology Progress Series 300, 91–103. DERYCKE, S., BACKELJAU, T., VLAEMINCK, C., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS, T. (2006). Seasonal dynamics of population genetic structure in cryptic taxa of the Pellioditis marina complex (Nematoda: Rhabditida). Genetica 128, 307–321. DERYCKE, S., BACKELJAU, T., VLAEMINCK, C., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS T. (2007). Spatiotemporal analysis of population genetic structure in Geomonhystera disjuncta (Nematoda, Monhysteridae) reveals high levels of molecular diversity. Marine Biology 151, 1799–1812. DERYCKE, S., FONSECA, G., VIERSTRAETE, A., VANFLETEREN, J., VINCX M., MOENS T. (2008). Disentangling taxonomy within the Rhabditis (Pellioditis) marina (Nematoda, Rhabditidae) species complex using molecular and morphological tools. Zoological Journal of the Linnean Society 152, 1-15. DOS SANTOS, G.A.P., DERYCKE, S., FONSECA-GENEVOIS, V., COELHO, L.C.B.B., CORREIA, M.T.S., MOENS, T. (2008). Differential effects of food availability on population growth and fitness of three species of estuarine, bacterial- feeding nematodes. Journal of Experimental Biology Ecology 355, 27-40

FLOYD, R., ABEBE, E., PAPERT, A. & BLAXTER, M.L. (2002) Molecular barcodes for soil nematode Identification. Molecular Ecology 11, 839–850. FONSECA, G., DERYCKE, S. & MOENS, T. (2008). Integrative taxonomy in two free-living nematode species complexes. Biological Journal of Linnean Society 94, 737-753. GODFRAY, H.C.J. (2002). Challenges for taxonomy—the discipline will have to reinvent itself if it is to survive and ﬂourish. Nature 417, 17–19. GRASSLE, J.F. & MACIOLEK, N.J. (1992). Deep-sea species richness: Regional and local diversity estimates from quantitative bottom samples. American Naturalist 139, 313- 341. GURALNICK, R.P., HILL, A.W. & LANE, M. (2007). Towards a collaborative, global infrastructure for biodiversity assessment. Ecological Letters 10, 663-972. HADDRATH, O., BAKER A. J. (2001). Complete mitochondrial DNA genome sequences of extinct birds, ratite phylogenetics and the vicariance biogeography hypothesis. Proceedings Royal Society London B 268, 939–945. HAJIBABAEI M., DEWAARD J.R., IVANOVA, N.V., RATNASINGHAM, S., DOOH, R.T., KIRK, S.L., MACKIE, P.M., HEBERT, P.D.N. (2005). Critical factors for assembling a high volume of DNA barcodes. Philosophical Transactions of the Royal Society of London Series B 360, 1959–1967. HAJIBABAEI, M., JANZEN, D.H., BURNS, J.M., HALLWACHS, W., HEBERT, P.D.N. (2006). DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of Science 103, 968-971. HEBERT P.D.N., CYWINSKA, A., BALL, S.L. & DEWAARD, J.R. (2003a). Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B 270, 313–321. HEBERT, P.D.N., RATNASINGHAM, S. & DEWAARD, J.R. (2003b). Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Philosophical Transactions Royal Society London B 270, 96–99. HEBERT, P.D.N., PENTON, E.H., BURNS, J.M., JANZEN, D.H., HALLWACHS, W. (2004). Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of National Academic of Science of United States 101, 14812–14817.

HEBERT, P.D.N. & GREGORY, T.R. (2005). The promise of DNA barcoding for taxonomy. Systematic Biology 54, 852–859. HILLIS, D.M., MABLE, B.K. & MORITZ, C. (1996). Applications of Molecular Systematics: The state of the Field and a look to the future. In Molecular Systematics, 2nd ed., Hillis, D.M., Moritz, C. & Mable, B.K. (eds.), 515-543. HOLTERMAN, M., VAN DER WURV, A., VAN DEN ELSEN, S., VAN MEGEN, H., BONGERS, T., HOLOVACHOV, O., BAKKER, J., HELDER, J. (2006). Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution towards crown clades. Molecular Biology and Evolution 23, 1792–1800. HOLTERMAN, M., HOLOVACHOV, O., VAN DEN ELSEN, S., VAN MEGEN, H., BONGERS, T., BAKKER, J., HELDER, J. (2008a). Small subunit ribosomal DNA-based phylogeny of basal Chromadoria (Nematoda) suggests that transitions from marine to terrestrial habitats (and vice versa) require relatively simple adaptations. Molecular Phylogenetics and Evolution 48, 758-763. HOLTERMAN, M., RYBARCZYK, K., VAN DEN ELSEN, S., VAN MEGEN, H., MOOYMAN, P., PENA SANTIAGO, R., BONGERS, T., BAKKER, J., HELDER, J. (2008b). A ribosoma DNA-based framework for the detection and quantification of stress-sensitive nematode families in terrestrial habitats. Molecular Ecology Resources 8, 23-34. HUYNEN, L., MILLAR, C.D., SCOFIELD, R.P., LAMBERT, D.M. (2003). Nuclear DNA sequences detect species limits in ancient moa. Nature 425, 175–178. KAMPFER, S., STURMBAUER, C. & OTT, C.J. (1998). Phylogenetics analysis of rDNA sequences from adenophorean nematodes and implications for the Adenophorea-Secernentea controversy. Invertebrate biology 117, 29-36. KAHVEJIAN, A., QUACKENBUSH, J. & THOMPSON, J.F. (2008). What would you do if you could sequence everything? Nature Biotechnology 26, 1125-1133. KRESS, W.J., WURDACK, K.J., ZIMMER, E.A., WEIGT, L.A., JANZEN, D.H. (2005). Use of DNA barcodes to identify flowering plants. Plant Biology, 102, 8369-8374.

LAMBERT, D.M., BAKER, A., HUYNEN, L., HADDDRATH, O., HEBERT, P. D. N., MILLAR, C.D. (2005). Is a Large-Scale DNA-based Inventory of Ancienty Life possible? Journal of Heredity 96, 279-284. LAMBSHEAD, P.J.D. (1993). Recent developments in marine benthic biodiversity research. Oceanis 19, 5-24. LAMBSHEAD, P.J.D. (2004). Marine nematode biodiversity. In: Chen ZX, Chen WY, Chen SY, Dickson DW (eds) Nematology: advances and perspectives, vol 1: nematode morphology, physiology and ecology. CABI Publishing, Wallingford, pp 436-467. LITVAITIS, M.K., BATES, J.W., HOPE, W.D., MOENS, T. (2000). Inferring a classification of the Adenophorea (Nematoda) from nucleotide sequences of the D3 expansion segment (26/28S rDNA). Canadian Journal of Zoology 78, 911–922. MARKMANN, M. & TAUTZ D. (2005). Reverse taxonomy: an approach towards determining the diversity of meiobenthic organisms based on ribosomal RNA signature sequences. Phylosophical Transactions of Royal Society B 360, 1917– 1924. MARGULIES, M.M., EGHOLM, W.E., AIRMAN, S., ATTIYA, J.S., BADER, L.A., BEMBEN, J., BERKA, M.S., BRAVERMAN, Y.J., CHEN, Z., CHEN, S.B., DEWELL, L., DU, J.M., FIERRO, X.V., GOMES, B.C., GODWIN, W., HE, S., HELGESEN, C.H., HO, G.P., IRZYK, S.C., JANDO, M.L.I., ALENQUER, T.P., JARVIE, K.B., JIRAGE, J.B., KIM, J. R., KNIGHT, J.R., LANZA, J.H., LEAMON, S.M., LEFKOWITZ, M., LEI, J., LI, K. L., LOHMAN, H., LU, V.B., MAKHIJANI, K.E., MCDADE, M.P., MCKENNA, E.W., MYERS, E., NICKERSON, J.R., NOBILE, R., PLANT, B.P., PUC, M.T., RONAN, G.T., ROTH, G. J., SARKIS, J.F., SIMONS, J.W., SIMPSON, M., SRINIVASAN, K.R., TARTARO, A., TOMASZ, K.A., VOGT, G.A., VOLKMER, S.H., WANG, Y., WANG, M.P., WEINER, P., YU, R.F., BEGLEY,. ROTHBERG. J.M. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437, 376-380. MARTIN, J., ABUBUCKER, S., WYLIE, T., YIN, Y., WANG, Z., MITREVA, M. (2008). Nematode.net update: improvements enabling more efficient data mining and comparative nematode genomics. Nucleic Acids Research 37, 571-578.

MAY, R.M. (1988). How many species are there on Earth? Science. 241, 1441–1449. MELDAL, B.H.M., DEBENHAM, N.J., DE LEY, P., DE LEY, I.T., VANFLETEREN, J.R., VIERSTRAETE, A.R., BERT, W., BORGONIE, G., MOENS, T., TYLER, P. A., AUSTEN, M.C., BLAXTER, M.L., ROGERS, A.D., LAMBSHEAD, P.J.D. (2007). An improved molecular phylogeny of the Nematoda with special emphasis on marine taxa. Molecular Phylogenetic and Evolution 42, 622–636. MEUSNIER, I., SINGER, G.A.C., LANDRY, J. F., HICKEY, D.A., HEBERT, P.D.N., HAJIBABAEI, M. (2008). A universal DNA mini-barcode for biodiversity analysis. B.M.C Genomics 9, 214 MUSAT, N., GIERE O., GIESEKE, A., THIERMANN, F., AMANN R., DUBILIER, N. (2007). Molecular and morphological characterization of the association between bacterial endosymbionts and the marine nematode Astomonema sp. from the Bahamas. Environmental Microbiology 9, 1345-1353. NERES, P.F.,FONSECA-GENEVOIS V., TORRES, R.A.,CAVALCANTI, M.F., CASTRO, F.J.V., SILVA, N.R.R., RIEGER, T.T., DECRAEMER, W. Morphological and molecular taxonomy of a new Daptonema (Nematoda, Xyalidae) with comments on the systematics of some related taxa. Zoological Journal of the Linnean Society, in press. PAGE, R.D.M. (2008). Biodiversity informatics: the challenge of linking data and the role of shared identifiers. Briefings in Bioinformatics, 1-10. PATTERSON, D.J., REMSEN, D., MARINO, W.A., NORTON, C. (2006). Taxonomic indexing – extending the role of taxonomy. Systematic Biology 55, 363-373. PARK, L.K. & MORAN, P. (1994). Developments in molecular techniques in fisheries. Reviews in Fish Biology and Fisheries 4, 300-325. PLATT, H. & WARWICK, R. (1998). Free living marine nematodes Part II. British Chromadorids. Synopses of the British Fauna (new series) edited by Doris M. Kermack and R.S.K Barnes 38, 502pp. PEGOVA, A.N., KRASNOVA, E. & ALESHIN, V.D.V. (2004). Evidence from the small and large ribosomal RNA structure suggests that Anoplostoma rectospiculum Gal'tsova, 1976 (Nematoda: Anoplostomatidae) is a member of the superfamily Enoploidea, not Oncholaimoidea. Nematology 6, 413-421.

ROGERS, A.D. & LAMBSHEAD, P.J.D. (2004). Molecular studies of nematode diversity, past, present and future. In: Cook, R. & Hunt, D.J. (Eds). Proceedings of the Fourth International Congress of Nematology, 8 - 13 June 2002, Tenerife, Spain. Nematology Monographs and Perspectives Volume 2. Brill Academic Publishing. SAVOLAINEN, V., COWAN, R.S., VOGLER, A.P., RODERICK, G.K., LANE. R. (2005). Towards writing the encyclopedia of life: an introduction to DNA barcoding. Philosophical Transactions Royal Society B 360, 1805-1811. SHARMA, J., SUN, L., HOPE, W.D., FERRIS, V.R. (2006). Phylogenetic Relationships of the Marine Nematode Family Comesomatidae. Journal of Nematology 38, 229-232. SHENDURE, J., MITRA R.D., VARMA C., CHURCH, G.M. (2004). Advanced sequencing technologies: Methods and goals. Nature Reviews Genetics 5, 335-344. STEIN, L.D. (2003). Integrating Biological Databases. Nature Reviews 4, 337-345. TORSVIK, V., ØVREÅS, L. & THINGSTAD, T.F. (2002). Prokaryotic Diversity Magnitude, Dynamics, and Controlling Factors. Science 296, 1064 – 1066. WARWICK, R. M., PLATT, H. M., SOMERFIELD, P. J. (1998). Free living marine nematodes. Part III. Synopses of the British Fauna (new series) edited R.S.K. Barnes and J. H. Crothers. 53, 296pp. WILLIAMS, B.D., SCHRANK, B., HUYNH, C., SHOWNKEEN, R., WATERSTON, R. H. (1992). A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence tagged sites. Genetics 131, 609–624. WANDELER, P., HOECK, P.E.A., KELLER, L.F. (2007). Back to the future: museum specimens in population genetics. Trends in Ecology and Evolution 22, 634-642. WILSON, E.O. (2003). The encyclopedia of Life. Trends in Ecology and Evolution 18, 77–80.

Capítulo 4

Descrição de Cornurella gen nv.

(Desmodoridae, Nematoda) utilizando

parâmetros morfológicos.

Artigo em preparação para submissão à Hydrobiologia.

Silva, N. R. R.; Silva, M. C.; Esteves, A. M.; Decraemer, W.; Santos, M. T. C.

A genus Cornurella gen. n. (Nematoda, Desmodoridae, Filipjev, 1922) from Campos Basin, Rio de Janeiro, Brazil.

Neyvan Renato Rodrigues da Silva1,2, Maria Cristina da Silva2, André Morgado Esteves2, Wilfrida Decraemer3,4, Maria Tereza dos Santos Correia2. 1- Instituto Federal do Rio Grande do Norte, Campus Zona Norte, Rua Brusque 2926, Potengi, Natal – Rio Grande do Norte. 2- Centro de Ciências Biológicas, Universidade Federal de Pernambuco, Av. Prof. Professor Moraes Rêgo, s/n, Cidade Universitária, Recife, Brazil 3 Department of Biology, Ghent University, Ledeganckstraat 35; B-9000, Ghent, Belgium. 4 – Royal Belgian Institute of Natural Sciences, Vautierstraat 29, B-1000 Brussels, Belgium

Corresponding author: [email protected]

"This paper has not been submitted elsewhere in identical or similar form, nor will it be during the first three months after its submission to Hydrobiologia."

Abstract A new genus of the family Desmodoridae, Cornurella gen. n. has been described from a Campos Basin sea site, Rio de Janeiro, Brazil. It differs from the other genera of the family by the presence of a strong cephalic capsule with horn-like ornamentation and morphological character well distinguished from all other members of the order Desmodorida. The closest genus to Corrnurella gen. n. is Desmodorella Cobb, 1933: both genera exhibit strong cuticular annulations of the body wall ornamented with longitudinal rows of spines.

Keywords – Cornurella, Desmodoridae, Campos Basin, Brazil.

Introduction

The Brazilian Petroleum and Gas Company—PETROBRAS S.A.—started the “Campos Basin Deep Sea Environmental Project” in the Southeast of Brazil, coordinated by Centro de Pesquisa e Desenvolvimento Leopoldo A. Miguez de Mello (Petrobras Research Center, Rio de Janeiro, Brazil: CENPES) in 2001. Benthic studies, including the biodiversity of meiofauna, were carried out on the continental slope (Soares et al. 1999). The Order Desmodorida De Coninck, 1965 possesses a single suborder Desmodorina De Coninck, 1965 with two superfamilies Desmodoroidea Filipjev, 1922 and Microlaimoidea Micoletzky, 1922 (De Ley & Blaxter, 2002; Decraemer & Smol, 2006). Within the superfamily Desmodoroidea three families are recognized: the Desmodoridae Filipjev, 1922; Draconematidae Filipjev, 1918 and Epsilonematidae Steiner, 1927 (Lorenzen, 1994). Desmodorids are essentially marine nematodes, except for the largely freshwater genus Prodesmodora (Decraemer & Smol; 2006). Species of the family Desmodoridae possess a more or less brownish, largely cylindrical appearance but some taxa may have the neck region and mid-body region somewhat widened though never as pronounced as in the Draconematidae and Epsilonematidae (Decraemer & Smol, 2006). The Desmodoridae include six subfamilies differentiated from one another upon body cuticle (finely transversely striated to coarsely annulated), cephalic capsule (present or absent), position of amphideal fovea (far anteriorly to more posteriorly along the anterior pharyngeal region), structure of the buccal cavity and armature (present or absent), position of secretory-excretory pore in relation to the nerve ring and presence/absence of Cyanobacteria. At present the subfamily Desmodorinae Filipjev, 1922 contains 15 genera differentiated upon the following main diagnostic characters: ornamentation of body cuticle, head region (except lip region) with or without thickened cuticle forming a helmet, structure of cephalic helmet when present, position of amphideal fovea with relation to body annulations/striations and presence or absence of a cuticularized cephalic plate supporting the fovea and shape and length of pharyngeal (Decraemer & Smol, 2006). The subfamily Desmodorinae is mainly characterized by a transversely striated body cuticle, a set off cephalic helmet, amphideal fovea in general not surrounded by striation of body cuticle and usually not located on a cuticularized plate, buccal cavity armed with distinct teeth and pharyngeal

bulb round to elongate (Decraemer & Smol, 2006). Among the samples of Campos Basin, Rio de Janeiro, Brazil, a new genus Cornurella gen. n. with one new species was found and is described in current contribution. Dealing with fixed sediment material, species description was based upon the morphological species concept whereby phenotypic differences were considered as surrogates for underlying genetic differences.

Materials and methods Study area The Campos Basin is located on the south-western margin of the South Atlantic, between latitudes 21°30′ and 23°30′ S (Fig. 1). It occupies an area of 120.000 km2 and depth may reach 3.500 m. The hydrodynamic processes in this region are controlled by the Brazilian current, which reaches 200 meters. It is covered by fine continental sediment and a sandy fraction that is composed mainly of foraminifera tests (Soares- Gomes et al., 1999).

Figure 1. Study area emphasizing the station where Cornurella gen. n. was found. 93

Sampling and processing Sediment samples were collected on board of the Research vessel Gyre using a box corer (USNEL SPADE Corer - Ocean Instruments) with 0.25-m2 surface area. The corer was divided into 25 cells (Hessler & Jumars, 1974) from which meiofauna were subsampled. A core of 2 cm of internal diameter was inserted within the sediment to a depth of 10 cm. Each sediment subsamples were cut from 0-2cm sections fixed with formalin and stored in plastic containers. Nematode specimens used in this study were sampled at 25-m depth in Campos Basin (Rio de Janeiro, Brazil) station I1 (21º 10’ 57”S; 40º 28’33”W (figure 1). Nematodes were isolated by manual elutriation, as described by Boisseau (1957). Specimens were slowly transferred to glycerin (De Grisse, 1969). The methodology described by Cobb (1917) was adapted and used to mount the permanent slides. Measurements and drawings were made with an Olympus BX-51 optical microscope, with the aid of a drawing tube. Photographs were taken with a C–5050ZOOM Olympus digital camera. Molecular techniques were performed with Cornurella specimens using PCR and sequencing target genes (18S and 28S). However, we abandoned as a result of poor PCR amplification and unreliable sequences.

All the measurements are expressed in micrometers.

Abbreviations used in the text:

L: total length hd.: head diameter ceph. cap.: length of cephalic capsule abd: anal body diameter amphd. pos.: distance of amphidial fovea from anterior end amph.: amphideal fovea diameter amph.%: diameter of amphidial fovea expressed as percentage of the corresponding head diameter annul. ant.: width annules in anterior body region annul. mid.: idem distance between annulations in mid-body region annul. t.: idem distance between annulations in tail region mbd.: maximum body diameter; 94

ph: pharynx length nr.: distance of nerve ring from anterior body end nrph.%: expressed as percentage of pharynx length bulb.: pharyngeal bulb diameter cbd. bulb.: corresponding body diameter at level of pharyngeal bulb bulb.%: diameter bulb expressed as a percentage of corresponding body diameter spic.: spicule length measured along median line gub.: gubernaculum length t.: tail length testis: testis length outer. l.s.: outer labial setae length c.s.: cephalic setae length som. s.: somatic setae length cloac. s.: precloacal setae length hor. s.: setae inserted on thorn horn.: horn length v.: distance of vulva from anterior end V%: position of the vulva as percentage of total body length ovar. ant.: length of anterior ovary ovar. post.: length of posterior ovary a: L/mbd b: L/ph c: L/t c’: t/abd

Results Family Desmodoridae Filipjev, 1922 Subfamily Desmodorinae Filipjev, 1922 Genus Cornurella gen. n. Cornurella verae sp. n.

Subfamily Desmodorinae Micoletzky, 1924 (adapted from Verschelde et al., 1998 and Decraemer & Smol 2006)

Diagnosis. Desmodoridae. Cylindrical body with well-developed head capsule and short conical to long conico-cylindrical tail. Fine, short somatic setae arranged in six or eight longitudinal rows. Distinct body annuli slender (i.e short) to coarse. No special ornamentation or appendages. Distinct head capsule or helmet consisting of a short or long lip region usually with thickened cuticle, followed by a large main part with distinctly thicker inner layer of the cuticle, on which the fovea amphidialis and, if present, the subcephalic setae are located; cephalic setae are located either in the lip region and main part of the head capsule; the head capsule can either be smooth or partly to entirely ornamented with small vacuoles. Amphideal fovea in general not surrounds by striation/annulation of body cuticle and located on head region. A fine sutura can be visible between lip region and main part of the head capsule; the head capsule can either be smooth or partly to entirely ornamented with small vacuoles. Four cephalic setae located in front of or at the level of the anterior edge of the fovea amphidialis, subcephalic setae absent or present, when present few in number and mainly located posterior to the fovea amphidialis; few additional setae can be present when subcephalic setae are absent. Distinct fovea amphidialis cryptospiral to multispiral, seldom loop-shaped, of which the aperture amphidialis is equally sized with or smaller than the fovea amphidialis. Cuticle with transverse striae/annules except for the head region. Buccal cavity always armed with distinct large dorsal tooth and two (seldom one) subventral teeth. Cylindrical pharynx with muscular bulb round to elongate. Male reproductive system monorchic, short spicules arched, capitulum present, velum present but often obscure. Pore-like precloacal supplements can be present. Female reproductive system didelphic, amphidelphic with reflected ovaries.

Cornurella gen. n. Diagnosis. Body cuticle clearly annulated and ornamented with longitudinal rows of spines. Well demarked cephalic capsule with horn-like structures in each side of its base, a pair dorsally and one pair ventrally in front of posterior head border. Amphideal

fovea loop-shaped, lying on a cuticular plate; narrow fovea in females. Buccal cavity with one large dorsal tooth and two smaller ventro-sublateral teeth. Pharynx with well- developed rounded terminal bulb. Females with two opposed, antidromously reflexed ovaries. One anterior testis lying left of intestine in males. Precloacal region surrounded by setae and papillae. Long and filiform spicules. Gubernaculum small, without apophysis. Three caudal glands ending in a spinneret. Tail conical, terminal region without annulations.

Etymology: From the Latin word cornus, referring to the horn-like ornamentation at the base of cephalic capsule.

Table 1: Comparison of major morphological features among Cornurella gen. n. and other genera within Subfamily Desmodorinae.

Reference Cuticle Head Pharynx Amphideal Tail shape Pre-cloacal Copulatory Gubernaculum fovea supplements apparatus Tail tip Rod-shaped Cylindrical Papilloid Spicule strongly Acanthopharyngoides (Filipjev, 1918) Striated Helmet with bulb unispiral and a larger curved, cuticulariz elongated posterior. cephalated ed Short Spicule Proximal curved conical, short, hook plate No helmet, Short with some Presence of proximal Acanthopharynx Marion, 1870 Striated rounded cone- spiral bulb species warts end shaped with row Button- of spines shaped Cylindrical Spicule Dorsal Globular Twenty-four with curved apophysis Bolbonema Cobb, 1920 Striated capsule or Oval conical supplements spherical proximally smooth and bulb cephaleted Spicule Presence of two Cylindrical Spiral Conical slender, of four separate Croconema Cobb, 1920 Striated Long Capsule with bulb No papillae central dot elongated sharp and pieces. swelling curved Cryptospiral simple Short Spicule to Cylindrical conical to round Well develop multispiral No Desmodora De Man, 1889 Striated with end long proximally capsule (1-2 turns), supplements bulb conico- with fine some species cylindrical sharp ovoid Long Presence of Lateraly- Well develop Multispiral Short- spicules crurae Desmodorella Cobb, 1933 Striated Cylindrical ventral rows capsule 1,25-2 turns conical without of spines capitulum Spicule Plate-shaped curved, Echinodesmodora Blome, 1982 Striated No helmet Cylindrical Cryptospiral Conical Tubiliform cephalated proximally Cylindrical Cuticularize ? Metadesmodora Stekhoven, 1942 Striated No helmet Conical ? ? with bulb d plate Paradesmodora Stekhoven, 1950 Striated, Well develop Cylindrical spiral conical 9-11 pores in Spicule Paired lateral 98

cuticular cephalic capsule with thick ventral curved, plates rings terminal cuticle cephalated bulb Sexual dimorphism Spicule Cylindrical Open loop- Row of curved and shape in somatic with Psammonema Well-offset Striated prolonged males, Conical setae, ventral capitulum, Plate shaped Verschelde & Vincx, 1995 labial region tripartite end cryptospiral- row of thick velum and bulb to close setae present pointed loop-shape tips in females Spicule Cylindrical Ventral row Well develop blade-like Pseudochromadora Daday, 1889 Striated with ovoid Loop-shaped Conical of setae and Simple bar cephalic capsule and large bulb pappilae capitulum Spiral 1,25 Pseudodesmodora Boucher, 1975 Striated Helmet Cylindrical Conical ? ? ? turns Crescent shape in Row of Sibayinema Coarsely smooth Cylindrical male and Conical subventral ? ? Swart & Heynes, 1991 annulated circular in setae female Arcuated Setiform Spicule Stygodesmodora Blome, 1982 striated No helmet Cylindrical spiral simple conical papilae curved Cylindrical Multispiral Rounded Spicule Simple or not Zalonema Cobb, 1920 Striated pyriform (two turns or conical papillae triangular short present bulb more) Cylindrical Long setae, Very long Square with a with short setae spicules Cornurella gen. n. Striated broader cephalic Loop shape Conical simple terminal and groups without capsule bulb of papillae capitulum

Cornurella verae gen. n. sp. n. (Fig. 2, 3, 4, 5; Table 2).

Etymology: The specific name is in honor to Professor Dra. Verônica da Fonsêca-Genevois of the Federal University of Pernambuco, for her pioneering work in the field of meiobenthology in Brazil. Material examined: 8 males and 6 females. Holotype: 1 male, found in station I1 (21º 10’ 57”S, 40º, 28’33”W Campos Basin, Rio de Janeiro, Brazil, 25 m depth, 0–2 cm profile. Deposited in Museu Nacional do Rio de Janeiro, Brazil (MNRJ 340). Allotype: female found in station I1 (21º 10’ 57”S, 40º, 28’33”W Campos Basin, Rio de Janeiro, Brazil, 25 m depth, 0–2 cm. Deposited in Museu Nacional do Rio de Janeiro, Brazil (MNRJ 341). Paratypes: Campos Basin (Rio de Janeiro, Brazil) Continental slope station I1. Seven male paratypes (NM LMZOO–UFPE 143-150), five females paratypes (NM LMZOO–UFPE 151- 156) deposited at the Laboratório de Meiofauna no Departamento de Zoologia, Universidade Federal de Pernambuco. The all paratypes were found in 25 m depth, 0–2 cm. Juveniles: not found.

Description Males - Cylindrical body with both end regions attenuated. Cuticle, except in head region, annulated with annules in pharyngeal region slightly broader and in tail region slightly narrowing than on the rest of the body. Body annules ornamented with spines arranged in six longitudinal rows, beginning posterior to cardia. A set of three additional longitudinal rows of spines together provide a lateral differentiation on both sides of the body. Somatic setae distributed along the body. Strong cephalic capsule with anterior region presents a sutura dividing the cephalic capsule in two parts. Cephalic arrangement with six inner labial papillae, six outer labial setae, four cephalic setae and four subcephalic setae. Amphideal fovea loop-shaped on a cuticular plate. Two short setae ventrally and dorsally on the right side from same level of fovea, two pairs in each side of the fovea. Additionally, dorsally and ventrally setae on the thrown-like protrusion plus a longer sublateral setae at posterior end of fovea. Two pairs of two ventral and two dorsal horn-like structures situated on the base of cephalic capsule. Buccal cavity with one large dorsal tooth and two smaller ventro-sublateral teeth. Strong 100

muscular, cylindrical pharynx with rounded terminal bulb, occupying 75% of the corresponding body diameter. Nerve ring at 57% from anterior end. Cardia small. Secretory- excretory pore not observed. Reproductive system monorchic, with anterior outstretched testis at the left side of the intestine. Presence of twelve pairs of precloacal setae and a circle of papillae surrounding the cloacal opening. Very long, slightly curved, filiform spicules, slightly sclerotized, without capitulum, distally tapered to a pointed end. Gubernaculum simple, without apophysis. Three caudal glands. Tail conical, terminal region without annulations. Tubular spinneret.

101

Figure 2. Cornurella verae sp. n. (A) Head region; (B) Male overview; (C) Pharyngeal region; (D) Body Cuticle; (E) Copulatory apparatus, tail and caudal glands.

102

Figure 3. Cornurella verae gen. n. sp. n. (A) Male overview; (B) Pharyngeal region; (C) Anterior emphasizing amphideal fovea and horns; (D) Dorsal tooth; (E) Body cuticle with lateral differentiation; (F) Spicule, (G) Tail region.

103

Figure 4. Cornurella verae sp. n. (A) Female overview; (B) Head region; (C) Pharyngeal region; (D). Body Cuticle; (E) Vulva; (F) Tail region with caudal glands.

104

Figure 5. Cornurella verae sp. n. (A) Female overview; (B) Amphideal fovea, cephalic capsule and horns; (C) Dorsal tooth and subventral teeth; (D) Body Cuticle; (E) Vulva region (F) Tail region; (G) Reproductive system.

105

Table 2. Measurements of Cornurella verae gen n. sp. n. Measurements in µm.

Males Females Holo Para n=8 Allo Para n=6 Mean Range SD Mean Range SD L 1230 1285.9 762-1715 248.9 1104 1113 960-1312 134.15 Hd 18 18.2 15-21.6 2.2 24 21.8 15.6-24 2.69 ceph. cap. 30 23.8 18.6-30 3.1 33 24.6 19.8-33 4.09 amph pos. 12 6.1 4.2-12 2.2 7 3.0 1-7 1.95 Amph. 9 9.4 8.4-10.8 0.7 7.8 6.0 6-7.8 0.81 amph % 50 52.4 38.8-64 7.7 32.5 37.8 28-45 5.28 annul. ant. 3 2.3 1.8-3 0.5 3 3.0 2.4-3 0.27 annul. mid. 1.8 1.3 0.6-1.8 0.5 1.2 1.2-1.8 0.21 annul. t. 2.4 1.2 0.6-2.4 0.6 1.8 2.0 1.8-2 0.07 mbd 35.4 32.5 27-37.8 3.3 43.2 39.0 36.6-48.6 3.94 abd 28.2 28.5 26.4-37.8 3.4 25.8 28.0 19.2-30 3.70 Ph 143.4 138.1 120-164.4 14.0 139.6 156.5 116.4-160 16.44 Nr 76.8 72.8 43.8-91.2 14.9 84.6 48.0 64.2-96 30.19 nrph% 53 53.3 35-66 8.7 60 59.2 54-63 2.73 bulb 22.8 20.5 16.2-25.8 2.6 19.8 23.0 18-28.8 3.64 cbd bulb 28.2 28.7 25.8-33 2.3 29.4 33.0 26.4-43.8 5.33 bulb% 80 70.8 62-80 6.0 67 74.9 67-87 7.28 spic. 195 196.3 150.6-240 27.1 - 92.7 - 29.64 gub. 25.2 23.7 20.4-27.6 2.6 - 1113.1 - 134.15 T 96.6 96.9 78-106.8 15.5 167.8 21.8 72-167.8 2.69 372-1020 208. - - - - testis 872 762.7 6 outer l.s. 4.2 6.6 2.4-9 2.4 3 3 3-6 1.16 cef. s. 6 10.3 6-13.8 2.5 3.6 3.6 3.6-9 1.77 som.s. 10.2 10.7 8.4-12 1.3 9.6 9.6 8.4-12 1.17 cloac.s. 6 6.9 6-9 1.1 - - - - 9-12.6 Not visible Not 6.6-14 hor. s. 12 11.5 1.8 visible 2.46 hor. 9 10.0 7.8-12 1.4 6.6 6.6 6-9 1.18 A 34 40.1 23-53.9 9.9 25 25 23.5-29.9 2.11 B 8.5 11.2 6.3-11 6.2 7.9 7.9 7.9-8.9 0.31 C 12 13.1 8.7-14.4 2.1 16.2 16.2 8.3-16.2 2.39 c' 3.4 3.3 1.5-4.8 0.8 2.6 2.6 2.6-3.9 0.42 ovar.ant. - - - - 246.4 246.4 168-246.4 36.32 ovar. post. - - - - 256 256 160-320 53.69 V - - - - 654 654 478.8-824 116.77 V% - - - - 59 59 43-62.8 6.16

Females - General body shape largely similar to males, but with some morphometrical differences and sexual dimorphism in amphideal fovea and in arrangement of subcephalic setae and length cephalic setae (table 2). Amphideal fovea in female loop-shaped and narrow as compared to males. Strong cephalic capsule with six inner labial papillae, six outer labial setae and four cephalic setae. Subcephalic setae absent. On left and right side of the head, two

106

pairs are confusing of setae present at mid-fovea ventrolateral and dorsolateral setae. Horn- like protrusions present. Less somatic setae compared to male. Reproductive system didelphic, ovaries opposed, reflexed and left of intestine. No spermatheca observed. Vulva sclerotized. Tail conical.

Diagnosis

Cornurella verae gen nv sp. n. is characterized by its slender body (a=23-53.9), cuticle with strong annulations, longitudinal rows of spines and lateral differentiation. Horn-like structures present dorsally and ventrally at base of cephalic capsule followed a setae inserted at this level. Arrangement of anterior sensilla visible as a crown of six minute outer labial sensilla and a crown of four cephalic setae; the latter are in male accompanied by four subcephalic setae near their insertion base. At level of amphideal fovea additional subcephalic setae are present in both male and female. Amphideal fovea loop-shaped, larger in males than in females. Buccal cavity with one dorsal tooth and two ventrosublateral teeth Pharynx with posterior bulb. Males with long spicules slightly sclerotized and without capitulum. Tail conical.

Discussion RELATIONSHIPS Based upon a comparison of the diagnostic features of the genera within the subfamily, Cornurella gen. n. was considered most closely related to Desmodorella Cobb, 1933. Both genera share strong cuticular annulations of the body wall, ornamented with longitudinal rows of spines. The new genus differs from Desmodorella by possessing six longitudinal rows of spines along the body. Nevertheless, in the lateral field three additional longitudinal lines of spines are very close together like a “lateral differentiation”. The presence of well-developed cephalic capsule also resembles Desmodorella, but differs from it mainly because the new genus presents ornamentation in the cephalic capsule (horn-like structures) that is unique to the family and possesses two pairs of cephalic setae in the same level of the amphideal fovea. Other similarities between those genera are: sexual dimorphism in amphideal fovea; presence of one dorsal and two subventral teeth (Verschelde et al. 1998). The subfamily Desmodorinae possesses 15 genera listed in Table 1.

107

Cornurella gen. n. resembles Desmodorella in strong cuticular annulations and presence of cuticular ornamentation as longitudinal rows of spines, usually more numerous than the six longitudinal lines of spines in the new species and not restricted to the post cardiac region. Twelve longitudinal rows of spines were observed in Desmodorella tenuispiculum by Boucher (1975), those rows alternated with six longitudinal rows of somatic setae. This type of spines or setae as lateral differentiation is recorded also in other genus like Sibayinema Swart & Heyns, 1991, but in Croconema Cobb, 1920 there are ridges, spines and the setae are arranged in six to eight longitudinal rows. Lateral cuticular differentiations visible as lateral alae have been described in Pseudochromadora Daday, 1899 and Psammonema Verschelde & Vincx, 1995 (Verschelde et al. 2006). In Desmodorella balteata and D. spineacaudata, described by Verschelde et al. (1998), the spines of the two lateral pairs of longitudinal rows are conspicuously more developed, giving at first view the false impression of the presence of lateral alae called by the authors “false lateral alae”. The head set off as a conspicuous cephalic capsule or helmet is very common feature in Desmodorida Decraemer & Smol (2006). Cornurella gen. n. also presents a strong cephalic capsule divided in two parts. In Croconema, the cephalic capsule presents a distinct sutura between lip region and main region (Verschelde et al., 2006). In Cornurella gen. n. presents a similar structure in the buccal armature with a distinct sutura that is retractable. The same authors described Pseudochromadora galeata and P. securis and also called sutura a similar structure on the head that separated the cephalic capsule in two or three parts. In this manuscript the same name sutura was also adopted for the division of cephalic capsule. Verschelde et al. (1998) in a review of Desmodora and descriptions of new desmodorids amended a diagnosis of the genus Desmodorella and described conical head capsule and lip region separated by a sutura. Yet, species described here differ from the other species in the ornamentation of cephalic capsule (horn-like structures) that is unique within these genera with additional setae in the cephalic capsule (Table 1). Another important feature is the presence of sexual dimorphism in both species of the genus Cornurella gen. n. This sexual dimorphism is related to loop-shaped amphids: narrower in females than in males. According to Verschelde et al. (2006) sexual dimorphism related to the amphids within the subfamily Desmodorinae can be found in Pseudochromadora, Sibayinema and Croconema. The copulatory apparatus of the new genus is very similar to Desmodorella, composed by long filiform spicules and short gubernaculum. The presence of precloacal setae was also 108

observed in some species of Desmodorella (D. tenuispiculum, D. balteata, D. spineacaudata). According to Verschelde et al., (1998) the precloacal setae present in D. balteata resemble those found in males of most species of the genus Pseudochromadora. The circle of papillae that surround the cloaca in Cornurella gen. n do not appear in any description of valid Desmodorella species, but the amended diagnosis made for the genus Pseudochromadora by Verschelde et al. (2006) described that almost all males (only one exception) have copulatory thorns.

Key to genera of the Desmodorinae (adapted from Decraemer & Smol, 2006)

1. No cephalic helmet...... …..……....…...... 2 Cephalic helmet present………...... 5

2. Amphideal fovea on a cuticularized plate...... 3 Amphideal fovea not on a cuticularized plate...... 4

3. Striation of body cuticle starts posterior to the amphideal fovea...... Metadesmodora Striation of body cuticle starts at level of amphideal fovea...... Stygodesmodora

4. Amphideal fovea completely surrounded by striation of body cuticle...... Echinodesmodora Amphideal fovea partially surrounded by striation of body cuticle...... Paradesmodora

5. Cephalic helmet with horns at the base...... Cornurella Cephalic helmet without horns at the base...... …...... ……...………….6

6. Amphideal fovea on a cuticularized plate...... 7 Amphideal fovea not on a cuticularized plate...... 8

7. Cephalic helmet with cuticularized plates; unispiral amphideal fovea; two or more ventrosublateral tooth...... …………………...... …..Acanthopharynx Cephalic helmet different; spiral amphideal fovea with 1.25 turns; a single small ventrosublateral tooth...... Pseudodesmodora

8. Striated body cuticle with longitudinal ornamentation...... 9 Striated body cuticle without longitudinal ornamentation...... 10

9. Body cuticle with longitudinal rows of ridges or spines; sub-cephalic setae present; amphideal fovea spiral with at least 1.5 turns...... Desmodorella Body cuticle with longitudinal rows of brush-like organs and lateral differentiation; subcephalic setae absent; amphideal fovea crescent-shaped in male, circular in female...... Sibaynema

10. Cephalic helmet longer than wide, with numerous sub-cephalic setae arranged in three or more rows...... Croconema

109

Cephalic helmet different; sub-cephalic setae absent or when present less numerous and different arrangement...... 11

11. Body cuticle with differentiated lateral alae...... 12 Lateral alae absent...... 13

12. Lateral alae thin, beginning at anterior third of pharynx; buccal cavity with denticles...... Psamonema Lateral alae thicker, beginning posterior to pharynx; denticles absent...... Pseudochromadora

13 Cephalic helmet globular; four cephalic setae at base of helmet...... Bolbonema Cephalic helmet with different shape; cephalic setae inserted more anteriorly...... 14

14. Pharyngeal bulb elongated, about half as long as the pharynx...... Acanthopharynx Pharyngeal bulb shorter...... 15

15. Amphideal fovea multispiral (at least two turns); sub-cephalic setae present...... Zalonema Amphideal fovea cryptospiral or spiral with less turns; sub-cephalic setae present or absent...... …Desmodora

Acknowledgements We gratefully thank the Brazilian Petroleum and Gas Company (PETROBRAS S.A.) for providing biological material for taxonomic project included on the Brazilian deep-sea research. Mr. Félix Nonnemacher for English revision.

References

Blaxter, M. L., de Ley, P., Garey, J. R. & Liu, L. X., Scheldemann, P., Vierstraete, A., Vanfleteren, J. R., Mackey, L. Y., Dorris, M., Frisse, L. M., Vida, J. T. & Thomas, W. K. 1998. A molecular evolutionary framework for the phylum Nematoda. Nature. 392: 71– 75. Boisseau, J. P. 1957. Techniques pour l’etude quantitative de la faune interstitielle des sables. Comptes Rendus Du Congrés Des Sociétés Savantes de Paris et Des Départments. 1957: 117-119. Cobb, N. A. 1917. Notes on nemas. Intra Vitam color reactions in nemas. Contributions to a Science of Nematology. 5: 120–124. De Grisse, A. T. 1969. Redescription ou modification de quelques techniques utilisées dasn l`étude des nématodes phytoparasitaires. Mededelingen Rijksfakulteit Landbouwwetenschappen Gent. 34: 351–369.

110

De Ley, P., Blaxter, M. L. 2002. Systematic position and phylogeny. In: Lee, D. (Ed.), The Biology of Nematodes. Harwood Academic Publishers, Reading, 1–30. Decraemer, W., Smol, N. 2006. Orders Chromadorida, Desmodorida and Desmoscolecida. In Eyualem-Abebe, W. Traunspurger & I. Andrássy. Freshwater Nematodes: Ecology and Taxonomy, 497–573. Filipjev, I. 1922. Encore sur les Nematodes libres de la Mer Noire. Trudy Stavropol'skago Sel'skokhozyaistvennago Instituta Stavropol, 1: 83–184. Giblin-Davis, R. M., Davies, K. A., Taylor, G. S.; Thomas, W. K. 2004. Entomophilic nematode models for studying biodiversity and cospeciation. In: Chen, Z.X., Chen, S.Y., Dickson, D.W. (Eds.), Nematology, Advances and Perspectives. Tsinghua University Press/CABI Publishing, New York, 493–540. Hessler, R. R. & Jumars, P. A. 1974. Abyssal community analysis from replicate box cores in the Central North Pacific. Deep-Sea Research. 21: 185–209. Lambshead, P. J. D. 2004. Marine nematode biodiversity. In: Chen ZX, Chen WY, Chen SY, Dickson DW (eds) Nematology: advances and perspectives, vol 1: nematode morphology, physiology and ecology. CABI Publishing, Wallingford, pp 436-467. Lorenzen, S 1981. Entwurf eines phylogenetischen Systems der frei1ebenden Nematoden Veröffentlichungen des Instituts für Meeresforschung in Bremerhaven, 7: 1–472. Lorenzen, S. 1994. The Phylogenetic systematics of free living nematodes. The Ray Society, 383pp. Platt, H. M. & Warwick, R.M., 1988. Free-living marine nematodes (Synopses of the British Fauna, part II: British Chromadoridas). Leiden, New York: Kbenhavn, Koln. Soares-Gomes, A., Abreu, C., M. R. C., Absher, T. M. & Figueiredo, A, A. G. 1999. Abiotic features and the abundance of macrozoobenthos of continental margin sediments of East Brazil. Marine Ecology Progress Series, 127: 113–119. Verschelde, D., Gourbault, N. & Vincx, M. 1998. Revision of Desmodora with descriptions of new Desmodorids (Nematoda) from hydrothermal vents of the Pacific. Journal of the Marine Biological Association of the United Kingdon 78: 75-112. Verschelde, D., W. Nicholas & M. Vincx 2006. A review of the genera Croconema Cobb, 1920 and Pseudochromadora Daday, 1899 (Nematoda: Desmodoroidea): new species from the coasts of Kenya and Australia. Hydrobiologia 571: 17-40.

111

Capítulo 5

Discussão

112

5. Discussão

5.1. Marcadores moleculares utilizados na taxonomia Molecular dos Nematoda marinhos As análises moleculares e filogenéticas têm sido vistas como ferramentas importantes na elucidação da problemática que envolve a determinação das espécies e a descrição de novas espécies de Nematoda, principalmente devido à plasticidade fenotícipa na população e reduzido número de caracteres diagnósticos (Floyd et al., 2002; Blaxter et al., 2005, Bhadury et al., 2006). O esforço de padronização de identificação de espécies usando técnicas moleculares tem sido proposto para a determinação de espécies através da utilização de marcadores genéticos (Sunnucks, 2000; Blaxter, 2004). A principal dificuldade na taxonomia molecular é encontrar um gene que faça a discriminação de espécies no reino animal. Os principais marcadores nucleares utilizados na taxonomia molecular dos Nematoda marinhos são: subunidade menor ribossomal (18S/SSU), subunidade maior ribossomal (28S/LSU), unidade espaçadora interna (ITS), enquanto que o principal marcador mitocondrial é a citocromo oxidase subunidade 1. O marcador nuclear 18S é um dos mais utilizados nos trabalhos que abordam as relações filogenéticas dos Nematoda marinhos, um dos primeiros a utilizar esse marcador foi Blaxter et al., (1998) baseada na análise das sequências de 53 espécies de nematódeos de diferentes grupos trabalhando desde os parasitas de plantas até os de vida livre. Aleshin et al., (1998) apresenta um estudo com as primeiras relações filogenéticas com alguns grupos de Nematoda incluindo as ordens Enoplida, Chromadorida, Desmodorida e Monhysterida, tradicionalmente agrupados dentro da Subclasse Adenophorea. Entretanto, a antiga classificação em Adenophorea e Secernentea foi substituída pelas classes: Enoplea e Chromadorea devido a constatações oriundas das análises filogenéticas de SSU que mostraram que a evolução do parasitismo surgiu diversas vezes ao longo da evolução do grupo, além das espécies parasitas terem evoluído a partir de um nematódeo ancestral de vida livre (Blaxter et al., 1998). Assim, Aleshin et al., (1998) e Blaxter et al., 1998 concluíram que a antiga classe Adenophorea era um grupo parafilético porque eles incluem ancestrais na classe dos Secernentea, mostrando que não há uma separação entre os grupos dos Nematoda de vida livre e parasitária. Holteman et al., 2008 apresentaram a filogenia dos Nematoda baseadas na transição entre os habitats marinhos para o terrestre e vice-versa, mostrando que a partir de análises filogenéticas detalhadas de 128 sequências de SSU (18S) de todo o comprimento do gene

113

mostraram uma clara transição na maioria dos grupos de Nematoda em diferentes níveis taxonômicos do ambiente marinho para terrestre e vice-versa. Outro marcador utilizado para filogenia dos Nematoda é o segmento D2/D3 do marcador subunidade maior 28S (LSU), utilizado inicialmente para testar a hipótese de monofilia do grupo. Em relação a subunidade maior ribossomal (28S, LSU) tem sido um dos marcadores mais utilizados como fonte de sequência diagnóstica no grupo dos Nematoda, particularmente na região D2/D3, levando em consideração que essa região apresenta 12 subunidades (D1-D12) (Sonnenberg et al., 2007). Devido a alternância de regiões conservadas e variáveis, essa região apresenta primers com alta porcentagem de sucesso na PCR além de proporcionar um sinal robusto ao conteúdo correspondente ao nível de diagnostico das espécies, gêneros e famílias (De Ley et al., 2005). Nossos resultados corrobaram a maior facilidade na amplificação desse marcador nos nematódeos marinhos da Bacia de Campos, principalmente porque o marcador produz fragmentos de aproximadamente 400 pares de bases, sendo considerado uma quantidade suficiente para resolução das relações filogenéticas ao nível genérico (De Ley, comunicação pessoal). Entretanto, para o marcador (COI)citocromo oxidase subunidade I, sendo que este é considerado um dos mais difíceis no processo de amplificação do DNA (PCR) ficando abaixo de 50% de sucesso, além de ainda não existir um primer universal de citocromo oxidase I para amplificar todos os representantes do filo, existe uma dificuldade aparante na utilização do primer de COI em espécies de Nematoda marinhos (Bhadury et al., 2006b). Alguns trabalhos com COI foram aplicados no entendimento de processo de especiação críptica em Pellioditis marina (Rhabditida) e estudos de genética populacional em duas espécies de vida livre (Derycke et al., 2005). Atualmente, diversos trabalhos têm focado a utilização de COI como marcador universal barcode como caracter diagnóstico em diversos grupos de vertebrados e invertebrados (Hebert et al., 2003a; Hajibabei et al., 2005, Folmer et al., 1994, Rach et al., 2008) (ver Capítulo 1, Figura 2). Nossos resultados mostraram que esse marcador foi ineficaz na amplificação do DNA dos Nematoda da Bacia de Campos. Um outro marcador alternativo chamado de minibarcode de COI foi utilizado nas espécies da Bacia de Campos, apresentando maior sucesso de amplificação do DNA.

114

5.2. Inventário Molecular e integração das informações nos diversos bancos de dados para os Nematoda Um inventário molecular mostrando a situação da quantidade de espécies com sequências depositadas em bancos genéticos públicos foi desenvolvida nesse trabalho mostrando a situação do grupo em relação à quantidade de sequências código de barras depositadas em relação à diversidade morfológica do grupo. Aproximadamente mais de 200 espécies dos Nematoda marinhos apresentam sequências depositadas na última década em bancos genéticos, com um total de 600 sequências depositadas em bancos genéticos para o grupo (ver Capítulo 2 e 3). Essa coletânea de dados foi usada para estimar para quais regiões do planeta há sequências de Nematoda marinhos depositados e quais os principais genes usados para produção de sequências código de barras. A quantidade de sequências depositadas é considerada muito baixa em relação à diversidade total do grupo e pequena numa escala global. Atualmente as sequências depositadas são produzidas principalmente na Europa, EUA, Holanda e Inglaterra, sendo estes países pioneiros depositários de sequências código de barras dos Nematoda marinhos (ver Figura 1, Capitulo 2). Sequências de DNA código de barras têm sido produzidas principalmente em regiões temperadas restritas à Europa, Ásia e América do Norte, mostrando que a biodiversidade dos Nematoda marinhos é bem representada nos limites acima do equador, enquanto que em regiões tropicais, novas descrições de espécies têm aumentado rapidamente, mas em termos das técnicas moleculares ainda é subestimado. O emprego da metodologia de produção de sequências código de barras para os Nematoda marinhos tem a finalidade principal de produzir fragmentos genômicos padronizados para facilitar a identificação e descobertas de novas espécies (Hebert et al., 2003; Kress et al., 2005; Savolainen et al., 2005). Atualmente, com o aumento na disponibilidade de variantes de pares de bases proporcionam uma aplicabilidade universal e objetiva em análises comparativas na população e identificação das espécies (Carvalho & Hauser, 1994; Park & Moran, 1994). Recentemente, o desenvolvimento de técnicas de sequênciamento em larga escala em combinação com técnicas anteriores sugerem que pode haver um aumento no número de sequências de DNA código de barras em espécies de Nematoda de vida livre, incluindo a determinação da “árvore da vida” que é visto como uma nova era no estudo da biodiversidade da biota marinha (Moritz & Cicero, 2004, Lambert et al., 2005). 115

A sequência código de barras de um táxon desconhecido pode ser comparada com uma biblioteca de DNA de referência (bancos públicos genéticos), no intuito de reconhecer sua identidade (Hebert et al., 2004, Hajibabei et al., 2005). Em comparação a essa técnica de taxonomia baseada em sequências de DNA, vários marcadores genéticos têm sido empregados para produção de novas sequências e discriminação dentro do grupo dos Nematoda ao nível específico, sendo que marcadores com diferentes combinações, como os de subunidade menor ribossomal (SSU-18S) amplamente empregados em estudos de discriminação intra-específica e caracterização molecular, apresentando, portanto o maior número de sequências depositadas em bancos públicos genéticos (Blaxter et al., 1998; Bhadury et al., 2006; De Ley et al., 2005). A necessidade de integração dos dados ecológicos, moleculares e morfológicos é sugerida como uma ferramenta de aumento do conhecimento taxonômico, molecular e ecológico dos Nematoda marinhos. A partir desse esforço taxonômico com as técnicas moleculares promoverá o desenvolvimento de um sistema ou cartão biológico que aborda e integra todos os aspectos, desde ciclo de vida incluindo sequências código de barras, descrição morfológica, sendo chamado de Cartão de Identificação dos Nematoda (Figura 1, Capítulo 4).

5.3. Fixação de amostras para estudo molecular. Com a descoberta da reação em cadeia da polimerase e necessidade contínua de redução de custos e tempo para amplificação do DNA, os estudos moleculares têm sido amplamente desenvolvidos em diversas áreas da biologia. Embora a molécula de DNA seja altamente informativa, o tratamento das amostras requer uma rápida intervenção para evitar sua degradação em pequenos fragmentos devido à atividade das nucleases (Yorder et al., 2006). Já foi reportada a dificuldade de obtenção de DNA de alta qualidade em organismos de mar profundo devido à utilização do formaldeído como fixador para amostras biosedimentológicas, sendo muitas vezes pouco utilizado para estudos moleculares (Schander & Halanych, 2003). Devido à redução de custos em expedições oceanográficas raramente as amostras coletadas são utilizadas em estudos moleculares e evolucionários, se restringindo a estudos ecológicos. Em Nematologia, etanol e formaldeído têm sido frequentemente usados para preservação de DNA dos Nematoda, entretanto nenhuma dessas soluções apresenta 116

propriedades ideais de fixação, ou seja, adequada preservação de ambos DNA e morfologia dos organismos, além do transporte do material biológico do campo, facilidade de estocagem e a diminuição de efeitos de toxicidade desses fixativos (Thomas et al., 1997, Roubtsova et al., 2005). No tocante do estudo molecular dos Nematoda marinhos torna-se necessário a otimização de utilização de um fixador para estudos moleculares. Yorder et al., 2006 apresentou a utilização de uma solução que consiste na combinação de dimetil sulfóxido, EDTA e cloreto de sódio (DESS), sendo testado em diversas aplicações na preservação dos Nematoda para análises morfológica e molecular. Foi mostrado que DESS tem uma ação na inativação de enzimas que degradam DNA através da combinação dos efeitos de choque osmótico severo seguido de um rápido transporte de EDTA e cloreto de sódio através do tecido do animal auxiliado pela presença de dimetil sulfato (DMSO) (Yorder et al., 2006). Diante dos relatos da literatura, as amostras biosedimentológicas usadas no estudo molecular dos Nematoda da Bacia de Campos, que foram fixadas em ethanol absoluto, provavelmente sofreram contaminação durante a coleta ou estocagem das amostras para posterior envio para o laboratório. Foram retirados 50 espécimes de Nematoda de cada estação, totalizando 150 espécimes, sendo utilizados quatro marcadores, sendo dois nucleares (18S e 28S) e dois mitocondriais (COI e Minibarcode), porém apesar do marcador de subunidade maior (28S) ter apresentado bons resultados de amplificação, entretanto, constatou-se que as sequências provavelmente podem ter sido contaminadas com fungo, após uso do programa Blast ou padrão de comparação feito em todos os organismos do Genbank. As amostras utilizadas nesse estudo foram fixadas em etanol com o intuito de preservar DNA para as análises moleculares, porém a utilização deste fixador mostrou-se ineficaz para evitar a contaminação, além do tempo de estocagem das amostras in situ, pode ter influenciado na contaminação das amostras utilizadas nesse estudo. Entretanto, como as amostras utilizadas nesse estudo foram coletadas pela companhia petrolífera brasileira (PETROBRAS), já que as amostras dos outros locais aqui estudados foram fixadas com DESS. Neste processo de amostragem, foi utilizado etanol como fixador para as análises moleculares, devido ao custo ser mais baixo em comparação com a utilização do DESS. Entretanto, esse fixador apesar de preservar o DNA, foi suscetível a contaminação e, para o estudo taxonômico mostrou-se ineficaz, dificultando a identificação taxonômica de toda comunidade dos Nematoda da Bacia de Campos.

117

5.4. Utilização do Minibarcode e D2D3 (28S) na sistemática molecular dos Nematoda marinhos. As árvores construídas através da utilização do Minibarcode (COI) mostraram que o primer não apresentou boa resolução filogenéticas a partir do método de máxima verossimilhança e agrupamento vizinhos (NJ) (anexo). Foi utilizado o alinhamento Mafft que depois de editado, apresentou para Minibarcode regiões completamente conservadas com poucas diferenças taxonômico-moleculares. Quando lançadas o alinhamento das sequências para criação da árvore através do algoritmo Raxml, os resultados apresentados corroboraram que não houve discriminação taxonômica a partir das sequências amplificadas dos Nematoda da Bacia de Campos, ou seja, principalmente para o método NJ as espécies de Nematoda não apresentaram nenhuma diferença mostrando-se em apenas um grande clado. Entretanto, para o marcador 28S (D2D3) este apresentou uma melhor resolução, apesar de haver clados com relações de parentesco com alguns erros, não condizendo com a taxonomia dos Nematoda. Vale ressaltar que o marcador minibarcode, apesar de ser alternativa para fins de barcoding do grupo em estudo, não apresentou resultados confiáveis ou mesmo que possam reproduzir a utilidade desse marcador para filogenia ou sistemática molecular. O fragmento produzido a partir da amplificação do minibarcode é relativamente pequeno (150 bp) que segundo alguns autores não são suficientes para reconstrução filogenética ou sistemática do grupo (De Ley, comunicação pessoal). A filogenia construída para o filo Nematoda foi desenvolvida através da utilização do gene 18S, no qual o gene inteiro apresenta mais de 1000bp como montante de informação utilizada na criação da nova classificação (De Ley & Blaxter, 2002). Apesar disso, esse trabalho foi pioneiro na utilização do gene na tentativa de determinação da sistemática molecular dos Nematoda marinhos, corroborando a importância da taxonomia como ferramenta indispensável na construção das árvores filogenéticas. Existe a necessidade de design de novos primers para estudo taxonômico molecular com os Nematoda marinhos, principalmente novos genes ligados à citocromo-oxidase, pois é visto que o marcador não apresenta um sucesso na amplificação do DNA desses organismos. Provavelmente, a utilização de novos marcadores poderá apresentar um melhor sinal filogenético, sendo preferencialmente marcadores que apresentam regiões variáveis em alternância com regiões conservadas do gene. A taxonomia molecular é um campo promissor que se acompanhado de conceitos como cartão de identificação dos Nematoda, taxonomia integrativa e barcoding poderão se

118

constituir em ferramentas úteis, importantes no estudo das relações de filogenéticas, ecológica, genética populacional culminando nos estudos de biodiversidade no grupo.

119

Capítulo 6

Conclusões

120

CONCLUSÕES

1 – A taxonomia integrativa é um conceito novo e fundamental no estudo taxonômico molecular dos Nematoda marinhos.

2 – Os resultados obtidos neste trabalho apontam para a necessidade de integração dos dados ecológicos, taxonômicos e moleculares no estudo do grupo, sendo essencial a aplicação do conceito do Cartão de Identificação dos Nematoda.

3 – Os marcadores nucleares LSU e SSU apresentaram problemas na amplificação das espécies de Nematoda da Bacia de Campos. Apesar da facilidade de amplificação da LSU

(28S), porém existe o problema da amplificação de contaminantes como fungos e bactérias, enquanto que o SSU (18S), mesmo apresentando diversas combinações na literatura, muitas apresentam uma dificuldade de amplificação, corroborando a idéia de um desenho de primer específico para os Nematoda marinhos como fator de padronização laboratorial para os estudos taxonômico molecular do grupo.

4 – Existe uma necessidade de padronização de protocolos de coleta, fixação e armazenamento de amostras sedimentológicos para estudos moleculares com os Nematoda, procurando evitar a contaminação das amostras para análises moleculares.

5 – A aplicação do barcoding para o filo Nematoda ainda não pode ser ampla, porque até o momento a quantidade de sequências depositadas em bancos genéticos públicos ainda é extremamente escassa em relação à biodiversidade do grupo, desta forma persiste a contemporaneidade da produção de novas sequências.

6 – O marcador minibarcode, apesar de amplificar o DNA das espécies de Nematoda da Bacia de Campos, não se mostrou eficaz na discriminação sistemática molecular da comunidade nematofaunística, já que apresentou baixos valores de bootstraap, além de não mostrar nenhuma região congruente com COI de Nematoda e outros invertebrados. 121

REFERÊNCIAS BIBLIOGRÁFICAS

ABEBE, E., BLAXTER, M. (2003). Comparison of biological, molecular and morphological methods of species identification in a set of cultured Panagrolaimus isolates. Journal of Nematology 35: 119–128. ABEBE, E. R, GRIZZLE, E., HOPE, D., THOMAS, W. K. (2004). Nematode diversity in the Gulf of Maine, USA, and a Web-accessible relational database. Journal of Marine Biological Association of the United Kingdom. 84:1159–1167. ADAMS, B. J. (1998). Species concepts and the evolutionary paradigm in modern nematology. Journal of Nematology. 30: 1–21. AGUINALDO, A. M. A.; TURBEVILLE, J. M.; LINFORD, L. S.; RIVERA, M. C. G.; RUDOLF, J. R.; RAFF, A.; LAKE, J. A. (1997). Evidence for a clade of nematodes, arthropods and other moulting animals. Nature 387: 489 – 493. ALESHIN, V. V.; KEDROVA, O.S.; MILYUTINA, I. A.; VLADYCHENSKAYA, N. S.; PETROV, N. B. (1998). Relationships among nematodes based on the analysis of 18S rRNA gene sequences: molecular evidence for monophyly of chromadorian and secernentian nematodes. Russian Journal of Nematology 6 (2), 175-184. ARMENTEROS, M., RUIZ-ABIERNO, R., VINCX, M., DECRAEMER, W. (2009). A morphometric analysis of the genus Terschellingia (Nematoda: Linhomoeidae) with redefinition of the genus and key to the species. Journal of the Marine Biological Association of the United Kingdom 1-11. ARMSTRONG, M. R., BLOK, V. C., PHILLIPS, M. S. (2000). A multipartite mitochondrial genome in the potato cyst nematode Globodera pallida. Genetics 154: 181–192. AVISE, J. C., WALKER, D. (1999) Species realities and number in sexual vertebrates: Perspectives from an asexually transmitted genome. Proceedings of National Academy Society USA 96: 992–995. AVISE, J. C (2000). Phylogeography: the history and formation of species. Harvard University Press, Cambridge. BARRETT, R. D. H., HEBERT, P. D. N. (2005). Identifying spiders through DNA barcodes. Canadian Journal of Zoology. 83: 481–491. BERT, W.; LELIAERT, F., VIERSTRAETE, A. R.; VANFLETEREN, J. R.; BORGONIE, G. (2008). Molecular phylogeny of the Tylenchina and evolution of the female gonoduct (Nematoda: Rhabditida). Molecular Phylogenetics and Evolution 48: 728-744. BHADURY, P. (2005) Molecular resolution of marine nematodes for improved assessment of 122

biodiversity. PhD Thesis, University of Plymouth. BHADURY, P., AUSTEN, M. C., BILTON, D. T., LAMBSHEAD, P. J. D., ROGERS, A. D., SMERDON, G. R. (2006a) Molecular detection of marine nematodes from environmental samples: overcoming eukaryotic interference. Aquatic Microbial Ecology 44: 97–103. BHADURY, P., AUSTEN, M. C., BILTON, D. T., LAMBSHEAD, P. J. D., ROGERS, A. D., SMERDON, G. R. (2006b). Development and evaluation of a DNA-barcoding approach for the rapid identification of nematodes. Marine Ecology Progress Series 320: 1–9. BHADURY, P., AUSTEN, M. C., BILTON, D. T., LAMBSHEAD, P. J. D., ROGERS A. D., SMERDON, G. R. (2007). Exploitation of archived marine nematodes— a hot lysis DNA extraction protocol for molecular studies. Zoologica Scripta 36, 93–98. BHADURY, P., AUSTEN, M. C., · BILTON, D. T., LAMBSHEAD, P. J. D., ROGERS, A. D. SMERDON, G. R. (2008). Evaluation of combined morphological and molecular techniques for marine nematode (Terschellingia spp.) identification. Marine Biology 154:509–518. BIRD, D. M., BLAXTER, M. L., MCCARTER, J. P, MITREVA, M., STERNBERG, P. W., THOMAS, W. K. (2005). A White Paper on Nematode Comparative Genomics. Journal of Nematology. 37(4): 408–416. BLAXTER, M. L., DE LEY, P., GAREY, J. R., LIU, L. X., SCHELDEMANN, P., VIERSTRAETE, A., VANFLETEREN, J. R., MACKEY, L.Y., DORRIS, M., FRISSE, L. M., VIDA, J. T., THOMAS, W. K. (1998). A molecular evolutionary framework for the phylum Nematoda. Nature 392: 71–75. BLAXTER, M. L., FLOYD, R. (2003). Molecular taxonomics for biodiversity surveys: already a reality. Trends Ecology Evolution 18: 268-269. BLAXTER, M. (2003a). Comparative genomics: two worms are better than one. Nature 426(6965): 395-396. BLAXTER, M. (2003b). Molecular systematics: Counting angels with DNA. Nature 421(6919): 122-124. BLAXTER, M. L. (2004). The promise of DNA taxonomy. Philosophical Transactions Royal Society London B 359(1444): 669-679. BLAXTER, M.; ELSWORTH, B.; DAUB, J. (2004). DNA taxonomy of a neglected animal phylum: an unexpected diversity of tardigrades. Proceedings Royal Society London B 271: 189-192. BLAXTER, M., MANN, J., CHAPMAN, T., THOMAS, F., WHITTON, C., FLOYD, R., 123

ABEBE, E. (2005). Deﬁning operational taxonomic units using DNA barcode data. Philosophical Transactions Royal Society B. 360: 1935-1943. BLOUIN, M. S., YOWELL, C. A., COURTNEY, C. H., DAME, J. B. (1998). Substitution bias, rapid saturation, and the use of mtDNA for nematode systematic. Molecular Biology and Evolution 15: 1719-1727. BLOUIN, M. S. (2002). Molecular prospecting for cryptic species of nematodes: mitochondrial DNA versus internal transcribed spacer. International Journal of Parasitology 32: 527–531 BOCK, W. J. (2004). Species: the concept, category and taxon. Journal of Zoological Systematics Evolutionary Research 42(3): 178-190. BOISSEAU, J. P. (1957). Techniques pour l’etude quantitative de la faune interstitielle des sables. Comptes Rendus Du Congrés Des Sociétés Savantes de Paris et Des Départments 1957: 117-119 BROWN, S.A. (1997). Revolution at the checkout counter. Cambridge, MA: Harvard University Press. CARVALHO G. R.; HAUSER, L. (1994). Molecular genetics and the stock concept in fisheries. Reviews in Fisheries and Fish Biology 4: 326-350. CHILTON, N. B.; NEWTON, L. A.; BEVERIDGE, I.; GASSER, R. B. (2001) Evolutionary relationships of trichostrongyloid nematodes (Strongylida) inferred from ribosomal DNA sequence data. Molecular Phylogenetics Evolution. 19: 367–386; CHILTON, N. B., HUBY-CHILTON, F., GASSER, R. B. (2003). First complete large subunit ribosomal RNA sequence and secondary structure for a parasitic nematode: phylogenetic and diagnostic implications. Molecular and Cellular Probes 17: 33-39. CLARK, B. R., GODFRAY, H. C. J., KITCHING, I. J., MAYO, S. J., SCOBLE, M. J. (2009). Taxonomy as an eScience. Philosophical Transactions Royal Society A 367: 953- 966. COBB, N. A. (1917). Notes on nemas. Intra Vitam color reactions in nemas. Contributions to a Science of Nematology 5: 120–124. COOK, A. A., BHADURY, P., DEBENHAM, N. J., MELDAL, B. H. M., BLAXTER, M. L, SMERDON G. R., AUSTEN, M. C., LAMBSHEAD, P. J. D., ROGERS, A. D. (2005). Denaturing gradient gel electrophoresis (DGGE) as a tool for identification of marine nematodes. Marine Ecology Progress Series 291: 103–113. COOMANS, A. (2002). Present status and future of nematode systematics. Nematology 4, 124

573–582. COUNTWAY, P. D., GAST, R. J., SAVAI, P., CARON, D. A. (2005). Protistan Diversity Estimates Based on 18S rDNA from Seawater Incubations in the Western North Atlantic. Journal of Eukaryotic Microbiology 52(2): 95–106. DAMAHAPATRA, K. K., MALLET, J. (2006). DNA barcodes: recent successes and future prospects. Heredity 97: 254–255. DARDEN, L., TABERY, J. (2005). “Molecular Biology,” The Stanford Encyclopedia of Philosophy, Edward N. Zalta (ed.) available online at http://plato.stanford.edu/entries/molecular-biology/Griffiths. DAYRAT, B. (2005). Towards integrative taxonomy. Biological Journal of the Linnean Society 85: 407–415. DE CONINCK, L. A. (1942). Sur quelques espèces nouvelles de nematodes libres (Ceramonematinae Cobb, 1933), avec quelques remarques de systematique. Bulletin Museum Royale d'Histoire Naturelle Belgique 18: 1-37. DE GRISSE, A. T. (1969). Redescription ou modification de quelques techniques utilisées dasn l`étude des nématodes phytoparasitaires. Mededelingen Rijksfakulteit Landbouwwetenschappen Gent 34: 351–369. DE LEY P., FÉLIX, M. A., FRISSE, L. M., NADLER, S. A., STERNBER, P. W., THOMAS, W. K. (1999). Molecular and morphological characterization of two reproductively isolated species with mirror-image anatomy (Nematoda: Cephalobidae). Nematology 1: 591–612. DE LEY, P., BERT, W. (2002). Video capture and editing as a tool for the storage, distribution and illustration of morphological characters of nematodes. Journal of Nematology 34: 296–302. DE LEY, P., BLAXTER, M. (2002). Systematic position and phylogeny. The biology of nematodes. Chapter 1, edited. Donald L. Lee, 1-30. DE LEY P.; BLAXTER M. (2004). A new system for Nematoda: combining morphological characters with molecular trees, and translating clades into ranks and taxa. Nematology Monographs and Perspectives 2: 633–653. DE LEY, P., DE LEY, I. M., MORRIS, K., ABEBE, E., MUNDO OCAMPO, M., YODER, M., HERAS, J., WAUMANN, D., ROCHA-OLIVARES, A., BURR, A. H. J., BALDWIN J. G., THOMAS, W. K. (2005). An integrated approach to fast and informative morphological vouchering of nematodes for applications in molecular barcoding. 125

Philosophical Transaction of the Royal Society 360: 1945–1958. DE LEY, P. (2006). A quick tour of nematode diversity and the backbone of nematode phylogeny. WormBook, ed. The C. elegans Research Community, WormBook. DE LEY, P., DECRAEMER, W., EYUALEM-ABEBE. (2006). Introduction, summary of present knowledge and research addressing the ecology and taxonomy of freshwater nematodes. Pp 3-30 in Eyualem-Abebe, Andrássy, I. & Traunspurger, W. (Eds). Freshwater Nematodes, Ecology and Taxonomy. CABI Publishing, Wallingford, UK DECRAEMER, W. (1985). Revision and phylogenetic systematic of the Desmoscolecidae (Nematoda). Hydrobiologia 120: 259-283. DECRAEMER, W., GOURBALT, N. & BACKELJAU, T. (1997). Marine nematodes of the family Draconematidae (Nemata): a synthesis with phylogenetics relationships. Hydrobiologia 357: 185-202. DECRAEMER W., SMOL N. (2006). Orders Chromadorida, Desmodorida and Desmocolecida. In: Eyualem A, Andrássy I, Traunspurger W. eds. Freshwater Nematodes: Ecology and Taxonomy. CABI Plublishing, Massachusetts 497-573. DERYCKE S., REMERIE T., VIERSTRAETE, A., BACKELJAU, T., VANFLETEREN, J., VINCX M., MOENS T. (2005). Mitochondrial DNA variation and cryptic speciation within the free-living marine nematode Pellioditis marina. Marine Ecology Progress Series 300: 91–103. DERYCKE, S., BACKELJAU, T., VLAEMINCK, C., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS, T. (2006). Seasonal dynamics of population genetic structure in cryptic taxa of the Pellioditis marina complex (Nematoda: Rhabditida). Genetica 128: 307–321. DERYCKE, S., BACKELJAU, T., VLAEMINCK, C., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS, T. (2007). Spatiotemporal analysis of population genetic structure in Geomonhystera disjuncta (Nematoda, Monhysteridae) reveals high levels of molecular diversity. Marine Biology 151: 1799–1812. DERYCKE, S., FONSECA, G., VIERSTRAETE, A., VANFLETEREN, J., VINCX, M., MOENS T. (2008). Disentangling taxonomy within the Rhabditis (Pellioditis) marina (Nematoda, Rhabditidae) species complex using molecular and morphological tools. Zoological Journal of the Linnean Society 152: 1-15. DeSALLE, R., EGAN, M. G., SIDDALL, M., (2005). The unholy trinity: taxonomy, species delimitation and DNA barcoding. Philosophical Transactions Royal Society B. 360: 1905- 126

1916. DORRIS, M., DE LEY, P., BLAXTER, M. L. (1999). Molecular analysis of nematode diversity and the evolution of parasitism. Parasitology Today 15(5): 188-193. DORRIS, M., VINEY, M. E., BLAXTER, M. L. (2002). Molecular phylogenetics analysis of the genus Strongyloides and related nematodes. International Journal of Parasitology 32: 1507-1517. DOS SANTOS, G. A. P., DERYCKE, S., FONSECA-GENEVOIS, V., COELHO, L. C. B. B., CORREIA, M. T. S., MOENS, T. (2008). Differential effects of food availability on population growth and fitness of three species of estuarine, bacterial-feeding nematodes. Journal of Experimental Biology Ecology 355(1): 27-40. EISENSTEIN, M. (2009). Sequencing in a flash. Nature Methods 6(2): 114-115. EKREM, T.; WILLASSEN, E.; STUR, E. (2007). A comprehensive DNA sequences library is essential for identification with DNA barcodes. Molecular Phylogenetics and Evolution, 43: 530-542. EVANS, K. M., WORTLEY, A. H., MANN, D. G. (2007). An assessment of potential “barcode” genes (cox1, rbcL, 18S and ITS rDNA) and their effectiveness in determining relationships in Sellaphora (Bacillariophyta). Protist 158: 349-364. FÉLIX M.-A., DE LEY, P., SOMMER, R. J., FRISSE, L. M., NADLER, S. A., THOMAS, W. K., VANFLETEREN, J. R., STERNBERG, P. W. (2000). Evolution of vulva development in the Cephalobina (Nematoda). Developmental Biology 221: 68–86. FILIPJEV, I. (1922). Encore sur les Nematodes libres de la Mer Noire. Trudy Stavropol'skago Sel'skokhozyaistvennago Instituta Stavropol 1: 83–184. FITCH, D. H. A., BUGAJ-GAWEDA, B., EMMONS, S. W. (1995). 18s Ribosomal RNA Gene Phylogeny for Some Rhabditidae Related to Caenorhabditis. Molecular Biology and Evolution. 12(2): 346-358. FLOYD, R., ABEBE, E., PAPERT, A., BLAXTER, M. L. (2002) Molecular barcodes for soil nematode Identification. Molecular Ecology 11, 839–850. FLOYD, R. M., ROGERS, A. D., LAMBSHEAD, P. J. D, SMITH, C. R. (2005). Nematode- specific PCR primers for the 18S small subunit rRNA. Molecular Ecology Notes 5: 611– 612. FOLMER, O., BLACK, M., HOEH, W., LUTZ, R., VRIJENHOEK, R. (1994). DNA primers for ampliﬁcation of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. 127

FONSECA, G., DECRAEMER, W. (2008). State of the art of the free-living marine Monhysteridae (Nematoda) Journal of the Marine Biological Association of the United Kingdom, 1-20. FONSECA, G., DERYCKE, S., MOENS, T. (2008). Integrative taxonomy in two free-living nematode species complexes. Biological Journal of Linnean Society 94: 737-753. FONTANILLA, I. K. C., WADE, C. M. (2008). The small subunit (SSU) ribosomal (r) RNA gene as a genetic marker for identifying infective 3rd juvenile stage Angiostrongylus cantonensis. Acta Tropica 105: 181–186. FOUCHER, A. L. J. L., BONGERS, T., NOBLE, L. R., WILSON, M. J. (2004). Assessment of nematode biodiversity using DGGE of 18S rDNA following extraction of nematodes from soil. Soil & Biochemistry 36, 2027-2032. FRANÇOIS, C., KEBDANI, N., BARKER, I., TOMLINSON, J., BOONHAM, N., CASTAGNONE-SERENO, P. (2006). Towards specific diagnosis of plant-parasitic nematodes using DNA oligonucleotide microarray technology: A case study with the quarantine species Meloidogyne chitwoodi. Molecular and Cellular Probes 20: 64–69. FRÉZAL, L., LEBLOIS, R. (2008). Four years of DNA barcoding: Current advances and prospects. Infection, Genetics and Evolution 8, 727–736. GASSER, R. B., NEWTON, S. E. (2000). Genomic and genetic research on bursate nematodes: significance, implications and prospects. International Journal for Parasitology 30, 509-534. GIBLIN-DAVIS, R. M., DAVIES, K. A., TAYLOR, G. S., THOMAS, W. K. (2004). Entomophilic nematode models for studying biodiversity and cospeciation. In: Chen, Z.X., Chen, S.Y., Dickson, D.W. (Eds.), Nematology, Advances and Perspectives. Tsinghua University Press/CABI Publishing, New York, 493–540. GODFRAY, H. C. J. (2002). Challenges for taxonomy—the discipline will have to reinvent itself if it is to survive and ﬂourish. Nature 417: 17–19. GOLDEN, T. R., MELOV, S. (2004). Microarray analysis of gene expression with age in individual nematodes. Aging Cell 3: 111–124. GOURBAULT, N., DECRAEMER, W. (1996). Marine nematodes of the family Epsilonematidae: A synthesis with phylogenetic relationships. Nematologica 42: 133-158. GRASSLE J. F., MACIOLEK, N. J. (1992). Deep-sea species richness: Regional and local diversity estimates from quantitative bottom samples. American Naturalist 139: 313- 341. GREENSLADE, P., NICHOLAS, W. L. (1991). Some Thoracostomopsidae (Nematoda: 128

Enoplida) from Australia, including Descriptions of Two New Genera and Diagnostic Keys. Invertebrate Taxonomy 4: 1031-1052. GURALNICK, R. P., HILL, A. W., LANE, M. (2007). Towards a collaborative, global infrastructure for biodiversity assessment. Ecological Letters 10: 663-972. HADDRATH, O., BAKER, A. J. (2001). Complete mitochondrial DNA genome sequences of extinct birds, ratite phylogenetics and the vicariance biogeography hypothesis. Proceedings Royal Society London B 268: 939–945. HAJIBABAEI M., DEWAARD J. R., IVANOVA, N. V., RATNASINGHAM, S., DOOH, R. T., KIRK, S. L., MACKIE, P. M., HEBERT, P. D. N. (2005) Critical factors for assembling a high volume of DNA barcodes. Philosophical Transactions of the Royal Society of London Series B, 360: 1959–1967. HAJIBABAEI, M., JANZEN, D. H., BURNS, J. M., HALLWACHS, W., HEBERT, P. D. N. (2006). DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the National Academy of the United States of America. 103(4): 968-971. HAJIBABAEI, M.; SINGER, G. A. C.; HEBERT, P. D. N.; HICKEY, D. A. (2007). DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends Genetics 23: 167–172. HASPEGSLAGH, G. (1973). Superfamilie Ceramonematoidea De Coninck, 1965: een monografische studie 1-359. HASPEGSLAGH, G. (1979). Superfamily Ceramonematoidea (Cobb, 1933) General morphology. Annales Society Royal Zoolology Belgique. - T. 108 (1978) - fasc. 1-2, 65-74. HEBERT, P. D. N., CYWINSKA, A., BALL, S. L., DEWAARD, J. R. (2003a). Biological identifications through DNA barcodes. Proceedings of the Royal Society of London B 270: 313–321. HEBERT, P. D. N., RATNASINGHAM, S., DEWAARD, J. R. (2003b). Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Philosophical Transactions Royal Society London B 270, S96–S99 (Suppl). HEBERT, P. D. N., PENTON, E. H., BURNS, J. M., JANZEN, D. H., HALLWACHS, W. (2004). Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of National Academic Science of United States 101: 14812–14817. HEBERT, P. D. N., GREGORY, T. R. (2005). The promise of DNA barcoding for taxonomy. Systematic Biology 54: 852–859. 129

HESSLER, R. R., JUMARS, P. A. (1974). Abyssal community analysis from replicate box cores in the Central North Pacific. Deep-Sea Research 21: 185–209. HILLIS D. M., DIXON, M. T. (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. Quartely Review of Biology 66: 411–437. HILLIS, D. M., MORITZ, C., PORTER, C. A., BAKER, R. J. (1991) Evidence for biased gene conversion in concerted evolution of ribosomal DNA. Science 251: 308–310. HILLIS, D. M., MABLE, B. K., MORITZ, C. (1996). Applications of Molecular Systematics: The state of the Field and a look to the future. In Molecular Systematics, 2nd ed., Hillis, D. M., Moritz, C. & Mable, B.K. (eds.). Pp. 515-543. Sinauer Associates Inc., Sunderland, MA. HOLLINGSWORTH, B. D. (1998). The systematics of chuckwallas (Sauromalus) with a phylogenetic analysis of other iguanid lizards. Herpetolology Monography. 12: 38–191. HOLTERMAN, M., VAN DER WURV, A., VAN DEN ELSEN, S., VAN MEGEN, H., BONGERS, T., HOLOVACHOV, O., BAKKER, J., HELDER, J., (2006). Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution towards crown clades. Molecular Biology and Evolution 23: 1792– 1800. HOLTERMAN, M., HOLOVACHOV, O., VAN DEN ELSEN, S., VAN MEGEN, H, BONGERS, T., BAKKER, J., HELDER, J. (2008a). Small subunit ribosomal DNA-based phylogeny of basal Chromadoria (Nematoda) suggests that transitions from marine to terrestrial habitats (and vice versa) require relatively simple adaptations. Molecular Phylogenetics and Evolution 48: 758-763. HOLTERMAN, M., RYBARCZYK, K., VAN DEN ELSEN, S., VAN MEGEN, H., MOOYMAN, P., PENA SANTIAGO, R., BONGERS, T., BAKKER, J. HELDER, J. (2008b). A ribosoma DNA-based framework for the detection and quantification of stress- sensitive nematode families in terrestrial habitats. Molecular Ecology Resources 8: 23-34. HOTEZ, P. J.; BETHONY, J.; BOTTAZZI, M. E.; BROOKER, S.; BUSS, P. (2005) Hookworm: “The great infection of mankind.” PloS Med 2(3): 67. HUANG, J., XU Q., SUN, Z. J., TANG, G.L., SU, Z. Y. (2007). Identifying earthworms through DNA barcodes. Pedobiologia 51: 301—309. HUGOT, J. P., BAUJARD, P., MORAND, S. (2001). Biodiversity in helminths and nematodes as a field of study: an overview. Nematology 3(3): 199-208.

130

HUYNEN, L., MILLAR, C. D., SCOFIELD, R. P., LAMBERT, D. M. (2003). Nuclear DNA sequences detect species limits in ancient moa. Nature 425: 175–178. IVANOVA, N. V., DEWAARD, J. R., HEBERT, P. D. N. (2006). An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes, 6: 998–1002. JANZEN D H, HAJIBABAEI M, BURNS J M, HALLWACHS W, REMIGIO E, HEBERT P (2005) Wedding biodiversity inventory of a large complex Lepidoptera fauna with DNA barcoding. Philosophical Transactions of Royal Society B 360: 1835-1845. JANZEN, D. H. (2004). Now is the time. Philosophical Transactions Royal Society London B 359: 731–732. JENSEN, P. (1978). Revision of Microlimidae, Erection of Molgolaimidae fam. n., and remarks on the systematic position of Paramicrolaimus (Nematoda, Desmodorida). Zoologica Scripta 7: 159-173. JENSEN, P. (1994). Revision of Ethmolaiminae Filipjev & Stekhoven, 1941 (Nematoda, Chromadorida), with descriptions of one new genus and three new species. Hydrobiologia 286:(1) 1-15 KAHVEJIAN, A., QUACKENBUSH, J., THOMPSON, J.F. (2008). What would you do if you could sequence everything? Nature Biotechnology 26: 1125-1133. KAMPFER, S., STURMBAUER, C., OTT, C. J. (1998). Phylogenetics analysis of rDNA sequences from adenophorean nematodes and implications for the Adenophorea- Secernentea controversy. Invertebrate biology 117: 29-36. KOHLER, F. (2007). From DNA taxonomy to barcoding — how a vague idea evolved into a biosystematic tool. Museum für Naturkunde der Humboldt-Universität Zu Berlin 83: 44– 51. KRESS, W. J., WURDACK, K. J., ZIMMER, E. A., WEIGT, L. A., JANZEN, D. H. (2005). Use of DNA barcodes to identify flowering plants. Plant biology, 102(23): 8369-8374. KUMARI, S., DECRAEMER W., TRAVERSA, D., LIŠKOVÁ, M. (2009). Molecular and morphological delineation of Longidorus poessneckensis Altherr, 1974 (Nematoda: Dorylaimida). European Journal of Plant Pathology 123: 125-137. KUZMIN, Y., TKACH, V. V.; BROOKS, D. R. (2007). Rhabdias alabialis sp. nov. and R. pseudosphaerocephala sp. nov. (Nematoda: Rhabdiasidae) in the marine toad, Bufo marinus (L.) (Lissamphibia: Anura: Bufonidae) in Central America. Journal of Parasitology 93(1): 159-165. 131

LAMBERT, D. M., BAKER, A., HUYNEN, L., HADDDRATH, O., HEBERT, P. D. N., MILLAR, C. D. (2005). Is a Large-Scale DNA-based Inventory of Ancienty Life possible? Journal of Heredity 96(3): 279-284. LAMBSHEAD, P. J. D. (1993). Recent developments in marine benthic biodiversity research. Oceanis 19: 5-24. LAMBSHEAD, P. J. D. (2004). Marine nematode biodiversity. In: Chen ZX, Chen WY, Chen SY, Dickson DW (eds) Nematology: advances and perspectives, vol 1: nematode morphology, physiology and ecology. CABI Publishing, Wallingford, 436-467. LEE, M. S. Y. (2004). The molecularisation of taxonomy. Invertebrate Systematic 18: 1–6. LIPSCOMB, D., PLATNICK, N., WHEELER, Q. (2003). The intellectual content of taxonomy: a comment on DNA taxonomy. Trends Ecology and Evolution. 18: 65–68. LITAKER, R. W., VANDERSEA, M. W., KIBLER, S. R, REECE, K. S., STOKES, N. A., LUTZONI, F. M., YONISH, B. A., WEST, M. A., BLACK, M. N. D., TESTER, P. A. (2007). Recognizing dinofagellate species using ITS rDNA sequences. Journal of Phycology. 43: 344–355. LITVAITIS, M. K., BATES, J. W., HOPE, W. D., MOENS, T. (2000). Inferring a classification of the Adenophorea (Nematoda) from nucleotide sequences of the D3 expansion segment (26/28S rDNA). Canadian Journal of Zoology 78: 911–922. LORENZ, J. G., JACKSON, W. E., BECK, J. C., HANNER, R. (2005) “The problems and promise of DNA barcodes for species diagnosis of primate biomaterials,” Philosophical Transactions of Royal Society B. 360: 1869–1877. LORENZEN, S. (1977). Revision der Xyalidae (freilebende Nematoden) aufder Grundlage einer kritischen Analyse von 56 Arten aus Nord- und Ostsee. VeröVentlichungen des Institutes für Meeresforschung in Bremerhaven 16: 197–261. LORENZEN, S. (1981). Entwurf eines phylogenetischen Systems der frei1ebenden Nematoden Veröffentlichungen des Instituts für Meeresforschung in Bremerhaven 7: 1– 472. LORENZEN, S. (1994). The Phylogenetic systematics of free living nematodes. The Ray Society 383pp. LUNT, D. H., HYMAN, B. C. (1997). Animal mitochondrial DNA recombination. Nature 387: 247. MALHOTRA, A., THORPE, R. S. (2004). A phylogeny of four mitochondrial gene regions suggests a revised taxonomy for Asian pitvipers (Trimeresurus and Ovophis). Molecular 132

Phylogenetics and Evolution 32: 83–100. MALLET, J.; WILLMOTT, K. (2003). Taxonomy: renaissance or Tower of Babel? Trends in Ecology and Evolution 18(2): 57 – 59. MARGULIES, M., M. EGHOLM, W. E., AIRMAN, S., ATTIYA, J. S., BADER, L. A. BEMBEN, J., BERKA, M. S., BRAVERMAN, Y. J. CHEN, Z. CHEN, S. B., DEWELL, L., DU, J. M., FIERRO, X. V., GOMES, B. C., GODWIN, W., HE, S., HELGESEN, C.- H., HO, G. P., IRZYK, S. C., JANDO, M. L. I.; ALENQUER, T. P.; JARVIE, K. B.; JIRAGE, J. B.; KIM, J. R.; KNIGHT, J. R.; LANZA, J. H.; LEAMON, S. M.; LEFKOWITZ, M.; LEI, J.; LI, K. L.; LOHMAN, H.; LU, V. B.; MAKHIJANI, K. E.; MCDADE, M. P.; MCKENNA, E. W.; MYERS, E.; NICKERSON, J. R.; NOBILE, R.; PLANT, B. P.; PUC, M. T.; RONAN, G. T.; ROTH, G. J., SARKIS, J. F., SIMONS, J. W., SIMPSON, M., SRINIVASAN, K. R., TARTARO, A., TOMASZ, K. A., VOGT, G., A. VOLKMER, S. H., WANG, Y., WANG, M. P., WEINER, P., YU, R. F. BEGLEY, J. M., ROTHBERG. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature 437: 376-380. MARKMANN, M., TAUTZ, D. (2005). Reverse taxonomy: an approach towards determining the diversity of meiobenthic organisms based on ribosomal RNA signature sequences. Phylosophical Transactions of Royal Society B 360: 1917–1924. MARQUES, D. K. L. (2002). Aplicação da biologia molecular em programas de conservação de recursos pesqueiros. Corumbá: Embrapa Pantanal, 22p. MARSHALL, E. (2005). Taxonomy. Will DNA barcodes breathe life into classification? Science, 307(5712): 1037. MARTIN, J., ABUBUCKER, S., WYLIE, T., YIN, Y., WANG, Z., MITREVA, M. (2008). Nematode.net update: improvements enabling more efficient data mining and comparative nematode genomics. Nucleic Acids Research 37: D571-D578. MAY, R. M. (1988). How many species are there on Earth? Science. 241: 1441–1449. MELDAL, B. H. M., DEBENHAM, N. J., DE LEY, P., DE LEY, I. T., VANFLETEREN, J. R., VIERSTRAETE, A. R., BERT, W., BORGONIE, G., MOENS, T., TYLER, P. A., AUSTEN, M. C., BLAXTER, M. L., ROGERS, A. D., LAMBSHEAD, P. J. D. (2007). An improved molecular phylogeny of the Nematoda with special emphasis on marine taxa. Molecular Phylogenetic and Evolution 42: 622–636. MEUSNIER, I., SINGER, G. A. C., LANDRY, J. F., HICKEY, D. A., HEBERT, P. D. N., HAJIBABAEI, M. (2008). A universal DNA mini-barcode for biodiversity analysis. B. M. 133

C Genomics 9: 214 MEYER, C. P., PAULAY, G. (2005). DNA Barcoding: Error Rates Based on Comprehensive Sampling. Plos Biology. 3(12): 2229-2238. MINDELL, D. P., SORENSON, M. D., DIMCHEFF, D. E. (1998). Multiple independent origins of mitochondrial gene order in birds. Proceedings of National Academic of Science United States 95: 10693-10697. MONIS, P. T., ANDREWS, R. H., SAINT, C. P. (2002). Molecular biology techniques in parasite ecology. International Journal for Parasitology 32, 551–562. MORITZ, C., CICERO, C. (2004). DNA barcoding: promise and pitfalls. Plos Biology 2, 1529–1531. MUSAT, N., GIERE O., GIESEKE, A., THIERMANN, F., AMANN R., DUBILIER, N. (2007). Molecular and morphological characterization of the association between bacterial endosymbionts and the marine nematode Astomonema sp. from the Bahamas. Environmental Microbiology 9(5): 1345-1353. MUTHUMBI, A. W., VINCX, M. (1998). Chromadoridae (Chromadorida: Nematoda) from the Indian Ocean: Description of new and known species. Hydrobiologia 364: 119–153. MUTHUMBI, A. W., VINCX, M. (1999). Microlaimidae (Microlaimoidea: Nematoda) from the Indian Ocean: description of nine new and known species Hydrobiologia 397: 39-58. NADLER, S. A., HOBERG, E. P., HUDSPETH, D. S. S., RICKARD, L. G. (2000). Relationships of Nematodirus species and Nematodirus battus isolates (Nematoda: Trichostrongyloidea) based on nuclear ribosomal DNA sequences. Journal of Parasitology 86: 588–601. NADLER, S. A. (2002). Species delimitation and nematode biodiversity: phylogenies rule. Nematology 4: 615–625. NERES P. F., FONSECA-GENEVOIS, V., TORRES, R. A., CAVALCANTI, M. F., CASTRO, F. J. V., SILVA, N. R. R., RIEGER, T. T., DECRAEMER, W. (2010) in press Morphological and molecular taxonomy of a new Daptonema (Nematoda, Xyalidae) with comments on the systematics of some related taxa. Zoological Journal of the Linnean Society. NICHOLAS, W. L., TRUEMAN, J. W. H. (2002). The taxonomy of the family Xyalidae Chitwood, 1951 (Monhysterida: Nematoda): a cladistic analysis. Nematology 4(4): 453- 470.

134

PAGE, R. D. M. (2008). Biodiversity informatics: the challenge of linking data and the role of shared identifiers. Briefings in Bioinformatics 1-10. PAGE, T. J., CHOY, S. C., HUGHES, J. M. (2005). The taxonomic feedback loop: symbiosis of morphology and molecules. Biological Letters 1: 139-142. PARK, L. K., MORAN, P. (1994). Developments in molecular techniques in fisheries. Reviews in Fish Biology and Fisheries, 4: 300-325. PARKINSON, J., MITREVA, M., HALL, N., BLAXTER, M., MCCARTER, J. P. (2003). 400 000 nematode ESTs on the Net. Trends in Parasitology 19(7): 283-286. PARKINSON, J., WHITTON, C., SCHMID, R., THOMSON, M., BLAXTER, M. (2004). Nemabase: a resource for parasitic nematode ESTs. Nucleic Acids Research 32: 427-430. PARMAKELIS, A., SPANOS, E., PAPAGIANNAKIS, G., LOUIS, C., MYLONAS, M. (2003). Mitochondrial DNA phylogeny and morphological diversity in the genus Mastus (Beck, 1837): a study in a recent (Holocene) island group (Koufonisi, southeast Crete). Biological Journal of the Linnean Society 78: 383–399. PATTERSON, D. J., REMSEN, D., MARINO, W. A., NORTON, C. (2006). Taxonomic indexing – extending the role of taxonomy. Systematic Biology 55(3): 363-373. PEGOVA, A. N., KRASNOVA, E., ALESHIN, V. D. V. (2004). Evidence from the small and large ribosomal RNA structure suggests that Anoplostoma rectospiculum Gal'tsova, 1976 (Nematoda: Anoplostomatidae) is a member of the superfamily Enoploidea, not Oncholaimoidea. Nematology 6(3): 413-421. PLATONOVA, T. A., MOKIEVSKY, V. O. (1994). Revision of the marine nematodes of the family Ironidae (Nematoda, Enoplida). Zoological Rossica, 3: 5-17. PLATT, H. M. (1982). Revision of the Ethmolaimidae (Nematoda: Chromadorida). Bulletin of the British Museum (Natural History). Zoology Series 43: (4). PLATT, H. M. (1985). The free-living marine nematode genus Sabatieria (Nematoda: Comesomatidae). Taxonomic revision and pictorial keys. Zoological Journal of the Linnean Society 83: 27–78. PLATT, H. M., WARWICK, R. M. (1988). Free-living marine nematodes (Synopses of the British Fauna no. 38, part II: British Chromadoridas). Leiden, NewYork: K_benhavn, Koln. PLATT, H., WARWICK, R. (1998). Free living marine nematodes Part II. British Chromadorids. Synopses of the British Fauna (new series) edited by Doris M. Kermack and R.S.K Barnes 38, 502pp. 135

POWERS, T. O., TODD, T. C., BURNELL, A. M., MURRAY, P. C. B., FLEMING, C. C., SZALANSKI, A. L., ADAMS, B. A., HARRIS, T. S. (1997). The rDNA internal transcribed spacer region as a taxonomic marker for nematodes. Journal of Nematology. 29(4): 441-450. POWERS, T. (2004). Nematode molecular diagnostics: from bands to barcodes. Annual Review of Phytopathology 42: 367-83. QUICKE, D. J. L. (2004). The world of DNA barcoding and morphology collision or synergism and what of the future. Systematistic 23: 8–12. RACH, J., DeSALLE, R., SARKAR, I. N., SCHIERWATER, B., HADRYS, H. (2008). Character-based DNA barcoding allows discrimination of genera, species and populations in Odonata. Proceedings Royal Society B 275: 237-247. ROGERS, A. D., LAMBSHEAD, P. J. D. (2004). Molecular studies of nematode diversity, past, present and future. In: Cook, R. & Hunt, D.J. (Eds). Proceedings of the Fourth International Congress of Nematology, 8 - 13 June 2002, Tenerife, Spain. Nematology Monographs and Perspectives Volume 2. Brill Academic Publishing. ROUBTSOVA, T. V., MOENS, M., SUBBOTIN, S. A. (2005). PCR amplification of a rRNA gene fragment from formalin fixed and glycerine-embedded nematodes from permanent slides. Russian Journal of Nematology 13: 137-140. RUBINOFF, D. (2006). DNA barcoding evolves into the familiar. Conservation Biology 20 (5): 1548-1549. RUBINOFF, D., CAMERON, S., WILL, K. (2006). A genomic perspective on the shortcomings of mitochondrial DNA for “barcoding” identification. Journal of Heredity 29: 1-14. RUSIN, L. Y., ALESHIN, V. V., TCHESUNOV, A. V., ATRASHKEVICH, G. I. (2003). The 18S ribosomal RNA gene of Soboliphyme baturini Petrow, 1930 (Nematoda: Dioctophymida) and its implications for phylogenetic relationships within Dorylaimia. Nematology 5: 615–628. SAUNDERS, G. W. (2005). Applying DNA barcoding for red macroalgae: a preliminary appraisal holds promise for future applications. Philosophical Transactions of Royal Society of London, Biological Sciences 360: 1879-1888. SAVOLAINEN, V., COWAN, R. S., VOGLER, A. P., RODERICK, G. K., LANE. R. (2005). Towards writing the encyclopedia of life: an introduction to DNA barcoding. Philosophical Transactions Royal Society B 360: 1805-1811. 136

SCHANDER, C., HALANYCH, K. M. (2003). DNA, PCR and formalinized animal tissue – short review and protocols. Organisms, Diversity & Evolution 3: 195-205. SCHANDER, C., WILLASSEN, E. (2005). What can biological barcoding do for marine biology? Marine Biology Research 1: 79-83. SEBERG, O., HUMPHRIES, C. J., KNAPP, S., STEVENSON, D. W., PETERSEN G., SCHARFF, N., ANDERSEN, N. M. (2003). Shortcuts in systematics? A commentary on DNA-based taxonomy. Trends in Ecology and Evolution 18: 63–65. SHARMA, J., SUN, L., HOPE, W. D., FERRIS, V. R. (2006). Phylogenetic Relationships of the marine nematode Family Comesomatidae. Journal of Nematology 38(2): 229-232. SHENDURE, J., MITRA R. D., VARMA C., CHURCH, G. M. (2004). Advanced sequencing technologies: Methods and goals. Nature Reviews Genetics 5: 335-344. SITES, J. W., MARSHALL, J. C. (2003). Delimiting species: a renaissance issue in systematic biology. Trends in Ecology and Evolution 18: 462–470. SMITH, M. A., FISHER, B. L. & HEBERT, P. D. N. (2005). DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar. Philosophical Transactions Royal Society B 360: 1825–1837. SMITH, G. F., ROUX, J. P., TOLLEY, K., CONRAD, F. (2006a). Taxonomy and barcoding: conflict or companions. South Journal of Science 102, 517-518. SMITH M. A., WOODLEY N. E.; JANZEN, D. H.; HALLWACHS, W.; HEBERT, P. D. N. (2006b). DNA barcode reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Sciences United States 103: 3657–3662. SMYTHE, A. B., SANDERSON, M. J., NADLER, S. A. (2006). Nematode Small Subunit Phylogeny Correlates with Alignment Parameters. Systematic Biology. 55(6): 972-992. SOARES-GOMES, A., ABREU, C. M. R. C., ABSHER, T. M., FIGUEIREDO, A, A. G. (1999). Abiotic features and the abundance of macrozoobenthos of continental margin sediments of East Brazil. Marine Ecology Progress Series 127: 113–119. SONNENBERG, R., NOLTE, A. W., TAUTZ, D. (2007). An evaluation of LSU rDNA D1- D2 sequences for their use in species identification. Frontiers in Zoology 4(6): 1-12. STEIN, L. D. (2003). Integrating Biological Databases. Nature Reviews 4: 337-345. STOECKLE, M. (2003). Taxonomy, DNA, and the barcode of life. Bioscience 53: 796–797. SUBBOTIN, S. A., STURHAN, D., VOVLAS N., CASTILLO, P., TAMBE, J. T., MOENS M., BALDWIN, J. G. (2007). Application of the secondary structure model of rRNA for 137

phylogeny: D2–D3 expansion segments of the LSU gene of plant-parasitic nematodes from the family Hoplolaimidae Filipjev, 1934. Molecular Phylogenetics and Evolution 43:

881–890. SUDHAUS, W., FITCH, D. (2001). Comparative Studies on the Phylogeny and Systematics of the Rhabditidae (Nematoda). Journal of Nematology 33(1): 1–70. SUNNUCKS, P. (2000). Efficient genetic markers for population biology. Tree. 5(5): 199- 203. TAUTZ, D., ARCTANDER, P., MINELLI, A., THOMAS, R. H., VOGLER, A. P. (2002). DNA points the way ahead in taxonomy. Nature. 418(368): 479. TAUTZ, D., ARCTANDER, P., MINELLI, A., THOMAS, R. H., VOGLER, A. P. (2003). A plea for DNA taxonomy. Trends Ecology and Evolution 18(2): 71–74. TCHESUNOV, A. V., MILIJUTINA, M. A. (2002). A review of the family Ceramonematidae (marine free-living nematodes), with descriptions of nine species from the White Sea. Zoological Institute 11: 1-39. TCHESUNOV, A.V., MOKIEVSKY, V.O. (2005). A review of the genus Amphimonhystera Allgén, 1929 (Monhysterida: Xyalidae, Marine Freeliving Nematodes) with description of three new species. Zootaxa 1052: 1–20. TENENTE, G., DE LEY P., DE LEY, I. T., KARSSEN, G. (2004). Sequence analysis of the D2/D3 region of the large subunit rDNA from different Meloidogyne isolates. Nematropica. 34(1): 1-12. THOMAS, W. K., VIDA, J. T., FRISSE, L. M., MUNDO-CAMPO, M., BALDWIN, J. G. (1997). DNA sequences from formalin-fixed nematodes: integrating molecular and morphological approaches to taxonomy. Journal of Nematology 29(3): 250–254. TIMM, R. W. (1962). Marine Nematodes of family Linhomoeidae from the Arabian Sea at Karachi. Canadian Journal of Zoology 4: 165-178. TIMM, R. W. (1970). A revision of the nematode order Desmoscolecida Filipjev, 1929. University of California publication in Zoology. 93: 1-113. TORSVIK, V., ØVREÅS, L., THINGSTAD, T. F. (2002). Prokaryotic Diversity Magnitude, Dynamics, and Controlling Factors. Science 296 (5570): 1064 – 1066. TRINGE, S. G., RUBIN, E. M. (2005). Metagenomics: DNA sequencing of environmental samples. Nature Reviews Genetics. 6: 805-814. VALDECASAS, A. G., WILLIAMS, D., WHEELER, Q. D (2008). ‘Integrative taxonomy’ then and now: a response to Dayrat (2005)’ Biological Journal of the Linnean Society 93: 138

211–216. VANFLETEREN, J. R., VIERSTRAETE, A. R. (1999). Insertional RNA editing in metazoan mitochondria: The cytochrome b gene in the nematode Teratocephalus lirellus Cambridge University Press Society RNA 5: 622-624. VERSCHELDE, D., VINCX, M. (1994). Epsilonematidae (Nematoda, Desmodoroidea) from East African Coast, with a discussion on the external morphology of cuticular appendages. Nematologica 40: 78-105. VERSCHELDE, D., VINCX, M. (1995). Psammonema gen. n. and Pseudochromadora Daday, 1889 (Nematoda, Desmodoridae) from sandy sediments of Gazi, Kenya. Bulletin van het Koninkklijk Belgisch Instituut voor Natuurwetenschappen, Biologie 65: 11-39. VERSCHELDE, D., GOURBAULT, N., VINCX, M. (1998). Revision of Desmodora with Descriptions of new Desmodorids (Nematoda) from hydrothermal vents of the pacific. Journal Marine Biology Association U. K 78: 75-112. VERSCHELDE, D., NICHOLAS, W., VINCX, M. (2006). A review of the genera Croconema Cobb, 1920 and Pseudochromadora Daday, 1899 (Nematoda, Desmodoroidea): new species from the Coasts of Kenya and Australia. Hydrobiologia 571: 17-40. VINCX, M., GOURBAULT, N. (1989). Desmodoridae from the Bay of Morlaix (Brittany) and the Southern Bight of the North Sea. Les Cahiers de Biologie Marine. 30: 103-114. VOGLER, A. P., MONAGHAN, M. T. (2007). Recent advances in DNA taxonomy. Journal Zoological Systematics Evolution Research 45(1): 1-10. WAITE, I. S., O’DONNELL, A. G., HARRISON, A., DAVIES, J. T., COLVAN, S. R., EKSCHMITT, K., DOGAN, H., WOLTERS, V., BONGERS, T., BONGERS, M., BAKONYI, G., NAGY, P., PAPATHEODOROU, E.M., STAMOU, G. P., BOSTROM, S. (2003). Design and evaluation of nematode 18S rDNA primers for PCR and denaturating gradient gel electrophoresis (DGGE) of soil community DNA. Soil Biology & Biochemistry 35: 1165-1173. WAKE, M.H. (2003). What is ‘Integrative Biology’? Journal of Integrative and Comparative Biology 43, 239–241. WANDELER, P., HOECK, P. E. A., KELLER, L. F. (2007). Back to the future: museum specimens in population genetics. Trends in Ecology and Evolution 22(12): 634-642. WARD, R. D., ZEMLAK, T. S., INNES, B. H., LAST, P. R., HEBERT, P. D. N. (2005). DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society 139

B 360: 1847––1857. WARWICK, R. M., PLATT, H. M., SOMERFIELD, P. J. (1998). Free living marine nematodes. Part III. Synopses of the British Fauna (new series) edited R.S.K. Barnes and J. H. Crothers. 53: 296p. WATTS, K. J., COURTNEY, C. H., REDDY, G. R. (1999). Development of a PCR and probe-based test for the sensitive and specific detection of the dog heartworm, Dirofiaria immitis, in its mosquito intermediate host. Molecular Cell Probes 14: 425–430. WHEELER, Q. D. (2004). Taxonomic triage and the poverty of identiﬁcation and classiﬁcation. Cladistics 20: 47–55. WHEELER, Q. D., RAVEN, P. H., WILSON, E. O. (2004). Taxonomy: impediment or expedient? Science 303: 285. WIENS, J. J., PENKROT, T. A. (2002). Delimiting species using DNA and morphological variation and discordant species limits in spiny lizards (Sceloporus). Systematic Biology 51: 69–91. WILL, K. W., RUBINOFF, D. (2004). Myth of the molecule: DNA barcodes for species cannot replace morphology for identification and classification. Cladistics 20: 47-55. WILL, K. W., MISHLER, B. D., WHEELER, Q. D. (2005). The perils of DNA barcoding and the need for integrative taxonomy. Systematic Biology 54: 844–851. WILLIAMS, B. D., SCHRANK, B., HUYNH, C., SHOWNKEEN, R., WATERSTON, R. H. (1992). A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence tagged sites. Genetics 131: 609–624. WILSON, E. O. (2003). The encyclopedia of Life. Trends in Ecology and Evolution 18: 77– 80. WILSON, E. O. (2004). Taxonomy as a fundamental discipline. Philosophical Transactions of the Royal Society of London B 359: 739. WRATHER, J. A., ANDERSON, T. R., ARSYAD, D. M., TAN, Y., PLOPER, L. D., PORTA-PUGLIA, A., RAM, H. H., YORINORI, J. T. (2001). Soybean disease loss estimates for the top ten soybean-producing countries in 1998. Canadian Journal of Plant Patology 23: 115–121. XIQUAN, S. GUANPIN, Y. YONGJIAN, L. (2007). Nematode Diversity of Qingdao Coast Inferred from the 18S Ribosomal RNA Gene Sequence Analysis. Journal of Ocean University of China. 6(2): 132-136. YE, W., SZALANSKI, A. L., ROBBINS, R. T. (2004). Phylogenetic relationships and 140

genetic variation in Longidorus and Xiphinema Species (Nematoda: Longidoridae) using ITS1 sequences of nuclear ribosomal DNA. Journal of Nematology 36: 14–19. YODER, M., DE LEY, I. T., KING, I. W, MUNDO-OCAMPO, M., MANN, J., BLAXTER, M., POIRAS, L., DE LEY, P. (2006). DESS: a versatile solution for preserving morphology and extractable DNA of nematodes. Nematology. 8(3): 367-376. ZHENG, J., SUBBOTIN, S. A., HE, S., GU, J., MOENS, M. (2003). Molecular characterization of some Asian isolates of Bursaphelenchus xylophilus and B. mucronatus using PCR-RFLPs and sequences of ribosomal DNA. Russian Journal of Nematology 11: 17-22.

141

Publicações

1) Silva, N. R. R., Silva, M. C., Genevois, V.G.F., Esteves, A. M., De Ley, P., Decraemer, W., Rieger, T. T., Dos Santos, M. T. Marine nematodes taxonomy in the DNA age: the present and future of molecular tools to assess their biodiversity. Submetido a Nematology.

2) Silva, N. R. R., De Ley, P., King, I., Robinson, C., Decraemer, W., Pereira, T. J., Rocha- Olivares, A., Silva, M. C., Thomas, M. C., Genevois, V., Larrazabal, A. L., Santos, M. T. C., Rieger, T. T Inventorying the diversity of free living marine nematodes: using DNA barcoding and integrative approach. Submetido a Nematology

3) Silva, N. R. R., Silva, M. C., Decraemer, W., Santos, M. T. C. A new genus Cornurella gen. n. (Nematoda, Desmodoridae, Filipjev, 1922) from Campos Basin, Rio de Janeiro, Brazil. Para ser submetido a Hydrobiologia.

4) Neres, P. F., Fonsêca-Genevois, V. G., Torres, R. A., Cavalcanti, M. F., Silva, N. R. R., Rieger, T. T., Decraemer, W. Morphological and molecular taxonomy of a new Daptonema (Nematoda, Xyalidae) with comments on the systematics of some related taxa. Zoological Journal of Linnean Society 158: 1-15, 2010.

5) Maria, T. F., Silva, N. R. R., Wandeness, A. P., Esteves, A. M. (2008) Spatio-temporal study and population structure of Daptonema oxycerca (Nematoda: Xyalidae) in Coroa Grande, Rio de Janeiro, BRAZIL. Brazilian Journal of Oceanography 56(1): 41-50.

142

Anexos

Resultados

143

CR25 D 1CR19B9Oncholaimus Viscosia3P6K2 90 ViscosiaI43 CR14 D 9CR2C9Terschellingia CR20 D 2CR4C9Axonolaimus 100 CR13 D 8CR2C9Sabatieria 81Enoplolaimus2P6K2 CR2499 D 10CR5C9Axonolaimus 72 30 35 CR21 D 5CR5C9Axonolaimus Linhomoeus7I12K2 100 CR29 D 5CR19B9Paralinhomoeus 100 CR26 D 2CR19B9Linhomoeus CR27 D 3CR19B9Sabatieria 57 99 NudoraI39 100 MonoposthiaI36 66 Xyalasp3P11K2 AnticomaE24 97 100 SabatieriaE31 89 NR21 D 14N23F9Rhynchonemasp 30 97 CR22 D 6CR5C9Theristus CR23 D 8CR5C9Onyx 84 100 CR19 D 1CR4C9Monhysterid 73 NR19 D 13N23F9Sigmophoranemasp 82 ViscosiaI14K2 NR3 D 3N23F9Enoploides 100 100 NR9 D 8N23F9Enoploides 30 Oncholaimidae2I6K2 DaptonemaA41 3294 NR23 D 15N23F9Enoploides 33 Enoploides2P9K2 96 70 EpacanthionI19 67 NR1 D 2N23F9Enoploides 26 Enoploides1P11K2 CR16 D 11CR3C9Spilophorella 100 CR15 D 10CR3C9Spilophorella 100 CR18 D 13CR3C9Spilophorella 91 NR11 D 9N23F9Gonionchussensibilis NR13100 D 10N23F9Gonionchussensibilis 97 100 NR5 D 4N23F9Onchiumsp HalalaimusE21 100 LinhomoeusE17 Pontonema6I23B4 100 Pontonema3I24B4 0.1

Topologia da Máxima Verossimilhança baseada nas sequências D2D3 das espécies de Nematoda da Bacia de Campos (RJ) e Bolsa Chica (USA) baseado no algoritmo Mafft 5.6. Os números são valores de bootstrap com suporte acima de 50%. Barra de escala 0,1 substituições por sítio.

144

Pontonema6I23B4 Pontonema3I24B4 LinhomoeusE17 ComesomaspMKL1 Linhomoeus7I12K2 'CR19 D 1CR4C9Monhysterid' 'CR25 D 1CR19B9Oncholaimus' 'CR15 D 10CR3C9Spilophorella' 'CR14 D 9CR2C9Terschellingia' 'CR18 D 13CR3C9Spilophorella' 'NR19 D 13N23F9Sigmophoranemasp' 'NR23 D 15N23F9Enoploides' 'NR11 D 9N23F9Gonionchussensibilis' 'CR22 D 6CR5C9Theristus' Dichromadorasp Adoncholaimusthalassophygas Anoplostomaviviparum HalalaimusE21 53 'CR16 D 11CR3C9Spilophorella' TheristusMKL1 69 AnticomaE24 100 SabatieriaE31 Xyalasp3P11K2 58 58 Theristusacer 'NR5 D 4N23F9Onchiumsp(?)' 100 'NR13 D 10N23F9Gonionchussensibilis' DaptonemaA41 100 Enoploides2P9K2 EpacanthionMKL1 'NR1 D 2N23F9Enoploides' EpacanthionI19 ViscosiaI14K2 99 93 Oncholaimidae2I6K2 EnoploidesMKL1 61 'NR9 D 8N23F9Enoploides' 86 'NR3 D 3N23F9Enoploides' MesacanthionMKL1 55 Enoploides1P11K2 'CR21 D 5CR5C9Axonolaimus' 100 Enoplolaimus2P6K2 98 'CR24 D 10CR5C9Axonolaimus' SabatieriaMKL1 50 'CR27 D 3CR19B9Sabatieria' MonoposthiaI36 56 MonoposthiaMKL2 79 NudoraI39 ViscosiaI43 100 Viscosia3P6K2 'CR13 D 8CR2C9Sabatieria' 64 'NR21 D 14N23F9Rhynchonemasp' 'CR20 D 2CR4C9Axonolaimus' 53 'CR23 D 8CR5C9Onyx' 'CR26 D 2CR19B9Linhomoeus' 100 'CR29 D 5CR19B9Paralinhomoeus' 10

Topologia do Neighbour-joining basedo no alinhamento no segmento D2D3 (28S) alinhado com MAFFT 5.6. O Mafft consiste num algoritmo baseada na rápida transformação para o tipo Fourier que foi desenvolvido especificamente para grande conjunto de dados, sendo mais acurado em relação a outros pacotes de alinhamento. Logo após foi utilizado para construção da árvore PAUP 4.0b10. Os números são valores de bootstrap com suporte de ramo acima de 50%. Barra de escala: 0,01 substituições por sítio.

145

E8Terschellingia brevicaudata

I18Chromadoridae

I16 Desmodora sp

I50Desmodorella

I17Desmodora sp2 10 I32 Bolbonema sp

6 I33 Gonionchus

94 6 6 I24Cornurella 6 I14Desmodora

6 I23 Epacanthion

6 E11 Innocuonema assymetricum E15 Daptonema 6 6 I31Desmodora

17 32 30 I53Pseudochromadora 20 I27 Paracyatholaimus quadriseta 22 22 I51 Paracanthonchus quadriseta 34 I26 Epsilonema anulosum 13 E31 Sabatieria

I54 Desmodoridae 7 I37 Xyala 7 I13 Epsilonema anulosum 100 E34 unidentified 18 I34Cornurella sp

E2Terschellingia brevicaudata 52 E43 unidentified

A11Monhysteridae

78 DracunculuslutraeEU646613 100 CaenorhabditiselegansAY171197 100 HaemonchuscontortusEU346694 10

Topologia da Máxima Verossimilhança baseada minibarcode (COI), alinhado com Clustal X e utilizando algoritmo RAxML.

146

HaemonchuscontortusEU346694

DracunculuslutraeEU646613 53 CaenorhabditiselegansAY171197

E2Terschellingia brevicaudata

E43 unidentified

E8Terschellingia brevicaudata 100 E11 Innocuonema assymetricum

E15 Daptonema 74 I27 Paracyatholaimus quadriseta

I51 Paracanthonchus quadriseta

I53Pseudochromadora

71 E31 Sabatieria

I26 Epsilonema anulosum

I31Desmodora

I13 Epsilonema anulosum

I33 Gonionchus

I37 Xyala

90 I17Desmodora sp2

I23 Epacanthion

I32 Bolbonema sp

I50Desmodorella

I16 Desmodora sp

I54 Desmodoridae

E34 unidentified

I24Cornurella

I14Desmodora

I34Cornurella sp

I18Chromadoridae

A11Monhysteridae 10

Neighbour-joining baseado no alinhamento minibarcode (COI) alinhado com Clustal X. A construção da árvore consenso foi realizada através do PAUP 4.0b10. Números são valores de Bootstrap com suporte acima de 50%. Barra de escala: 0,01 substituições por sítio.

147